COMPOSITIONS AND METHODS FOR RAPID IDENTIFICATION AND PHENOTYPIC ANTIMICROBIAL SUSCEPTIBILITY TESTING OF BACTERIA AND FUNGI
20210147898 · 2021-05-20
Inventors
- Kyle C. Cady (Santa Clara, CA, US)
- Brett Hanson (Milpitas, CA, US)
- Paulino Abdon (Los Gatos, CA, US)
- Ryan Chan (San Jose, CA, US)
- Patrick Lin (San Jose, CA, US)
- Rochak Mehta (Fremont, CA, US)
- Troy Rabang (Campbell, CA, US)
Cpc classification
C12Q1/6897
CHEMISTRY; METALLURGY
C12Q1/18
CHEMISTRY; METALLURGY
C12Q2565/1015
CHEMISTRY; METALLURGY
International classification
C12Q1/18
CHEMISTRY; METALLURGY
Abstract
The present invention relates to compositions and methods for the use of polymerase chain reaction (PCR) as a reporter assay for rapid and simultaneous bacterial identification and phenotype testing for antimicrobial susceptibility (AST). The current invention uses a strategy that has shown the ability for multiplexing and for handling polymicrobial samples for antimicrobial susceptibility testing.
Claims
1. A method comprising performing a single quantitative real-time PCR assay as a reporter in the presence of at least one concentration of at least one antimicrobial or antimicrobial class to simultaneously identify and determine the antimicrobial susceptibility of a target group of bacteria or fungi that have similar or identical clinical breakpoints for at least one antimicrobial or one antimicrobial class.
2. The method of claim 1 wherein the identification of the target group of bacteria or fungi is by detecting a signal that is specific to the target group of bacteria or fungi wherein the specific signal is detected by using primer and probe oligonucleotides that hybridize more selectively to a target gene that is from the target group of bacteria or fungi compared to the target gene that is not from the target group of bacteria or fungi.
3. The method of claim 2 wherein the target gene is selected from rplP, ompA, tuf, rpoB, ddl, ddlA, fdnG, sodA, gyrB, O-antigen acetylase, ecfX, tusA, CPE, sip, and nuc.
4. The method of claim 1 wherein the target group of bacteria or fungi comprises a taxonomic Order, wherein the taxonomic Order is Order Enterobacterales.
5. The method of claim 4 wherein the target gene is selected from rplP, gyrB, and rpoB.
6. The method of claim 5 wherein the primer and probe oligonucleotides that hybridize more selectively to the target gene that is in the Order Enterobacterales than to the target gene that is not in the Order Enterobacterales comprise the nucleotide sequences comprising SEQ ID NOs: 1-16.
7. The method of claim 1 wherein the target group of bacteria or fungi comprises a taxonomic Family, wherein the taxonomic Family is selected from Enterobacteriaceae, Yersiniaceae, Morganellaceae, or a combination of said families.
8. The method of claim 1 wherein the target group of bacteria or fungi comprises a taxonomic Genus, wherein the taxonomic Genus is selected from Enterococcus, Candida, Pseudomonas, Acinetobacter, Staphylococcus, Stenotrophomonas, Streptococcus, and Escherichia, Klebsiella, Enterobacter, Salmonella, Citrobacter, Serratia, Shigella, Corynebacterium, Micrococcus, Bacillus, Haemophilus, Propionibacterium, Bacteroides, Clostridium, Peptostreptococcus, Fusobacterium, Pasteurella, Lactobacillus, Aerococcus, Prevotella, Burkholderia, Moraxella, Vibrio, Listeria, Plesiomonas, Yersinia, Morganella, Providencia, or Proteus.
9. The method of claim 1 wherein the wherein the target group of bacteria or fungi represents a taxonomic Species, wherein the taxonomic Species is selected from Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Klebsiella pneumoniae, Klebsiella oxytoca, Enterobacter cloacae, Enterobacter aerogenes, Citrobacter freundii, Citrobacter koseri, Morganella morganii, Providencia stuartii, Proteus mirabilis, Proteus vulgaris, Candida albicans, Candida auris, Pseudomonas aeruginosa, Acinetobacter baumannii, Acinetobacter pittii, Acinetobacter nosocomialis, Haemophilus influenza, Listeria monocytogenes, Staphylococcus aureus, Staphylococcus lugdunensis, Staphylococcus epidermidis, Stenotrophomonas maltophilia, Streptococcus pneumoniae, Streptococcus agalactiae, Streptococcus pyogenes, Plesiomonas shigelloides, Vibrio parahaemolyticus, Vibrio vulnmficus, or Vibrio cholerae.
10. The method of claim 1 further comprising simultaneously identifying and determining the antimicrobial susceptibility of more than one target groups of bacteria or fungi wherein each target group of bacteria or fungi has similar or identical clinical breakpoints for at least one antimicrobial or one antimicrobial classes.
11. The method of claim 1 wherein the target group of bacteria or fungi are present in bloodstream infections (BSI), gastrointestinal infections or colonization, respiratory infections or colonization, urinary infections or colonization, nasal infections or colonization, rectal infections or colonization, or wound infections.
12. A method comprising performing a single multiplexed quantitative real-time PCR assay as a reporter in the presence of at least one concentration of at least one antimicrobial or antimicrobial class to simultaneously identify and determine the antimicrobial susceptibility of a plurality of bacterial or fungal strains from a biological sample.
13. The method of claim 12 wherein the biological sample is selected from whole blood, plasma, serum, red blood cell fraction, saliva, cerebrospinal fluid, semen, urine, stool, rectal swab, nasal swab, wound swab, dermal swab, bile, lymph, sputum, lavage fluid, or a combination thereof.
14. The method of claim 12 wherein the plurality of bacterial or fungal strains are grouped into at least one group of bacteria or fungi that have similar or identical clinical breakpoints for at least one antimicrobials or antimicrobial classes.
15. The method of claim 12 wherein the plurality of bacterial or fungal strains are grouped into more than one groups of bacteria or fungi wherein each group of bacteria or fungi has similar or identical clinical breakpoints for at least one antimicrobial or one antimicrobial classes.
16. The method of claim 12 wherein the identification of the plurality of bacterial or fungal strains utilizes a plurality of strain-specific 5′ nuclease (TaqMan) oligonucleotide probes, each probe labeled with a fluorescent dye and each fluorescent dye having a different emission wavelength from another fluorescent dye.
17. The method of claim 16 wherein one or more of the plurality of strain-specific 5′ nuclease (TaqMan) oligonucleotide probes comprises probes that utilize the Temperature Assisted Generation of Signal (TAGS) technology.
18. A method comprising performing a single quantitative real-time PCR assay in the presence of at least one concentration of at least one antimicrobial or class of antimicrobials to simultaneously identify and determine Susceptible, Intermediate and Resistant (SIR) information for a target bacterial or fungal strain or for a target group of bacteria or fungi to the antimicrobial or the class of antimicrobials wherein the identification of the target strain or target group and the determination of SIR information are derived from one or more mathematical relationships associated with PCR data.
19. The method of claim 18 wherein the mathematical relationship is selected from Threshold Cycle (Ct), Slope, Inflection of a sigmoid curve fit, Absolute Fluorescence Intensity (AFI), or Endpoint Relative Intensity (ERI), or a combination thereof.
20. The method of claim 18 wherein the mathematical relationship is a relative expression between different antimicrobial concentrations or different antimicrobials and is selected from ΔCt, 2{circumflex over ( )}(ΔCt), ΔInflection, ΔAFI, or ΔERI, or a combination thereof.
21. The method of claim 18 further comprising identifying and determining the antimicrobial susceptibility of more than one target bacteria or fungi strains or more than one target groups of bacteria or fungi wherein each target strain or target group has similar or identical clinical breakpoints for at least one antimicrobial or one antimicrobial classes.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0081] The disclosed methods may include performing at least one cycling step that includes amplifying one or more portions of the nucleic acid molecule gene target from a sample using one or more pairs of primers. A “sample” or “biological sample” as used herein refers to a sample that includes but is not limited to whole blood, plasma, serum, red blood cell fraction, saliva, cerebrospinal fluid, semen, stool, urine, rectal swab, bile, lymph, sputum, lavage fluid, or a combination thereof. “Primer(s)” as used herein refer to oligonucleotide primers that specifically anneal to the target bacterial gene, and initiate DNA synthesis therefrom under appropriate conditions producing the respective amplification products. Each of the discussed primers anneals to a target within or adjacent to the respective target nucleic acid molecule such that at least a portion of each amplification product contains nucleic acid sequence corresponding to the target. The one or more amplification products are produced provided that one or more of the target bacterial gene nucleic acid is present in the sample, thus the presence of the one or more of target bacterial gene amplification products is indicative of the presence of that bacterial strain in the sample. The amplification product should contain the nucleic acid sequences that are complementary to one or more detectable probes for target bacterial gene. “Probe(s)” as used herein refer to oligonucleotide probes that specifically anneal to nucleic acid sequence encoding the target bacterial gene. Each cycling step includes an amplification step, a hybridization step, and a detection step, in which the sample is contacted with the one or more detectable probes for detection of the presence or absence of the bacterial strain in the sample.
[0082] As used herein, the term “amplifying” refers to the process of synthesizing nucleic acid molecules that are complementary to one or both strands of a template nucleic acid molecule. Amplifying a nucleic acid molecule typically includes denaturing the template nucleic acid, annealing primers to the template nucleic acid at a temperature that is below the melting temperatures of the primers, and enzymatically elongating from the primers to generate an amplification product. Amplification typically requires the presence of deoxyribonucleoside triphosphates, a DNA polymerase enzyme (e.g., Platinum® Taq) and an appropriate buffer and/or co-factors for optimal activity of the polymerase enzyme (e.g., MgCl.sub.2 and/or KCl).
[0083] The term “primer” as used herein is known to those skilled in the art and refers to oligomeric compounds, primarily to oligonucleotides but also to modified oligonucleotides that are able to “prime” DNA synthesis by a template-dependent DNA polymerase, i.e., the 3′-end of the, e.g., oligonucleotide provides a free 3′-OH group whereto further “nucleotides” may be attached by a template-dependent DNA polymerase establishing 3′ to 5′ phosphodiester linkage whereby deoxynucleoside triphosphates are used and whereby pyrophosphate is released. Therefore, there is—except possibly for the intended function—no fundamental difference between a “primer”, an “oligonucleotide”, or a “probe”.
[0084] The term “hybridizing” refers to the annealing of one or more probes to an amplification product. Hybridization conditions typically include a temperature that is below the melting temperature of the probes but that avoids non-specific hybridization of the probes.
[0085] The term “5′ to 3′ nuclease activity” refers to an activity of a nucleic acid polymerase, typically associated with the nucleic acid strand synthesis, whereby nucleotides are removed from the 5′ end of nucleic acid strand.
[0086] The term “thermostable polymerase” refers to a polymerase enzyme that is heat stable, i.e., the enzyme catalyzes the formation of primer extension products complementary to a template and does not irreversibly denature when subjected to the elevated temperatures for the time necessary to effect denaturation of double-stranded template nucleic acids. Generally, the synthesis is initiated at the 3′ end of each primer and proceeds in the 5′ to 3′ direction along the template strand. Thermostable polymerases have been isolated from Thermus flavus, T. ruber, T. thermophilus, T. aquaticus, T. lacteus, T. rubens, Bacillus stearothermophilus, and Methanothermus fervidus. Nonetheless, polymerases that are not thermostable also can be employed in PCR assays provided the enzyme is replenished.
[0087] The term “complement thereof” refers to nucleic acid that is both the same length as, and exactly complementary to, a given nucleic acid.
[0088] The term “extension” or “elongation” when used with respect to nucleic acids refers to when additional nucleotides (or other analogous molecules) are incorporated into the nucleic acids. For example, a nucleic acid is optionally extended by a nucleotide incorporating biocatalyst, such as a polymerase that typically adds nucleotides at the 3′ terminal end of a nucleic acid.
[0089] The terms “identical” or percent “identity” in the context of two or more nucleic acid sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides that are the same, when compared and aligned for maximum correspondence, e.g., as measured using one of the sequence comparison algorithms available to persons of skill or by visual inspection. Exemplary algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST programs, which are described in, e.g., Altschul et al. (1990) “Basic local alignment search tool” J. Mol. Biol. 215:403-410, Gish et al. (1993) “Identification of protein coding regions by database similarity search” Nature Genet. 3:266-272, Madden et al. (1996) “Applications of network BLAST server” Meth. Enzymol. 266:131-141, Altschul et al. (1997) “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs” Nucleic Acids Res. 25:3389-3402, and Zhang et al. (1997) “PowerBLAST: A new network BLAST application for interactive or automated sequence analysis and annotation” Genome Res. 7:649-656, which are each incorporated herein by reference.
[0090] A “modified nucleotide” in the context of an oligonucleotide refers to an alteration in which at least one nucleotide of the oligonucleotide sequence is replaced by a different nucleotide that provides a desired property to the oligonucleotide. Exemplary modified nucleotides that can be substituted in the oligonucleotides described herein include, e.g., a C5-methyl-dC, a C5-ethyl-dC, a C5-methyl-dU, a C5-ethyl-dU, a 2,6-diaminopurine, a C5-propynyl-dC, a C5-propynyl-dU, a C7-propynyl-dA, a C7-propynyl-dG, a C5-propargylamino-dC, a C5-propargylamino-dU, a C7-propargylamino-dA, a C7-propargylamino-dG, a 7-deaza-2-deoxyxanthosine, a pyrazolopyrimidine analog, a pseudo-dU, a nitro pyrrole, a nitro indole, 2′-O-methyl Ribo-U, 2′-O-methyl Ribo-C, an N4-ethyl-dC, an N6-methyl-dA, and the like. Many other modified nucleotides that can be substituted in the oligonucleotides are referred to herein or are otherwise known in the art. In certain embodiments, modified nucleotide substitutions modify melting temperatures (Tm) of the oligonucleotides relative to the melting temperatures of corresponding unmodified oligonucleotides. To further illustrate, certain modified nucleotide substitutions can reduce non-specific nucleic acid amplification (e.g., minimize primer dimer formation or the like), increase the yield of an intended target amplicon, and/or the like in some embodiments. Examples of these types of nucleic acid modifications are described in, e.g., U.S. Pat. No. 6,001,611, which is incorporated herein by reference.
[0091] The term “TAGS” or “Temperature Assisted Generation of Signal” (disclosed in U.S Patent Publication No. 2018/0073064 and incorporated by reference herein in its entirety) is a multiplexing technology that enables the measurement of multiple individual targets in each fluorescence channel by collecting fluorescence data at different temperatures during thermal cycling. Consequently, TAGS multiplexing with two or three temperature channels can double or triple the number of resolvable targets per optical channel. In principle, this technology can be deployed on any quantitative PCR (qPCR) instrument capable of collecting more than one fluorescence read per PCR cycle.
