CHLOROQUINE-BASED MATERIALS FOR THE TREATMENT OF DISEASES
20210161825 · 2021-06-03
Inventors
Cpc classification
A61K47/34
HUMAN NECESSITIES
A61K47/6933
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K47/58
HUMAN NECESSITIES
A61K47/6927
HUMAN NECESSITIES
C08F293/005
CHEMISTRY; METALLURGY
A61K31/4706
HUMAN NECESSITIES
A61K31/713
HUMAN NECESSITIES
A61K9/5031
HUMAN NECESSITIES
A61K39/3955
HUMAN NECESSITIES
A61K9/0053
HUMAN NECESSITIES
A61P1/00
HUMAN NECESSITIES
A61K47/6929
HUMAN NECESSITIES
C08F220/281
CHEMISTRY; METALLURGY
C08F2438/03
CHEMISTRY; METALLURGY
International classification
A61K9/50
HUMAN NECESSITIES
A61K31/4706
HUMAN NECESSITIES
A61K31/713
HUMAN NECESSITIES
A61K39/395
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K47/58
HUMAN NECESSITIES
A61K47/69
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
A61P1/00
HUMAN NECESSITIES
C08F220/28
CHEMISTRY; METALLURGY
Abstract
Provided herein are copolymers comprising a plurality of a first monomer and a plurality of a second monomer, wherein chloroquine, hydroxychloroquine, or a chloroquine analog is appended to at least a portion of the plurality of the first monomer. Also provided are nanoparticles comprising copolymers as described herein, and methods of using the copolymers and nanoparticles for treating diseases or disorders, e.g., Inflammatory Bowel Disease (IBD) or cancer (e.g., colon cancer).
Claims
1. A copolymer comprising a plurality of a first monomer and a plurality of a second monomer, wherein chloroquine, hydroxychloroquine, or a chloroquine analog is appended to at least a portion of the plurality of the first monomer.
2. The copolymer of claim 1, wherein chloroquine, hydroxychloroquine, or a chloroquine analog is appended to all of the first monomer.
3. The copolymer of claim 1 or 2, comprising chloroquine.
4. The copolymer of claim 1 or 2, comprising hydroxychloroquine.
5. The copolymer of claim 1 or 2, comprising a chloroquine analog.
6. The copolymer of claim 5, wherein the chloroquine analog is hydroxychloroquine, methacryloyl chloroquine, quinacrine, 8-hydroxyquinoline, primaquine, sontoquine, azidoquine, or methacryloyl triazole chloroquine.
7. The copolymer of claim 6, wherein the chloroquine analog is methacryloyl chloroquine.
8. The copolymer of any one of claims 1 to 7, wherein at least one of the first monomer and the second comprises an acrylate, an acrylamide, or an alkene.
9. The copolymer of any one of claims 1 to 8, wherein the first monomer having chloroquine appended thereto comprises ##STR00036## wherein m and n each are independently an integer from 0 to 10.
10. The copolymer of claim 9, wherein the first monomer having chloroquine appended thereto comprises ##STR00037##
11. The copolymer of any one of claims 1 to 10, wherein the second monomer comprises N-(2-hydroxypropyl)methacrylamide (HPMA).
12. The copolymer of any one of claims 1 to 11, further comprising a polymer block.
13. The copolymer of claim 12, wherein the polymer block comprises poly(lactide-co-glycolide) (PLGA), polylactic acid (PLA), polycaprolactone (PCL), other polyesters, poly(propylene oxide), poly(1,2-butylene oxide), poly(n-butylene oxide), poly(tetrahydrofurane), and polystyrene; glyceryl esters, polyoxyethylene fatty alcohol ethers, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene fatty acid esters, sorbitan esters, glycerol monostearate, polyethylene glycols, polypropyleneglycols, cetyl alcohol, cetostearyl alcohol, stearyl alcohol, aryl alkyl polyether alcohols, polyoxyethylene-polyoxypropylene copolymers, poloxamines, cellulose, methylcellulose, hydroxylmethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, polysaccharides, starch and their derivatives, hydroxyethylstarch, polyvinyl alcohol (PVA), polyvinylpyrrolidone phospholipids, amphiphilic lipids, 1,2-dialkylglycero-3-alkylphophocholines, 1,2-distearoyl-sn-glecro-3-phosphocholine (DSPC), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[carboxy(polyethylene glycol) (DSPE-PEG), dimethylaminoethanecarbamoyl cheolesterol (DC-Chol), N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium (DOTAP), alkyl pyridinium halides, quaternary ammonium compounds, lauryldimethylbenzylammonium, acyl carnitine hydrochlorides, dimethyldioctadecylammonium (DDAB), n-octylamines, oleylamines, benzalkonium, cetyltrimethylammonium, chitosan, chitosan salts, poly(ethylenimine) (PEI), poly(N-isopropyl acrylamide (PNIPAM), and poly(allylamine) (PAH), poly (dimethyldiallylammonium chloride) (PDDA), alkyl sulfonates, alkyl phosphates, alkyl phosphonates, potassium laurate, triethanolamine stearate, sodium lauryl sulfate, sodium dodecylsulfate, alkyl polyoxyethylene sulfates, alginic acid, alginic acid salts, hyaluronic acid, hyaluronic acid salts, gelatins, dioctyl sodium sulfosuccinate, sodium carboxymethylcellulose, cellulose sulfate, dextran sulfate and carboxymethylcellulose, chondroitin sulfate, heparin, synthetic poly(acrylic acid) (PAA), poly (methacrylic acid) (PMA), poly(vinyl sulfate) (PVS), poly(styrene sulfonate) (PSS), esters and amides of poly(methacrylic acid) and poly(acrylic acid) (e.g., alkylmethacrylates—methyl, ethyl, propyl, butyl) bile acids and their salts, cholic acid, deoxycholic acid, glycocholic acid, taurocholic acid, glycodeoxycholic acid, a derivative thereof, or a combination thereof.
14. The copolymer of claim 12 or 13, wherein the polymer block comprises styrene.
15. The copolymer of claim 14, wherein the second monomer comprises HPMA and the polymer block comprises polystyrene.
16. The copolymer of any one of claims 1 to 15, wherein the chloroquine, hydroxychloroquine, or chloroquine analog is attached to the first monomer via a bond cleavable from the polymer block under physiological conditions.
17. The copolymer of claim 16, wherein the chloroquine, hydroxychloroquine, or chloroquine analog is attached to the first monomer via an amide bond, an ester bond, a 5-10 membered heterocycle, or a peptide bond.
18. The copolymer of any one of claims 1 to 17, wherein the chloroquine, hydroxychloroquine, or chloroquine analog is attached to the first monomer via a bond not cleavable from the polymer block under physiological conditions.
19. The copolymer of claim 18, wherein the chloroquine, hydroxychloroquine, or chloroquine analog is attached to the first monomer via a triazolyl ring.
20. The copolymer of any one of claims 1 to 17, wherein the chloroquine, hydroxychloroquine, or chloroquine analog is attached to the first monomer via a bond cleavable from the polymer block under physiological conditions.
21. The copolymer of claim 1 having a structure of: ##STR00038## each x is independently an integer of 1 to 200; each y is independently an integer of 0 to 500; each z is independently an integer of 1 to 500; each m is independently an integer of 1 to 500 and each n is independently an integer of 1 to 10,000.
22. The copolymer of any one of claims 1 to 21, further comprising a crosslinker.
23. The copolymer of claim 22, wherein the crosslinker is cleavable under physiological conditions.
24. The copolymer of claim 23, wherein the crosslinker is a reactive oxygen species—(ROS)—sensitive linker.
25. The copolymer of claim 24, wherein the crosslinker is an aromatic azo linker degradable by colonic azo-reductases.
26. The copolymer of claim 25, wherein the ROS-sensitive linker comprises a thioketal crosslinker, organochalcogen, arylboronic esters, thioether, vinyldithioether, aryl oxalate ester, or ferrocene.
27. The copolymer of any one of claims 21 to 24, wherein the crosslinker comprises ##STR00039##
28. A bead, microparticle or nanoparticle comprising a plurality of the copolymer of any one of claims 1 to 27.
29. The bead, microparticle or nanoparticle of claim 28, comprising a polymer of any one of claims 12 to 26.
30. The bead, microparticle or nanoparticle of claim 27 or 28, further comprising a therapeutic agent.
31. The bead, microparticle or nanoparticle of claim 30, wherein the therapeutic agent comprises an anti-inflammatory compound, an immune system suppressor, an antibiotic, or a combination thereof.
32. The bead, microparticle or nanoparticle of claim 31, wherein the anti-inflammatory compound comprises an aminosalicylate, a corticosteroid, cyclosporine, small interfering RNA (siRNA), or an antibody.
