METHOD FOR SCREENING AND IDENTIFYING FUNCTIONAL LNCRNAS
20210163936 · 2021-06-03
Inventors
- Wensheng Wei (Beijing, CN)
- Ying Liu (Beijing, CN)
- Zhongzheng Cao (Beijing, CN)
- Yinan Wang (Beijing, CN)
- Yu Guo (Beijing, CN)
- Pengfei YUAN (Beijing, CN)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N2740/16043
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Provided is a high-throughput method for screening or identifying long non-coding RNAs by CRISPR system, which uses paired guide RNA targeting the genomic sequence within the region spanning −50 bp to +75 bp surrounding a splice donor site or a splice acceptor site of a long non-coding RNA.
Claims
1. A CRISPR/Cas guide RNA construct for disrupting a long non-coding RNA in a eukaryotic genome comprising a guide sequence targeting a genomic sequence around a splice site of a long non-coding RNA and a guide hairpin sequence, operably linked to a promoter.
2-4. (canceled)
5. The CRISPR/Cas guide RNA construct of claim 1, wherein the guide sequence targets a genomic sequence within the region spanning −50-bp to +75-bp surrounding a SD site or SA site of a long non-coding RNA.
6. The CRISPR/Cas guide RNA construct of claim 5, wherein the guide sequence targets a genomic sequence within the region spanning −30-bp to +30-bp surrounding a SD site or SA site of a long non-coding RNA.
7. The CRISPR/Cas guide RNA construct of claim 6, wherein the guide sequence targets a genomic sequence within the region spanning −10-bp to +10-bp surrounding a SD site or SA site of a long non-coding RNA.
8. The CRISPR/Cas guide RNA construct of claim 1, wherein the guide RNA construct is a viral vector or a plasmid.
9. A library composed of a plurality of the CRISPR/Cas guide RNA construct of claim 1.
10-15. (canceled)
16. A method for determining the functional profile of a long non-coding RNA comprising introducing, into a host cell a CRISPR/Cas guide RNA construct comprising a guide sequence targeting a genomic sequence around a splice site of a long non-coding RNA and a guide hairpin sequence, operably linked to a promoter, expressing the guide RNA that targets the genomic sequence in the host cell, and in the presence of a CRISPR/Cas nuclease, introducing exon skipping and/or intron retention in the long non-coding RNA, and thereby determining the functional profile of the long non-coding RNA.
17. The method of claim 16, wherein the guide sequence targets a genomic sequence within the region spanning −50-bp to +75-bp surrounding a SD site or SA site of a long non-coding RNA.
18. The method of claim 17, wherein the guide sequence targets a genomic sequence within the region spanning −30-bp to +30-bp surrounding a SD site or SA site of a long non-coding RNA.
19. The method of claim 18, wherein the guide sequence targets a genomic sequence within the region spanning −10-bp to +10-bp surrounding a SD site or SA site of a long non-coding RNA.
20. The method of claim 16, wherein the functional profile comprises a cellular phenotype change and/or an increase or a decrease of expression of a coding gene or non-coding gene.
21. The method of claim 20, wherein the coding gene is an exogenous reporter gene or a native coding gene in the genome.
22. The method of claim 16, wherein the host cell is in a host cell population and each host cell independently comprises a unique guide RNA construct.
23. The method of claim 22, wherein the method is a high throughput method for screening or identifying long non-coding RNAs in a eukaryotic genome.
24. (canceled)
25. A method for perturbating or eliminating the function of a long non-coding RNA in a eukaryotic cell comprising introducing into the eukaryotic cell one or more CRISPR/Cas guide RNAs that target one or more polynucleotide sequences around one or more splice sites of the long non-coding RNA, whereby the one or more guide RNAs target the one or more polynucleotide sequences around the one or more splice sites of the long non-coding RNA and in the presence of Cas protein, the one or more polynucleotide sequences are cleaved, resulting in intron retention and/or exon skipping of the long non-coding RNA and thus perturbating or eliminating the function of the long non-coding RNA.
26. The method of claim 25, the guide RNA targets a polynucleotide sequence within the region spanning −50-bp to +75-bp surrounding a SD site or SA site of a long non-coding RNA.
27. The method of claim 26, the guide RNA targets a polynucleotide sequence within the region spanning −30-bp to +30-bp surrounding a SD site or SA site of a long non-coding RNA.
28. The method of claim 27, the guide RNA targets a polynucleotide sequence within the region spanning −10-bp to +10-bp surrounding a SD site or SA site of a long non-coding RNA.
29-38. (canceled)
39. The method of claim 25, further comprising identifying the function of the lncRNA as being necessary for the growth and proliferation of tumor cells, wherein perturbating the function of the lncRNA thereby inhibits the growth and proliferation of the tumor cells.
40. The method of claim 39, wherein the lncRNAs necessary for growth and proliferation of tumor cells are selected from the group consisting of XXbac-B135H6.15, RP11-848P1.5, AC005330.2, AP001062.9, AP005135.2, RP11-867G23.4, LINC01049, DGCR5, RP11-509A17.3, CTB-25J19.1, CTD-2517M22.17, CROCCP2, AC016629.8, CTC-490G23.4, RP11-117D22.1, AC067969.2, RP11-251M1.1, AC004471.9, AC004471.10, AC002472.11, RP11-429J17.7, RP11-56N19.5, TMEM191A, LL22NC03-102D1.18, LINC00410, LL22NC03-23C6.13, RP11-83J21.3, RP11-544A12.4, ANKRD62P1-PARP4P3, CTD-2031P19.5, XXbac-B444P24.8, RP11-464F9.21, TPTEP1, MIR17HG and BMS1P20.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
DETAILED DESCRIPTION OF THE INVENTION
Definition
[0037] The present invention will be described with respect to particular embodiments and with reference to certain drawings but the invention is not limited thereto but only by the claims. Any reference signs in the claims shall not be construed as limiting the scope. In the drawings, the size of some of the elements may be exaggerated and not drawn on scale for illustrative purposes. Where the term “comprising” is used in the present description and claims, it does not exclude other elements or steps. Where an indefinite or definite article is used when referring to a singular noun e.g. “a” or “an”, “the”, this includes a plural of that noun unless something else is specifically stated.
[0038] The following terms or definitions are provided solely to aid in the understanding of the invention. Unless specifically defined herein, all terms used herein have the same meaning as they would to one skilled in the art of the present invention. Practitioners are particularly directed to Sambrook et al., Molecular Cloning: A Laboratory Manual, 2.sup.nd ed., Cold Spring Harbor Press, Plainsview, N.Y. (1989); and Ausubel et al., Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999), for definitions and terms of the art. The definitions provided herein should not be construed to have a scope less than understood by a person of ordinary skill in the art.
[0039] The terms “polynucleotide”, “nucleotide”, “nucleotide sequence”, “nucleic acid” and “oligonucleotide” are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three dimensional structure, and may perform any function, known or unknown. The following are non limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus), exons, introns, messenger RNA (mRNA), long non-coding RNA (lncRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
[0040] In aspects of the invention the terms “chimeric RNA”, “chimeric guide RNA”, “guide RNA”, “single guide RNA” and “synthetic guide RNA” are used interchangeably and refer to the polynucleotide sequence comprising the guide sequence, the tracr sequence and the tracr mate sequence. The term “guide sequence” refers to the about 20 bp sequence within the guide RNA that specifies the target site and may be used interchangeably with the terms “guide” or “spacer”.
[0041] As used herein, “expression” refers to the process by which a polynucleotide is transcribed from a DNA template (such as into an mRNA or other RNA transcript) and/or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides may be collectively referred to as “gene product.” If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.
[0042] The practice of the present invention employs, unless otherwise indicated, conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA, which are within the skill of the art. See Sambrook, Fritsch and Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd edition (1989); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F. M. Ausubel, et al. eds., (1987)); the series METHODS IN ENZYMOLOGY (Academic Press, Inc.): PGR 2: A PRACTICAL APPROACH (M. J. MacPherson, B. D. Hames and GR. Taylor eds. (1995)), Harlow and Lane, eds. (1988) ANTIBODIES, A LABORATORY MANUAL, and ANIMAL CELL CULTURE (R. L. Freshney, ed. (1987)).sup.14-18.
[0043] Several aspects of the invention relate to vector systems comprising one or more vectors, or vectors as such. Vectors can be designed for expression of CRISPR transcripts (e.g. nucleic acid transcripts, proteins, or enzymes) in prokaryotic or eukaryotic cells. For example, CRISPR transcripts can be expressed in bacterial cells such as Escherichia coli, insect cells, yeast cells, or mammalian cells. Suitable host cells are also recited in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990).sup.19. Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
[0044] In some embodiments, a vector is capable of driving expression of one or more sequences in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8.sup.20 and pMT2PC.sup.21. When used in mammalian cells, the expression vector's control functions are typically provided by one or more regulatory elements. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, simian virus 40, and others disclosed herein and known in the art. For other suitable expression systems for both prokaryotic and eukaryotic cells see, e.g., Chapters 16 and 17 of Sambrook, et al., MOLECULAR CLONING: A LABORATORY MANUAL. 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989.sup.14.