[0092] The term “colonization” is defined as the presence of bacteria or fungi on a body surface (like on the skin, mouth, intestines or airway) without necessarily causing disease in the person. The term “infection” is defined as the invasion of a host organism's bodily tissues by disease-causing organisms (such as bacteria and fungi). Infection also results from the interplay between pathogens and the defenses of the hosts they infect.
[0093] The term “antimicrobial” refers to an agent or drug used to treat a microbial infection, usually by killing the microorganism or by inhibiting its growth. Antimicrobials may include antibiotics for treating bacterial infection, antifungals for treating fungi infection, antiprotozoals for treating protozoan infection and antivirals for treating viral infection. Antimicrobials are classified in several different manners (and referred as “antimicrobial class”) and include classification by mechanism of action (e.g. inhibition of cell wall synthesis, inhibition of protein or nucleic acid synthesis, disruption of cell membrane), by source (e.g. from natural sources or synthetic), and by chemical structure (e.g. β-lactams, aminoglycosides, macrolides, quinolones etc.).
[0094] Examples of antimicrobial classes include but are not limited to: Allylamines, Amidinopenicillins, Aminocyclitols, Aminoglycosides, Amphenicols, Ansamycins, B-3-Glucan synthase inhibitors, Carbapenems, Cephalosporins, Clycylcyclines, Cyclic polypeptides, Glycopeptides, Imidazoles, Lincosamides, Lipopeptides, Macrolides and ketolides, Monobactams, Nitrofurantoins, Nitroimidazoles, Oxazolidinones, Penicillins, Phophonic acid derivatives, Pleuromutilins, Polyenes, Polymyxins, Pseudomonic acids, Quinolones, Riminofenazines, Steroid antibacterials, Streptogramins, Sulfonamides, dihydrofolate reductase inhibtors and combinations, Sulfones, Tetracyclines, and Triazoles.
[0095] Examples of antimicrobial drugs or agents include but are not limited to: naftifine, mecillinam, spectinomycin, chloramphenicol, rifampicin, caspofungin, meropenem, ceftriaxone, cefepime, ceftaroline, tigecycline, bacitracin, vancomycin, miconazole, clindamycin, daptomycin, erythromycin, telithromycin, aztreonam, nitrofurantoin, metronidazole, linezolid, ampicillin, fosfomycin, retapamulin, amphotericin-B, colistin, mupirocin, ciprofloxacin, clofazimine, fusidic acid, quinupristin/dalfopristin, sulfamethoxazole, trimethoprim, dapsone, chlortetracycline, and fluconazole.
[0096] The term “the presence of at least one concentration” when applied to an antimicrobial/antifungal or a class of antimicrobials/antifungals refers to given concentration(s) of the antimicrobial/antifungal or the class of antimicrobials/antifungals that is/are present at value(s) that is/are not zero.
[0097] The term “Minimum Inhibitory Concentration” or “MIC” refers to the lowest concentration of an antimicrobial required to inhibit the growth of an organism. In classical culture-based tests, the MIC is determined when the bacteria are added to wells containing growth media and varying concentrations of the antimicrobial. The concentration of antimicrobial is doubled in each successive well and the MIC is found by identifying the well with the lowest antimicrobial concentration in which there is no visible growth after an incubation period. The term “breakpoint” refers to a chosen concentration of an antimicrobial that defines whether a species of bacteria is susceptible or resistant to the antimicrobial. If the MIC is less than or equal to the susceptibility breakpoint the bacteria is considered susceptible to the antimicrobial. If the MIC is greater than this value the bacteria is considered intermediate or resistant to the antimicrobial. Breakpoints can therefore be used to interpret MIC results from Antimicrobial Susceptibility Testing, and to classify “groupings” of organisms as either “Susceptible, Intermediate, or Resistant (SIR)” to a given antimicrobial or antifungal.
[0098] Breakpoints are an integral part of modern microbiology laboratory practice and are used to define susceptibility and resistance to antibacterials. Depending on the testing method, they are expressed as either a concentration (in mg/liter or g/ml) or a zone diameter (in mm). In general, all susceptibility testing methods require breakpoints, also known as interpretive criteria, so that the results of the tests can be interpreted as susceptible, intermediate, or resistant and reported as such to a broad range of clinicians. “Clinical breakpoints” which refer to those concentrations (MICs) that separate strains where there is a high likelihood of treatment success from those bacteria where treatment is more likely to fail. In their simplest form, these breakpoints are derived from prospective human clinical studies comparing outcomes with the MICs of the infecting pathogen.
Detection and Identification of Infectious Pathogens
[0099] The present disclosure provides methods to detect infectious pathogens, for example, bacteria strains that cause bloodstream infections. The methods comprise the steps of amplifying portions of target genes by PCR using strain-specific, species-specific, genus-specific, family-specific, or order-specific primer sequences and detecting the amplification products using strain-specific, species-specific, genus-specific, family-specific, or order-specific probe nucleic acid sequences. Target gene selection was the result of an in silico search of the public sequence database, as well as a literature search for nucleic acid sequences that are specific to a species (e.g. E. coli) or to an order (e.g. Enterobacterales) and discriminate against other strains and families. As a result of the search, the following target genes were identified:
Enterobacterales Order: rplP, ompA, tuf gyrB, rpoB
Enterobacteriaceae family: rplP, ompA, tuf gyrB, rpoB
Enterococcus genus: tuf rpoB, sodA, ddl, gyrB
Pseudomonas genus: gyrB, O-antigen acetylase, rpoB, ecfX, tuf
Acinetobacter genus: ompA, tusA, rpoB, gyrB
Strenotrophomonas maltophilia: fdnG, gyrB, tuf
Staphylococcus aureus: CPE, gyrB, nuc, rpoB, tuf ddlA
Staphylococcus epidermidis: altE, femA
Coagulase-negative Staphylococci: rpoB, tuf, sodA
Streptococcus genus: tuf gyrB, sip, ddlA
Streptococcus pneumoniae: lytA, SP2020, piaB
Proteus mirabilis: UreR, UreC
Candida albicans: ACT, RPB-1, 5.8s ribosomal RNA, 18s ribosomal RNA
[0100] For detection of bacteria belonging to the Enterobacterales Order or to the Enterobacteriaceae family, primers and probes to amplify the rplP gene encoding for the ribosomal L16 protein are provided (SEQ ID NO: 1-3, TABLE I). Addition of a second probe (SEQ ID NO: 4, TABLE I) further extends inclusivity to include other prevalent pathogens in the order Enterobacterales, such as the strains Serratia marcescens and Proteus mirabilis. Nucleic acids other than those exemplified herein can also be used to detect highly specific pathogen grouping target genes in a sample. For example, functional variants can be evaluated for specificity and/or sensitivity by those of skill in the art using routine methods. Representative functional variants can include, e.g., one or more deletions, insertions, and/or substitutions in the target gene primers and probes disclosed herein. More specifically, embodiments of the oligonucleotides each include a nucleic acid with a sequence selected from SEQ ID NOs: 1-4, a substantially identical variant thereof in which the variant has at least, e.g., 80%, 90%, or 95% sequence identity to one of SEQ ID NOs: 1-4, or a complement of SEQ ID NOs: 1-4 and the variant.
TABLE-US-00001 TABLE I Oligonucleotides for detecting Enterobacteriaceae family or Enterobacterales order Primers and Probes that hybridize to rplP gene in Enterobacteriaceae/Enberbacteriales strains Oligonucleotide Oligonudeotide SEQ ID Type Name NO: Sequence Modifications Forward primer RM_ENTF 1 TAATCGGCAGTTTCGCTG<t_BB_ t_BB_dC = dC> t-butylbenzyl-dC Reverse primer RM_ENTRP 2 GTTCCCGGACAAACCGATC<t_ t_BB_dA = BB_dA> t-butylbenzyl-dA Probe 1 RM_ETP02 3 <Cy5.5>TTCACGGGCCA<BHQ-2> <Cy5.5>: GCTCTTCCGGAACACCGTCCA Fluorophore T<Phos> <BHQ_2>: Quencher <Phos>: Phosphate Probe 2 RM_ETP02B 4 <Cy5.5>CTGGATCAGGG<BHQ_2> <Cy5.5>: CAACCCAATACTCCACGTTAC Fluorophore C<Phos> <BHQ_2>: Quencher <Phos>: Phosphate
[0101] The detection of bacteria belonging to the Enterobacterales order can also comprise of other primers and probes for amplifying the rplP gene (SEQ ID NOs: 5-7, TABLE II), as well as primers and probes for amplifying the gyrB gene that encodes the DNA gyrase subunit B protein (SEQ ID NOs: 8-10, TABLE III) and primers and probes for amplifying the rpoB gene that encodes the DNA-dependent RNA polymerase (SEQ ID NOs: 11-16, TABLE IV). Representative functional variants can include, e.g., one or more deletions, insertions, and/or substitutions in the target gene primers and probes disclosed herein. More specifically, embodiments of the oligonucleotides each include a nucleic acid with a sequence selected from SEQ ID NOs: 5-7, 8-10, 11-16, a substantially identical variant thereof in which the variant has at least, e.g., 80%, 90%, or 95% sequence identity to one of SEQ ID NOs: 5-7, 8-10, 11-16, or a complement of SEQ ID NOs: 5-7, 8-10, 11-16 and the variant.
TABLE-US-00002 TABLE II Oligonucleotides for detecting Enterobacterales order Primers and Probes that hybridize to rplP gene in Enterobacteriaceae/ Enterobacterales strains Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP2891 5 AATTCCGTAAAATGCACAAAG GCC Reverse primer SEGP2892 6 GCTTAACTGCACGGGTCATAG CA Probe SEGP2893 7 <FAM>TGGTCGTCT<ZEN>GAC <FAM>: Fluorophore TGCACGTCAGATCGAAGC <ZEN>: Quencher <3IABkFQ> <3IABkFQ>: 3′ Blocker
TABLE III: Oligonucleotides for Detecting Enterobacterales Order
[0102]
TABLE-US-00003 Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP1899 8 TGTCGAATTCTTATGACTCCTC CAGTA Reverse primer SEGP1901 9 CGCGAGCGCTTCGTCGA Probe SEGP2016 10 <HEX>CCGGTCTGC<ZEN>ACC <HEX>: Fluorophore ACATGGTATTCGAGGTGG <ZEN>: Quencher <3IABkFQ> <3IABkFQ>: 3′ Blocker
TABLE-US-00004 TABLE IV Oligonucleotides for detecting Enterobacterales order Primers and Probes that hybridize to rpoB gene in Enterobacteriaceae/ Enterobacterales strains Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP2799 11 TGGTAAACGTCCACAAGTTCTGGA Reverse primers SEGP2800 12 CATACTGCCCTTCAGGATCTTGC SEGP2802 13 GTAGCTGACATATTGCAGTTCAGCA SEGP2821 14 CCGTTCTGACCGTCCGGATC Probes SEGP2804 15 <FAM>TATCTCCTT<ZEN>TCTA <FAM>: Fluorophore TCCAGCTTGACTCGTTTC AGA <ZEN>: Quencher AGTTTATCGA<3IABkFQ> <3IABkFQ>: 3′ Blocker SEGP2822 16 <FAM>TC TCC TTTC<ZEN>T ATCCAGCTGGATTCATTC CAG AAATTCATTGAAC<3IABkFQ>
[0103] For detection of bacteria belonging to the species Acinetobacter baumannii (Abi), primers and probes for amplifying the ompA gene encoding for the outer membrane protein A are provided (see TABLE V). Nucleic acids other than those exemplified herein can also be used to detect Acinetobacter genus-specific pathogen grouping target genes in a sample. For example, functional variants can be evaluated for specificity and/or sensitivity by those of skill in the art using routine methods. Representative functional variants can include, e.g., one or more deletions, insertions, and/or substitutions in the target gene primers and probes disclosed herein. More specifically, embodiments of the oligonucleotides each include a nucleic acid with a sequence selected from SEQ ID NOs: 17-19, 20-22, 29-31 a substantially identical variant thereof in which the variant has at least, e.g., 80%, 90%, or 95% sequence identity to one of SEQ ID NOs:17-19, 20-22, 29-31 or a complement of SEQ ID NOs: 17-19, 20-22, 29-31 and the variant.
TABLE-US-00005 TABLE V Oligonucleotides for detecting Acinetobacter baumannii Primers and Probes that hybridize to ompA gene in A. baumannii Oligonucleotide Oligonudeotide SEQ ID Type Name NO: Sequence Modifications Forward primer RM_AFP01 17 TTGGTGGTCACTTGAAG<t_BB_ t_BB_dC = dC> t-butylbenzyl-dC Reverse primer RM_ARP02 18 TTTCTGGCTTGTATTGGT<t_BB_ t_BB_dC = dC> t-butylbenzyl-dC Probe RM_P02 19 <HEX_Thr>ACTCCAG<BHQ_2>T <HEX_Thr>: TGCTCCACAACCACAAGAG<Phos> Fluorophore <BHQ_2>: Quencher <Phos>: Phosphate Forward primer SEGP2603 20 TTATCTTTAGCTCGTGCTAACTC TGTTAAA Reverse primer SEGP2606 21 GCACGACCTTCTTTAGTTTTGTT GTCA Probe SEGP2769 22 <ATTO>TCTACTCA<BHQ_2>AG <ATTO>: GTTTCGCTTGGGATCAACCGAT Fluorophore TGCT<Phos> <BHQ_2>: Quencher <Phos>: Phosphate Forward primer SEGP1813 29 ACCCTAACGCTACTGCACGT Reverse primer SEGP1815 30 GGTTGATCCCAAGCGAAACCT Probe SEGP1951 31 <ATTO>TCGAAGGT<BHQ_2>CA <ATTO>: CACAGATAACACT<Phos> Fluorophore <BHQ_2>: Quencher <Phos>: Phosphate
[0104] The detection of Acinetobactr baumnannii can also comprise of primers and probes for amplifying the rpoB gene (SEQ ID NOs:23-25, TABLE VI) and for amplifying the gyrB gene (SEQ ID NOs:26-28, TABLE VII). Representative functional variants can include, e.g., one or more deletions, insertions, and/or substitutions in the target gene primers and probes disclosed herein. More specifically, embodiments of the oligonucleotides each include a nucleic acid with a sequence selected from SEQ ID NOs:23-25, 26-28, a substantially identical variant thereof in which the variant has at least, e.g., 80%, 90%, or 95% sequence identity to one of SEQ ID NOs: 23-25, 26-28, or a complement of SEQ ID NOs: 23-25, 26-28, and the variant.