33. The bead, microparticle or nanoparticle of claim 32, wherein the antibody or siRNA is an anti-TNFα antibody or anti-TNFα siRNA.
34. The bead, microparticle or nanoparticle of any one of claims 28 to 33, further comprising a targeting ligand.
35. The bead, microparticle or nanoparticle of claim 34, wherein the targeting ligand comprises a lectin or mannose.
36. A method of treating inflammatory bowel disease (IBD) comprising administering to a patient in need thereof a therapeutically effective amount of the copolymer of any one of claims 1 to 27, or the bead, microparticle or nanoparticle of any one of claims 28 to 35.
37. The method of claim 36, wherein IBD comprises ulcerative colitis, Crohn's disease, irritable bowel syndrome, amebic colitis, acute self-limiting colitis, or colitis.
38. The method of claim 37, wherein IBD comprises colitis.
39. A method of treating colon cancer comprising administering to a patient in need thereof a therapeutically effective amount of the copolymer of any one of claims 1 to 27, or the bead, microparticle or nanoparticle of any one of claims 28 to 35.
40. The method of claim 39, wherein the administering comprises oral administration.
41. A method of making the copolymer of any one of claims 1 to 27, comprising: admixing a plurality of the first monomer and the second monomer under conditions to polymerize the first monomer and the second monomer to form the copolymer, optionally in the presence of a polymerization initiator, a chain transfer agent, or both.
42. A method of making the copolymer of any one of claims 1 to 27, comprising: admixing a plurality of a first monomer precursor and the second monomer under conditions to polymerize the first monomer precursor and the second monomer to form a copolymer precursor, optionally in the presence of a polymerization initiator, a chain transfer agent, or both; and reacting the copolymer precursor with chloroquine or a chloroquine analog to append the chloroquine or the chloroquine analog to the copolymer precursor to form the copolymer.
43. The method of claim 42, wherein the first monomer precursor comprises an alkyne moiety, and the chloroquine or chloroquine analog comprises an azide moiety, and the reacting comprises formation of a triazolyl between the alkyne and the azide to append the chloroquine or the chloroquine analog.
44. The method of any one of claims 41 to 43, comprising admixing in the present of the polymerization initiator.
45. The method of claim 44, wherein the polymerization initiator comprises azobisisobutyronitrile (AIBN).
46. The method of any one of claims 41 to 45, comprising admixing in the presence of the chain transfer agent.
47. The method of claim 46, wherein the chain transfer agent comprises ##STR00040## or a mixture thereof.
48. The method of claim 47, wherein the chain transfer agent comprises ##STR00041## or a mixture thereof.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
DETAILED DESCRIPTION
[0023] The present disclosure provides compositions and methods for the treatment of diseases and disorders, such as inflammatory bowel disease (IBD) and related disorders. In particular, provided are chloroquine and hydroxychloroquine-based polymers which may be formed into beads, microparticles, and/or nanoparticles. The beads, microparticles and/or nanoparticles may also be used to package other drugs for the treatment of diseases or disorders, e.g., IBD.
[0024] The main challenge in the development of oral IBD therapies is the physiological changes in the course of the disease. (Keely et al., Nanomedicine: Nanotechnology, Biology and Medicine, 11 (2015) 1117-1132.) The GI environment is diverse and factors like residence time, changes in pH, enzymatic or microbial degradation play an important role in drug delivery. These factors vary significantly between IBD patients and healthy individuals. For example, colonic transit time ranges from 6 to 70 hours in IBD patients as compared to 4 to 6 hours in healthy individuals. (Yosida et al., Pharm. Res., 17 (2000) 160-167; Wilding et al., Pharm. Res., 8 (1991) 360-364.) Colon pH in IBD patients is significantly lower than in healthy colon. (Rasmussen et al., Digest. Dis. Sci., 38 (1993) 1989-1993; Evans et al., Gut, 48 (2001) 571.) The epithelial barrier represents one of the tightest barriers in the human body. (Nusrat et al., World J. Gastroenterol., 14 (2008) 401-407.) It consists of tight junction proteins, which selectively regulate the transport across the colonic epithelium. Inflammation alters the permeability of this barrier and consequently, the protective mechanisms significantly alter the physiology of the colonic epithelium, which in turn affects drug transport.
[0025] Due to the chronic nature of IBD, patients remain on various treatments for life and thus long-term effects of the therapy represent a significant concern. Various systemic therapies have been explored, but the systemic effects of long-term anti-inflammatory treatment remains a concern.
[0026] Many strategies have been explored for local oral drug delivery to the inflamed colon. Conventional delivery systems are designed to function well in healthy intestinal pH but may perform poorly in IBD. (Keely et al., Nanomedicine: Nanotechnology, Biology and Medicine, 11 (2015) 1117-1132; Aggarwal et al., Drug Deliv. Transl. Res., 4 (2014) 187-202.) Nanoparticles and microparticles have been researched with respect to their size as well as charge for accumulation in inflamed colon. Results have shown that passively targeted systems with particle size ranging from 100 to 300 nm and positive surface charge preferentially accumulate in the inflamed colon. (Lehr et al., J. Controlled Rel., 161 (2012) 235-246; Rubinstein et al., Mol. Pharm., 6 (2009) 1083-1091.) The specificity of these systems can be enhanced by incorporation of targeting ligands (e.g. lectins, mannose) that bind receptors overexpressed in the inflamed colon. (Merlin et al., Biomaterials, 34 (2013) 7471-7482; Merlin et al., Gastroenterol., 146 (2014) 1289-1300.e1219.)
[0027] Conjugating small molecule drugs to polymers has been explored as another delivery strategy to enhance colon retention. (Vicent et al., Nanomedicine, 5 (2010) 915-935.) Dexamethasone-poly(dimethylamino)ethyl methacrylate conjugates and dextran-budesonide conjugates have been reported as potential orally administered alternatives to free dexamethasone and budesonide that overcome systemic side effects and pH lability, respectively. (Dorkoosh et al., Int. J. Pharm., 365 (2009) 69-76; Brayden et al., J. Controlled Rel., 135 (2009) 35-43.)
[0028] Thus, provided herein are copolymers comprising chloroquine, hydroxychloroquine, or a chloroquine analog that can treat or prevent a disease or disorder associated with inflammation in a subject. These copolymers are useful in the treatment of a variety of diseases and disorders, including but not limited to, IBD and cancer. Particularly, they allow treatment to be targeted directly to the lower gastrointestinal tract, without the need for systemic therapy.
Copolymers of the Disclosure
[0029] Provided herein are copolymers comprising a plurality of a first monomer and a plurality of a second monomer, wherein chloroquine, hydroxychloroquine, or a chloroquine analog is appended to at least a portion of the plurality of the first monomer. In some cases, chloroquine, hydroxychloroquine, or a chloroquine analog is appended to each of the first monomer. In some cases, chloroquine, hydroxychloroquine, or a chloroquine analog is appended to a portion of the first monomer. In some cases, the copolymer comprises chloroquine. In some cases, the copolymer comprises hydroxychloroquine. In some cases, the copolymer comprises a chloroquine analog.
[0030] In some cases, the chloroquine analog is hydroxychloroquine, methacryloyl chloroquine, quinacrine, 8-hydroxyquinoline, primaquine, sontoquine, azidoquine, or methacryloyl triazole chloroquine. In some cases, the chloroquine analog is methacryloyl chloroquine.
[0031] In some cases, at least one of the first monomer and the second comprises an acrylate, an acrylamide, or an alkene. In some cases, the first monomer having chloroquine appended thereto comprises
##STR00001##
wherein m and n each are independently an integer from 0 to 10.
[0032] In some cases, the first monomer having chloroquine appended thereto comprises
##STR00002##
where m and n are each independently an integer from 0 to 10 (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10), and in some cases, m or n is 0, 1, or 2. In some cases, the first monomer having chloroquine appended thereto comprises
##STR00003##
In some cases, m is 0. In some cases, m is 1. In some cases, m is 2. In some cases, m is 3. In some cases, m is 4. In some cases, m is 5. In some cases, m is 6. In some cases, m is 7. In some cases, m is 8. In some cases, m is 9. In some cases, m is 10. In some cases, the first monomer having chloroquine appended thereto comprises
##STR00004##
In some cases, n is 0. In some cases, n is 1. In some cases, n is 2. In some cases, n is 3. In some cases, n is 4. In some cases, n is 5. In some cases, n is 6. In some cases, n is 7. In some cases, n is 8. In some cases, n is 9. In some cases, n is 10. In some cases, the first monomer having chloroquine appended thereto comprises
##STR00005##
[0033] In some cases, the second monomer comprises an acrylamide monomer. In some cases, the second monomer comprises N-(2-hydroxypropyl)methacrylamide (HPMA).