[0045] In general, “CRISPR system” refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus. In some embodiments, one or more elements of a CRISPR system is derived from a type I, type II, or type III CRISPR system.
[0046] In the context of formation of a CRISPR complex, “target sequence” refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex.
[0047] Typically, in the context of an endogenous CRISPR system, formation of a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands in or near (e.g. within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from) the target sequence. Without wishing to be bound by theory, the tracr sequence, which may comprise or consist of all or a portion of a wild-type tracr sequence (e.g. about or more than about 20, 23, 26, 29, 32, 35, 38, 41, 44, 47, 50, 53, 56, 59, 62, 65, 70, 75, 80, 85 or more nucleotides of a wild-type tracr sequence), may also form part, of a CRISPR complex, such as by hybridization along at least a portion of the tracr sequence to all or a portion of a tracr mate sequence that is operably linked to the guide sequence.
[0048] In some embodiments, the tracr sequence has sufficient complementarity to a tracr mate sequence to hybridize and participate in formation of a CRISPR complex. As with the target sequence, it is believed that complete complementarity is not needed, provided there is sufficient to be functional. In some embodiments, the tracr sequence has at least 50%, 60%, 70%, 80%, 90%, 95% or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned.
[0049] In some embodiments, one or more vectors driving expression of one or more elements of a CRISPR system are introduced into a host cell such that expression of the elements of the CRISPR system directs formation of a CRISPR complex at one or more target sites. In another embodiment, the host cell is engineered to stably express Cas9 and/or OCT1.
[0050] In general, a guide sequence is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of a CRISPR complex to the target sequence. In some embodiments, the degree of complementarity between a guide sequence and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more. Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting example of which include the Smith-Waterman algorithm, the Needleman-Wimsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g. the Burrows Wheeler Aligner), ClustalW, Clustai X, BLAT, Novoalign (Novocraft Technologies, ELAND ((Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net). In some embodiments, a guide sequence is about or more than about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 or more nucleotides in length. In some embodiments, a guide sequence is less than about 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer nucleotides in length. The ability of a guide sequence to direct sequence-specific binding of a CR1SPR complex to a target sequence may be assessed by any suitable assay. For example, the components of a CRJSPR system sufficient to form a CRISPR complex, including the guide sequence to be tested, may be provided to a host cell having the corresponding target sequence, such as by transfection with vectors encoding the components of the CRISPR sequence, followed by an assessment of preferential cleavage within the target sequence. Similarly, cleavage of a target polynucleotide sequence may be evaluated in a test tube by providing the target sequence, components of a CRISPR complex, including the guide sequence to be tested and a control guide sequence different from the test guide sequence, and comparing binding or rate of cleavage at the target sequence between the test and control guide sequence reactions. Other assays are possible, and will occur to those skilled in the art.
[0051] In some embodiments, the CRISPR enzyme is part of a fusion protein comprising one or more heterologous protein domains (e.g. about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more domains in addition to the CRISPR enzyme). A CRISPR enzyme fusion protein may comprise any additional protein sequence, and optionally a linker sequence between any two domains. Examples of protein domains that may be fused to a CRISPR enzyme include, without limitation, epitope tags, reporter gene sequences, and protein domains having one or more of the following activities: methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, RNA cleavage activity and nucleic acid binding activity.
[0052] In some aspects, the invention provides methods comprising delivering one or more polynucleotides, such as or one or more constructs including vectors as described herein, one or more transcripts thereof, and/or one or proteins transcribed therefrom, to a host cell. The invention serves as a basic platform for enabling targeted modification of DNA-based genomes. It can interface with many delivery systems, including but not limited to viral, liposome, electroporation, microinjection and conjugation. In some aspects, the invention further provides cells produced by such methods, and organisms (such as animals, plants, or fungi) comprising or produced from such cells. In some embodiments, a CRISPR enzyme in combination with (and optionally complexed with) a guide sequence is delivered to a cell. Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids into mammalian cells or target tissues. Such methods can be used to administer nucleic acids encoding components of a CRISPR system to cells in culture, or in a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (e.g. a transcript of a vector described herein), naked nucleic acid, and nucleic acid complexed with a delivery vehicle, such as a liposome. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes for delivery to the cell.
[0053] Methods of non-viral delivery of nucleic acids include lipofection, nucleofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA and artificial virions.
[0054] The use of RNA or DNA viral based systems for the delivery of nucleic acids has high efficiency advantage in targeting a virus to specific cells in the body and trafficking the viral payload to the nucleus.
[0055] In preferred embodiments, targets of the present invention include long noncoding RNAs (lncRNAs), which represent a class of long transcribed RNA molecules, for example, the RNA molecules longer than 200 nucleotides. Their size distinguishes lncRNAs from small regulatory RNAs such as microRNAs (miRNAs), short interfering RNAs (siRNAs), Piwi-interacting RNAs (piRNAs), small nucleolar RNAs (snoRNAs), short hairpin RNA (shRNA), and other short RNAs. LncRNAs may function by binding to DNA or RNA in a sequence specific manner or by binding to proteins. In contrast to miRNAs, lncRNAs appear not to operate by a common mode of action but can regulate gene expression and protein synthesis in a number of ways.
[0056] lncRNAs can be classified into the following locus biotypes based on their location with respect to protein-coding genes. Intergenic lncRNA, which are transcribed inter genetically from both strands; Intronic lncRNA, which are entirely transcribed from introns of protein-coding genes; Sense lncRNA, which are transcribed from the sense strand of protein-coding genes and contain exons from protein-coding genes that overlap with part of protein-coding genes or cover the entire sequence of a protein-coding gene through an intron; and Antisense lncRNA, which are transcribed from the antisense strand of the protein-coding genes that overlap with exonic or intronic regions, or cover the entire protein-coding sequence through an intron. Recent research in human transcriptome analysis shows that protein-coding sequences only account for a small portion of the genome transcripts. The majority of the human genome transcripts are non-coding RNAs.
[0057] The term “lncRNA” refers broadly to the targets of the present invention and include the “lncRNA gene”, as well as the resultant “lncRNA transcript.”
[0058] As used herein, the term “exon” indicates any part of a gene that will encode a part of the final mature RNA produced by that gene after introns have been removed by RNA splicing. The term exon refers to both the DNA sequence within a gene and to the corresponding sequence in RNA transcripts. In RNA splicing, introns are removed and exons are covalently joined to one another as part of generating the mature messenger RNA.
[0059] An “intron” is any nucleotide sequence within a gene that is removed by RNA splicing during maturation of the final RNA product. The term intron refers to both the DNA sequence within a gene and the corresponding sequence in RNA transcripts. Sequences that are joined together in the final mature RNA after RNA splicing. Introns are found in the genes of most organisms and many viruses, and can be located in a wide range of genes, including those that generate proteins, ribosomal RNA (rRNA), long non-coding RNA (lncRNA) and transfer RNA (tRNA). When proteins are generated from intron-containing genes, RNA splicing takes place as part of the RNA processing pathway that follows transcription and precedes translation.
[0060] The term “splicing” as used herein means editing of a nascent precursor RNA into mature RNA, for example, editing nascent precursor messenger RNA (pre-mRNA) transcript into a mature messenger RNA (mRNA). For many eukaryotic introns, splicing is carried out in a series of reactions which are catalyzed by the spliceosome, a complex of small nuclear ribonucleoproteins (snRNPs). Spliceosomal introns often reside within the sequence of eukaryotic protein-coding genes. Within the intron, a donor site (5′ end of the intron), a branch site (near the 3′ end of the intron) and an acceptor site (3′ end of the intron) are required for splicing. The splice donor (SD) site includes an almost invariant sequence GT at the 5′ end of the intron, within a larger, less highly conserved region. The splice acceptor (SA) site at the 3′ end of the intron terminates the intron with an almost invariant AG sequence. Upstream (5′-ward) from the AG there is a region high in pyrimidines (C and T), or polypyrimidine tract. Further upstream from the polypyrimidine tract is the branchpoint, which includes an adenine nucleotide involved in lariat formation.sup.22, 23.