TABLE-US-00006 TABLE VI Oligonucleotides for detecting Acinetobacter baumannii Primers and Probes that hybridize to rpoB gene in Acinetobacter baumannii Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP2590 23 CATACTCATATACCGAAAAGAAACGG Reverse primer SEGP2593 24 CTATACTCAACAAATTCTAAAGCAGC Probe SEGP2594 25 <FAM>CGCGAAGAT<ZEN>ATCGGTCT <FAM>: CC<3IABkFQ> Fluorophore <ZEN>: Quencher <3IABkFQ>: 3′ Blocker
TABLE-US-00007 TABLE VII Oligonucleotides for detecting Acinetobacter baumannii Primers and Probes that hybridize to gyrB gene in Acinetobacter baumannii Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP2626 26 ACAGAACAAACCAATGAAAAGGCTT ATGATTC Reverse primer SEGP2628 27 ACCATATGGTGTAAACCGGTACC Probe SEGP2629 28 <FAM>AAAGTATTA<ZEN>CGTGATTA <FAM>: GATGCAGTTCGTAAACGTCCGGGT Fluorophore <3IABkFQ> <ZEN>: Quencher <3IABkFQ>: 3′ Blocker
[0105] For detection of bacteria belonging to the species Pseudomonas aruginosa (Pae), primers and probes for amplifying the tuf gene encoding elongation factor (SEQ ID NOs: 32-34, TABLE VIII), the gyrB gene (SEQ ID NOs: 35-37, TABLE IX) and the rpoB gene (SEQ ID NOs: 38-40, TABLE X) are provided. Nucleic acids other than those exemplified herein can also be used to detect Pseudomonas genus-specific pathogen grouping target genes in a sample. For example, functional variants can be evaluated for specificity and/or sensitivity by those of skill in the art using routine methods. Representative functional variants can include, e.g., one or more deletions, insertions, and/or substitutions in the target gene primers and probes disclosed herein. More specifically, embodiments of the oligonucleotides each include a nucleic acid with a sequence selected from SEQ ID NOs: 32-34, 35-37, 38-40, a substantially identical variant thereof in which the variant has at least, e.g., 80%, 90%, or 95% sequence identity to one of SEQ ID NOs: 32-34, 35-37, 38-40, or a complement of SEQ ID NOs: 32-34, 35-37, 38-40 and the variant.
TABLE-US-00008 TABLE VIII Oligonucleotides for detecting Pseudomonas aeruginosa Primers and Probes that hybridize to tuf gene in Pseudomonas aeruginosa Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP2341 32 CCGTGCAGAAGCTGGTAG Reverse primer SEGP2342 33 GAGATCGAGAACACGTCTTCG Probe SEGP2343 34 <FAM>TTCCGGAGC<ZEN>CGGTTCGT <FAM>: GCCATCG<3IABkFQ> Fluorophore <ZEN>: Quencher <3IABkFQ>: 3′ Blocker
TABLE-US-00009 TABLE IX Oligonucleotides for detecting Pseudomonas aeruginosa Primers and Probes that hybridize to gyrB gene in Pseudomonas aeruginosa Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP2630 35 GGAGTACAACATCGACAAGCTGC Reverse primer SEGP2631 36 CGCTCGATCAGCTCGGGC Probe SEGP2632 37 <FAM>CACAACATC<ZEN>ATCATCAT <FAM>: GACCGATGCTGACGTCGAC<3IABkFQ> Fluorophore <ZEN>: Quencher <3IABkFQ>: 3′ Blocker
TABLE-US-00010 TABLE X Oligonucleotides for detecting Pseudomonas aeruginosa Primers and Probes that hybridize to rpoB gene in Pseudomonas aeruginosa Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP2634 38 GGCGTGCTGAAGATCGTCAA Reverse primer SEGP2637 39 ACCGGCATGATCACCGAGA Probe SEGP2640 40 <FAM>CGCATCCAG<ZEN>CCGGGCGA <FAM>: CAAGATGG<3IABkFQ> Fluorophore <ZEN>: Quencher <3IABkFQ>: 3′ Blocker
[0106] For detection of bacteria belonging to the species Strenotrophomonas maltophilia (S. maltophilia), primers and probes for amplifying the fdnG gene (SEQ ID NOs: 41-43, TABLE XI), the gyrB gene (SEQ ID NOs: 44-46, TABLE XII) and the tufgene (SEQ ID NOs: 47-49, TABLE XIII) are provided. Nucleic acids other than those exemplified herein can also be used to detect Strenotrophomonas genus-specific pathogen grouping target genes in a sample. For example, functional variants can be evaluated for specificity and/or sensitivity by those of skill in the art using routine methods. Representative functional variants can include, e.g., one or more deletions, insertions, and/or substitutions in the target gene primers and probes disclosed herein. More specifically, embodiments of the oligonucleotides each include a nucleic acid with a sequence selected from SEQ ID NOs: 41-43, 44-46, 47-49, a substantially identical variant thereof in which the variant has at least, e.g., 80%, 90%, or 95% sequence identity to one of SEQ ID NOs: 41-43, 44-46, 47-49, or a complement of SEQ ID NOs: 41-43, 44-46, 47-49, and the variant.
TABLE-US-00011 TABLE XI Oligonucleotides for detecting Strenotrophomonas maltophilia Primers and Probes that hybridize to fdnG gene in Strenotrophomonas maltophilia Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP2532 41 CCAAGCTCGACAAGCCGT AC Reverse primer SEGP2538 42 GCTTGGAGAACGCGCTGA TC Probe SEGP2544 43 <FAM>TGCAGGCGT<ZEN> <FAM>: Fluorophore ACGAGCTGATGAACGAAG <ZEN>: Quencher GC<3IABkFQ> <3IABkFQ>: 3′ Blocker
TABLE-US-00012 TABLE XII Oligonucleotides for detecting Strenotrophomonas maltophilia Primers and Probes that hybridize to gyrB gene in Strenotrophomonas maltophilia Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP2578 44 TGCAGTGGACCGACTCCTA Reverse primer SEGP2579 45 CTGCTTGGCGATGCCGTTCT Probe SEGP2580 46 <FAM>GACGATGTA<ZEN>CTGCTT <FAM>: Fluorophore CACCAAC<3IABkFQ> <ZEN>: Quencher <3IABkFQ>: 3′ Blocker
TABLE-US-00013 TABLE XIII Oligonucleotides for detecting Strenotrophomonas maltophilia Primers and Probes that hybridize to tuf gene in Strenotrophomonas maltophilia Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP2572 47 GCACCAAGCCGCACGTCA Reverse primer SEGP2573 48 GTGCGCGGTCGAGATCGT Probe SEGP2574 49 <FAM>CAAGACCAC<ZEN>GCTGA <FAM>: Fluorophore CCGC<3IABkFQ> <ZEN>: Quencher <3IABkFQ>: 3′ Blocker
[0107] For detection of bacteria belonging to the Enterococcus genus, primers and probes for amplifying the tufgene (SEQ ID NOs: 50-52, TABLE XIV), the rpoB gene (SEQ ID NOs: 53-55, TABLE XV), the ddl gene encoding xxxx (SEQ ID NOs: 56-61, TABLE XVI), and the gyrB gene (SEQ ID NOs: 62-66, TABLE XVII) are provided. Nucleic acids other than those exemplified herein can also be used to detect Enterococcus genus-specific pathogen grouping target genes in a sample. For example, functional variants can be evaluated for specificity and/or sensitivity by those of skill in the art using routine methods. Representative functional variants can include, e.g., one or more deletions, insertions, and/or substitutions in the target gene primers and probes disclosed herein. More specifically, embodiments of the oligonucleotides each include a nucleic acid with a sequence selected from SEQ ID NOs: 50-52, 53-55, 56-61, 62-66, a substantially identical variant thereof in which the variant has at least, e.g., 80%, 90%, or 95% sequence identity to one of SEQ ID NOs: 50-52, 53-55, 56-61, 62-66, or a complement of SEQ ID NOs: 50-52, 53-55, 56-61, 62-66 and the variant.
TABLE-US-00014 TABLE XIV Oligonucleotides for detecting Enterococcus genus Primers and Probes that hybridize to tuf gene in Enterococcus genus Oligonucleotide Oligonudeotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP1632 50 GACAAACCATTCATGATGCCA G Reverse primer SEGP1631 51 AACTTCGTCACCAACGCGAAC Probe SEGP1633 52 <HEX>CTGGACGTG<ZEN>GTA <HEX>: Fluorophore CTGTTGCTAC<3IABkFQ> <ZEN>: Quencher <3IABkFQ>: 3′ Blocker
TABLE-US-00015 TABLE XV Oligonucleotides for detecting Enterococcus genus Primers and Probes that hybridize to rpoB gene in Enterococcus genus Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP2522 53 CCGTCCAGTGGTAGCAAGTAT CA Reverse primer SEGP2525 54 ACCATAGTGAGAGTAGTGAAC GTCA Probe SEGP2770 55 <HEX>TTGACTCGT<ZEN>GAC <HEX>: Fluorophore CGTGCCGGTTATGAAGTTCG <ZEN>: Quencher <3IABkFQ> <3IABkFQ>: 3′ Blocker
TABLE-US-00016 TABLE XVI Oligonucleotides for detecting Enterococcus genus Primers and Probes that hybridize to ddl gene in Enterococcus genus Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP1624 56 CGTAGCATTCTATGATTATGAAGC SEGP1627 57 C GACAGGAAAGAAACTAGGAGGAC Reverse primer SEGP1625 58 CATCGTGTAAGCTAACTTCG SEGP1628 59 AAACAGACACATCGTGCT Probe SEGP1626 60 <HEX>CAGATTCCA<ZEN>GCCGAA <HEX>: Fluorophore SEGP1629 61 GTGCC<3IABkFQ> <ZEN>: Quencher <HEX>CACTTCTGC<ZEN>CGCCAT <3IABkFQ>: 3′ ACAACAA<3IABkFQ> Blocker
TABLE-US-00017 TABLE XVII Oligonucleotides for detecting Enterococcus genus Primers and Probes that hybridize to gyrB gene in Enterococcus genus Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP2882 62 AGCAACGATCCTGAAAAATGCGA SEGP2884 ATTGTTCATC 63 AGTAAAGATCCGGAAAAATGCGA ATTATTTATC Reverse primer SEGP2885 64 AAAGACCGGATCTCTTCATTTGCC SEGP2886 65 AATGACCGAATTTCTTCATTGGCT Probe SEGP2888 66 <FAM>CCAATTCGT<ZEN>GGGAA <FAM>: Fluorophore AATCTTGAATGTTGAGAAAGCAAG <ZEN>: Quencher CA<3IABkFQ> <3IABkFQ>: 3′ Blocker
[0108] For detection of bacteria belonging to the species Staphylococcus aureus (S. aureus), primers and probes for amplifying the CPE gene encoding a protein involved in capsular formation (SEQ ID NOs: 67-69, 72 TABLE XVIII), the gyrB gene (SEQ ID NOs: 73-75, TABLE XIX), the ddlA gene (SEQ ID NOs: 76-78, TABLE XX). For detection of bacteria belonging to the Staphylococcus genus, primers and probes for amplifying the tufgene (SEQ ID NOs: 79-81, TABLE XXII) are provided. Nucleic acids other than those exemplified herein can also be used to detect Staphylococcus genus-specific pathogen grouping target genes in a sample. For example, functional variants can be evaluated for specificity and/or sensitivity by those of skill in the art using routine methods. Representative functional variants can include, e.g., one or more deletions, insertions, and/or substitutions in the target gene primers and probes disclosed herein. More specifically, embodiments of the oligonucleotides each include a nucleic acid with a sequence selected from SEQ ID NOs: 67-69, 72, 73-75, 76-78, 79-81, a substantially identical variant thereof in which the variant has at least, e.g., 80%, 90%, or 95% sequence identity to one of SEQ ID NOs: 67-69, 72, 73-75, 76-78, 79-81, or a complement of SEQ ID NOs: 67-69, 72, 73-75, 76-78, 79-81 and the variant.
TABLE-US-00018 TABLE XVIII Oligonucleotides for detecting Staphylococcus aureus Primers and Probes that hybridize to CPE gene in Staphylococcus aureus Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP1490 67 AAGATAAGCTTATTGAACAAGG ACATC Reverse primer SEGP1491 68 CTTGAGGTGAATTGTTGTGAAC C Probe SEGP1492 72 <FAM>TTAGGAATC<ZEN>AATT <FAM>: Fluorophore ATGGAA <ZEN>: Quencher GTCGACCTCGT<3IABkFQ> <3IABkFQ>: 3′ Blocker Probe SEGP1493 69 <HEX>TTAGGAATC<ZEN>AATT <HEX>: Fluorophore ATGGAAGTCGACCTCGT<3IABkFQ> <ZEN>: Quencher <3IABkFQ>: 3′ Blocker
TABLE-US-00019 TABLE XIX Oligonucleotides for detecting Staphylococcus aureus Primers and Probes that hybridize to gyrB gene in Staphylococcus aureus Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP2792 73 CACAAGTCGCACGTACAGTG Reverse primer SEGP2793 74 ATTCTTCAGGACTTTTACTAGA GCAATCG Probe SEGP2794 75 <FAM>TAAATCAGC<ZEN>GTT <FAM>: Fluorophore AGATGTAGCAAGTC<3IABkFQ> <ZEN>: Quencher <3IABkFQ>: 3′ Blocker
TABLE-US-00020 TABLE XX Oligonucleotides for detecting Staphylococcus aureus Primers and Probes that hybridize to ddlA gene in Staphylococcus aureus Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP2932 76 ATCTACTGATGAGCTTCATTT AGAAAATGGA Reverse primer SEGP2933 77 TCAAAAAGTCCTTGAATCGTG CCA Probe SEGP2935 78 <FAM>CGCTTGAGA<ZEN>TTT <FAM>: Fluorophore CACAGCTATTGAAAGAAAGTA <ZEN>: Quencher GTTCAGGACAA<3IABkFQ> <3IABkFQ>: 3′ Blocker
TABLE-US-00021 TABLE XXI Oligonucleotides for detecting Staphylococcus Genus Primers and Probes that hybridize to tuf gene in Staphylococcus genus Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP1835 79 CCGTGTTGAACGTGGTCAAAT CAAA Reverse primer SEGP1836 80 AGCAGCTAATACTTGACCACG TTGTA Probe SEGP1838 81 <FAM>AGACTACGC<ZEN>TG <FAM>: Fluorophore AAGCTGGTGAC<3IABkFQ> <ZEN>: Quencher <3IABkFQ>: 3′ Blocker
[0109] For detection of bacteria belonging to the species Streptococcus agalactiae (S. agalactiae), primers and probe for amplifying the gyrB gene (SEQ ID NOs: 121-123, TABLE XXII), the sip gene encoding the surface immunogenic protein (SEQ ID NOs: 82-84, TABLE XXIII), and the ddlA gene (SEQ ID NOs: 85-87, TABLE XXIV) are provided. For detection of bacteria belonging to the Streptococcus genus, primers and probes for amplifying the tufgene (SEQ ID NOs: 100-102, TABLE XXV) are provided. Nucleic acids other than those exemplified herein can also be used to detect Streptococcus genus-specific pathogen grouping target genes in a sample. For example, functional variants can be evaluated for specificity and/or sensitivity by those of skill in the art using routine methods. Representative functional variants can include, e.g., one or more deletions, insertions, and/or substitutions in the target gene primers and probes disclosed herein. More specifically, embodiments of the oligonucleotides each include a nucleic acid with a sequence selected from SEQ ID NOs: 121-123, 82-84, 85-87, 100-102 a substantially identical variant thereof in which the variant has at least, e.g., 80%, 90%, or 95% sequence identity to one of SEQ ID NOs: 121-123, 82-84, 85-87, 100-102 or a complement of SEQ ID NOs: 121-123, 82-84, 85-87, 100-102 and the variant.