[0034] In some cases, the copolymer further comprises a polymer block. In some cases, the polymer block comprises poly(lactide-co-glycolide) (PLGA), polylactic acid (PLA), polycaprolactone (PCL), other polyesters, poly(propylene oxide), poly(1,2-butylene oxide), poly(n-butylene oxide), poly(tetrahydrofurane), and polystyrene; glyceryl esters, polyoxyethylene fatty alcohol ethers, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene fatty acid esters, sorbitan esters, glycerol monostearate, polyethylene glycols, polypropyleneglycols, cetyl alcohol, cetostearyl alcohol, stearyl alcohol, aryl alkyl polyether alcohols, polyoxyethylene-polyoxypropylene copolymers, poloxamines, cellulose, methylcellulose, hydroxylmethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, polysaccharides, starch and their derivatives, hydroxyethylstarch, polyvinyl alcohol (PVA), polyvinylpyrrolidone phospholipids, amphiphilic lipids, 1,2-dialkylglycero-3-alkylphophocholines, 1,2-distearoyl-sn-glecro-3-phosphocholine (DSPC), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[carboxy(polyethylene glycol) (DSPE-PEG), dimethylaminoethanecarbamoyl cheolesterol (DC-Chol), N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium (DOTAP), alkyl pyridinium halides, quaternary ammonium compounds, lauryldimethylbenzylammonium, acyl carnitine hydrochlorides, dimethyldioctadecylammonium (DDAB), n-octylamines, oleylamines, benzalkonium, cetyltrimethylammonium, chitosan, chitosan salts, poly(ethylenimine) (PEI), poly(N-isopropyl acrylamide (PNIPAM), and poly(allylamine) (PAH), poly (dimethyldiallylammonium chloride) (PDDA), alkyl sulfonates, alkyl phosphates, alkyl phosphonates, potassium laurate, triethanolamine stearate, sodium lauryl sulfate, sodium dodecylsulfate, alkyl polyoxyethylene sulfates, alginic acid, alginic acid salts, hyaluronic acid, hyaluronic acid salts, gelatins, dioctyl sodium sulfosuccinate, sodium carboxymethylcellulose, cellulose sulfate, dextran sulfate and carboxymethylcellulose, chondroitin sulfate, heparin, synthetic poly(acrylic acid) (PAA), poly (methacrylic acid) (PMA), poly(vinyl sulfate) (PVS), poly(styrene sulfonate) (PSS), esters and amides of poly(methacrylic acid) and poly(acrylic acid) (e.g., alkylmethacrylates—methyl, ethyl, propyl, butyl) bile acids and their salts, cholic acid, deoxycholic acid, glycocholic acid, taurocholic acid, glycodeoxycholic acid, a derivative thereof, or a combination thereof. In some cases, the polymer block comprises styrene.
[0035] In some cases, the second monomer comprises HPMA and the polymer block comprises polystyrene.
[0036] In some cases, the chloroquine, hydroxychloroquine, or chloroquine analog is attached to the first monomer via a bond cleavable from the co-polymer under physiological conditions. Some examples of bonds cleavable under physiological conditions include disulfide, ester, ether, amide, imine, acetal, thioketal, orthothioester, and orthoester bonds.
[0037] In some cases, the chloroquine, hydroxychloroquine, or chloroquine analog is attached to the first monomer via an amide bond, an ester bond, a 5-10 membered heterocycle, or a peptide bond. In some cases, the chloroquine, hydroxychloroquine, or chloroquine analog is attached to the first monomer via an amide bond. In some cases, the chloroquine, hydroxychloroquine, or chloroquine analog is attached to the first monomer via an ester bond. In some cases, the chloroquine, hydroxychloroquine, or chloroquine analog is attached to the first monomer via a 5-10 membered heterocycle. In some cases, the chloroquine, hydroxychloroquine, or chloroquine analog is attached to the first monomer via a 5-membered heterocycle. In some cases, the chloroquine, hydroxychloroquine, or chloroquine analog is attached to the first monomer via a triazolyl ring (e.g., the result of a “click” chemistry coupling of an alkyne and an azide).
[0038] In some cases, the chloroquine, hydroxychloroquine, or chloroquine analog is attached to the first monomer via a bond not cleavable under physiological conditions. In some cases, the choroquine, hydroxychloroquine, or chloroquine analog is attached to the first monomer via a triazolyl ring.
[0039] Some specifically contemplated copolymers described herein have the structure of:
##STR00006##
wherein each x is independently an integer of 1 to 200, each y is independently an integer of 0 to 500, each z is independently an integer of 1 to 500, each m is independently an integer of 1 to 500, and each n is independently an integer of 1 to 10,000.
[0040] In some cases, the copolymer has the structure of
##STR00007##
In some cases, the copolymer has the structure of
##STR00008##
In some cases, the copolymer has the structure of
##STR00009##
In some cases, the copolymer has the structure of
##STR00010##
In some cases, the copolymer has the structure of
##STR00011##
[0041] In some cases, the copolymers disclosed herein comprise a crosslinker. In some cases, the crosslinker is cleavable under physiological conditions. In some cases, the crosslinker is a reactive oxygen species—(ROS)—sensitive linker. In some cases, the ROS-sensitive linker comprises a thioketal crosslinker, organochalcogen, arylboronic esters, thioether, vinyldithioether, aryl oxalate ester, or ferrocene. In some cases, the crosslinker is enzymatically-degradable. In some cases, the crosslinker is an aromatic azo linker degradable by colonic azo-reductases. In some cases, the crosslinker comprises
##STR00012##
[0042] In some cases, the disclosed co-polymers are further conjugated to a polymer block. In some cases, the copolymers are attached to copolymers of N-(2-hydroxypropyl)methacrylamide (HPMA). In various embodiments, the copolymers are attached to copolymers of hydroxypropyl methacrylate. In some embodiments, the co-polymers are attached to copolymers of 2-(dimethlamino)ethyl methacrylate.
[0043] Non-limiting examples of chloroquine, hydroxychloroquine, or chloroquine analogs include chloroquine, hydroxychloroquine, methacryloyl chloroquine, quinacrine, 8-hydroxyquinoline, primaquine, sontoquine, and azidochloroquine, and methacryloyl triazole chloroquine. In some cases, the chloroquine, hydroxychloroquine, or chloroquine analog is cleavable from the copolymer. In some cases, the chloroquine, hydroxychloroquine, or chloroquine analog is not cleavable from the copolymer.
[0044] In various embodiments the co-polymer (e.g., a chloroquine-HPMA co-polymer) can be combined with another polymer block as shown in Scheme 1a.
##STR00013## ##STR00014##
[0045] Non-limiting examples of suitable polymers which can comprise the polymer block are poly(lactide-co-glycolide) (PLGA), polylactic acid (PLA), polycaprolactone (PCL), other polyesters, poly(propylene oxide), poly(1,2-butylene oxide), poly(n-butylene oxide), poly(tetrahydrofurane), and polystyrene; glyceryl esters, polyoxyethylene fatty alcohol ethers, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene fatty acid esters, sorbitan esters, glycerol monostearate, polyethylene glycols, polypropyleneglycols, cetyl alcohol, cetostearyl alcohol, stearyl alcohol, aryl alkyl polyether alcohols, polyoxyethylene-polyoxypropylene copolymers, poloxamines, cellulose, methylcellulose, hydroxylmethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, polysaccharides, starch and their derivatives, hydroxyethylstarch, polyvinyl alcohol (PVA), polyvinylpyrrolidone phospholipids, amphiphilic lipids, 1,2-dialkylglycero-3-alkylphophocholines, 1,2-distearoyl-sn-glecro-3-phosphocholine (DSPC), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[carboxy(polyethylene glycol) (DSPE-PEG), dimethylaminoethanecarbamoyl cheolesterol (DC-Chol), N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium (DOTAP), alkyl pyridinium halides, quaternary ammonium compounds, lauryldimethylbenzylammonium, acyl carnitine hydrochlorides, dimethyldioctadecylammonium (DDAB), n-octylamines, oleylamines, benzalkonium, cetyltrimethylammonium, chitosan, chitosan salts, poly(ethylenimine) (PEI), poly(N-isopropyl acrylamide (PNIPAM), and poly(allylamine) (PAH), poly (dimethyldiallylammonium chloride) (PDDA), alkyl sulfonates, alkyl phosphates, alkyl phosphonates, potassium laurate, triethanolamine stearate, sodium lauryl sulfate, sodium dodecylsulfate, alkyl polyoxyethylene sulfates, alginic acid, alginic acid salts, hyaluronic acid, hyaluronic acid salts, gelatins, dioctyl sodium sulfosuccinate, sodium carboxymethylcellulose, cellulose sulfate, dextran sulfate and carboxymethylcellulose, chondroitin sulfate, heparin, synthetic poly(acrylic acid) (PAA), poly (methacrylic acid) (PMA), poly(vinyl sulfate) (PVS), poly(styrene sulfonate) (PSS), esters and amides of poly(methacrylic acid) and poly(acrylic acid) (e.g., alkylmethacrylates—methyl, ethyl, propyl, butyl) bile acids and their salts, cholic acid, deoxycholic acid, glycocholic acid, taurocholic acid, glycodeoxycholic acid, derivatives thereof, and combinations thereof. In one embodiment the additional polymer blocks comprise polystyrene.