[0061] Nuclear pre-mRNA introns are characterized by specific intron sequences located at the boundaries between introns and exons. These sequences are recognized by spliceosomal RNA molecules when the splicing reactions are initiated. The major spliceosome splices introns containing GT at the 5′ splice site and AG at the 3′ splice site, and this type of splicing is termed canonical splicing or termed the lariat pathway, which accounts for more than 99% of splicing. By contrast, when the intronic flanking sequences do not follow the GT-AG rule, noncanonical splicing is said to occur which accounts for less than 1% of splicing.sup.24.
[0062] Our bioinformatics analysis using Weblogo3 tools shows that about 99% intronic regions in human genome are flanked by GT at the 5′ sites and AG at the 3′ sites. These intronic regions are applicable for coding genes and noncoding RNAs.
[0063] Exon skipping is a form of RNA splicing which causes “skipping” of one or more exons over the resultant RNA, while “intron retention” is a form of RNA splicing in which an intron is simply retained in the resultant RNA after splicing.
[0064] Splicing is regulated by trans-acting proteins (repressors and activators) and corresponding cis-acting regulatory sites (silencers and enhancers) on the pre-mRNA. However, as part of the complexity of alternative splicing, it is noted that the effects of a splicing factor are frequently position-dependent. That is, a splicing factor that serves as a splicing activator when bound to an intronic enhancer element may serve as a repressor when bound to its splicing element in the context of an exon, and vice versa.sup.25. The secondary structure of the pre-mRNA transcript also plays a role in regulating splicing, such as by bringing together splicing elements or by masking a sequence that would otherwise serve as a binding element for a splicing factor.sup.26. Together, these elements form a “splicing code” that governs how splicing will occur under different cellular conditions.sup.27.
[0065] Modification of a Gene in a Eukaryotic Cell
[0066] The present method is related to effectively delivering an sgRNA targeting splice site to generate exon skipping and/or intron retention to perturb a gene, for example a coding gene or noncoding gene. For a gene coding for lncRNA, the method can effectively affect the function of the lncRNA.
[0067] To assess the power of splicing-targeting in CRISPR screen, we designed a saturation library targeting splice sites of 79 ribosomal genes, most of which were essential for cellular growth in various cell lines. This library contained 5,788 sgRNAs whose cutting sites are within □50-bp to +75-bp surrounding every 5′ SD site and □75-bp to +50-bp surrounding every 3′ SA site of these 79 genes. It became evident that sgRNAs affecting splice sites outperformed those targeting only exonic regions, and the closer the distances from sgRNAs' cutting sites to splice sites, the better their effects on gene disruption, with peak points slightly towards the exons for both SD and SA cases.
[0068] CRISPR/Cas9 Mechanism of Action and Library Screening Rationale
[0069] The method of the present invention utilizes the CRISPR/Cas system. Cas9 is a nuclease from the microbial type II CRISPR (clustered regularly interspaced short palindromic repeats) system, which has been shown to cleave DNA when paired with a single-guide RNA (gRNA). The gRNA contains a 17-21 bp sequence that directs Cas9 to complementary regions in the genome, thus enabling site-specific creation of double-strand breaks (DSBs) that are repaired in an error-prone fashion by cellular non-homologous end joining (NHEJ) machinery. Cas9 primarily cleaves genomic sites at which the gRNA sequence is followed by a PAM sequence (-NGG). NHEJ-mediated repair of Cas9-induced DSBs induces a wide range of mutations initiated at the cleavage site which are typically small (<10 bp) insertion/deletions (indels) but can include larger (>100 bp) indels and altered individual bases.
[0070] The splicing-targeting method of the present invention can be used to screen a plurality (e.g., thousands) of sequences in the genome, thereby elucidating the function of such sequences. In some embodiments, the splicing-targeting method of the present invention involves in a high-throughput screen for long non-coding RNAs by using CRISPR/Cas9 system to identify genes required for survival, proliferation or drug resistance and so on. In the screen, gRNAs targeting tens of thousands of splicing sites within genes of interest are delivered, for example, by lentiviral vectors, as a pool, into target cells along with Cas9. By identifying gRNAs that are enriched or depleted in the cells after selection for the desired phenotype, genes that are required for this phenotype can be systematically identified.
[0071] In the above high-throughput CRISPR/Cas9-based approach, the gRNA libraries can be cloned into lentiviral vectors. In this situation, it is necessary to lower the multiplicity of infection (MOI) to limit the number of guide RNAs in a single cell, typically having only a single guide RNA per cell. It is random which gRNA is integrated in each cell, allowing a pooled screen in which each cell expresses only one gRNA. Of note, the genomic gRNA-based high-throughput screen targeting splice sites of the present invention could also be applied to other CRISPR-based high-throughput screens for coding genes and regulatory genes.
[0072] Guide RNAs
[0073] As is known in the art, CRISPR/Cas system nucleases require a guide RNA to cleave genomic DNA. These guide RNAs are composed of (1) a 19-21 nucleotide spacer (guide) of variable sequence (guide sequence) that targets the CRISPR/Cas system nuclease to a genomic location in a sequence-specific manner, and (2) an invariant hairpin sequence that is constant between guide RNAs and allows the guide RNA to bind to the CRISPR/Cas system nuclease. In the presence a CRISPR/Cas nuclease, the guide RNA triggers a CRISPR/Cas-based genomic cleavage event in a cell.
[0074] A guide sequence is selected or designed based on the contemplated target sequence. In some embodiments, the target sequence is a sequence around splice site, for example, −50-bp to +75-bp surrounding SD site, preferred the −30-bp to +30-bp region surrounding SD site, and most preferred the −10-bp to +10-bp region surrounding SD site; −50-bp to +75-bp region surrounding SA site, preferred the −30-bp to +30-bp region surrounding SA site, and most preferred the −10-bp to +10-bp region surrounding SA site of a gene coding for a lncRNA within a genome of a cell. Exemplary target sequences include those that are unique in the target genome.
[0075] For example, for the S. pyogenes Cas9, a unique target sequence in a genome may include a Cas9 target site of the form M.sub.8N.sub.12XGG where N.sub.12XGG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome. A unique target sequence in a genome may include an S. pyogenes Cas9 target site of the form M.sub.9N.sub.11AGG where N.sub.11XGG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome.
[0076] For the S. thermophilus CRISPR1 Cas9, a unique target sequence in a genome may include a Cas9 target site of the form M.sub.8N.sub.12XXAGAAW where N.sub.12XXAGAAW (N is A, G, T, or C; X can be anything; and W is A or T) has a single occurrence in the genome. A unique target sequence in a genome may include an S. thermophilus CRISPR1 Cas9 target site of the form M.sub.9N.sub.11XXAGAAW where N.sub.11XXAGAAW (N is A, G, T, or C; X can be anything; and W is A or T) has a single occurrence in the genome.
[0077] For the S. pyogenes Cas9, a unique target sequence in a genome may include a Cas9 target site of the form M.sub.8N.sub.12XGGXG where N.sub.12XGGXG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome. A unique target sequence in a genome may include an S. pyogenes Cas9 target site of the form M.sub.9N.sub.11XGGXG where N.sub.11XGGXG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome. In each of these sequences “M” may be A, G, T, or C, and need not be considered in identifying a sequence as unique.
[0078] It is to be understood that any hairpin sequence can be used provided it can be recognized and bound by a CRISPR/Cas nuclease.
[0079] Guide RNA Constructs
[0080] In certain embodiments, the present invention is related to a guide RNA construct. The guide RNA construct may comprise (1) a guide sequence and (2) a guide RNA hairpin sequence, and optionally (3) a promoter sequence capable of initiating guide RNA transcription. A non-limiting example of a guide RNA hairpin sequence is the FE hairpin sequence described in Chen et al. Cell. 2013 Dec. 19; 155(7): 1479-91. An example of a promoter is the human U6 promoter.
[0081] In certain embodiments, the present invention is related to CRISPR/Cas guide construct comprising (1) a guide sequence and (2) a guide RNA hairpin sequence, and optionally (3) a promoter sequence capable of initiating guide RNA transcription, wherein the guide sequence targeting a sequence around splice site in a eukaryotic genome, for example, the guide sequence targets the −50-bp to +75-bp region surrounding SD site or SA site, preferred the −30-bp to +30-bp region surrounding SD site or SA site, and most preferred the −10-bp to +10-bp region surrounding SD site or SA site of a gene coding for lncRNA. In certain embodiments, the guide sequence targets splice site of a gene coding for a long non-coding RNA in the eukaryotic genome to induce exon skipping and/or intron retention, and thus disrupting the long non-coding RNA. In certain embodiments, the eukaryotic genome is a human genome. In certain embodiments, the guide sequence is 19-21 nucleotides in length. In certain embodiments, the hairpin sequence is about 40 nucleotides in length and once transcribed can be bound to a CRISPR/Cas nuclease.