TABLE-US-00022 TABLE XXII Oligonucleotides for detecting Streptococcus agalactiae Primers and Probes that hybridize to gyrB gene in Streptococcus agalactiae Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP2921 121 ACCACTGTATTTGATTTTGAT AAATTAGCCAAA Reverse primer SEGP2922 122 TTCTCATTGATAAACTCAACG TATGAACCTA Probe SEGP2923 123 <FAM>ACTAAGAAT<ZEN>CTC <FAM>: Fluorophore CATTTCAGACAAGCGAGAAGG <ZEN>: Quencher TCAAGAAGTTG<3IABkFQ> <3IABkFQ>: 3′ Blocker
TABLE-US-00023 TABLE XXIII Oligonucleotides for detecting Streptococcus agalactiae Primers and Probes that hybridize to sip gene in Streptococcus agalactiae Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP2204 82 ATCCTGAGACAACACTGACA Reverse primer SEGP2205 83 TTGCTGGTGTTTCTATTTTCA Probe SEGP2206 84 <CY5.5>ATCAGAAGAGT<BHQ_ <CY5.5>: Fluorophore 2>CATACTGCCACTTC<Phos> <BHQ_2>: Quencher <Phos>: Phosphate
TABLE-US-00024 TABLE XXIV Oligonucleotides for detecting Streptococcus agalactiae Primers and Probes that hybridize to ddIA gene in Streptococcus agalactiae Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP2947 85 CACAAGAATTTGATGAAATGC CATCTTCA Reverse primer SEGP2949 86 ACAATTGCATTATCATCATAG ATATCACTTGGA Probe SEGP2951 87 <FAM>TAATGACAA<ZEN>ACC <FAM>: Fluorophore AAAC <ZEN>: Quencher TGTTGATTTAGACAAAATGGT <3IABkFQ>: 3′ Blocker TCGTCCA<3IABkFQ>
TABLE-US-00025 TABLE XXV Oligonucleotides for detecting Streptococcus Genus Primers and Probes that hybridize to tuf gene in Streptococcus genus Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP1705 100 GTACAGTTGCTTCAGGACGTA TC Reverse primer SEGP1706 101 ACGTTCGATTTCATCACGTTG Probe SEGP1709.1 102 <ATTO>TTCCGTA<BHQ_2>AA <ATTO>: Fluorophore CAACTTGACGAAGGTCTTG<Ph <ZEN>: Quencher os> <Phos>: Phosphate
[0110] For detection of the common fungal pathogens: Candida albicans and Candida auris, primers and probe for amplifying the 18s ribosomal RNA (18s rRNA) gene (SEQ ID NOs: 88-90, TABLE XXVI), and the 5.8s ribosomal RNA (5.8s rRNA) gene (SEQ ID NOs: 91-93, TABLE XXVII) are provided. Nucleic acids other than those exemplified herein can also be used to detect Candida genus-specific pathogen grouping target genes in a sample. For example, functional variants can be evaluated for specificity and/or sensitivity by those of skill in the art using routine methods. Representative functional variants can include, e.g., one or more deletions, insertions, and/or substitutions in the target gene primers and probes disclosed herein. More specifically, embodiments of the oligonucleotides each include a nucleic acid with a sequence selected from SEQ ID NOs: 88-90, 91-93, a substantially identical variant thereof in which the variant has at least, e.g., 80%, 90%, or 95% sequence identity to one of SEQ ID NOs: 88-90, 91-93, or a complement of SEQ ID NOs: 88-90, 91-93 and the variant.
TABLE-US-00026 TABLE XXVI Oligonucleotides for detecting Candida Primers and Probes that hybridize to 18s rRNA gene in Candida Oligonucleotide Oligonucleotide SEQ Type Name ID NO: Sequence Modifications Forward primer SEGP1712 88 CGTTTTCATTAATCAAGAA CGAAAGTTA Reverse primer SEGP1713 89 ACCGATCCCTAGTCGGCAT A Probe SEGP1716 90 <FAM>AGACTACGA<ZEN>C <FAM>: Fluorophore GGTATCTGATCATCTTCGA <ZEN>: Quencher TCCC<3IABkFQ> <3IABkFQ>: 3′ Blocker
TABLE-US-00027 TABLE XXVII Oligonucleotides for detecting Candida Primers and Probes that hybridize to 5.8s rRNA gene in Candida Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP1718 91 ACAACGGATCTCTTGGTTC TC Reverse primer SEGP1719 92 GCAATGTGCGTTCAAAGA TTCGA Probe SEGP1722.1 93 <FAM_Thr>TCGATGAAG<B <FAM_Thr>: HQ_2>AACGCAGCGAAATG Fluorophore CGATACG<Phos> <BHQ_2>: Quencher <Phos>: Phosphate
[0111] For detection of all types of bacteria, a primer and probe combination for amplifying a conserved region in the 16s ribosomal RNA (16s rRNA) gene (SEQ ID NOs: 94-96, TABLE XXVIII) is provided.
TABLE-US-00028 TABLE XXVIII Oligonucleotides for detecting general bacteria Primers and Probes that hybridize to 16s rRNA in bacteria (Gram-positive and Gram-negative) Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP1830 94 TCCTACGGGAGGCAGCAGT Reverse primer SEGP1831 95 GGACTACCAGGGTATCTAATC CTGTT Probe SEGP1895.1 96 <CFR_635>CGTATTACCGCGGC <CFR_635>: T<BHQ_2>GCTGGCAC<Phos> Fluorophore <BHQ_2>: Quencher <Phos>: Phosphate
[0112] In one embodiment, the above-described sets of primers and probes are used not only for the detection and for identification of infectious bacteria strains but also in the performance of an antimicrobial susceptibility testing (AST) assay. Therefore, the present invention discloses methods and compositions for performing quantitative real-time PCR reactions whereby identification (ID) of bacteria and testing of their antimicrobial susceptibility (AST) are determined simultaneously at a single assay setting.
[0113] A functionally active variant of any of the primers and/or probes disclosed herein may be identified by using the primers and/or probes in the disclosed methods. A functionally active variant of a primer and/or probe described herein pertains to a primer and/or probe that provide a similar or higher specificity and sensitivity in the described method or kit as compared to the respective sequence of the primer and/or probe described herein.
[0114] The variant may, e.g., vary from the sequence of the primers and probes described herein by one or more nucleotide additions, deletions or substitutions such as one or more nucleotide additions, deletions or substitutions at the 5′ end and/or the 3′ end of the respective sequence of the primer and/or probe described herein. As detailed above, a primer (and/or probe) may be chemically modified, i.e., a primer and/or probe may comprise a modified nucleotide or a non-nucleotide compound. A probe (or a primer) is then a modified oligonucleotide. “Modified nucleotides” (or “nucleotide analogs”) differ from a natural “nucleotide” by some modification but still consist of a base or base-like compound, a pentofuranosyl sugar or a pentofuranosyl sugar-like compound, a phosphate portion or phosphate-like portion, or combinations thereof. For example, a “label” may be attached to the base portion of a “nucleotide” whereby a “modified nucleotide” is obtained. A natural base in a “nucleotide” may also be replaced by, e.g., a 7-deazapurine whereby a “modified nucleotide” is obtained as well. The terms “modified nucleotide” or “nucleotide analog” are used interchangeably in the present application. A “modified nucleoside” (or “nucleoside analog”) differs from a natural nucleoside by some modification in the manner as outlined above for a “modified nucleotide” (or a “nucleotide analog”).
[0115] Oligonucleotides including modified oligonucleotides and oligonucleotide analogs that amplify a nucleic acid molecule encoding any of the target genes can be designed using, for example, a computer program such as OLIGO (Molecular Biology Insights Inc., Cascade, Colo.). Important features when designing oligonucleotides to be used as amplification primers include, but are not limited to, an appropriate size amplification product to facilitate detection (e.g., by electrophoresis), similar melting temperatures for the members of a pair of primers, and the length of each primer (i.e., the primers need to be long enough to anneal with sequence-specificity and to initiate synthesis but not so long that fidelity is reduced during oligonucleotide synthesis). Typically, oligonucleotide primers are 8 to 50 nucleotides in length (e.g., 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, or 50 nucleotides in length). In some embodiments oligonucleotide primers are 40 or fewer nucleotides in length.
[0116] In addition to a set of primers, the methods may use one or more probes in order to detect the presence or absence of target genes. The term “probe” refers to synthetically or biologically produced nucleic acids (DNA or RNA), which by design or selection, contain specific nucleotide sequences that allow them to hybridize under defined predetermined stringencies specifically (i.e., preferentially) to “target nucleic acids”, in the present case to a target gene nucleic acid. A “probe” can be referred to as a “detection probe” meaning that it detects the target nucleic acid.
[0117] In some embodiments, the described target gene probes can be labeled with at least one fluorescent label. In one embodiment, the target gene probes can be labeled with a donor fluorescent moiety, e.g., a fluorescent dye, and a corresponding acceptor moiety, e.g., a quencher. In one embodiment, the probe comprises or consists of a fluorescent moiety and the nucleic acid sequences comprise or consist of the probe sequences disclosed herein.
[0118] Designing oligonucleotides to be used as probes can be performed in a manner similar to the design of primers. Embodiments may use a single probe or a pair of probes for detection of the amplification product. Depending on the embodiment, the probe(s) use may comprise at least one label and/or at least one quencher moiety. As with the primers, the probes usually have similar melting temperatures, and the length of each probe must be sufficient for sequence-specific hybridization to occur but not so long that fidelity is reduced during synthesis. Oligonucleotide probes are generally 15 to 40 (e.g., 16, 18, 20, 21, 22, 23, 24, or 25) nucleotides in length.
Polymerase Chain Reaction (PCR)
[0119] U.S. Pat. Nos. 4,683,202, 4,683,195, 4,800,159, and 4,965,188 disclose conventional PCR techniques. PCR typically employs two oligonucleotide primers that bind to a selected nucleic acid template (e.g., DNA or RNA). Primers useful in some embodiments include oligonucleotides capable of acting as points of initiation of nucleic acid synthesis within the described target gene nucleic acid sequences. A primer can be purified from a restriction digest by conventional methods, or it can be produced synthetically. The primer is preferably single-stranded for maximum efficiency in amplification, but the primer can be double-stranded. Double-stranded primers are first denatured, i.e., treated to separate the strands. One method of denaturing double stranded nucleic acids is by heating.
[0120] If the template nucleic acid is double-stranded, it is necessary to separate the two strands before it can be used as a template in PCR. Strand separation can be accomplished by any suitable denaturing method including physical, chemical or enzymatic means. One method of separating the nucleic acid strands involves heating the nucleic acid until it is predominately denatured (e.g., greater than 50%, 60%, 70%, 80%, 90% or 95% denatured). The heating conditions necessary for denaturing template nucleic acid will depend, e.g., on the buffer salt concentration and the length and nucleotide composition of the nucleic acids being denatured, but typically range from about 90° C. to about 105° C. for a time depending on features of the reaction such as temperature and the nucleic acid length. Denaturation is typically performed for about 30 sec to 4 min (e.g., 1 min to 2 min 30 sec, or 1.5 min).
[0121] If the double-stranded template nucleic acid is denatured by heat, the reaction mixture is allowed to cool to a temperature that promotes annealing of each primer to its target sequence on the described target gene nucleic acid molecules. The temperature for annealing is usually from about 35° C. to about 65° C. (e.g., about 40° C. to about 60° C.; about 45° C. to about 50° C.). Annealing times can be from about 10 sec to about 1 min (e.g., about 20 sec to about 50 sec; about 30 sec to about 40 sec). The reaction mixture is then adjusted to a temperature at which the activity of the polymerase is promoted or optimized, i.e., a temperature sufficient for extension to occur from the annealed primer to generate products complementary to the template nucleic acid. The temperature should be sufficient to synthesize an extension product from each primer that is annealed to a nucleic acid template, but should not be so high as to denature an extension product from its complementary template (e.g., the temperature for extension generally ranges from about 40° C. to about 80° C. (e.g., about 50° C. to about 70° C.; about 60° C.). Extension times can be from about 10 sec to about 5 min (e.g., about 30 sec to about 4 min; about 1 min to about 3 min; about 1 min 30 sec to about 2 min).
[0122] PCR assays can employ nucleic acid such as RNA or DNA (cDNA). The template nucleic acid need not be purified; it may be a minor fraction of a complex mixture, such as nucleic acid contained in human cells. Nucleic acid molecules may be extracted from a biological sample by routine techniques such as those described in Diagnostic Molecular Microbiology: Principles and Applications (Persing et al. (eds), 1993, American Society for Microbiology, Washington D.C.). Nucleic acids can be obtained from any number of sources, such as plasmids, or natural sources including bacteria, yeast, protozoa viruses, organelles, or higher organisms such as plants or animals.
[0123] The oligonucleotide primers are combined with PCR reagents under reaction conditions that induce primer extension. For example, chain extension reactions generally include 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 15 mM MgCl.sub.2, 0.001% (w/v) gelatin, 0.5-1.0 μg protodenatured template DNA, 50 pmoles of each oligonucleotide primer, 2.5 U of Taq polymerase, and 10% DMSO). The reactions usually contain 150 to 320 M each of dATP, dCTP, dTTP, dGTP, or one or more analogs thereof.
[0124] The newly synthesized strands form a double-stranded molecule that can be used in the succeeding steps of the reaction. The steps of strand separation, annealing, and elongation can be repeated as often as needed to produce the desired quantity of amplification products corresponding to the target nucleic acid molecules. The limiting factors in the reaction are the amounts of primers, thermostable enzyme, and nucleoside triphosphates present in the reaction. The cycling steps (i.e., denaturation, annealing, and extension) are preferably repeated at least once. For use in detection, the number of cycling steps will depend, e.g., on the nature of the sample. If the sample is a complex mixture of nucleic acids, more cycling steps will be required to amplify the target sequence sufficient for detection. Generally, the cycling steps are repeated at least about 20 times, but may be repeated as many as 40, 60, or even 100 times.