Beads, Microparticles, and Nanoparticles of the Disclosure
[0046] Also provided are beads, microparticles and nanoparticles comprising a plurality of the copolymers described herein. In some cases, the bead, microparticle or nanoparticle comprises a copolymer further having a polymer block. In some cases, the bead, microparticle or nanoparticle comprises a polymer block comprising poly(lactide-co-glycolide) (PLGA), polylactic acid (PLA), polycaprolactone (PCL), other polyesters, poly(propylene oxide), poly(1,2-butylene oxide), poly(n-butylene oxide), poly(tetrahydrofurane), and polystyrene; glyceryl esters, polyoxyethylene fatty alcohol ethers, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene fatty acid esters, sorbitan esters, glycerol monostearate, polyethylene glycols, polypropyleneglycols, cetyl alcohol, cetostearyl alcohol, stearyl alcohol, aryl alkyl polyether alcohols, polyoxyethylene-polyoxypropylene copolymers, poloxamines, cellulose, methylcellulose, hydroxylmethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, polysaccharides, starch and their derivatives, hydroxyethylstarch, polyvinyl alcohol (PVA), polyvinylpyrrolidone phospholipids, amphiphilic lipids, 1,2-dialkylglycero-3-alkylphophocholines, 1,2-distearoyl-sn-glecro-3-phosphocholine (DSPC), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[carboxy(polyethylene glycol) (DSPE-PEG), dimethylaminoethanecarbamoyl cheolesterol (DC-Chol), N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium (DOTAP), alkyl pyridinium halides, quaternary ammonium compounds, lauryldimethylbenzylammonium, acyl carnitine hydrochlorides, dimethyldioctadecylammonium (DDAB), n-octylamines, oleylamines, benzalkonium, cetyltrimethylammonium, chitosan, chitosan salts, poly(ethylenimine) (PEI), poly(N-isopropyl acrylamide (PNIPAM), and poly(allylamine) (PAH), poly (dimethyldiallylammonium chloride) (PDDA), alkyl sulfonates, alkyl phosphates, alkyl phosphonates, potassium laurate, triethanolamine stearate, sodium lauryl sulfate, sodium dodecylsulfate, alkyl polyoxyethylene sulfates, alginic acid, alginic acid salts, hyaluronic acid, hyaluronic acid salts, gelatins, dioctyl sodium sulfosuccinate, sodium carboxymethylcellulose, cellulose sulfate, dextran sulfate and carboxymethylcellulose, chondroitin sulfate, heparin, synthetic poly(acrylic acid) (PAA), poly (methacrylic acid) (PMA), poly(vinyl sulfate) (PVS), poly(styrene sulfonate) (PSS), esters and amides of poly(methacrylic acid) and poly(acrylic acid) (e.g., alkylmethacrylates—methyl, ethyl, propyl, butyl) bile acids and their salts, cholic acid, deoxycholic acid, glycocholic acid, taurocholic acid, glycodeoxycholic acid, a derivative thereof, or a combination thereof.
[0047] In some cases, the bead, microparticle or nanoparticle further comprises a therapeutic agent. In some cases, the therapeutic agent comprises an anti-inflammatory compound, an immune system suppressor, an antibiotic, or a combination thereof. In some cases, the anti-inflammatory compound comprises an aminosalicylate, a corticosteroid, cyclosporine, small interfering RNA (siRNA), or an antibody. In some cases, the antibody or siRNA is an anti-TNFα antibody or anti-TNFα siRNA.
[0048] In some cases, the bead, microparticle, or nanoparticle further comprises a targeting ligand. In some cases, the targeting ligand comprises a lectin or mannose. In some cases, the targeting ligand comprises a lectin. In some cases, the targeting ligand comprises mannose.
[0049] In some embodiments, the co-polymers disclosed herein are formed into beads, microparticles, and/or nanoparticles by incorporating additional polymer blocks into the co-polymer to aid in bead, microparticle, and/or nanoparticle formation (e.g. polystyrene blocks). In some cases, the co-polymers with or without additional polymer blocks (e.g. polystyrene blocks) are linked together using a linker group. In some embodiments, the linker group is biologically cleavable linker group. In some embodiments, the linker group is a reactive oxygen species (ROS) sensitive linker group. Nonlimiting examples of ROS sensitive linkers include but are not limited to thioketal cross-linkers, organochalcogen (C—Se, Se—Se or C—Te, Te—Te), arylboronic esters, thioether, vinyldithioether, aryl oxalate ester, and ferrocene. In some embodiments, the ROS sensitive linker group is a thioketal cross-linker. Without wishing to be bound by theory, the linker group allows for the individual polymer strands to be aggregated together to form a bead, microparticle, and/or nanoparticle. In some cases, the linker can be cleaved to release the individual particle strands upon delivery to the area of inflammation within the body (e.g. intestine). In some cases, the beads, microparticles, and/or nanoparticles are modified with various targeting moieties including but not limited to antibodies, proteins, peptides, and small molecules to target the compositions to specific areas of disease. In some cases, beads, microparticles, and nanoparticles described herein can be encapsulated or coated (e.g., by spray-drying) with various enteric coatings (e.g., Eudragit) to protect them from degradation in vivo (e.g., in the stomach).
[0050] In embodiments, beads, microparticles, and/or nanoparticles can be used to deliver additional therapeutics to help treat diseases or disorders, e.g., IBD. In some cases, beads, microparticles, and/or nanoparticles described herein can be used to encapsulate/deliver additional therapeutics including but not limited to anti-inflammatory compounds, immune system suppressors, antibiotics, and combinations thereof. In some cases, the anti-inflammatory compounds include but are not limited to corticosteroids and aminosalicylates (ex. Mesalamine, balsalazide, and olsalazine). In some cases, the immune system suppressors include but are not limited to azathioprine, mercaptopurine, cyclosporine, methotrexate, infliximab, adalimumab, golimumab, natalizumab, vedolizumab, and ustekinumab. In some cases, the antibiotics include but are not limited to ciprofloxacin and metronidazole. In some cases, the additional therapeutic or therapeutics can be co-administered with co-polymers as disclosed herein that are not formed into micro and/or nanoparticles. In some cases, the additional therapeutic or therapeutics can be administered separately from co-polymers as disclosed herein that are not formed into micro and/or nanoparticles. In some cases, the additional therapeutic or therapeutics can be co-administered with co-polymers as disclosed herein that are formed into beads, microparticles, and/or nanoparticles. In some cases, the additional therapeutic or therapeutics can be administered separately from co-polymers as disclosed herein that are formed into beads, microparticles, and/or nanoparticles.
Synthesis of Chloroquine Copolymers of the Disclosure
[0051] The copolymers disclosed herein can be prepared in a variety of ways using commercially available starting materials, intermediates as reported in the literature, or from readily prepared intermediates, by employing standard synthetic methods and procedures either known to those skilled in the art, or in light of the teachings herein. Standard synthetic methods and procedures for the preparation of organic molecules and functional group transformations and manipulations can be obtained from the relevant scientific literature or from standard textbooks in the field. Although not limited to any one or several sources, classic texts such as Smith, M. B., March, J., March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, 5.sup.th edition, John Wiley & Sons: New York, 2001; and Greene, T.W., Wuts, P.G.M., Protective Groups in Organic Synthesis, 3.sup.rd edition, John Wiley & Sons: New York, 1999, are useful and recognized reference textbooks of organic synthesis known to those in the art. The following descriptions of synthetic methods are designed to illustrate, but not to limit, general procedures for the preparation of compounds and copolymers of the present disclosure.
[0052] The synthetic processes disclosed herein can tolerate a wide variety of functional groups; therefore, various substituted starting materials can be used. The processes generally provide the desired final compound at or near the end of the overall process, although it may be desirable in certain instances to further convert the compound to a pharmaceutically acceptable salt, ester or prodrug thereof.