[0082] CRISPR/Cas System Nucleases
[0083] In some embodiments, the CRISPR/Cas nuclease is a type II CRISPR/Cas nuclease. In some embodiments, the CRISPR/Cas nuclease is Cas9 nuclease. In some embodiments, the Cas9 nuclease is S. pneumoniae, S. pyogenes, or S. thermophilus Cas9, and may include mutated Cas9 derived from these organisms. The nuclease may be a functionally equivalent variant of Cas9. In some embodiments, the CRISPR/Cas nuclease is codon-optimized for expression in a eukaryotic cell. In some embodiments, the CRISPR/Cas nuclease directs cleavage of one or two strands at the location of the target sequence. The CRISPR/Cas system nucleases include but are not limited to Cas9 and Cpf1.
[0084] Reporter Genes and Proteins, and Readouts
[0085] The reporter gene may be integrated into a cell using a CRISPR/Cas mechanism, in some embodiments. For example, an expression vector, such as a plasmid, may be used that comprises a promoter (e.g., U6 promoter), a guide RNA hairpin sequence, and a guide sequence that targets the desired genomic locus where the reporter construct is to be integrated. Such an expression vector may be generated by cloning the guide sequence into an expression construct comprising the remaining elements. A DNA fragment comprising the coding sequence for the reporter protein can be generated and subsequently modified to include homology arms that flank the coding sequence of the reporter protein. The guide RNA expression vector, the amplified DNA fragments comprising the reporter protein coding sequence, and a CRISPR/Cas nuclease (or an expression vector encoding the nuclease) are introduced into the host cell (e.g., via electroporation). The expression vectors may further comprise additionally selection markers such as antibiotic resistance markers to enrich for cells successfully transfected with the expression vectors. Cells that express the reporter protein can be further selected.
[0086] Reporter genes are used for identifying potentially transfected cells and for evaluating the functionality of regulatory sequences. In general, a reporter gene is a gene that is not endogenous or native to the host cells and that encodes a protein that can be readily assayed. Reporter genes that encode for easily assayable proteins are known in the art, including but not limited to, green fluorescent protein (GFP), glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta-galactosidase, beta-glucuronidase, luciferase, HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and autofluorescent proteins including blue fluorescent protein (BFP), cell surface markers, antibiotic resistance genes such as neo, and the like.
[0087] Expression Vectors
[0088] The term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Vectors include, but are not limited to, nucleic acid molecules that are single-stranded, double-stranded, or partially double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends (e.g. circular); nucleic acid molecules that comprise DNA, RNA, or both; and other varieties of polynucleotides known in the art. One type of vector is a “plasmid,” which refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g. bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively-linked. Such vectors are referred to herein as “expression vectors.” Expression vectors in recombinant DNA techniques often take the form of plasmids.
[0089] Recombinant expression vectors can comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory elements, which may be selected on the basis of the host cells to be used for expression, that is operatively-linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, “operably linked” is intended to mean that the nucleotide sequence of interest is linked to the regulatory element(s) in a manner that allows for expression of the nucleotide sequence (e.g. in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).
[0090] Host Cells
[0091] Virtually any eukaryotic cell type can be used as a host cell provided it can be cultured in vitro and modified as described herein. Preferably, the host cells are pre-established cell lines. The cells and cell lines may be human cells or cell lines, or they may be non-human, mammalian cells or cell lines.
Example
Materials and Methods
1. Cells and Reagents
[0092] The HeLa cell line was from Z. Jiang's laboratory (Peking University) and cultured in Dulbecco's modified Eagle's medium (DMEM, Gibco C11995500BT). Huh 7.5 cell line from S. Cohen's laboratory (Stanford University School of Medicine) was cultured in DMEM (Gibco) supplemented with 1% MEM non-essential amino acids (NEAA, Gibco 1140-050). K562 cell from H. Wu's laboratory (Peking University) and GM12878 cell from Coriell Cell Repositories were cultured in RPMI1640 medium (Gibco 11875-093). All cells were supplemented with 10% fetal bovine serum (FBS, CellMax BL102-02) with 1% penicillin/streptomycin, cultured with 5% CO.sub.2 in 37° C.
2. Reverse Transcription PCR (RT-PCR) for Testing Intron Retention or Exon Skipping
[0093] The sgRNAs were cloned into a lentiviral expression vector carrying a CMV promoter-driven mCherry marker, then transduced into HeLaoc cells.sup.1-4 through viral infection at an MOI of <1. 72 hrs post infection, the mCherry positive cells were FACS-sorted and the total RNA of each sample was extracted using RNAprep pure Cell/Bacteria Kit (TIANGEN DP430). The cDNAs were synthesized from 2 μg of total RNA using Quantscript RT Kit (TIANGEN KR103-04), and the RT-PCR reactions were performed with TransTaq HiFi DNA Polymerase (TransGen AP131-13).
TABLE-US-00001 Sequences of sgRNAs targeting RPL18 or RPL11 gene: sgRNA1.sub.RPL18: (SEQ ID No: 1) 5′-GGACCAGCCACTCACCATCC sgRNA2.sub.RPL18: (SEQ ID No: 2) 5′-AGCTTCATCTTCCGGATCTT sgRNA3.sub.RPL11: (SEQ ID No: 3) 5′-TCCTTGTGACTACTCACCTT sgRNA4.sub.RPL11: (SEQ ID No: 4) 5′-AACTCATACTCCCGCACCTG Primers used for RT-PCR: 1F: (SEQ ID No: 5) 5′-CTGGGTCTTGTCTGTCTGGAA; 1R: (SEQ ID No: 6) 5′-CTGGTGTTTACATTCAGCCCC; 2F: (SEQ ID No: 7) 5′-GGCCAGAAGAACCAACTCCA; 2R: (SEQ ID No: 8) 5′-GACAGTGCCACAGCCCTTAG; 3F: (SEQ ID No: 9) 5′-TCAAGATGGCGTGTGGGATT; 3R: (SEQ ID No: 10) 5′-GACCAGCAAATGGTGAAGCC; 4F: (SEQ ID No: 11) 5′-GATCCTTTGGCATCCGGAGA; 4R: (SEQ ID No: 12) 5′-GCTGATTCTGTGTTTGGCCC.
3. Construction and Screening of Splicing-Targeting sgRNA Library on Essential Ribosomal Genes
[0094] The annotations of 79 ribosomal genes were retrieved from NCBI. We scanned all potential sgRNAs targeting −50-bp to +75-bp surrounding every 5′ SD site and −75-bp to +50-bp surrounding every 3′ SA site of these 79 genes including RPL10,RPL10A,RPL11,RPL12,RPL13,RPL13A,RPL14,RPL15,RPL17,RPL18,RPL1 8A,RPL19,RPL21,RPL22,RPL22L1,RPL23,RPL23A,RPL24,RPL26,RPL26L1,RPL2 7,RPL27A,RPL28,RPL29,RPL3,RPL30,RPL31,RPL32,RPL34,RPL35,RPL35A,RPL 36,RPL36A,RPL36AL,RPL37,RPL37A,RPL38,RPL39,RPL39L,RPL3L,RPL4,RPL4 1,RPL5,RPL6,RPL7,RPL7A,RPL7L1,RPL8,RPL9,RPS10,RPS11,RPS12,RPS13,RPS 14,RPS15,RPS15A,RPS16,RPS19,RPS2,RPS20,RPS21,RPS23,RPS24,RPS25,RPS26,RPS27,RPS27A,RPS27L,RPS28,RPS29,RPS3,RPS3A,RPS4X,RPS4Y1,RPS4Y2,RP S5,RPS6,RPS7,RPS8. We ensured that all sgRNAs had at least 2 mismatches to any other loci of the human genome. In order to exhibit the natural cleavage efficacy of sgRNAs in the library, the GC content was not considered in the design. Total of 5,788 sgRNAs targeting 79 ribosomal genes were synthesized using CustmoArray 12K array chip (CustmoArray, Inc.). Here taking the RPL18 gene among the 79 ribosomal genes as an example to illustrate the design of the sgRNAs.