Fluorescence Resonance Energy Transfer (FRET)
[0125] FRET technology (see, for example, U.S. Pat. Nos. 4,996,143, 5,565,322, 5,849,489, and 6,162,603) is based on a concept that when a donor fluorescent moiety and a corresponding acceptor fluorescent moiety are positioned within a certain distance of each other, energy transfer takes place between the two fluorescent moieties that can be visualized or otherwise detected and/or quantitated. The donor typically transfers the energy to the acceptor when the donor is excited by light radiation with a suitable wavelength. The acceptor typically re-emits the transferred energy in the form of light radiation with a different wavelength. In certain systems, non-fluorescent energy can be transferred between donor and acceptor moieties, by way of biomolecules that include substantially non-fluorescent donor moieties (see, for example, U.S. Pat. No. 7,741,467).
[0126] In one example, a oligonucleotide probe can contain a donor fluorescent moiety and a corresponding quencher, which may or not be fluorescent, and which dissipates the transferred energy in a form other than light. When the probe is intact, energy transfer typically occurs between the donor and acceptor moieties such that fluorescent emission from the donor fluorescent moiety is quenched the acceptor moiety. During an extension step of a polymerase chain reaction, a probe bound to an amplification product is cleaved by the 5′ to 3′ nuclease activity of, e.g., a Taq Polymerase such that the fluorescent emission of the donor fluorescent moiety is no longer quenched. Exemplary probes for this purpose are described in, e.g., U.S. Pat. Nos. 5,210,015, 5,994,056, and 6,171,785. Commonly used donor-acceptor pairs include the FAM-TAMRA pair. Commonly used quenchers are DABCYL and TAMRA. Commonly used dark quenchers include BlackHole Quenchers™ (BHQ), (Biosearch Technologies, Inc., Novato, Calif.), Iowa Black™, (Integrated DNA Tech., Inc., Coralville, Iowa), BlackBerry™ Quencher 650 (BBQ-650), (Berry & Assoc., Dexter, Mich.).
[0127] In another example, two oligonucleotide probes, each containing a fluorescent moiety, can hybridize to an amplification product at particular positions determined by the complementarity of the oligonucleotide probes to the target nucleic acid sequence. Upon hybridization of the oligonucleotide probes to the amplification product nucleic acid at the appropriate positions, a FRET signal is generated. Hybridization temperatures can range from about 35° C. to about 65° C. for about 10 sec to about 1 min.
[0128] Fluorescent analysis can be carried out using, for example, a photon counting epifluorescent microscope system (containing the appropriate dichroic mirror and filters for monitoring fluorescent emission at the particular range), a photon counting photomultiplier system, or a fluorimeter. Excitation to initiate energy transfer, or to allow direct detection of a fluorophore, can be carried out with an argon ion laser, a high intensity mercury (Hg) arc lamp, a fiber optic light source, or other high intensity light source appropriately filtered for excitation in the desired range.
[0129] As used herein with respect to donor and corresponding acceptor moieties “corresponding” refers to an acceptor fluorescent moiety or a dark quencher having an absorbance spectrum that overlaps the emission spectrum of the donor fluorescent moiety. The wavelength maximum of the emission spectrum of the acceptor fluorescent moiety should be at least 100 nm greater than the wavelength maximum of the excitation spectrum of the donor fluorescent moiety. Accordingly, efficient non-radiative energy transfer can be produced there between.
[0130] Fluorescent donor and corresponding acceptor moieties are generally chosen for (a) high efficiency Forster energy transfer; (b) a large final Stokes shift (>100 nm); (c) shift of the emission as far as possible into the red portion of the visible spectrum (>600 nm); and (d) shift of the emission to a higher wavelength than the Raman water fluorescent emission produced by excitation at the donor excitation wavelength. For example, a donor fluorescent moiety can be chosen that has its excitation maximum near a laser line (for example, Helium-Cadmium 442 nm or Argon 488 nm), a high extinction coefficient, a high quantum yield, and a good overlap of its fluorescent emission with the excitation spectrum of the corresponding acceptor fluorescent moiety. A corresponding acceptor fluorescent moiety can be chosen that has a high extinction coefficient, a high quantum yield, a good overlap of its excitation with the emission of the donor fluorescent moiety, and emission in the red part of the visible spectrum (>600 nm).
[0131] Representative donor fluorescent moieties that can be used with various acceptor fluorescent moieties in FRET technology include fluorescein, Lucifer Yellow, B-phycoerythrin, 9-acridineisothiocyanate, Lucifer Yellow VS, 4-acetamido-4′-isothio-cyanatostilbene-2,2′-disulfonic acid, 7-diethylamino-3-(4′-isothiocyanatophenyl)-4-methylcoumarin, succinimdyl 1-pyrenebutyrate, and 4-acetamido-4′-isothiocyanatostilbene-2,2′-disulfonic acid derivatives. Representative acceptor fluorescent moieties, depending upon the donor fluorescent moiety used, include LC Red 640, LC Red 705, Cy5, Cy5.5, Lissamine rhodamine B sulfonyl chloride, tetramethyl rhodamine isothiocyanate, rhodamine x isothiocyanate, erythrosine isothiocyanate, fluorescein, diethylenetriamine pentaacetate, or other chelates of Lanthanide ions (e.g., Europium, or Terbium). Donor and acceptor fluorescent moieties can be obtained, for example, from Molecular Probes (Junction City, Oreg.) or Sigma Chemical Co. (St. Louis, Mo.).
[0132] The donor and acceptor fluorescent moieties can be attached to the appropriate probe oligonucleotide via a linker arm. The length of each linker arm is important, as the linker arms will affect the distance between the donor and acceptor fluorescent moieties. The length of a linker arm can be the distance in Angstroms (Å) from the nucleotide base to the fluorescent moiety. In general, a linker arm is from about 10 Å to about 25 Å. The linker arm may be of the kind described in WO 84/03285. WO 84/03285 also discloses methods for attaching linker arms to a particular nucleotide base, and also for attaching fluorescent moieties to a linker arm.
[0133] An acceptor fluorescent moiety, such as an LC Red 640, can be combined with an oligonucleotide which contains an amino linker (e.g., C6-amino phosphoramidites available from ABI (Foster City, Calif.) or Glen Research (Sterling, Va.)) to produce, for example, LC Red 640-labeled oligonucleotide. Frequently used linkers to couple a donor fluorescent moiety such as fluorescein to an oligonucleotide include thiourea linkers (FITC-derived, for example, fluorescein-CPG's from Glen Research or ChemGene (Ashland, Mass.)), amide-linkers (fluorescein-NHS-ester-derived, such as CX-fluorescein-CPG from BioGenex (San Ramon, Calif.)), or 3′-amino-CPGs that require coupling of a fluorescein-NHS-ester after oligonucleotide synthesis.
[0134] As described herein, amplification products can be detected using labeled hybridization probes that take advantage of FRET technology. One FRET format utilizes TaqMan® technology to detect the presence or absence of an amplification product, and hence, the presence or absence of the target gene. TaqMan® technology utilizes one single-stranded hybridization probe labeled with, e.g., one fluorescent dye and one quencher, which may or may not be fluorescent. When a first fluorescent moiety is excited with light of a suitable wavelength, the absorbed energy is transferred to a second fluorescent moiety or a dark quencher according to the principles of FRET. The second moiety is generally a quencher molecule. During the annealing step of the PCR reaction, the labeled hybridization probe binds to the target DNA (i.e., the amplification product) and is degraded by the 5′ to 3′ nuclease activity of, e.g., the Taq Polymerase during the subsequent elongation phase. As a result, the fluorescent moiety and the quencher moiety become spatially separated from one another. As a consequence, upon excitation of the first fluorescent moiety in the absence of the quencher, the fluorescence emission from the first fluorescent moiety can be detected. By way of example, an ABI PRISM® 7700 Sequence Detection System (Applied Biosystems) uses TaqMan® technology, and is suitable for performing the methods described herein for detecting the presence or absence of the target gene in the sample.
[0135] Molecular beacons in conjunction with FRET can also be used to detect the presence of an amplification product using the real-time PCR methods. Molecular beacon technology uses a hybridization probe labeled with a first fluorescent moiety and a second fluorescent moiety. The second fluorescent moiety is generally a quencher, and the fluorescent labels are typically located at each end of the probe. Molecular beacon technology uses a probe oligonucleotide having sequences that permit secondary structure formation (e.g., a hairpin). As a result of secondary structure formation within the probe, both fluorescent moieties are in spatial proximity when the probe is in solution. After hybridization to the target nucleic acids (i.e., amplification products), the secondary structure of the probe is disrupted and the fluorescent moieties become separated from one another such that after excitation with light of a suitable wavelength, the emission of the first fluorescent moiety can be detected.
[0136] Another common format of FRET technology utilizes two hybridization probes. Each probe can be labeled with a different fluorescent moiety and are generally designed to hybridize in close proximity to each other in a target DNA molecule (e.g., an amplification product). A donor fluorescent moiety, for example, fluorescein, is excited at 470 nm by the light source of the LightCycler® Instrument. During FRET, the fluorescein transfers its energy to an acceptor fluorescent moiety such as LightCycler®-Red 640 (LC Red 640) or LightCycler®-Red 705 (LC Red 705). The acceptor fluorescent moiety then emits light of a longer wavelength, which is detected by the optical detection system of the LightCycler® instrument. Efficient FRET can only take place when the fluorescent moieties are in direct local proximity and when the emission spectrum of the donor fluorescent moiety overlaps with the absorption spectrum of the acceptor fluorescent moiety. The intensity of the emitted signal can be correlated with the number of original target DNA molecules (e.g., the number of target strain/family genomes). If amplification of target nucleic acid occurs and an amplification product is produced, the step of hybridizing results in a detectable signal based upon FRET between the members of the pair of probes.
[0137] Generally, the presence of FRET indicates the presence of the target gene in the sample, and the absence of FRET indicates the absence of the target gene in the sample. Inadequate specimen collection, transportation delays, inappropriate transportation conditions, or use of certain collection swabs (calcium alginate or aluminum shaft) are all conditions that can affect the success and/or accuracy of a test result, however. Using the methods disclosed herein, detection of FRET within, e.g., 45 cycling steps is indicative of the presence of the target strain/family of interest.
[0138] Representative biological samples that can be used in practicing the methods include, but are not limited to respiratory specimens, fecal specimens, blood specimens, dermal swabs, nasal swabs, wound swabs, blood cultures, skin, and soft tissue infections. Collection and storage methods of biological samples are known to those of skill in the art. Biological samples can be processed (e.g., by nucleic acid extraction methods and/or kits known in the art) to release target gene nucleic acid or in some cases, the biological sample can be contacted directly with the PCR reaction components and the appropriate oligonucleotides.
[0139] Melting curve analysis is an additional step that can be included in a cycling profile. Melting curve analysis is based on the fact that DNA melts at a characteristic temperature called the melting temperature (Tm), which is defined as the temperature at which half of the DNA duplexes have separated into single strands. The melting temperature of a DNA depends primarily upon its nucleotide composition. Thus, DNA molecules rich in G and C nucleotides have a higher Tm than those having an abundance of A and T nucleotides. By detecting the temperature at which signal is lost, the melting temperature of probes can be determined. Similarly, by detecting the temperature at which signal is generated, the annealing temperature of probes can be determined. The melting temperature(s) of the probes from the amplification products can confirm the presence or absence of the target strain/family of interest in the sample.
[0140] Within each thermocycler run, control samples can be cycled as well. Positive control samples can amplify target nucleic acid control template (other than described amplification products of target genes) using, for example, control primers and control probes. Positive control samples can also amplify, for example, a plasmid construct containing the target nucleic acid molecules. Such a plasmid control can be amplified internally (e.g., within the sample) or in a separate sample run side-by-side with the patients' samples using the same primers and probe as used for detection of the intended target. Such controls are indicators of the success or failure of the amplification, hybridization, and/or FRET reaction. Each thermocycler run can also include a negative control that, for example, lacks target template DNA. Negative control can measure contamination. This ensures that the system and reagents would not give rise to a false positive signal. Therefore, control reactions can readily determine, for example, the ability of primers to anneal with sequence-specificity and to initiate elongation, as well as the ability of probes to hybridize with sequence-specificity and for FRET to occur.
[0141] In an embodiment, the methods include steps to avoid contamination. For example, an enzymatic method utilizing uracil-DNA glycosylase is described in U.S. Pat. Nos. 5,035,996, 5,683,896 and 5,945,313 to reduce or eliminate contamination between one thermocycler run and the next.
[0142] Conventional PCR methods in conjunction with FRET technology can be used to practice the methods. In one embodiment, a LightCycler® instrument is used. The following patent applications describe real-time PCR as used in the LightCycler® technology: WO 97/46707, WO 97/46714, and WO 97/46712.
[0143] The LightCycler® can be operated using a PC workstation and can utilize a Windows NT operating system. Signals from the samples are obtained as the machine positions the capillaries sequentially over the optical unit. The software can display the fluorescence signals in real-time immediately after each measurement. Fluorescent acquisition time is 10-100 milliseconds (msec). After each cycling step, a quantitative display of fluorescence vs. cycle number can be continually updated for all samples. The data generated can be stored for further analysis.
[0144] As an alternative to FRET, an amplification product can be detected using a double-stranded DNA binding dye such as a fluorescent DNA binding dye (e.g., SYBR® Green or SYBR® Gold (Molecular Probes)). Upon interaction with the double-stranded nucleic acid, such fluorescent DNA binding dyes emit a fluorescence signal after excitation with light at a suitable wavelength. A double-stranded DNA binding dye such as a nucleic acid intercalating dye also can be used. When double-stranded DNA binding dyes are used, a melting curve analysis is usually performed for confirmation of the presence of the amplification product.
[0145] It is understood that the embodiments of the present disclosure are not limited by the configuration of one or more commercially available instruments.
Real-Time PCR for Phenotypic Antimicrobial Susceptibility Testing (AST)
[0146] Although quantitative real-time PCR (qPCR or qRT-PCR) can identify and quantify bacteria in samples with high specificity and sensitivity, its reliability in performing phenotypic based AST using growth of bacteria in the presence of antimicrobials has not been demonstrated with consistency. The present invention utilizes mathematical relationships derived from PCR growth curves to make the determination of whether a tested bacteria strain is susceptible, intermediate or resistant (SIR) to a given antimicrobial. The principle behind a phenotypic AST test using PCR is depicted in
[0147] Raw data from a hypothetical qPCR experiment in which either a resistant or a susceptible bacteria strain is incubated for four hours with various concentrations of an antimicrobial shown in
[0148] qPCR data can be used to determine whether a strain is susceptible, intermediate or resistant to a given antimicrobial by exploring a variety of mathematical relationships that are shown on
[0149] From the calculated differences in the mathematical features, simplified partitioning models such as that depicted in
EXAMPLES
[0150] The following examples, tables and figures are provided to aid the understanding of the subject matter, the true scope of which is set forth in the appended claims. It is understood that modifications can be made in the procedures set forth without departing from the spirit of the invention.