[0053] Disclosed herein are methods of making copolymers described herein. In some cases, the method comprises admixing a plurality of a first monomer and a second monomer under conditions to polymerize the first monomer and the second monomer to form the copolymer, optionally in the presence of a polymerization initiator, a chain transfer agent, or both. In some cases, the method comprises admixing in the presence of a polymerization initiator. In some cases, the method comprises admixing in the presence of a chain transfer agent. In some cases, the method comprises admixing in the presence of both a polymerization initiator and a chain transfer reagent. In some cases, the polymerization initiator comprises azobisisobutyronitrile (AIBN). In some cases, the chain transfer agent comprises
##STR00015##
or a mixture thereof. In some cases, the chain transfer agent comprises
##STR00016##
or a mixture thereof. In some cases, the chain transfer agent comprises
##STR00017##
In some cases, the chain transfer agent comprises
##STR00018##
In some cases, the chain transfer agent comprises
##STR00019##
In some cases, the chain transfer agent comprises
##STR00020##
In some cases, the chain transfer agent comprises
##STR00021##
In some cases, the chain transfer agent comprises
##STR00022##
In some cases, the chain transfer agent comprises a mixture of (4-cyano-4-(phenyl-carbonothioylthio)pentanoic acid), (4-cyano-4-[(ethylsulfanylthiocarbonyl)sulfanyl]pentanoic acid), (4-cyano-4-[(dodecyl sulfanylthiocarbonyl)sulfanyl]pentanoic acid), and/or (2-cyano-2-propyl dodecyl trithiocarbonate).
[0054] In some cases, the method comprises admixing a plurality of a first monomer precursor and the second monomer under conditions to polymerize the first monomer precursor and the second monomer to form a copolymer precursor, optionally in the presence of a polymerization initiator, a chain transfer agent, or both; and reacting the copolymer precursor with chloroquine or a chloroquine analog to append the chloroquine or the chloroquine analog to the copolymer precursor to form the copolymer. In some cases, the first monomer precursor comprises an alkyne moiety, and the chloroquine or chloroquine analog comprises an azide moiety (or vice versa), and the reacting comprises formation of a triazolyl between the alkyne and the azide to append the chloroquine or the chloroquine analog.
[0055] In general, copolymers as described herein can be synthesized according to Scheme 1.
##STR00023##
[0056] Copolymers having structure D can be synthesized using the procedure shown in Scheme 1. Copolymerization of monomers A and B under appropriate reaction conditions a form a copolymer (structure C) having a number of repeats q. For example, if A and B are both ethylene derivatives, the polymerization can be carried out under RAFT (reversible addition-fragmentation chain transfer) conditions, e.g., use of a chain transfer agent (CTA) and a radical initiator such as AIBN in a solvent or mixture of solvents (e.g., methanol, 1,4-dioxane, and/or DMSO) at elevated temperature (e.g., at 70° C.). Copolymer C can then be reacted with chloroquine or a chloroquine analog CQ* under appropriate reaction conditions b to yield a chloroquine-containing copolymer D. The conditions for the chloroquine derivatization can be selected based on the nature of monomers A and B. For example, in Scheme 1 above, monomers A and B are shown bearing side chains R.sub.1 and R.sub.2, respectively. These side chains R.sub.1 and R.sub.2 can be selected to react with CQ* to yield a chloroquine-containing copolymer D. For example, one of R.sub.1 and R.sub.2 can comprise an azide moiety, and CQ* can comprise an alkyne moiety which can undergo a “click” reaction to modify the copolymer C with chloroquine, yielding a modified copolymer D. Alternatively, one of R.sub.1 and R.sub.2 can be an alkyne moiety, and CQ* can comprise an azide moiety.
##STR00024##
[0057] Copolymers having structure D can be also synthesized using the procedure shown in Scheme 2. Copolymerization of monomers A and B under appropriate reaction conditions forms a copolymer (structure D) having a number of repeats q. For example, if A and B are both ethylene derivatives, the polymerization can be carried out under RAFT (reversible addition-fragmentation chain transfer) conditions, e.g., use of a chain transfer agent (CTA) and a radical initiator such as AIBN in a solvent or mixture of solvents (e.g., methanol, 1,4-dioxane, and/or DMSO) at elevated temperature (e.g., at 70° C.). In Scheme 2 above, monomer A is derivatized with chloroquine before the polymerization reaction, in order to yield a chloroquine-containing copolymer D upon reaction with monomer B. Monomer B can comprise a radical R.sub.2′ which allows for optional further derivatization of the copolymer.
[0058] Additional synthetic procedures for preparing the compounds disclosed herein can be found in the Examples section.
Methods of Use
[0059] The copolymers disclosed herein can be used in many different therapeutic applications, such as treatment of IBD or cancer. The co-polymers can be administered directly to a patient in need. The co-polymers may also be formed into beads, microparticles and/or nanoparticles before being administered to a patient. In some cases, the administering comprises oral administration.
[0060] Disclosed herein are methods of treating inflammatory bowel disease (IBD) comprising administering to a patient in need thereof a therapeutically effective amount of a copolymer described herein, or a bead, microparticle, or nanoparticle described herein. In some cases, IBD comprises ulcerative colitis, Crohn's disease, irritable bowel syndrome, amebic colitis, acute self-limiting colitis, or colitis. In some cases, IBD comprises Crohn's disease. In some cases, IBD comprises irritable bowel syndrome. In some cases, IBD comprises ulcerative colitis, amebic colitis, acute self-limiting colitis, or colitis. In some cases, IBD comprises ulcerative colitis. In some cases, IBD comprises amebic colitis. In some cases, IBD comprises acute self-limiting colitis. In some cases, IBD comprises colitis.
[0061] Also disclosed herein are methods of treating cancer comprising administering to a patient in need thereof a therapeutically effective amount of a copolymer described herein, or a bead, microparticle, or nanoparticle described herein. In some cases, the patient suffers from colon cancer. In some cases, the methods of treating cancer comprise administering an anti-cancer agents in addition to the co-polymers, beads, microparticles, and nanoparticles of the present disclosure. In some cases, co-polymers, beads, microparticles, and nanoparticles of the present disclosure can be administered with an anti-cancer agent. In some cases, the anti-cancer agent comprises small molecules, biologics (peptides, DNA, RNA, proteins, antibodies, and antibody fragments), and combinations thereof. In some cases, the anti-cancer agent is loaded or encapsulated within the co-polymers and/or beads, microparticles, and nanoparticles of the present disclosure.
[0062] The co-polymers and beads, microparticles, and nanoparticles of the present disclosure may be administered by any suitable method. In some cases, the beads, microparticles, and nanoparticles are administered orally, intravenously, rectally, subcutaneously, or intramuscularly. In some cases, the route of administration is orally or rectally. The co-polymers and beads, microparticles, and nanoparticles of the present disclosure can be designed so that they may be delivered orally, and due to their size (molecular weight), the co-polymers will not be taken up systemically to any large extend and are primarily localized within the gastrointestinal tract.
EXAMPLES
[0063] The following examples are provided for illustration and are not intended to limit the scope of the disclosure.
Synthetic Procedures for Copolymers
[0064] General Experimental Procedures. All reagents and solvents were obtained from commercial sources and used without additional purification.
Example 1—Synthesis of Chloroquine Copolymers
[0065] ##STR00025##
Synthesis of N-propargyl Methacrylamide (PPMA)
[0066] Methacrylic acid (20 mmol, 1721 mg, 1687 μL) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC-HCl, 30 mmol, 5751 mg) were dissolved in anhydrous chloroform (60 mL) and stirred at room temperature for 30 min. The mixture was cooled down in ice bath followed by addition of propargyl amine (13.33 mmol, 734 mg, 854 μL) dissolved in chloroform (15 mL). After stirring overnight, the resulting product was concentrated and purified by column chromatography with dichloromethane:methanol=10:1 as eluent.
##STR00026##
Synthesis of CQ-N.SUB.3
[0067] HCQ (360 mg, 1.07 mmol) and diphenylphosphoryl azide (338.5 mg, 1.23 mmol, 265 μL) were dissolved in dimethylformamide under argon. Then 1,8-Diazabicyclo(5.4.0)undec-7-ene (DBU, 190 mg, 1.23 mmol, 186 μL) was added and stirred for 48 h. The resulting product was diluted by dichloromethane (50 mL) and washed by deionized water (50 mL) twice and brine (50 mL). The organic phase was dried through sodium sulfate and evaporated by rotavap. The final product was purified by column chromatography with dichloromethane:methanol=10:1 as eluent.