TABLE-US-00002 Splice Distance site of to SEQ intron splice ID for site sgRNA_ID Gene_symbol Gene_ID sgRNA_sequence NO. targeting (bp) Location in785887_a_106 RPL18 6141 AAAACCACGGCGGATGGCAG 13 5′ end 41 intron in785887_a_112 RPL18 6141 TAGCCCAAAACCACGGCGGA 14 5′ end 47 intron in785887_a_116 RPL18 6141 CCCCTAGCCCAAAACCACGG 15 5′ end 51 intron in785887_a_119 RPL18 6141 GTGCCCCTAGCCCAAAACCA 16 5′ end 54 intron in785887_a_1721 RPL18 6141 CCCGCAGCCTTCCAGTGAAG 17 3′ end 61 intron in785887_a_1722 RPL18 6141 CCCCGCAGCCTTCCAGTGAA 18 3′ end 60 intron in785887_a_1723 RPL18 6141 CCCCCGCAGCCTTCCAGTGA 19 3′ end 59 intron in785887_a_1775 RPL18 6141 ACCTGTATAACTGGAGGGAC 20 3′ end 7 intron in785887_a_1780 RPL18 6141 CAGAAACCTGTATAACTGGA 21 3′ end 2 intron in785887_a_1781 RPL18 6141 CCAGAAACCTGTATAACTGG 22 3′ end 1 intron in785887_a_1784 RPL18 6141 TGGCCAGAAACCTGTATAAC 23 3′ end 2 exon in785887_a_19 RPL18 6141 CGGAAAGAGAGAACGGGCTG 24 5′ end 46 exon in785887_a_21 RPL18 6141 TCCGGAAAGAGAGAACGGGC 25 5′ end 44 exon in785887_a_63 RPL18 6141 GCAAAGCGAGCTCACCATGA 26 5′ end 2 exon in785887_s_102 RPL18 6141 TAATCCGCTGCCATCCGCCG 27 5′ end 48 intron in785887_s_108 RPL18 6141 GCTGCCATCCGCCGTGGTTT 28 5′ end 54 intron in785887_s_109 RPL18 6141 CTGCCATCCGCCGTGGTTTT 29 5′ end 55 intron in785887_s_114 RPL18 6141 ATCCGCCGTGGTTTTGGGCT 30 5′ end 60 intron in785887_s_115 RPL18 6141 TCCGCCGTGGTTTTGGGCTA 31 5′ end 61 intron in785887_s_124 RPL18 6141 GTTTTGGGCTAGGGGCACGC 32 5′ end 70 intron in785887_s_127 RPL18 6141 TTGGGCTAGGGGCACGCTGG 33 5′ end 73 intron in785887_s_128 RPL18 6141 TGGGCTAGGGGCACGCTGGA 34 5′ end 74 intron in785887_s_1710 RPL18 6141 TCATGTGTTTGCCCCTTCAC 35 3′ end 61 intron in785887_s_1720 RPL18 6141 GCCCCTTCACTGGAAGGCTG 36 3′ end 51 intron in785887_s_1774 RPL18 6141 TCCCGTCCCTCCAGTTATAC 37 3′ end 3 exon in785887_s_65 RPL18 6141 ATCATGGTGAGCTCGCTTTG 38 5′ end 11 intron in785887_s_72 RPL18 6141 TGAGCTCGCTTTGCGGCGTT 39 5′ end 18 intron in785887_s_73 RPL18 6141 GAGCTCGCTTTGCGGCGTTC 40 5′ end 19 intron in785887_s_74 RPL18 6141 AGCTCGCTTTGCGGCGTTCG 41 5′ end 20 intron in785887_s_78 RPL18 6141 CGCTTTGCGGCGTTCGGGGC 42 5′ end 24 intron in785888_a_101 RPL18 6141 GACAAGACCCAGCGGCTCCC 43 5′ end 36 intron in785888_a_109 RPL18 6141 TCCAGACAGACAAGACCCAG 44 5′ end 44 intron in785888_a_483 RPL18 6141 CTTGAGGCATCCCCAGGCCA 45 3′ end 73 intron in785888_a_489 RPL18 6141 GCCCCGCTTGAGGCATCCCC 46 3′ end 67 intron in785888_a_499 RPL18 6141 TTTACATTCAGCCCCGCTTG 47 3′ end 57 intron in785888_a_524 RPL18 6141 ATGTACGTCGTAAGTTGTTC 48 3′ end 32 intron in785888_a_547 RPL18 6141 TTCCGGATCTTAGGGTGGGG 49 3′ end 9 intron in785888_a_550 RPL18 6141 ATCTTCCGGATCTTAGGGTG 50 3′ end 6 intron in785888_a_551 RPL18 6141 CATCTTCCGGATCTTAGGGT 51 3′ end 5 intron in785888_a_552 RPL18 6141 TCATCTTCCGGATCTTAGGG 52 3′ end 4 intron in785888_a_555 RPL18 6141 GCTTCATCTTCCGGATCTTA 53 3′ end 1 intron in785888_a_556 RPL18 6141 AGCTTCATCTTCCGGATCTT 2 3′ end 0 intron in785888_a_57 RPL18 6141 GCCACTCACCATCCGGGAAA 54 5′ end 8 exon in785888_a_58 RPL18 6141 AGCCACTCACCATCCGGGAA 55 5′ end 7 exon in785888_a_63 RPL18 6141 GGACCAGCCACTCACCATCC 1 5′ end 2 exon in785888_a_64 RPL18 6141 TGGACCAGCCACTCACCATC 56 5′ end 1 exon in785888_s_108 RPL18 6141 GCCGCTGGGTCTTGTCTGTC 57 5′ nd 54 intron in785888_s_113 RPL18 6141 TGGGTCTTGTCTGTCTGGAA 58 5′ end 59 intron in785888_s_116 RPL18 6141 GTCTTGTCTGTCTGGAAGGG 59 5′ end 62 intron in785888_s_487 RPL18 6141 GGCCTGGGGATGCCTCAAGC 60 3′ end 58 intron in785888_s_488 RPL18 6141 GCCTGGGGATGCCTCAAGCG 61 3′ end 57 intron in785888_s_545 RPL18 6141 ATCCTCCCCACCCTAAGATC 62 3′ end 0 intron in785888_s_56 RPL18 6141 TCCCTTTCCCGGATGGTGAG 63 5′ end 2 intron in785888_s_60 RPL18 6141 TTTCCCGGATGGTGAGTGGC 64 5′ end 6 intron in785888_s_74 RPL18 6141 AGTGGCTGGTCCAGAGAGCA 65 5′ end 20 intron in785888_s_83 RPL18 6141 TCCAGAGAGCACGGTAGACC 66 5′ end 29 intron in785888_s_94 RPL18 6141 CGGTAGACCTGGGAGCCGCT 67 5′ end 40 intron in785889_a_533 RPL18 6141 GTGGTCACCCAGGGGCTGCC 68 3′ end 55 intron in785889_a_541 RPL18 6141 ACCCCTGCGTGGTCACCCAG 79 3′ end 47 intron in785889_a_543 RPL18 6141 AGACCCCTGCGTGGTCACCC 70 3′ end 45 intron in785889_a_552 RPL18 6141 TGGCGGGTCAGACCCCTGCG 71 3′ end 36 intron in785889_a_569 RPL18 6141 GGTGGAGAGGACAAGGCTGG 72 3′ end 19 intron in785889_a_572 RPL18 6141 CCTGGTGGAGAGGACAAGGC 73 3′ end 16 intron in785889_a_576 RPL18 6141 CATACCTGGTGGAGAGGACA 74 3′ end 12 intron in785889_a_582 RPL18 6141 AGTGCACATACCTGGTGGAG 75 3′ end 6 intron in785889_a_587 RPL18 6141 CGCGCAGTGCACATACCTGG 76 3′ end 1 intron in785889_a_59 RPL18 6141 CGCCAGCTCACCTTCAGTTT 77 5′ end 6 exon in785889_a_590 RPL18 6141 TCACGCGCAGTGCACATACC 78 3′ end 2 exon in785889_a_60 RPL18 6141 CCGCCAGCTCACCTTCAGTT 79 5′ end 5 exon in785889_a_96 RPL18 6141 ACAGTACAGCAAGGGTCTGA 80 5′ end 31 intron in785889_s_504 RPL18 6141 CTGCTGCGCCAAGGCAGTGG 81 3′ end 73 intron in785889_s_505 RPL18 6141 TGCTGCGCCAAGGCAGTGGA 82 3′ end 72 intron in785889_s_515 RPL18 6141 AGGCAGTGGAGGGTGAGTCC 83 3′ end 62 intron in785889_s_526 RPL18 6141 GGTGAGTCCTGGCAGCCCCT 84 3′ end 51 intron in785889_s_539 RPL18 6141 AGCCCCTGGGTGACCACGCA 85 3′ end 38 intron in785889_s_540 RPL18 6141 GCCCCTGGGTGACCACGCAG 86 3′ end 37 intron in785889_s_61 RPL18 6141 CAAACTGAAGGTGAGCTGGC 87 5′ end 7 intron in785889_s_62 RPL18 6141 AAACTGAAGGTGAGCTGGCG 88 5′ end 8 intron in785889_s_63 RPL18 6141 AACTGAAGGTGAGCTGGCGG 89 5′ end 9 intron in785889_s_68 RPL18 6141 AAGGTGAGCTGGCGGGGGCT 90 5′ end 14 intron in785890_a_130 RPL18 6141 TCTGGCCTCCCAGATCCAGG 91 3′ end 67 intron in785890_a_148 RPL18 6141 GGGATCTGGCGCCCAGCTTC 92 3′ end 49 intron in785890_a_162 RPL18 6141 AACCGGGTGAGACAGGGATC 93 3′ end 35 intron in785890_a_168 RPL18 6141 AAGGAGAACCGGGTGAGACA 94 3′ end 29 intron in785890_a_169 RPL18 6141 GAAGGAGAACCGGGTGAGAC 95 3′ end 28 intron in785890_a_191 RPL18 6141 CTTGCGAGGACCTAGGGAAG 96 3′ end 6 intron in785890_a_192 