Example 1 PCR Conditions
[0151] Real-time PCR detection of target genes were performed using the cobas 6800/8800 systems platforms (Roche Molecular Systems, Inc., Pleasanton, Calif.). The final concentrations of the amplification reagents are shown below:
TABLE-US-00029 TABLE XXIX PCR Amplification Reagents Master Mix Component Final Conc (45.0 uL) DMSO 5.4 % NaN3 0.027 % Potassium acetate 120.0 mM Glycerol 3.0 % Tween 20 0.015 % NaN3 0.027 % Tricine 60.0 mM NTQ21-46AAptamer 0.222 uM UNG Enzyme 10.0 U Z05D-DNA Polymerase 45.0 U dATP 400.0 uM dCTP 400.0 uM dGTP 400.0 uM dUTP 800.0 uM Forward primer oligonucleotides 0.50 μM Reverse primer oligonucleotides 0.50 μM Probe oligonucleotides 0.15 μM Manganese Acetate 3.30 mM Trizma Base 12 μM Methylparaben 0.08 %
[0152] The following table shows the typical thermoprofile used for PCR amplification reaction:
TABLE-US-00030 TABLE XXX PCR Thermoprofile Program Target Acquisition Hold Ramp Rate Name (° C.) Mode (hh:mm:ss) (° C./s) Cycles Analysis Mode Pre-PCR 50 None 00:02:00 4.4 1 None 94 None 00:00:05 4.4 55 None 00:02:00 2.2 60 None 00:06:00 4.4 65 None 00:04:00 4.4 1st 95 None 00:00:05 4.4 5 Quantification Measurement 55 Single 00:00:30 2.2 2nd 91 None 00:00:05 4.4 45 Quantification Measurment 58 Single 00:00:25 2.2 Cooling 40 None 00:02:00 2.2 1 None
[0153] The Pre-PCR program comprised initial denaturing and incubation at 55° C., 60° C. and 65° C. for reverse transcription of RNA templates. Incubating at three temperatures combines the advantageous effects that at lower temperatures slightly mismatched target sequences (such as genetic variants of an organism) are also transcribed, while at higher temperatures the formation of RNA secondary structures is suppressed, thus leading to a more efficient transcription. PCR cycling was divided into two measurements, wherein both measurements apply a one-step setup (combining annealing and extension). The first 5 cycles at 55° C. allow for an increased inclusivity by pre-amplifying slightly mismatched target sequences, whereas the 45 cycles of the second measurement provide for an increased specificity by using an annealing/extension temperature of 58° C.
Example 2 PCR Using Primers/Probes for Detecting Enterobacterales Order
[0154] Using the PCR conditions described in Example 1, PCR assays using forward primer RM_ENTF (SEQ ID NO: 1), reverse primer RM_ENTRP (SEQ ID NO: 2) and both probes RM_ETP02 (SEQ ID NO: 3) and RM_ETP02B (SEQ ID NO: 4) that target the rplP gene were tested against five bacteria strains from the Enterobacterales order: E. Coli, K. pneumonia, E. cloacae, S. marcescens, P. mirabilis, and two bacteria strains from non-Enterobacterales order: P. aeruginosa, and A. baumannii. The concentration of the starting material that used ranged between 1e8 and 5e8 CFU/ml for the culture fluid for all the strains (overnight cultures previously stored in glycerol) except for S. marcescens in which DNA (˜1e7 copies/ul) was used. No sample preparation was performed for the culture fluids. The results of this experiment showed that growth curves are observed only for the five strains of the Enterobacterales order family but not for the two non-Enterobacterales strains, thereby demonstrating good inclusivity and exclusivity profiles for this particular combination of primers and probes for detecting Enterobacterales. Similar experiments were performed testing the P. aeruginosa-specific primers and probe (SEQ ID NOs: 5-8) and the A. baumannii-specific primers and probe (SEQ ID NOs: 9-11) which also showed good specificity and exclusivity (data not shown).
[0155] PCR assays using forward primer SEGP1899 (SEQ ID NO: 8), reverse primer SEGP1901 (SEQ ID NO: 9) and probe SEGP2016 (SEQ ID NO: 10) that target the gyrB gene were tested against common Gram-negative pathogens: E. coli, K. pneumoniae, E. cloacae, K. oxytoca, K. aerogenes, S. marcescens, P. mirabilis, S. maltophilia, P. aeruginosa, A. baumannii, and A. pittii. Gram-positive organisms were also tested and showed no meaningful amplification (data not shown). The concentration of the genomic DNA was roughly 2-10 ng/uL for all samples, besides the no template control that was 0 ng/uL. As shown in
[0156] PCR assays were performed for other primers and probe combinations designed to target the rplP gene in Enterobacterales. PCR assays using forward primer SEGP2891 (SEQ ID NO: 5), reverse primer SEGP2892 (SEQ ID NO: 6) and probe SEGP2893 (SEQ ID NO: 7) that target the rplP gene were tested against common Gram-negative pathogens: E. coli, K. pneumoniae, E. cloacae, K. oxytoca, K. aerogenes, S. marcescens, P. mirabilis, S. maltophilia, P. aeruginosa, A. baumannii, and A. pittii. Gram-positive organisms were also tested and showed no meaningful amplification (data not shown). The concentration of the genomic DNA was roughly 2-10 ng/uL for all samples, besides the no template control which was 0 ng/uL. As shown in
[0157] Similar results were obtained in PCR assays using forward primer SEGP2799 (SEQ ID NO: 11), reverse primers SEGP2800 (SEQ ID NO: 12), SEGP2802 (SEQ ID NO: 13), and SEGP2821 (SEQ ID NO: 14), in combination with probes SEGP2804 (SEQ ID NO: 15) and SEGP2822 (SEQ ID NO: 16) that target the rpoB gene. As shown in
Example 3 PCR Using Primers/Probes for Detecting Acinetobacter Genus
[0158] PCR assays using forward primer SEGP2603 (SEQ ID NO: 20), reverse primer SEGP2606 (SEQ ID NO: 21), and probe SEGP2769 (SEQ ID NO: 22) that target the ompA gene were tested against common Gram-negative pathogens: E. coli, K. pneumoniae, E. cloacae, K. oxytoca, K. aerogenes, S. marcescens, P. mirabilis, S. maltophilia, P. aeruginosa, A. baumannii, and A. pittii. Gram-positive organisms were also tested and showed no meaningful amplification (data not shown). The concentration of the genomic DNA was roughly 2-10 ng/uL for all samples, besides the no template control that was 0 ng/uL. As shown in
[0159] Similar results were obtained in PCR assays using forward primer SEGP2590 (SEQ ID NO: 23), reverse primer SEGP2593 (SEQ ID NO: 24), and probe SEGP2594 (SEQ ID NO: 25) that target the rpoB gene (as shown in
Example 4 PCR Using Primers/Probes for Detecting Pseudomonas aeruginosa
[0160] PCR assays using forward primer SEGP2341 (SEQ ID NO: 32), reverse primer SEGP2342 (SEQ ID NO: 33) and probe SEGP2343 (SEQ ID NO: 34) that target the tufgene were tested against common Gram-negative pathogens: E. coli, K. pneumoniae, E. cloacae, K. oxytoca, K. aerogenes, S. marcescens, P. mirabilis, S. maltophilia, P. aeruginosa, A. baumannii, and A. pittii. Gram-positive organisms were also tested and showed no meaningful amplification (data not shown). The concentration of the genomic DNA was roughly 2-10 ng/uL for all samples, besides the no template control that was 0 ng/uL. As shown in
[0161] Similar results were obtained in PCR assays using forward primer SEGP2630 (SEQ ID NO: 35), reverse primer SEGP2631 (SEQ ID NO: 36), and probe SEGP2632 (SEQ ID NO: 37) that target the gyrB gene (as shown in
Example 5 PCR Using Primers/Probes for Detecting Stenotrophomonas maltophilia
[0162] PCR assays using forward primer SEGP2532 (SEQ ID NO: 41), reverse primer SEGP2538 (SEQ ID NO: 42) and probe SEGP2544 (SEQ ID NO: 43) that target the fdnG gene were tested against common Gram-negative pathogens: E. coli, K. pneumoniae, E. cloacae, K. oxytoca, K. aerogenes, S. marcescens, P. mirabilis, S. maltophilia, P. aeruginosa, A. baumannii, and A. pittii. Gram-positive organisms were also tested and showed no meaningful amplification (data not shown). The concentration of the genomic DNA was roughly 2-10 ng/uL for all samples, besides the no template control that was 0 ng/uL. As shown in
[0163] Similar results were obtained in PCR assays using forward primer SEGP2578 (SEQ ID NO: 44), reverse primer SEGP2579 (SEQ ID NO: 45), and probe SEGP2580 (SEQ ID NO: 46) that target the gyrB gene (as shown in
Example 6 PCR Using Primers/Probes for Detecting Enterococcus Genus
[0164] PCR assays using forward primer SEGP2522 (SEQ ID NO: 53), reverse primer SEGP2525 (SEQ ID NO: 54), and probe SEGP2770 (SEQ ID NO: 55) that target the rpoB gene were tested against common Gram-positive pathogens: S. agalactiae, S. pneumoniae, S. pyogenes, E. faecium, E. faecalis, S. aureus, and S. epidermidis. Gram-negative organisms were also tested and showed no meaningful amplification (data not shown). The concentration of the genomic DNA was roughly 2-10 ng/uL for all samples, besides the no template control that was 0 ng/uL. As shown in
[0165] Similar results were obtained in PCR assays using forward primers SEGP1624 (SEQ ID NO: 56) and SEGP1627 (SEQ ID NO: 57), reverse primers SEGP1625 (SEQ ID NO: 58) and SEGP1628 (SEQ ID NO: 59), and probes SEGP1626 (SEQ ID NO: 60) and SEGP1629 (SEQ ID NO: 61) that target the ddl gene (as shown in
Example 7 PCR Using Primers/Probes for Detecting Staphylococcus aureus
[0166] PCR assays using forward primer SEGP1490 (SEQ ID NO: 67), reverse primer SEGP1491 (SEQ ID NO: 68) and probe SEGP1492 (SEQ ID NO: 72) that target the CPE gene were tested against common Gram-positive pathogens: S. agalactiae, S. pneumoniae, S. pyogenes, E. faecium, E. faecalis, S. aureus, and S. epidermidis. Gram-negative organisms were also tested and showed no meaningful amplification (data not shown). The concentration of the genomic DNA was roughly 2-10 ng/uL for all samples, besides the no template control that was 0 ng/uL. As shown in
[0167] Similar results were obtained in PCR assays using forward primer SEGP2792 (SEQ ID NO: 73), reverse primer SEGP2793 (SEQ ID NO: 74), and probe SEGP2794 (SEQ ID NO: 75) that target the gyrB gene (as shown in
Example 8 PCR Using Primers/Probes for Detecting Streptococcus agalactiae
[0168] PCR assays using forward primer SEGP2921 (SEQ ID NO: 121), reverse primer SEGP2922 (SEQ ID NO: 122) and probe SEGP2923 (SEQ ID NO: 123) that target the gyrB gene were tested against common Gram-positive pathogens: S. agalactiae, S. pneumoniae, S. pyogenes, E. faecium, E. faecalis, S. aureus, and S. epidermidis. Gram-negative organisms were also tested and showed no meaningful amplification (data not shown). The concentration of the genomic DNA was roughly 2-10 ng/uL for all samples, besides the no template control that was 0 ng/uL. As shown on
[0169] Similar results were obtained in PCR assays using forward primer SEGP2204 (SEQ ID NO: 82), reverse primer SEGP2205 (SEQ ID NO: 83), and probe SEGP2206 (SEQ ID NO: 84) that target the sip gene (as shown in
Example 9 PCR Using Primers/Probes for Detecting Candida Genus
[0170] PCR assays using forward primer SEGP1712 (SEQ ID NO: 88), reverse primer SEGP1713 (SEQ ID NO: 89), and probe SEGP1716 (SEQ ID NO: 90) that target the RDN18 (18s rRNA) were tested against common fungal pathogens: Candida albicans and Candida auris. Gram-negative and positive organisms were also tested and showed no meaningful amplification (data not shown). The concentration of the genomic DNA was roughly 2-10 ng/uL for all samples, besides the no template control that was 0 ng/uL. As shown in
[0171] PCR assays using forward primer SEGP1718 (SEQ ID NO: 91), reverse primer SEGP1719 (SEQ ID NO: 92), and probe SEGP1722.1 (SEQ ID NO: 93) that target the RDN58 (5.8s rRNA) gene were tested against C. albicans and C. auris. Gram-negative and positive organisms were also tested and showed no meaningful amplification (data not shown). The concentration of the genomic DNA was roughly 2-10 ng/uL for all samples, besides the no template control that was 0 ng/uL. As shown in
Example 10 PCR for Detecting Common Gram-Negative and Gram-Positive Pathogens
[0172] PCR assays using forward primer SEGP1830 (SEQ ID NO: 94), reverse primer SEGP1831 (SEQ ID NO: 95) and probe SEGP1895.1 (SEQ ID NO: 96) that target the 16s gene were tested against common Gram-negative pathogens: E. coli, K. pneumoniae, E. cloacae, K. oxytoca, K. aerogenes, S. marcescens, P. mirabilis, S. maltophilia, P. aeruginosa, A. baumannii, and A. pittii. The concentration of the genomic DNA was roughly 2-10 ng/uL for all samples, besides the no template control that was 0 ng/uL. As shown on
[0173] This same combination of primers and probe that target the 16s gene was also tested against common Gram-positive pathogens: S. agalactiae, S. pneumoniae, S. pyogenes, E. faecium, E. faecalis, S. aureus, and S. epidermidis under identical concentrations. As shown on
Example 11 Interpretation of AST Results
[0174] In general, the two most commonly used guidelines for interpreting Antimicrobial Susceptibility Testing (AST) results are guidelines from the: 1) Clinical Laboratory Standards Institute (CLSI), and 2) European Committee on Antimicrobial Susceptibility Testing (EUCAST). The US uses the CLSI guidelines while the European countries use the EUCAST guidelines. The current version from CLSI is M100 ED30, “Performance Standards for Antimicrobial Susceptibility Testing, 30.sup.th Edition”, and available via URL: clsi.org/standards/products/microbiology/documents/m100. The current version from EUCAST is Version 10, “The European Committee on Antimicrobial Susceptibility Testing. Breakpoint tables for interpretation of MICs and zone diameters. Version 10.0, 2020” and available via URL:
www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Breakpoint_tables/v_10.0_Breakpo int_Tables.pdf.