##STR00027##
Synthesis of MA-tCQ
[0068] CQ-N.sub.3 (343 mg, 0.95 mmol) and PPMA (185 mg, 1.5 mmol) were dissolved in DMF (2.5 mL). CuSO.sub.4 (8 mg, 0.05 mmol) was dissolved in deionized water (0.4 mL) and added into the DMF solution. After the reaction mixture was degassed for 30 min, sodium ascorbate (40 mg, 0.2 mmol) dissolved in deionized water (0.4 mL) was added to the above reaction mixture under N.sub.2. The reaction was taken at 40° C. for 2 h and at room temperature overnight with stirring. The resulting mixture was diluted by DCM (50 mL) and washed by EDTA aqueous solution (50 mM, 50 mL) twice, water (50 mL) and brine (50 mL). The organic phase was dried through sodium sulfate and evaporated by rotavap. The final product was purified by column chromatography with dichloromethane:methanol=10:1 as eluent.
##STR00028##
Synthesis of NpCQ
[0069] Polymers with different CQ content were obtained by changing the monomer ratio of MA-tCQ to HPMA in the reagents, which was similar to the preparation of pCQ. Typically, MA-tCQ (70 mg, 0.15 mmol), HPMA (103 mg, 0.72 mmol), CTA and AIBN were dissolved in methanol:1,4-dioxane=1:1 (1 mL) and purged by nitrogen for 30 min. After stirred at 70° C. overnight, the polymer was precipitated out by adding the mixture to cold diethyl ether under vigorous stirring. The precipitates were collected and re-dissolved in methanol. The precipitation step was repeated twice and the polymers were dialyzed against water (MWCO: 3,500) for 2 days. The NpCQ polymers were obtained by lyophilization.
Example 2—Synthesis of Clickable HPMA-Containing Polymers
[0070] Investigation of chain transfer agent for polymerization of Poly(HPMA-co-PPMA) (pHP)
##STR00029##
Chain-Transfer Agent Synthesis of pHP
[0071] Reversible addition-fragmentation chain transfer (RAFT) polymerization was applied to synthesis of clickable HPMA and PPMA copolymers. Due to different monomer compatibility of RAFT agents, four CTAs were tested in the polymerization of pHP with PPMA content as 20% (mol %). One dithiobenzoate and three trithiocarbonates CTAs were chosen due to their reported compatibility to methacrylamides. The molar ratio of HPMA/PPMA/CTA/initiator was fixed at 80/20/1/0.25. HPMA, PPMA, AIBN and the CTAs were dissolved in 1,4-dioxane/DMSO (1/1, v/v, 100 mg/mL) and transferred to prescored ampoules. The ampoules were flame sealed after purged by nitrogen for 30 min. The polymerization was conducted at 70° C. for 16 h. The polymers were precipitated in cold diethyl ether for three times and dried under vacuum. The composition of each polymer was analyzed by .sup.1H NMR. The molecular weight of the polymers were tested by GPC as water soluble cationic polymers. Characterization data of pPPMA polymer prepared with different chain transfer agents is presented in Table 1, below.
TABLE-US-00001 TABLE 1 PPMA in [HPMA].sub.0/ feed/ [PPMA].sub.0/ M.sub.th M.sub.W in polymer CTA [CTA].sub.0/[I].sub.0 (kDa) (kDa) PDI (mol %)
Synthesis of pHP Copolymer
[0072] The pHP copolymer was prepared using 2-cyano-2-propyl dodecyl trithiocarbonate as CTA agent and AIBN as initiator. The copolymers were synthesized with arrange of molecular weights 7-56 kDa and different PPMA contents (Table 2). The procedure was the same as described above.
TABLE-US-00002 TABLE 2 PPMA in feed/ [HPMA].sub.0/[PPMA].sub.0/ M.sub.th M.sub.w in polymer Sample [CTA].sub.0/[I].sub.0 (kDa) (kDa) PDI (mol %) pHP0 100/0/1/0.25 14.3 14.8 1.1 0/0.sup. pHP5 95/5/1/0.25 14.2 16.7 1.2 5/4.3 pHP10 90/10/1/0.25 14.1 14.3 1.2 10/9.9 pHP20 80/20/1/0.25 13.9 13.6 1.2 20/19.7 pHP40 60/40/1/0.25 13.5 11.3 1.4 40/24.4 pHP20L 80/20/2/0.5 7.0 7.8 1.2 20/16.5 pHP20M 80/20/0.5/0.125 27.8 23.8 1.4 20/19.5 pHP20H 80/20/0.25/0.0625 55.6 38.1 1.4 20/20.6
Click CQ-N3 to pHP
[0073] ##STR00034##
[0074] To conduct the click reaction, pHP, CQ-N3 (1.1 equiv. of alkyne amount in pHP) and CuSO.sub.4 (0.1 equiv. of CQ-N3) were dissolved in water containing 10% DMF under nitrogen in a Schlenk tube. The reaction mixture was purged with nitrogen for 30 min. NaAs (0.4 equiv. of CQ-N.sub.3) was added before the tube was submerged in 40° C. oil bath. The reaction mixture was stirred at 40° C. for 2 h and cooled down to room temperature overnight. The resulting product was washed by 50 mM EDTA aqueous solution twice and water once to remove the copper ion, followed by dialysis against water (MWCO: 3,500) for 3 days. The final product was obtained by lyophilization. The molecular weight was obtained by GPC and CQ content was calculated by .sup.1H NMR.
Synthesis of pHPte Polymers by RAFT Polymerization
[0075] ##STR00035##
[0076] A copolymer of alkyne-containing poly(2-hydroxypropyl methacrylate) was prepared as described above using 4-cyano-4-[(ethylsulfanylthiocarbonyl)sulfanyl]pentanoic acid as the CTA (Table 3, below).
TABLE-US-00003 TABLE 3 PPMA in feed/ [HPMAte].sub.0/[PPMA].sub.0/ M.sub.th M.sub.w in polymer Sample [CTA].sub.0/[I].sub.0 (kDa) (kDa) PDI (mol %) pHPte0 100/0/1/0.25 14.4 17.6 1.1 0/0 pHPte5 95/5/1/0.25 14.3 19.2 1.1 5.0/4.8 pHPte10 90/10/1/0.25 14.2 19.9 1.1 10.0/8.3 pHPte20 80/20/1/0.25 14.0 20.5 1.1 20.0/15.3 pHPte40 60/40/1/0.25 13.6 16.9 1.2 40.0/28.0 pHPte20L 80/20/2/0.5 7.2 9.0 1.1 20.0/16.7 pHPte20M 80/20/0.5/0.125 28.0 32.9 1.2 20.0/16.7 pHPte20H 80/20/0.25/0.0625 55.9 51.2 1.1 20.0/15.3
Biological Assay Data
Example 3—Rodent Model of Colitis
[0077] One of the major challenges in testing novel oral drug delivery systems in IBD is mimicking the GI environment in vitro, particularly because of the diversity in the pH as well as presence of various enzymes. Consequently, animal models form an indispensable part of the IBD research. One of the most commonly used animal models of colitis is a chemical injury model using dextran sodium sulfate (DSS). The mechanism by which DSS induces colitis is not entirely clear. However, it is postulated that the inflammation is likely due to the damage caused to the epithelial monolayer allowing dissemination of luminal colonic contents into the underlying tissue. The DSS model is reproducible and the severity of the colitis can be controlled by adjusting the dose and frequency of DSS administration. One of the main advantages of the DSS-induced colitis is its histological similarity to human colitis. However, recent reports have challenged the biorelevance of the DSS model from a pathological perspective. Unlike human IBD, the DSS model lacks a clearly defined involvement of enteric bacterial flora. Another concern with the DSS model is that following ingestion, DSS forms nanosized vesicles with fatty acids in the colon and is deposited onto the colonic epithelium, essentially forming a physical barrier which can interfere in the interaction between therapeutics and drug delivery systems and the intestinal tissue. Moreover, unlike human IBD, the DSS model does not verify a clearly defined involvement of enteric bacterial flora [40]. In addition, interference of DSS with RT-PCR is an established concern.
[0078] To overcome the limitations of the DSS-colitis model of murine colitis and also to account for the involvement for the microbial-induced inflammatory signaling, as in IBD, we used the murine model of infectious colitis, which is frequently used for modeling the IBD in mouse. Notably, the C. rodentium-murine-specific bacteria that is closely related to important human pathogen E. soli. It attaches to the apical side of the colon epithelium and invades the colon wall, thus eliciting an immune response. In addition to being well characterized for understanding host responses to enteric bacteria, it produces robust colitis characterized by elongation of crypts, immune cell infiltration, and goblet cell depletion. Unlike the DSS colitis, which requires continuous administration of the DSS, the C. rodentium model uses a single gavage of the bacteria, and thus reduces the stress on the mice and minimizes the likelihood of interference with the tested drug delivery systems.