RPL18 6141 CCTTGCGAGGACCTAGGGAA 97 3′ end 5 intron in785890_a_193 RPL18 6141 CCCTTGCGAGGACCTAGGGA 98 3′ end 4 intron in785890_a_197 RPL18 6141 TCGGCCCTTGCGAGGACCTA 99 3′ end 0 intron in785890_a_198 RPL18 6141 CTCGGCCCTTGCGAGGACCT 100 3′ end 1 exon in785890_a_29 RPL18 6141 ACAGCCCTTAGGGGAGTCCA 101 5′ end 36 exon in785890_a_30 RPL18 6141 CACAGCCCTTAGGGGAGTCC 102 5′ end 35 exon in785890_a_60 RPL18 6141 CGTATCACTCACCGGAGAGC 103 5′ end 5 exon in785890_a_68 RPL18 6141 GTCGACCACGTATCACTCAC 104 5′ end 3 intron in785890_s_115 RPL18 6141 ACTGGCAGCCTTCACCCTCC 105 3′ end 71 intron in785890_s_121 RPL18 6141 AGCCTTCACCCTCCTGGATC 106 3′ end 65 intron in785890_s_122 RPL18 6141 GCCTTCACCCTCCTGGATCT 107 3′ end 64 intron in785890_s_136 RPL18 6141 GGATCTGGGAGGCCAGAAGC 108 3′ end 50 intron in785890_s_137 RPL18 6141 GATCTGGGAGGCCAGAAGCT 109 3′ end 49 intron in785890_s_160 RPL18 6141 CGCCAGATCCCTGTCTCACC 110 3′ end 26 intron in785890_s_63 RPL18 6141 GCTCTCCGGTGAGTGATACG 111 5′ end 9 intron in785890_s_70 RPL18 6141 GGTGAGTGATACGTGGTCGA 112 5′ end 16 intron in785890_s_71 RPL18 6141 GTGAGTGATACGTGGTCGAC 113 5′ end 17 intron in785890_s_76 RPL18 6141 TGATACGTGGTCGACGGGTT 114 5′ end 22 intron in785890_s_97 RPL18 6141 GGACTGAGCTGTGTGGCTAC 115 5′ end 43 intron in785891_a_435 RPL18 6141 AGGCCATTGTGGAGTGGCAC 116 3′ end 59 intron in785891_a_492 RPL18 6141 GAGCGGACGTAGGGTCTGTG 117 3′ end 2 intron in785891_a_493 RPL18 6141 GGAGCGGACGTAGGGTCTGT 118 3′ end 1 intron in785891_a_494 RPL18 6141 TGGAGCGGACGTAGGGTCTG 119 3′ end 0 intron in785891_a_53 RPL18 6141 CTCACTTGGTGTGGCTGTGC 120 5′ end 12 exon in785891_a_54 RPL18 6141 ACTCACTTGGTGTGGCTGTG 121 5′ end 11 exon in785891_a_67 RPL18 6141 CTGGGGGCCTGATACTCACT 122 5′ end 2 intron in785891_s_432 RPL18 6141 GTTCCTGTGCCACTCCACAA 123 3′ end 51 intron in785891_s_60 RPL18 6141 AGCCACACCAAGTGAGTATC 124 5′ end 6 intron in785892_a_1317 RPL18 6141 CACTCCCTGTGGGGGTGAAG 125 3′ end 22 intron in785892_a_1325 RPL18 6141 CGGATGTCCACTCCCTGTGG 126 3′ end 3 intron in785892_a_1326 RPL18 6141 GCGGATGTCCACTCCCTGTG 127 3′ end 2 intron in785892_a_1327 RPL18 6141 GGCGGATGTCCACTCCCTGT 128 3′ end 1 intron in785892_a_1328 RPL18 6141 TGGCGGATGTCCACTCCCTG 129 3′ end 0 intron in785892_s_1263 RPL18 6141 TTTCAGAAATAAGTAATAAT 130 3′ end 54 intron in785892_s_1274 RPL18 6141 AGTAATAATTGGCTATGGTT 131 3′ end 43 intron in785892_s_1276 RPL18 6141 TAATAATTGGCTATGGTTGG 132 3′ end 41 intron in785892_s_1283 RPL18 6141 TGGCTATGGTTGGGGGTAAT 133 3′ end 34 intron in785892_s_1284 RPL18 6141 GGCTATGGTTGGGGGTAATT 134 3′ end 33 intron in785892_s_1291 RPL18 6141 GTTGGGGGTAATTGGGTCCA 135 3′ end 26 intron in785892_s_1312 RPL18 6141 GGTTGCCTCTTCACCCCCAC 136 3′ end 5 intron in785892_s_1313 RPL18 6141 GTTGCCTCTTCACCCCCACA 137 3′ end 4 intron in785892_s_1318 RPL18 6141 CTCTTCACCCCCACAGGGAG 138 3′ end 1 exon in785892_s_1336 RPL18 6141 AGTGGACATCCGCCATAACA 139 3′ end 19 exon in785893_a_106 RPL18 6141 GGATCTGCAAGTCAGACCTG 140 5′ end 41 intron in785893_a_108 RPL18 6141 GAGGATCTGCAAGTCAGACC 141 5′ end 43 intron in785893_a_130 RPL18 6141 GCTTGGTGCCAGCACTAGAA 142 5′ end 65 intron in785893_a_82 RPL18 6141 GACCCTTCCCAAAGACCTCA 143 5′ end 17 intron in785893_a_83 RPL18 6141 TGACCCTTCCCAAAGACCTC 144 5′ end 18 intron in785893_s_58 RPL18 6141 GCTGTTGGTCAAGGTGAGGC 145 5′ end 4 intron in785893_s_59 RPL18 6141 CTGTTGGTCAAGGTGAGGCT 146 5′ end 5 intron in785893_s_74 RPL18 6141 AGGCTGGGCCCTGAGGTCTT 147 5′ end 20 intron in785893_s_75 RPL18 6141 GGCTGGGCCCTGAGGTCTTT 148 5′ end 21 intron in785893_s_79 RPL18 6141 GGGCCCTGAGGTCTTTGGGA 149 5′ end 25 intron in785893_s_90 RPL18 6141 TCTTTGGGAAGGGTCACCCC 150 5′ end 36 intron
[0095] The cell library harbouring these sgRNAs were constructed through lentiviral delivery at an MOI of <0.3 in Cas9-expressing HeLa and Huh7.5 cells.sup.28, with a minimum coverage of 400×. 72 hours after viral infection, the cells were sorted by FACS (BD) for mCherry.sup.+. The control cells (2.4×10.sup.6) of each library were collected for genomic DNA extraction using the DNeasy Blood and Tissue kit (QIAGEN 69506), and the experimental cells were continuously cultured for 15 days before genomic DNA extraction. For each replicate, the lentivirally integrated sgRNA-coding regions were PCR-amplified by TransTaq HiFi DNA Polymerase (TransGen AP131-13), and further purified with DNA Clean & Concentrator-25 (Zymo Research Corporation D4034) as previously described.sup.4,9. The resulting libraries were prepared for high-throughput sequencing analysis (Illumina HiSeq2500) using NEBNext Ultra DNA Library Prep Kit for Illumina (NEB E7370L).
4. Design and Construction of the Genome-Scale Human lncRNA Library
[0096] LncRNA annotations were retrieved from GENCODE dataset V20 which contains 14,470 lncRNAs. In this dataset, 2,477 lncRNAs without splice sites were removed in the first filtering process. For the rest lncRNAs, all potential 20-nt sgRNAs targeting −10-bp to +10-bp regions surrounding every 5′ SD site and 3′ SA site were designed. To ensure cleavage efficiency and specificity, we only kept sgRNAs with at least 2 mismatches to other loci in genome, whose GC content is between 20% and 80%, and removed those sgRNAs that contain ≥4-bp homopolymeric stretch of T nucleotides. To achieve the best coverage, certain sgRNAs with 1-bp or 0-bp mismatches to other loci were retained as long as they do not target any essential genes of K562 cell line.sup.15 and the total number of mismatched sites is less than 2. Total of 126,773 sgRNAs targeting 10,996 lncRNAs were ultimately synthesized. In the library, we also included 500 non-targeting sgRNAs in human genome as negative controls, and 350 sgRNAs targeting 36 essential ribosomal genes as positive controls. The oligonucleotides were synthesized using the CustmoArray 90K array chips (CustmoArray, Inc.), and the library construction was the same as described above.