[0175] In
[0176] In
[0177] In
Example 12 PCR ID/AST Assay Protocol
Methods and Materials:
[0178] a. Prepare antimicrobial (Abx) Plate ahead of time and store at −80 C until needed [0179] i. Diluent—Cation Adjusted Mueller Hinton Broth (CAMHB) [0180] ii. Final Vol—50 ul/well [0181] iii. Remove from −80 C and let thaw at 30 min/Room Temp prior to use
TABLE-US-00031 TABLE XXXI Antimicrobial (Abx) Plate Layout Antibiotic (Abx) Plate Layout 1 2 3 4 5 6 7 8 9 10 11 12 A 0 Abx ¼ Abx ½ Abx 1 Abx 2 Abx 4 Abx 0 Abx ¼ Abx ½ Abx 1 Abx 2 Abx 4 Abx B 0 Abx ¼ Abx ½ Abx 1 Abx 2 Abx 4 Abx 0 Abx ¼ Abx ½ Abx 1 Abx 2 Abx 4 Abx C 0 Abx ¼ Abx ½ Abx 1 Abx 2 Abx 4 Abx 0 Abx ¼ Abx ½ Abx 1 Abx 2 Abx 4 Abx D 0 Abx ¼ Abx ½ Abx 1 Abx 2 Abx 4 Abx 0 Abx ¼ Abx ½ Abx 1 Abx 2 Abx 4 Abx E 0 Abx ¼ Abx ½ Abx 1 Abx 2 Abx 4 Abx 0 Abx ¼ Abx ½ Abx 1 Abx 2 Abx 4 Abx F 0 Abx ¼ Abx ½ Abx 1 Abx 2 Abx 4 Abx 0 Abx ¼ Abx ½ Abx 1 Abx 2 Abx 4 Abx G 0 Abx ¼ Abx ½ Abx 1 Abx 2 Abx 4 Abx 0 Abx ¼ Abx ½ Abx 1 Abx 2 Abx 4 Abx H 0 Abx ¼ Abx ½ Abx 1 Abx 2 Abx 4 Abx 0 Abx ¼ Abx ½ Abx 1 Abx 2 Abx 4 Abx [0182] b. Overnight cultures in CAMHB—37 C/16-18 hrs/500 rpm [0183] i. 10 ul glycerol stock+490 ul CAMHB in 2 mL 96-well Deep Well Plate [0184] c. Normalize cultures to 1.00E+06 CFU/mL by Optical Density (OD) [0185] d. Prepare Test Plate by adding 50 ul normalized test isolate to appropriate wells of Abx Plate as outlined
TABLE-US-00032 TABLE XXXII Test Isolate Layout on Abx Plate Test Isolate Layout on Antibiotic (Abx) Plate 1 2 3 4 5 6 7 8 9 10 11 12 A Isolate_1 Isolate_9 B Isolate_2 Isolate_10 C Isolate_3 Isolate_11 D Isolate_4 Isolate_12 E Isolate_5 Isolate_13 F Isolate_6 Isolate_14 G Isolate_7 Isolate_15 H Isolate_8 Isolate_16 [0186] e. Incubate Test Plate at 37 C/4 hrs/no shaking [0187] f Prepare PCR Reagents according to TABLE IV [0188] g. Add 45 ul Master Mix to each well of a PCR Assay Plate [0189] h. Following incubation, stamp 5 ul/well of Test Plate to PCR Assay Plate [0190] i. Final Vol—50 ul/well [0191] i. For Test Plate, continue incubating at 37 C/12-16 hrs/no shaking to determine reference method Minimum Inhibitory Concentration (MIC) [0192] j. Load PCR Assay Plate to cobas z 480 instrument and run under conditions of TABLE IV. [0193] k. Following incubation read Test Plate for MIC and determine phenotypic Susceptible/Intermediate/Resistant interpretation.
Example 13 Real-Time PCR ID and AST Assay of Enterobacterales Order
[0194] Rapid identification and phenotypic antimicrobial susceptibility testing of Enterobacterales utilizing three distinct target genes, gyrB, rplP, and rpoB, and three classes of antibacterial agents ciprofloxacin (fluoroquinolone), gentamicin (aminoglycoside), and meropenem (carbapenem) was performed. The primer/probe sets used were as follows. For gyrB, SEQ ID NO: 8 (forward primer), SEQ ID NO: 9 (reverse primer), SEQ ID NO: 10 (probe); for rplP, SEQ ID NO: 5 (forward primer), SEQ ID NO: 6 (reverse primer), SEQ ID NO: 7 (probe); for rpoB, SEQ ID NO: 11 (forward primer), SEQ ID NOs: 12-14 (reverse primers), SEQ ID NOs: 15-16 (probe). The antimicrobial susceptibility of K. pneumoniae strains 0143 (antimicrobial resistant strain) and 16565 (antimicrobial sensitive strain) were interpreted according to the Clinical and Laboratory Standards Institute (CLSI) document M100 ED 30 to determine their resistance and susceptibility to the given antimicrobials, respectively. Each strain was inoculated at 5E5 CFU/mL into wells containing various concentrations of the indicated antimicrobials, and after 4 h of incubation were subjected to PCR-based rapid ID/AST testing using the protocol of Example 12.
[0195] The results are shown on
Example 14 Real-Time PCR ID and AST Assay of Pseudomonas aeruginosa
[0196] Rapid Identification and phenotypic antimicrobial susceptibility testing of Pseudomonas aeruginosa utilizing three distinct target genes, tuf; gyrB, rpoB, and three classes of antibacterial agents, ciprofloxacin, gentamicin, and meropenem, was performed. The primer/probe sets used were as follows. For tuf; SEQ ID NO: 32 (forward primer), SEQ ID NO: 33 (reverse primer), SEQ ID NO: 34 (probe); for gyrB, SEQ ID NO: 35 (forward primer), SEQ ID NO: 36 (reverse primer), SEQ ID NO: 37 (probe); for rpoB, SEQ ID NO: 38 (forward primer), SEQ ID NO: 39 (reverse primer), SEQ ID NO: 40 (probe). The antimicrobial susceptibility of P. aeruginosa strains 16657 (resistant) and 17816 (sensitive) were interpreted according to the Clinical and Laboratory Standards Institute (CLSI) document M100 ED 30 to determine their resistance and susceptibility to the given antimicrobials, respectively. Each strain was inoculated at 5E5 CFU/mL into wells containing various concentrations of the indicated antimicrobials, and after 4 h of incubation were subjected to PCR-based rapid ID/AST testing using the protocol of Example 12. The results, as shown in
Example 15 Real-Time PCR ID and AST Assay of Acinetobacter baumanii
[0197] Rapid Identification and phenotypic antimicrobial susceptibility testing of Acinetobacter baumanii utilizing three distinct target genes, ompA, rpoB, gyrB, and three classes of antibacterial agents, ciprofloxacin, gentamicin, and meropenem, was performed. The primer/probe sets used were as follows. For ompA, SEQ ID NO: 20 (forward primer), SEQ ID NO: 21 (reverse primer), SEQ ID NO: 22 (probe); for rpoB, SEQ ID NO: 23 (forward primer), SEQ ID NO: 24 (reverse primer), SEQ ID NO: 25 (probe); for gyrB, SEQ ID NO: 26 (forward primer), SEQ ID NO: 27 (reverse primer), SEQ ID NO: 28 (probe). The antimicrobial susceptibility of A. baumannii strains 17694 (resistant) and 16421 (sensitive) were interpreted according to the Clinical and Laboratory Standards Institute (CLSI) document M100 ED 30 to determine their resistance and susceptibility to the given antimicrobials, respectively. Each strain was inoculated at 5E5 CFU/mL into wells containing various concentrations of the indicated antimicrobials, and after 4 h of incubation were subjected to PCR-based rapid ID/AST testing using the protocol of Example 12. The results, as shown in
Example 16 Real-Time PCR ID and AST Assay of Staphylococcus aureus
[0198] Rapid Identification and phenotypic antimicrobial susceptibility testing of Staphylococcus. aureus utilizing three distinct target genes (gyrB, ddlA, tuf) and one class of antibacterial agent, cefoxitin (cephalosporin) was performed. The primer/probe sets used were as follows. For gyrB, SEQ ID NO: 73 (forward primer), SEQ ID NO: 74 (reverse primer), SEQ ID NO: 75 (probe); for ddlA, SEQ ID NO: 76 (forward primer), SEQ ID NO: 77 (reverse primer), SEQ ID NO: 78 (probe); for tuf; SEQ ID NO: 79 (forward primer), SEQ ID NO: 80 (reverse primer), SEQ ID NO: 81 (probe). The antimicrobial susceptibility of S. aureus strains 15509 (resistant) and 16405 (sensitive) were interpreted according to the Clinical and Laboratory Standards Institute (CLSI) document M100 ED 30 to determine their resistance and susceptibility to the given antimicrobials, respectively. Each strain was inoculated at 5E5 CFU/mL into wells containing various concentrations of the indicated antimicrobial, and after 4 h of incubation were subjected to PCR-based rapid ID/AST testing using the protocol of Example 12. The results, as shown in
Example 17 Real-Time PCR ID and AST Assay of Enterococcus faecium
[0199] Rapid Identification and phenotypic antimicrobial susceptibility testing of Enterococcus faecium utilizing three distinct target genes (rpoB, ddl, gyrB) and two classes of antibacterial agents, ampicillin (beta-lactam) and vancomycin (glycopeptide) was performed. The primer/probe sets used were as follows. For rpoB, SEQ ID NO: 53 (forward primer), SEQ ID NO: 54 (reverse primer), SEQ ID NO: 55 (probe); for ddl, SEQ ID NOs: 56-57 (forward primers), SEQ ID NOs: 58-59 (reverse primers), SEQ ID NOs: 60-61 (probes); for gyrB, SEQ ID NOs: 62-63 (forward primers), SEQ ID NOs: 64-65 (reverse primers), SEQ ID NO: 66 (probe). The antimicrobial susceptibility of E. faecium strains 18483 (resistant) and 18446 (sensitive) were interpreted according to the Clinical and Laboratory Standards Institute (CLSI) document M100 ED 30 to determine their resistance and susceptibility to the given antimicrobials, respectively. Each strain was inoculated at 5E5 CFU/mL into wells containing various concentrations of the indicated antimicrobial, and after 4 h of incubation were subjected to PCR-based rapid ID/AST testing using the protocol of Example 12. The results, as shown in
Example 18 Real-Time PCR ID and AST Assay of Candida Genus
[0200] Rapid Identification and phenotypic antimicrobial susceptibility testing of Candida can be performed with the target genes RDN18 (18s ribosomal RNA) and RDN58 (5.8s ribosomal RNA) using the primers and probes as shown in
Example 19 Generic Real-Time PCR ID and AST Assay
[0201] Rapid Identification and phenotypic antimicrobial susceptibility testing of any given Gram-negative or Gram-positive bacteria can be performed with the widely conserved 16s ribosomal RNA gene as target and using the primers and probe as shown in
Example 20 Multiplex PCR ID Assay with Breakpoint Groups
[0202]
[0203]
Example 21 Analysis of PCR-AST Assay
[0204]
TABLE-US-00033 TABLE XXXIII Oligonucleotides for detecting Pseudomonas aeruginosa Primers and Probes that hybridize to O-antigen acetylase gene in P. aeruginosa Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer RM_PFP01 130 ACGTTTTCCCTTCGCTG<t_BB_d t_BB_dA = A> t-butylbenzyl-dA Reverse primer RMPRP02 131 GTACAGTGACCAGCCAT<t_BB_ t_BB_ dC = 1 dC> t-butylbenzyl-dC Reverse primer RMPRP04 132 GCGAAACAATCCAGGCCAT<t_ t_BB_ dC = 2 BB_dC> t-butylbenzyl-dC Probe RM_P04 133 <FAM_Thr>CCTACG<BHQ_2>T <FAM_Thr>: GAATGCGCTGTTCGATGCGTT Fluorophore GGC<Phos> <BHQ_2>: Quencher <Phos>: Phosphate
[0205]
[0206]
[0207]
[0208]
Example 22 Multiplex ID-AST PCR Assay of Polymicrobial Samples
[0209] A. Kpn/Abi Multiplex PCR ID-AST assay was performed in a polymicrobial sample where a 1:1 ratio of two Gram-negative organisms, Klebsiella pneumonia (Kpn) and Acinetobacter baumannii (Abi) with different susceptibility combinations were co-incubated together in the absence or presence of three different antibiotics, ciproflaxocin, gentamicin and meropenem, at varying concentrations. Detection of the Kpn signal was from an ATTO-labeled probe and detection of the Abi signal was from a HEX-labeled probe. Primers and probes used in this assay are shown in TABLE XXXIV and the results are shown on
TABLE-US-00034 TABLE XXXIV Oligonucleotides Used in Kpn and Abi ID-AST Assay Primers and Probes used in polymicrobial ID-AST assay with Klebsiella pneumoniae and Acinetobacter baumannii Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primers SEGP1899 8 TGTCGAATTCTTATGACTCCTCCAG SEGP1813 29 TA ACCCTAACGCTACTGCACGT Reverse primers SEGP1901 9 CGCGAGCGCTTCGTCGA SEGP1815 30 GGTTGATCCCAAGCGAAACCT Probes SEGP2016 10 <HEX>CCGGTCTGC<ZEN>ACCACA <HEX>: Fluorophore TGGTATTCGAGGTGG<3IABkFQ> <ATTO>: Fluorophore SEGP1951 31 <ATTO>TCGAAGGT<BHQ_2>CACAC <ZEN>: Quencher AGATAACACT<Phos> <BHQ_2>: Quencher <3IABkFQ>: 3′ Blocker <Phos>: 3′ Blocker
[0210] B. Kpn/Sar Multiplex PCR ID-AST assay was performed in a polymicrobial sample where a 1:1 ratio of one Gram-negative organism Klebsiella pneumonia (Kpn) and one Gram-positive organism Staphylococcus aureus (Sar) with different susceptibility combinations were co-incubated together in the absence or presence of three different antibiotics, ciprofloxacin, cefoxitin and meropenem, at varying concentrations. Detection of the Kpn signal was from a HEX-labeled probe and detection of the Sar signal was from a FAM-labeled probe. Primers and probes used in this assay are shown in TABLE XXXV and the results are shown on