[0079] Hydroxychloroquine (HCQ) sulfate (98%), triethylamine, DMSO-d.sub.6 (99.8%) and chloroform-d (99.8%) were obtained from Acros Organics (Fisher Scientific). Methanol, acetonitrile (HPLC grade) were purchased from Fisher Scientific. pHP-CQ (pCQ) with 16.7 mol % of CQ and weight average molecular weight 60 kDa was synthesized and characterized as described above.
[0080] Male C57BL/6 mice (6 weeks old, 18-20 g) were obtained from Charles River Laboratories and used for all in vivo studies. All animal experiments were conducted according to the protocol approved by the University of Nebraska Medical Center Institutional Animal Care and Use Committee. C. rodentium was used to induce colitis in mice. Bacterial glycerol stock was streaked onto LB agar plates and the bacterial colonies were grown overnight at 37° C. A single colony was inoculated into 5 ml of 2% LB broth and incubated at 37° C., 280 rpm overnight to obtain a saturated primary culture. On the day of the experiment (Day 0), 2 ml of the primary culture was added into 300 ml of LB broth and the inoculum was placed on a shaker at 37° C. at 280 rpm for 6 hours. Bacterial optical density was measured at 600 nm. Bacteria were diluted with LB broth and delivered to mice (n=15) via oral gavage in a 100 μL volume containing 5×108 colony forming units (CFU). Healthy control group (n=5) was orally administered 100 μL of LB broth.
Statistics
[0081] The Mann-Whitney test was used for statistical analysis of mean differences between treatment groups for biodistribution studies. One-way ANOVA followed by Tukey multiple comparison test was used for statistical analysis of mean differences among multiple groups. A value of p<0.05 was considered statistically significant. All statistical analysis was performed using Graphpad Prism v5 (ns=not significant, *=p≤0.05, **=p≤0.01, ***=p≤0.001).
Example 4—Cytokine Analysis
[0082] At least five mice were sacrificed at each time-point (day 1, 10 and 14 after oral gavage of the C. rodentium). The colons were excised, cleaned, and their weight and length recorded. The entire colon was frozen and stored at −80° C. The colon was homogenized in 1.5 ml RIPA buffer using TissueLyserII (Qiagen) and the homogenates centrifuged at 15,000×g for 15 min at 4° C. The supernatant was analyzed for cytokine levels using ProcartaPlex™ Multiplex Immunoassay (Invitrogen) following the manufacturer's protocol. Briefly, magnetic beads coated with different cytokine antibodies were added at the required dilution to 96-well plate. Supernatants from the tissue homogenates and supplied fluorescent standards were added to the respective wells. The cytokines were detected by adding a detection antibody followed by addition of Streptavidin-PE. The beads were read on Luminex™ LX 200 Analyzer. The data obtained were analyzed using ProcartaPlex™ Analyst software to obtain cytokine concentrations.
[0083] It was first verified that the C. rodentium model exhibited expected pathobiology similar to the human IBD. As expected, significant upregulation in the expression of pro-inflammatory cytokines was observed over 14 days after single oral dose of the bacteria (
Example 5—Pharmacokinetics and Biodistribution
[0084] The pharmacokinetics and biodistribution of single dose pCQ was evaluated in a mouse model of IBD. Colitis was induced as described above and on day 14, mice were given a single dose of HCQ or pCQ in 200 μl of deionized water via oral gavage equivalent to 30 mg/kg HCQ. Blood was collected from the submandibular vein at 0.5, 1, 2, 4, 8, and 24 h post-administration. The animals were sacrificed, and organs harvested at 0.5, 2, 8, and 24 h post-administration and stored at −80° C. until further use. The mice were randomized to selected sampling times so that three blood samples and one terminal tissue collection were obtained from each.
[0085] Blood, tissue and fecal samples were processed by two methods to determine free HCQ and total HCQ. For the first method, HCQ was isolated by a simple extraction from the organs as described in Murry et al., J. Chrom. B., (2018) 1072, 320-327. The second method utilized base hydrolysis to release HCQ covalently bound to pCQ and subsequent HCQ extraction using solid phase extraction (SPE). Tissues and feces were homogenized in water prior to loading to the SPE cartridge. The calibration and quality control samples were separately prepared for HCQ and pCQ by spiking 10 μl of appropriate calibration stock of HCQ and pCQ, in 100 μl of blank biomatrix, and 10 μl of internal standard solution (1.0 μg/ml) added. For the study, 25 μl of blood and 100 μl of tissue homogenate were used. 400 μl of 1 M NaOH, 600 μl water and 100 μl methanol were added and the samples were incubated at 50° C. for 1 h to hydrolyze HCQ from the pCQ. Subsequently, 400 μ12% formic acid was added and the samples were vortexed for 30 s and centrifuged at 1301×g for 10 min. The SPE was carried out using Oasis HLB 3cc, 60 mg extraction Cartridge (Waters, Inc). Cartridges were pre-conditioned with 1 ml acetonitrile followed by 1 ml water. Samples were loaded to the cartridges and washed with 2 ml of aqueous 15% methanol and dried at high vacuum for 15 min. Analytes were eluted with 2 ml of acetonitrile. The eluents were collected in glass tubes and dried under nitrogen in water bath at 50° C. The dry residues were reconstituted in 400 μ1 0.1% formic acid:methanol mixture (60:40) and centrifuged at 13000×g and 10 μl supernatant was injected into the HPLC. The LC-MS/MS conditions were as previously described. (Murry et al., J. Chrom. B., (2018) 1072, 320-327.) The assay was linear over the range of 1 to 2000 ng/mL.
[0086] The pharmacokinetic parameters of HCQ and pCQ in blood and tissues were calculated using non-compartmental analysis with Phoenix WinNonlin 6.3 (Pharsight Corporation). The maximum concentration (C.sub.max) and time to C.sub.max (T.sub.max) were obtained from the visual inspection of the concentration-time plot. The area under the curve (AUC.sub.0-∞) was estimated using the linear trapezoidal method from 0-t.sub.last and extrapolation from t.sub.last to infinity based on the observed concentration at the last time point divided by the terminal elimination rate constant (λ). The elimination half-life (t.sub.1/2) was calculated as 0.693/k. Apparent clearance (CI/F) and the apparent volume of distribution of the elimination phase (V.sub.d/F) were calculated as dose/AUC.sub.0-∞ and dose/k*AUC.sub.0-∞, respectively. The mean residence time (MRT) was calculated as AUMC.sub.0-∞/AUC.sub.0-∞. Mean tissue concentrations were calculated and expressed as ng/g tissue. The absolute bioavailability was calculated as:
where AUC.sub.po and AUC.sub.iv are the areas under the curve after oral (po) and i.v. administration and D.sub.iv and D.sub.po are the corresponding doses.
[0087] The pCQ contains HCQ attached by a potentially hydrolyzable ester linker and it was thus important to distinguish between polymer-conjugated HCQ and free HCQ released from pCQ. This was achieved by using two LC-MS/MS analytical methods. First, HCQ was quantified using a simple extraction from blood and tissues to determine the amount of HCQ that was released from pCQ by hydrolysis in the GI tract, blood, or liver. In the second method, an alkaline hydrolysis step was included that was optimized to fully hydrolyze the ester linker between HCQ and the polymer, thus providing information on the total (polymer bound+hydrolyzed) HCQ. The difference in the HCQ amount obtained from the two methods was used to calculate the percent of HCQ in the tissues that remained bound to the polymer. The HCQ amount quantified by both methods was similar in blood and tissues from animals treated with HCQ.
[0088] The blood concentration vs. time profile for the HCQ and pCQ after oral administration is shown in
TABLE-US-00004 TABLE 4 Pharmacokinetic parameter HCQ pCQ C.sub.max (ng/ml) 2,343 ± 46 12.2 ± 1.7 t.sub.1/2 (h) 5.6 ± 1.9 11.7 ± 3.6 t.sub.max (h) 3.3 ± 1.2 4.7 ± 3.1 AUC.sub.0-last (h × ng/ml) 26,446 ± 507 161 ± 8 AUC.sub.0-∞ (h × ng/ml) 28,182 ± 1476.sup. 231 ± 49 Cl/F (L/h/kg) 1.1 ± 0.1 134 ± 27 MRT (h) 6.8 ± 0.6 9.9 ± 0.7
[0089] The blood concentration vs. time profile for the HCQ and pCQ after oral administration is shown in
Colon and Liver Distribution
[0090] There have been numerous reports indicating that conjugating small molecule drugs to polymers can change their pharmacokinetics and pre-dispose them to preferential accumulation in specific tissues. An analysis was carried out of how differences in blood pharmacokinetics affect relative distribution of pCQ and HCQ to the colon and liver following oral administration in the C. rodentium colitis.