5. Genome-Scale lncRNA Screening
[0097] A total of 5×10.sup.8 K562 cells were plated onto the 175 cm.sup.2 flasks (Corning 431080) for each of two replicates. Cells were infected with sgRNA library lentiviruses at an MOI of less than 0.3 (1000× coverage) in 24 hrs. 48 hrs post infection, the library cells were subjected to puromycin treatment (3 μg/ml; Solarbio P8230) for two days. For each replicate, a total of 1.3×10.sup.8 cells were collected as the Day-0 control samples for genome extraction. 30 days post viral infection, 1.3×10.sup.8 experimental cells were isolated for genome extraction and NGS analysiso.
6. Computational Analysis of Screens
[0098] Sequencing reads were mapped to hg38 reference genome and decoded by home-made scripts. sgRNA counts from two replicates were quantile normalized, then average counts and fold changes between experimental and control groups were calculated. 1000 negative control genes were generated by randomly sampling 10 negative control sgRNAs with replacement per gene. Noisy sgRNAs were then filtered based on the following criteria: if a sgRNA's fold change was lower than mean fold change of positive control sgRNAs in one replicate and higher than mean fold change of negative control sgRNAs in another replicate, the sgRNA was regarded as a noisy sgRNA for filtering. For each lncRNA after noise filtering, we compared the fold change of sgRNAs with negative control by Wilcox test, and corrected the P values using empirical distribution generated by negative control genes to reduce false positive rate. We ultimately defined screen score as: screen score=scale(−log.sub.10(adjusted p-value))+|scale(log.sub.2(sgRNA fold change))|. We designated those hits with screen score higher than 2 as essential lncRNAs.
7. Validation of lncRNA Hits
[0099] The two top-ranking sgRNAs for validation by splicing strategy were selected from library, which had at least 2 mismatches to any other loci in the genome. For the pgRNA deletion strategy, pgRNAs were designed to delete the promoter and the first exon of each lncRNA. We designed gRNA pairs according to the following criteria: (1) one sgRNA targets the 2.5-3.5 kb regions upstream the transcription start site (TSS) and the other one targets the 0.2-1.5 kb regions downstream the TSS: (2) avoid overlapping with any exons or promoters of coding or nocoding genes. For each sgRNA of the pairs, we further ensured that (1) the GC content is between 45% and 70%, (2) the sgRNA does not include ≥4-bp homopolymer stretch, and (3) the sgRNA contains more than 2 mismatches to any other loci in human genome. We included some sgRNAs with 2 mismatches to other loci, but the number of off-target sites is less than 2.
[0100] All the sgRNAs or pgRNAs targeting the selected lncRNAs to be validated were individually cloned into the lentiviral vector with a CMV promoter-driven EGFP marker. After virus packaging, the sgRNA or pgRNA lentivirus was transduced into K562 or GM12878 cells at an MOI of <1.0. The cell proliferation assay was previously described.sup.9.
8. RNA Sequencing and Data Analysis
[0101] Two sgRNAs targeting the splice sites of lncRNA MIR17HG and BMS1P20 were individually cloned into the lentiviral vector with an EGFP marker. The sgRNAs were delivered into K562 or GM12878 cells by lentiviral infection at an MOI of <1. 2×10.sup.6 EGFP positive cells of K562 or GM12878 were sorted by FACS 5 days post infection. Total RNA of each sample was extracted using RNeasy Mini Kit (QIAGEN 79254), and the RNA-seq libraries were prepared following the NEBNext PolyA mRNA Magnetic Isolation Module (NEB E7490S), NEBNext RNA First Strand Synthesis Module (NEB E7525S), NEBNext mRNA Second Strand Synthesis Module (NEB E6111S) and NEBNext Ultra DNA Library Prep Kit for Illumina (NEB E7370L). All samples were subjected to NGS analysis using the Illumina HiSeq X Ten platform (Genetron Health). Deep sequencing reads were mapped to hg38 reference genome and gene expression was quantified by RSEM v1.2.25.sup.30. Differential expression analysis was conducted by EBSeq version 1.10.0.sup.31 and differentially expressed genes were selected from those that had adjusted P value <0.05 and absolute log.sub.2(fold change) >3. Gene Ontology and KEGG analysis was conducted by DAVID 6.8.sup.32.
Result
[0102] In consistence with the common knowledge that there are conserved sequences marking the splice sites, our bioinformatics analysis using Weblogo3 tools.sup.33 showed that about 99% intronic regions in human genome are flanked by GT at the 5′ splice donor (SD) sites and AG at the 3′ splice acceptor (SA) sites. It is worthy of note that AG sequences are predominantly present as the last two bases of exons just upstream of the SD sites (
[0103] To further assess the power of splicing-targeting in CRISPR screen, we designed a saturation library targeting splice sites of 79 ribosomal genes, most of which were essential for cellular growth in various cell lines.sup.29. This library contained 5,788 sgRNAs whose cutting sites are within −50-bp to +75-bp surrounding every 5′ SD site and −75-bp to +50-bp surrounding every 3′ SA site of these 79 genes (see Table 1 for the examples of sgRNA).
[0104] The cell libraries harbouring these sgRNAs were constructed through lentiviral delivery at an MOI (multiplicity of infection) of <0.3 in Cas9-expressing HeLa and Huh7.5 cells14. The screening was performed through prolonged cell culturing of library cells spanning 15 days, and the sgRNAs leading to cell viability drops were deciphered based on NGS analysis.
[0105] By calculating the log.sub.2 fold change of sgRNAs between 15-day experimental (Exp) and control (Ctrl) samples, we ranked all sgRNAs and aligned them according to their distances in base pair (bp) between sgRNA-cutting sites and their corresponding SD or SA sites. The Spearman correlation between the biological replicates of Ctrl and Exp in both HeLa and Huh7.5 cells showed that all results were highly reproducible (
[0106] As the numbers of sgRNAs designed for any locus were not equal, we compared the percentages of high-efficient (over 4-fold dropout) sgRNAs at every locus for fair comparison. With such normalization, we further confirmed that both SD- and SA-targeting sgRNAs were vastly superior to those targeting only exonic regions (
[0107] Based on above results, we inferred that this strategy should be universally applicable for coding genes and noncoding RNAs because RNA splicing is a well conserved mechanism for both. Assuming that targeting splice sites would potentially enable functional disruptions of lncRNAs in human cells through either exon skipping and/or intron retention, we designed and constructed a special splicing-targeting sgRNA library to establish the genome-scale and functional screening of lncRNAs. Among 14,470 lncRNAs retrieved from GENCODE dataset V20, we first filtered out 2,477 lacking splice sites. We abided by several other rules: all sgRNAs' cutting sites are within −10-bp to +10-bp surrounding splice sites, and sgRNAs are predicted to have high cleavage activity.sup.29,36,37 without off-targeting to any known essential gene.sup.15 (see Methods). We ultimately generated a library containing 126,773 sgRNAs targeting 10,996 unique lncRNAs. Together with 500 non-targeting control sgRNAs and 350 sgRNAs targeting essential ribosomal genes, we constructed the cell library in K562 cells engineered to stably express Cas9 protein (
[0108] After 30-day culturing, sgRNAs targeting lncRNAs and essential genes were both depleted compared with the non-targeting sgRNAs (
[0109] From the negatively selected lncRNAs whose corresponding sgRNAs were consistently depleted in two replicates, we chose 35 top-ranking lncRNA genes for further validation. For each candidate, we cloned the two top-ranking sgRNAs obtained from library screen into a lentiviral backbone with an EGFP selection marker. A non-targeting sgRNA and a sgRNA targeting the non-functional adeno-associated virus integration site 1 (AAVS1) locus were chosen as negative controls, and an sgRNA targeting the ribosomal gene RPL18 was also included as the positive control (
[0110] To further verify our validation assay as well as the screening strategy, both of which relied on splicing-perturbation, we chose the pgRNA-mediated deletion method9 to independently investigate the roles of lncRNA hits from our screen. We selected 6 lncRNAs from the validated 35 hits, and another 6 candidates from the top hits which were not included in above validation because their top-ranking splicing-targeting sgRNAs had certain off-target possibility. Four pgRNAs were designed for each of these 12 lncRNAs, deleting their promoters and first exons (see Methods). AAVS1 locus or ribosomal genes RPL19 and RPL23A were chosen for pgRNA targeting as negative control or positive controls, respectively (
[0111] To better understand the mechanisms leading to these varied phenotypes in K562 and GM12878 cells, we further explored the functions of lncRNA MIR17HG which was essential for both cell lines (
[0112] In K562 cell line, changing the splicing pattern of MIR17HG down-regulated 179 known essential genes.sup.15 which affect cell growth and proliferation (P=0.01,
[0113] In sum, genetic perturbation of both protein-coding gene and lncRNA could be substantially enhanced by targeting splice sites. Splicing-targeting provides extra opportunity for gene disruption besides generating reading frame-shift mutations in protein-coding genes. This feature becomes irreplaceable for knocking out reading-frame-insensitive noncoding RNAs via sgRNA approach. In addition, this strategy aiming at disrupting the splice sites could be particularly useful when it is difficult to design appropriate sgRNAs targeting genes with conserved coding sequences.