TABLE-US-00035 TABLE XXXV Oligonucleotides Used in Kpn and Sar ID-AST Assay Primers and Probes used in polymicrobial ID-AST assay with Klebsiella pneumoniae and Staphylococcus aureus Oligonucleotide Oligonucleotide SEQ Type Name ID NO: Sequence Modifications Forward SEGP1899 8 TGTCGAATTCTTATGACTCCTCCAGTA primers SEGP1835 79 CCGTGTTGAACGTGGTCAAATCAAA Reverse primers SEGP1901 9 CGCGAGCGCTTCGTCGA SEGP1836 80 AGCAGCTAATACTTGACCACGTTGTA Probes SEGP2016 10 <HEX>CCGGTCTGC<ZEN>ACCACATG <HEX>: Fluorophore GTATTCGAGGTGG<3IABkFQ> <FAM>: Fluorophore SEGP1838 81 <FAM>AGACTACGC<ZEN>TGAAGCTG <ZEN>: Quencher GTGAC<3IABkFQ> <3IABkFQ>: 3′ Blocker
[0211] C. Kpn/Cal Multiplex PCR ID-AST assay was performed in a polymicrobial sample where a 1:1 ratio of one Gram-negative organism, Klebsiella pneumonia (Kpn), and one fungal organism, Candida albicans (Cal) with different susceptibility combinations were co-incubated together in the absence or presence of two different antibiotics, ciprofloxacin and meropenem, at varying concentrations. Detection of the Kpn signal was from a HEX-labeled probe and detection of the Cal signal was from a FAM-labeled probe. Primers and probes used in this assay are shown in TABLE XXXVI and the results are shown on
TABLE-US-00036 TABLE XXXVI Oligonucleotides Used in Kpn and Cal ID-AST Assay Primers and Probes used in polymicrobial ID-AST assay with Klebsiella pneumoniae and Candida albicans Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primers SEGP1899 8 TGTCGAATTCTTATGACTCCTCCA SEGP1712 88 GTA CGTTTTCATTAATCAAGAACGAAA GTTA Reverse primers SEGP1901 9 CGCGAGCGCTTCGTCGA SEGP1713 89 ACCGATCCCTAGTCGGCATA Probes SEGP2016 10 <HEX>CCGGTCTGC<ZEN>ACCAC <HEX>: Fluorophore ATGGTATTCGAGGTGG<3IABkFQ> <FAM>: Fluorophore SEGP1716 90 <FAM>AGACTACGA<ZEN>CGGTA <ZEN>: Quencher TCTGATCATCTTCGATCCC<3IABkF <3IABkFQ>: 3′ Q> Blocker
[0212] D. Efs/Sar Multiplex PCR ID-AST assay was performed in a polymicrobial sample where a 1:1 ratio of two Gram-positive organisms, Enterococcus faecalis (Efs) and Staphylococcus aureus (Sar), with different susceptibility combinations were co-incubated together in the absence or presence of vancomycin at varying concentrations. Detection of the Efs signal was from a HEX-labeled probe and detection of the Sar signal was from a FAM-labeled probe. Primers and probes used in this assay are shown in TABLE XXXVII and the results are shown on
TABLE-US-00037 TABLE XXXVII Oligonucleotides Used in Efs and Sar ID-AST Assay Primers and Probes used in polymicrobial ID-AST assay with Enterococcus faecalis and Staphylococcus aureus Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward SEGP1624 56 CGTAGCATTCTATGATTATGAAGCC primers SEGP1835 79 CCGTGTTGAACGTGGTCAAATCAAA Reverse primers SEGP1625 58 CATCGTGTAAGCTAACTTCG SEGP1836 80 AGCAGCTAATACTTGACCACGTTGTA Probes SEGP1626 60 <HEX>CAGATTCCA<ZEN>GCCGAAGT <HEX>: SEGP1838 81 GCC<3IABkFQ> Fluorophore <FAM>AGACTACGC<ZEN>TGAAGCT <FAM>: GGTGAC<3IABkFQ> Fluorophore <ZEN>: Quencher <3IABkFQ>: 3′ Blocker
[0213] E. Sar/Cal Multiplex PCR ID-AST assay was performed in a polymicrobial sample where a 1:1 ratio of one Gram-positive organism, Staphylococcus aureus (Sar) and one fungal organism Candida albicans (Cal), with different susceptibility combinations were co-incubated together in the absence or presence of cefoxitin at varying concentrations. Detection of the Sar signal was from a FAM-labeled probe and detection of the Cal signal was from a HEX-labeled probe. Primers and probes used in this assay are shown in TABLE XXXVIII and the results are shown on
TABLE-US-00038 TABLE XXXVIII Oligonucleotides Used in Sar and Cal ID-AST Assay Primers and Probes used in polymicrobial ID-AST assay with Staphylococcus aureus and Candida albicans Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward SEGP1835 79 CCGTGTTGAACGTGGTCAAATC primers SEGP1712 88 AAA CGTTTTCATTAATCAAGAACGAA AGTTA Reverse primers SEGP1836 80 AGCAGCTAATACTTGACCACGTT SEGP1713 89 GTA ACCGATCCCTAGTCGGCATA Probes SEGP1838 81 <FAM>AGACTACGC<ZEN>TGAA <HEX>: Fluorophore SEGP1717 GCTGGTGAC<3IABkFQ> <FAM>: Fluorophore 134 <HEX>AGACTACGA<ZEN>CGGT <ZEN>: Quencher ATCTGATCATCTTCGATCCC<3IA <3IABkFQ>: 3′ Blocker BkFQ>
Example 23 PCR Assays for Determining Mechanism of Carbapenem Resistance
[0214] PCR assays that target the blaKPC, blaVIM, blaNDM, and blaOXA-48 genes were tested against Gram-negative pathogens with known mechanisms of carbapenem resistance: K. pneumoniae, E. cloacae, P. aeruginosa, A. baumannii, E. coli and K. aerogenes. The primers and probes used in this assay are listed in TABLE XXXIX. The concentration of the genomic DNA was roughly 2-10 ng/L for all samples other than the no template control. The results of the experiment are shown on
TABLE-US-00039 TABLE XXXIX Oligonucleotides Used in Carbapenem Resistance PCR Assay Gene Oligonucleotide Oligonucleotide SEQ ID Target Type Name NO: Sequence Modifications blaKPC Forward Primer SEGP2124 103 GCGATACCACGTTCCGT CTG blaVIM SEGP2135 104 CCGAGTGGTGAGTATCC GAC blaNDM SEGP2127 105 TTTGGCGATCTGGTTTT CCG blaOXA-48 SEGP2133 106 GGCACGTATGAGCAAG ATGC blaKPC Reverse Primer SEGP2125 107 CGGTCGTGTTTCCCTTT AGC blaVIM SEGP2136 108 GAATGCGTGGGAATCTC GTTC blaNDM SEGP2128 109 ATCAAACCGTTGGAAGC GAC blaOXA-48 SEGP2134 110 GTTTGACAATACGCTGG CTGC blaKPC Probe SEGP2126 111 <CFR_635>AGCGGCAGC <CFR_635>: AGTTT<BHQ_2>GTTGAT Fluorophore TG<Phos> <BHQ_2>: blaVIM SEGP2137 112 <CFR_635>CGCTGTATCA Quencher ATCAA<BHQ_2>AAGCA <phos>: 3, ACTCATCA<Phos> Blocker blaNDM SEGP2129 113 <CFR_635>AGACATTCG GTGCGA<BHQ_2>GCTG GC<Phos> blaOXA-48 SEGP2346 114 <CFR_635>TCGGGCAAT GT<BHQ_2>AGACAGTTT CTGGCTCGACG<Phos>
Example 24 Species-Specific PCR ID-AST Assays
[0215] PCR assays using forward primer SEGP2164 (SEQ ID NO: 115), reverse primer SEGP2166 (SEQ ID NO: 116) and probe SEGP2167 (SEQ ID NO: 117) that target the citC gene of P. stuartii, and also forward primer SEGP2119 (SEQ ID NO: 118), reverse primer SEGP2121 (SEQ ID NO: 119) and probe SEGP2120 (SEQ ID NO: 120) that target the invA gene of Salmonella were tested against common Gram-negative pathogens: E. coli, K. pneumoniae, E. cloacae, K. oxytoca, K. aerogenes, S. marcescens, P. mirabilis, C. freundii, P. stuartii, P. rettgeri, S. enterica, S. maltophilia, P. aeruginosa, A. baumannii, and A. pittii. The sequences are shown in TABLE XL. Gram-positive organisms were also tested and showed no meaningful amplification (data not shown). The concentration of the genomic DNA was roughly 2-10 ng/uL for all samples, besides the no template control which was 0 ng/uL. As shown in
TABLE-US-00040 TABLE XL Oligonucleotides for detecting P. stuartii and Salmonella Primers and Probes targeting citC gene of P. Stuartii and invA gene of Salmonella Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward primer SEGP2164 115 GCCATCGTGATGAATGCCAATCC SEGP2119 118 TGACCATTTCAATGGGAACTCTGC Reverse primer SEGP2166 116 TCAGAGCCTTTGTGGATAGTGAGA SEGP2121 119 AGATCGCCAATCAGTCCTAACGA Probe SEGP2167 117 <FAM>TTGGCTACA<ZEN>TTTATT <FAM>: TGTCGTCAAAGAAGATACCTCACG Fluorophore CTTCC<3IABkFQ> <ZEN>: Quencher SEGP2120 120 <FAM>CAAAGGCGA<ZEN>GCAGC <3IABkFQ>: 3′ CGCTCAGTATTGAGGA<3IABkFQ> Blocker
[0216] PCR assays using forward primer SEGP2921 (SEQ ID NO: 121), reverse primer SEGP2922 (SEQ ID NO: 122) and probe SEGP2923 (SEQ ID NO: 123) that target the gyrB gene of S. agalactiae, forward primer SEGP2947 (SEQ ID NO: 85), reverse primer SEGP2949 (SEQ ID NO: 86) and probe SEGP2951 (SEQ ID NO: 87) that target the ddlA gene of S. agalactiae, forward primer SEGP2777 (SEQ ID NO: 124), reverse primer SEGP2778 (SEQ ID NO: 125) and probe SEGP2779 (SEQ ID NO: 126) that target the tufgene of S. pneumoniae and forward primer SEGP2113 (SEQ ID NO: 127), reverse primer SEGP2114 (SEQ ID NO: 128) and probe SEGP2115 (SEQ ID NO: 129) that target the speB gene of S. pyogenes were tested against common Gram-positive pathogens: S. agalactiae, S. pneumoniae, S. pyogenes, E. faecium, E. faecalis, S. aureus, and S. epidermidis. The sequences are shown in TABLE XLI. Gram-negative organisms were also tested and showed no meaningful amplification (data not shown). The concentration of the genomic DNA was roughly 2-10 ng/uL for all samples, besides the no template control which was 0 ng/uL. As shown in
TABLE-US-00041 TABLE XLI Oligonucleotides for detecting S. agalactiae, S. pneumoniae and S. pyogenes Primers and Probes targeting gyrB gene of S. agalactiae, ddlA gene of S. agalactiae, tuf gene of S. pneumonia, speB gene of S. pyogenes Oligonucleotide Oligonucleotide SEQ ID Type Name NO: Sequence Modifications Forward SEGP2921 121 ACCACTGTATTTGATTTTGATAAATTAGCCAAA primer SEGP2947 85 CACAAGAATTTGATGAAATGCCATCTTCA SEGP2777 124 GTGACTCTAAATACGAAGACATCGTT SEGP2113 127 CGGAAGAAGCCGTCAGAGAC Reverse primer SEGP2922 122 TTCTCATTGATAAACTCAACGTATGAACCTA SEGP2949 86 ACAATTGCATTATCATCATAGATATCACTTGGA SEGP2778 125 GCAATGGTTTGTCAGTGTCACG SEGP2114 128 ATGGTGCTGACGGACGTAAC Probe SEGP2923 123 <FAM>ACTAAGAAT<ZEN>CTCCATTTCAGACA <FAM>: AGCGAGAAGGTCAAGAAGTTG<3IABkFQ> Fluorophore SEGP2951 87 <FAM>TAATGACAA<ZEN>ACCAAACTGTTGAT <ZEN>: TTAGACAAAATGGTTCGTCCA<3IABkFQ> Quencher SEGP2779 126 <FAM>TGAACACAG<ZEN>TTGATGAGTATATC <3IABkFQ>: CCA<3IABkFQ> 3′ Blocker SEGP2115 129 <FAM>CACCCCAAC<ZEN>CCCAGTTAACA<3IA BkFQ>
[0217] The impact of using species-specific primer/probe sets in making accurate calls in PCR ID-AST assays can be seen in
Example 25 Interpretation of PCR ID-AST Assay Data
[0218]
[0219]
[0220] There are specific examples of using algorithmic elements to improve breakpoint based AST calling. One example is the use of resistance mechanism detection to adjust phenotype result calling. Each resistance mechanism can have one or more antibiotic substrates associated with its activity which are known a priori. These mechanisms can also have different time-frames in which their activity can be detected. Some of these resistance mechanisms do not have robust activity within 4 hours and can only be detected phenotypically after much longer incubation times (12-24 hours). For these resistance mechanisms an organism may be identified as susceptible to a given drug simply because the resistance mechanism has not manifested sufficiently within a 4 hour time frame. Detection of these types of resistance mechanisms via separate PCR wells allows for the correction of discordant phenotypic results. A specific example is Serratia marsescens that sometimes encodes a SME carbapenemase resistance mechanism which is inducible, but not within a 4 hour time frame. Thus these resistant S. marsescens strains will appear to be phenotypically susceptible to meropenem, but detection of the SME gene will allow the correct phenotypic prediction which is meropenem resistance. Another example is the use of phenotypic susceptibility from one or more antibiotics to predict susceptibility for other antibiotics. Because resistance mechanisms often have overlapping substrate specificity this means that susceptibility to some antibiotics is directly correlated with susceptibility to other antibiotics. Likewise, resistance to some antibiotics is directly correlated with resistance to other antibiotics. This is similar to the Expert Rules system that many AST product manufacturers employ whereas data collected from the PCR ID-AST assays of the present invention would be employed as an adjunct to other methods of phenotypic result interpretation. A specific example would be a strain that is susceptible to the antibiotic ertapenem will always be susceptible to the antibiotic meropenem due to the nature of carbapenemases and their substrate specificity which is always higher for degradation of ertapenem. Similarly, any strain that is resistant to meropenem will also be resistant to ertapenem for the same reason.
[0221] While the foregoing invention has been described in some detail for purposes of clarity and understanding, it will be clear to one skilled in the art from a reading of this disclosure that various changes in form and detail can be made without departing from the true scope of the invention. For example, all the techniques and apparatus described above can be used in various combinations. All publications, patents, patent applications, and/or other documents cited in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application, and/or other document were individually indicated to be incorporated by reference for all purposes.