TABLE-US-00005 TABLE 5 Pharmacokinetic Liver Colon parameter HCQ pCQ HCQ pCQ C.sub.max (ng/ml) 12,807 ± 3703 220.2 ± 102.7 10,304 ± 746.sup. 7,121 ± 2,984 t.sub.max (h) 2.0 ± 0.0 0.5 ± 0.0 8.0 ± 0.0 8.0 ± 0.0 AUC.sub.0-last (h × ng/ml) 167,944 ± 19,302 1,547 ± 100.sup. 166,377 ± 14,873 93,088 ± 34,403 AUC.sub.0-∞ (h × ng/ml) 175,852 ± 18,362 1,659 ± 78 208,917 ± 55,806 94,515 ± 35,363
[0091] The colon and liver PK and distribution results are shown in Table 5 and
[0092] Having established the local colon accumulation of pCQ, an analysis of pCQ hydrolysis in the GI tract and the extent of release of free HCQ was undertaken. An analysis of the content of polymer-bound HCQ and the extent of pCQ hydrolysis using the two different sample preparation methods described above was carried out. As shown in
HCQ and pCQ Metabolism
[0093] To address tissue accumulation and subsequent metabolism of HCQ and pCQ, the concentrations of HCQ metabolites in colon and liver were measured at serial time points following oral administration. HCQ is metabolized in the liver by dealkylation into three major metabolites: desethylchloroquine (DCQ), bisdesethylchloroquine (BDCQ) and desethylhydroxychloroquine (DHCQ. It was previously shown that DCQ has similar antimalarial activity as HCQ. All the N-dealkylated metabolites have been implicated in heart failure and retinopathy, with BDCQ being more cardiotoxic than HCQ [44]. Importantly for chronic use in IBD, HCQ and its metabolites have extremely long biological half-lives and thus their monitoring is important.
[0094] As expected, pCQ significantly decreased the extent and rate of HCQ metabolism due to the covalent bond formed between the polymer and the hydroxyl in HCQ. The metabolite concentration results in liver and colon are shown in
[0095] Data in
Example 6—Therapeutic Efficacy
[0096] Colitis was induced as stated above and mice were randomly assigned to healthy, HCQ, and pCQ treatment groups (n=5) and untreated group (n=8). Starting day 1, the mice received oral gavage of either HCQ or pCQ every other day (30 mg/kg HCQ equivalent in 200 μl sterile deionized water). Untreated and healthy controls were administered 200 μl sterile deionized water. On day 14, the mice were sacrificed and the colons were harvested. The colon was opened longitudinally, cleaned of fecal matter, and excised into two parts along the length, which were stored accordingly for determination of cytokine mRNA levels by RT-PCR and histological analysis.
[0097] The longitudinally opened colons were rolled into a Swiss roll from distal to proximal end. The rolls were fixed for 24 h in 4% paraformaldehyde, embedded in paraffin, sectioned and stained with hematoxylin and eosin (H&E). The stained sections were evaluated by a pathologist without the knowledge of the identity of the samples using a light microscope. Histopathological scores were assigned based on criteria as previously described. (Jacobson et al., Am. J. Physiol., 294 (2008) G295.) Scoring was performed based on severity of epithelial injury (graded 0-3, from absent to mild including superficial epithelial injury, moderate including focal erosions, and severe including multifocal erosions), the extent of inflammatory cell infiltrate (graded 0-3, from absent to transmural), and goblet cell depletion (0-1). For each tissue, a numerical score was assigned in a blinded manner to prevent bias. Scores from each tissue section group were averaged to obtain a mean histopathological score. Crypt heights were measured using ImageJ software, with 10 measurements taken in distal colons of each mouse. Only well-oriented and intact crypts were measured. Tissue sections were stained for cleaved caspase 3 (CC3) and macrophage infiltration (CD68). CC3 positive cells in the entire colon roll were counted at 20× magnification. Results were expressed as mean CC3 positive cells per entire colon roll. CD68 positive cells were counted in five randomly chosen areas in the colon roll at high power field (HPF). Results were expressed as mean of CD68 positive cells per HPF.
[0098] The local colon accumulation, limited systemic exposure, and low liver distribution of pCQ provided strong rationale for the testing of its anti-inflammatory activity in colitis. A therapeutic efficacy study was designed to assess whether restricting the distribution of pCQ to the GI tract preserves the activity of HCQ. The mice with colitis were treated (every other day) with oral gavage of pCQ and HCQ. Histological changes in the colon were examined following animal sacrifice on day 14. As shown in
[0099] To assess the immunohistochemical changes that occur during inflammation, a study was conducted of the effect of pCQ treatment on the expression of two markers (CD68, CC3) that are commonly measured in reported in vivo IBD studies. CD68 is a transmembrane glycoprotein specifically expressed by monocytes and macrophages. CD68 plays an important role in macrophage homing to tissues and is used to study macrophage infiltration in the inflamed colon. Colon sections from patients with active IBD have significantly higher macrophage infiltration than healthy subjects. Elevated infiltration of CD68+macrophages was observed in the colons of untreated mice with colitis (
Example 7—Real-Time PCR (RT-PCR)
[0100] Colon samples from the therapeutic study were stored in RNAlater™ (Thermo Fisher Scientific Inc.) at 4° C. for 48 hours to allow sufficient time for tissue penetration followed by removal of excess solution. The tissues were then stored at −80° C. until further processing. Stored frozen tissues were homogenized in TRIzol™ (Thermo Fisher Scientific Inc.) reagent using TissueLyser II (Qiagen) and mRNA was isolated from the homogenized tissues according to manufacturer's protocol. The extracted mRNA was quantified using Nanodrop Onec UV-Vis spectrophotometer (Thermo Fisher Scientific Inc.). The cDNA was synthesized from the mRNA using High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor per the manufacturer's protocol (Thermo Fisher Scientific Inc.). A volume corresponding to 1 μg of RNA as determined by UV spectrometer was used for cDNA synthesis. Synthesized cDNA was stored at −20° C. until further use. RT-PCR was carried out using the synthesized cDNA from colon tissue samples to determine the levels of mRNA of the target genes. Healthy and untreated colons were used as controls. cDNA was mixed with 0.2 μM of primer pair of gene of interest (Table 1) and iTaq™ Universal SYBR® Green Supermix (Biorad) into an optical reaction tube (Qiagen). The RT-PCR reaction was carried out in Rotor-Gene Q 2plex thermal cycler (Qiagen) using the following cycle program: 95° C. for 3 minutes; 40 cycles 60° C. for 30 seconds. Results obtained from the RT-PCR were analyzed by Ct method to determine the fold change in gene expression. Primer sequences for the RT-PCR are given in Table 6, below.
TABLE-US-00006 TABLE 6 mRNA targets Primer sequence (5′-3′) TNF-α F CATGAGCACAGAAAGCATGATC (SEQ ID NO: 1) R CCTTCTCCAGCTGGAAGACT (SEQ ID NO: 2) IL-6 F ATGGATGCTACCAACTGGAT (SEQ ID NO: 3) R TGAAGGACTCTGGCTTTGTCT (SEQ ID NO: 4) IL-1β F CAACCAACAAGTGATATTCTCCATG (SEQ ID NO: 5) R GATCCACACTCTCCAGCTGCA (SEQ ID NO: 6) IL-2 F TGAGCAGGATGGAGAATTACAGG (SEQ ID NO: 7) R GTCCAAGTTCATCTTCTAGGCAC (SEQ ID NO: 8)
[0101] Following histological evaluation, the mechanisms of anti-inflammatory activity of pCQ were explored. Upregulation of pro-inflammatory cytokines is a hallmark of IBD and lowering local levels of cytokines has been shown to reduce colon inflammation. To investigate how pCQ treatment changes the cytokine expression profile, mRNA levels of selected pro-inflammatory cytokines were measured in the colons after oral administration of seven doses of pCQ over 14 days. Although inhibition of TNFα is a well-established approach in the treatment of IBD and TNFα expression was 5-times higher in the untreated group, we observed no significant reduction in the colon TNFα expression after treatment with pCQ (
[0102] In contrast to IL-6 and IL1β, both treatments resulted in upregulated IL-2 expression (
[0103] To further elucidate the mechanism of pCQ action, the expression of STAT3, which is a downstream target of IL-6 with a known importance in the development of IBD, was observed. As shown in
[0104] In view of the many possible embodiments to which the principles of the disclosure may be applied, it should be recognized that the illustrated embodiments are only examples and should not be taken as limiting the scope of the invention.