[0114] CRISPR-Cas9 system has been applied to identify functional lncRNAs in large-scale through two strategies, paired-gRNA (pgRNA) deletion9 and CRISPRi.sup.12. Although it is technically easier to scale up using CRISPRi strategy than pgRNA-mediated genomic deletion, CRISPRi as well as CRISPRa method generally act within a 1-kb window around the targeted transcriptional start site (TSS).sup.12,26, by which one would risk affecting expression of neighboring genes inadvertently for nearly 60% of lncRNA loci.sup.27. Splicing-targeting strategy could effectively avoid cutting most overlapping regions using a single guide RNA, and has much better chance to avoid affecting the neighboring genes, consequently decreasing the false positive rate. After all, CRISPRi, which only decreases gene expression level instead of completely knocking out the target locus, leaves room for false-negative results.
[0115] Based on the experimental data, it is demonstrated that the new method elaborated in this invention has significant advantages in negative CRISPR screening of coding genes complementary to conventional exon-targeting method, and enables large-scale loss-of-function screen of noncoding genes using single guide RNA-CRISPR library. In addition, exon skipping or intron retention generated by splice-site disruption offers a convenient approach for functional validation of individual non-coding RNA.
REFERENCES
[0116] 1. Shalem, O. et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science 343, 84-87 (2014). [0117] 2. Wang, T., Wei, J. J., Sabatini, D. M. & Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science 343, 80-84 (2014). [0118] 3. Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C. & Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotechnol 32, 267-273 (2014). [0119] 4. Thou, Y. et al. High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature 509, 487-491 (2014). [0120] 5. Ezkurdia, I. et al. Multiple evidence strands suggest that there may be as few as 19,000 human protein-coding genes. Hum Mol Genet 23, 5866-5878 (2014). [0121] 6. Rinn, J. L. & Chang, H. Y. Genome regulation by long noncoding RNAs. Annu Rev Biochem 81, 145-166 (2012). [0122] 7. Quinn, J. J. & Chang, H. Y. Unique features of long non-coding RNA biogenesis and function. Nat Rev Genet 17, 47-62 (2016). [0123] 8. Kretz, M. et al. Control of somatic tissue differentiation by the long non-coding RNA TINCR. Nature 493, 231-235 (2013). [0124] 9. Zhu, S. et al. Genome-scale deletion screening of human long non-coding RNAs using a paired-guide RNA CRISPR-Cas9 library. Nat Biotechnol 34, 1279-1286 (2016). [0125] 10. Guttman, M. et al. lincRNAs act in the circuitry controlling pluripotency and differentiation. Nature 477, 295-300 (2011). [0126] 11. Lin, N. et al. An evolutionarily conserved long noncoding RNA TUNA controls pluripotency and neural lineage commitment. Mol Cell 53, 1005-1019 (2014). [0127] 12. Liu, S. J. et al. CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science 355 (2017). [0128] 13. Adamson, B., Smogorzewska, A., Sigoillot, F. D., King, R. W. & Elledge, S. J. A genome-wide homologous recombination screen identifies the RNA-binding protein RBMX as a component of the DNA-damage response. Nat Cell Biol 14, 318-328 (2012). [0129] 14. Sambrook, Fritsch and Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd edition (1989). [0130] 15. F. M. Ausubel, et al. eds., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (1987). [0131] 16. M. J. MacPherson, B. D. Hames and G. R. Taylor eds., METHODS IN ENZYMOLOGY (Academic Press, Inc.): PGR 2: A PRACTICAL APPROACH (1995). [0132] 17. Harlow and Lane, eds. ANTIBODIES, A LABORATORY MANUAL, (1988). [0133] 18. R. L Freshney, ed., ANIMAL CELL CULTURE (1987). [0134] 19. Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990). [0135] 20. Seed, 1987. Nature 329: 840 (Seed, B. An LFA-3 cDNA encodes a phospholipid-linked membrane protein homologous to its receptor CD2. Nature (1987) 329: 840-842.) [0136] 21. Kaufman, et al., 1987. EMBO J. 6: 187-195 (Randal J, Kaufman, et al. Translational efficiency of polycistronic mRNAs and their utilization to express heterologous genes in mammalian cells. The EMBO Journal (1987) 6: 187-195) [0137] 22. Clancy, Suzanne. RNA Splicing: Introns, Exons and Spliceosome. Nature Education. 1, 31 (2008). [0138] 23. Black, Douglas L. Mechanisms of Alternative Pre-Messenger RNA Splicing. Annual Review of Biochemistry. 72: 291-336 (2003). [0139] 24. Ng, Bernard; Yang, Fan; et al. Increased noncanonical splicing of autoantigen transcripts provides the structural basis for expression of untolerized epitopes. Journal of Allergy and Clinical Immunology. 114: 1463-70(2004). [0140] 25. Lim, K H; Ferraris, L; et al. Using positional distribution to identify splicing elements and predict pre-mRNA processing defects in human genes. Proc. Natl. Acad. Sci. USA. 108: 11093-11098 (2011). [0141] 26. Warf, M B; Berglund, J A. Role of RNA structure in regulating pre-mRNA splicing. Trends Biochem. Sci. 35: 169-178 (2010). [0142] 27. Warf, M B; Berglund, J A. Role of RNA structure in regulating pre-mRNA splicing. Trends Biochem. Sci. 35 (3): 169-178 (2010). [0143] 28. Ren, Q. et al. A Dual-Reporter System for Real-Time Monitoring and High-throughput CRISPR/Cas9 Library Screening of the Hepatitis C Virus. Scientific reports 5, 8865 (2015). [0144] 29. Wang, T. et al. Identification and characterization of essential genes in the human genome. Science 350, 1096-1101 (2015). [0145] 30. Li, B. & Dewey, C. N. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC bioinformatics 12, 323 (2011). [0146] 31. Leng, N. et al. EBSeq: an empirical Bayes hierarchical model for inference in RNA-seq experiments. Bioinformatics 29, 1035-1043 (2013). [0147] 32. Jiao, X. et al. DAVID-WS: a stateful web service to facilitate gene/protein list analysis. Bioinformatics 28, 1805-1806 (2012). [0148] 33. Crooks, G. E., Hon, G., Chandonia, J. M. & Brenner, S. E. WebLogo: a sequence logo generator. Genome Res 14, 1188-1190 (2004). [0149] 34. Matlin, A. J., Clark, F. & Smith, C. W. Understanding alternative splicing: towards a cellular code. Nat Rev Mol Cell Biol 6, 386-398 (2005). [0150] 35. Taggart, A. J., DeSimone, A. M., Shih, J. S., Filloux, M. E. & Fairbrother, W. G. Large-scale mapping of branchpoints in human pre-mRNA transcripts in vivo. Nat Struct Mol Biol 19, 719-721 (2012). [0151] 36. Hsu, P. D. et al. DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol 31, 827-832 (2013). [0152] 37. Xu, H. et al. Sequence determinants of improved CRISPR sgRNA design. Genome Res 25, 1147-1157 (2015). [0153] 38. Heidari, N. et al. Genome-wide map of regulatory interactions in the human genome. Genome Res 24, 1905-1917 (2014). [0154] 39. Muller, R. Y., Hammond, M. C., Rio, D. C. & Lee, Y. J. An Efficient Method for Electroporation of Small Interfering RNAs into ENCODE Project Tier 1 GM12878 and K562 Cell Lines. J Biomol Tech 26, 142-149 (2015). [0155] 40. Joung, J. et al. Genome-scale activation screen identifies a lncRNA locus regulating a gene neighbourhood. Nature (2017). [0156] 41. Goyal, A. et al. Challenges of CRISPR/Cas9 applications for long non-coding RNA genes. Nucleic Acids Res 45, e12 (2017).