Respiratory syncytial virus with a genomic deficiency complemented in trans

10967014 · 2021-04-06

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention relates to pneumoviral virions comprising a viral genome that has a mutation in a gene coding for a protein that is essential for infectivity of the pneumovirus, whereby the mutation causes a virus produced from only the viral genome to lack infectivity, and whereby the virion comprises the protein in a form and in an amount that is required for infectivity of the virion. The invention also relates to methods for producing the pneumoviral virions and for using the virions in the treatment or prevention of pneumoviral infection and disease. A preferred pneumoviral virion is a virion of Respiratory Syncytial Virus in which preferably the gene for the G attachment protein is inactivated and complemented in trans.

Claims

1. A method for producing a vaccine comprising Respiratory Syncytial Virus (RSV) virions comprising (i) a viral genome having a deletion or inactivation of only the gene coding for a G-attachment protein and (ii) a RSV G-attachment protein at its surface, the method comprising: (a) infecting a culture of a first host cell with a RSV comprising a viral genome having the deletion or inactivation, wherein the first host cell is a Vero cell that comprises an expression vector which directs expression of the RSV G-attachment protein in the first host cell; (b) recovering the virions from the infected first host cell culture; and (c) formulating the produced RSV virions with a pharmaceutically acceptable excipient into a vaccine.

2. The method according to claim 1, wherein the first host cell culture is infected with RSV virions produced by a method comprising: (a) providing to a second host cell one or more expression vectors which direct expression in the host cell of: (i) a viral genomic RNA that has a deletion or inactivation of a gene coding for a G-attachment protein; (ii) a RSV polymerase enzyme complex and optionally one or more further viral proteins; and, (b) culturing the second host cell whereby the RSV virions are produced.

3. The method according to claim 2, further comprising amplifying the RSV virions produced by the second host cell by one or more further cellular infection steps employing host cells which are the same or different from the second host cell.

4. The method according to claim 2, wherein the viral genomic RNA is transcribed from a viral DNA copy that is under the control of a bacteriophage DNA-dependent RNA polymerase promoter, and wherein the second host cell is provided with an expression vector which directs expression of the bacteriophage DNA-dependent RNA polymerase in the second host cell.

5. The method according to claim 4, wherein the bacteriophage DNA-dependent RNA polymerase is T7, T3 or SP6 polymerase.

6. The method according to claim 2, wherein the RSV polymerase enzyme complex at least includes the L, P, N proteins.

7. The method according to claim 2, wherein the one or more further viral proteins is a RSV matrix membrane protein.

8. The method according to claim 6, wherein the RSV matrix membrane protein is M2-1 protein.

9. The method according to claim 1, wherein the pharmaceutically acceptable excipient comprises a carrier, adjuvant, stabiliser, solubiliser, and/or preservative.

10. The method according to claim 9, wherein the pharmaceutically acceptable excipient comprises adjuvant, stabiliser, solubiliser, and/or preservative.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 Diagram of construction of pRSVXΔG. Upper line represents RSV isolate X genomic RNA, with genes indicated. Boxes below represent RT-PCR products and oligonucleotide duplexes used for construction: Numbers inside boxes indicate the oligonucleotide numbers as listed in table I. Restriction sites introduced for cloning are indicated. The final cloning scheme is indicated below: circles are plasmids and the arrows show the order of cloning.

(2) FIGS. 2A and 2B Alignments showing the differences between RSV isolate X and pRSVXΔG sequences. Sequences are shown as alignment of genomic sense. For pRSVXΔG only nucleotides differing from RSV isolate X are indicated. Similar sequences are indicated by dots (.) and gaps are indicated by (-). Gene start signals are single underlined, gene stop signals double underlined, and the genes are indicated in the captions. Boxes outline the restriction enzyme recognition sites resulting from the nucleotide changes introduced. The sequences presented in FIGS. 2A and 2B correspond with the following fragments of SEQ ID NO: 1: Intergenic region between L and M2-2: 6722-6792 of SEQ ID NO:1 Intergenic region between P and N: 12855-12899 of SEQ ID NO:1 Intergenic region between N and NS2: 14081-14127 of SEQ ID NO:1 Region of G gene deletion: 9607-9636 and 10532-10605 of SEQ ID NO:1.

(3) FIG. 3 Identification of sequence markers in RSV RT-PCR amplification products, digestions digests: a) MluI, b) XmaI, c) SexA-I, d) SnaB-I.

(4) FIGS. 4A and 4B Growth curves of RSV isolate X and ΔG-RSV isolate X. Vero (solid lines) and Hep-2 (dashed lines) cells were infected with virus at MOI=0.1 and incubated at 37° C. At the indicated time points cells were harvested and CCID50 titres were determined on Vero cells.

TABLES

(5) Table I. Primers used for RT-PCR cloning of RSV isolate X.

(6) Table II. Primers used for cloning of helper plasmids and for plasmids used for construction of stable cell lines.

(7) Table III. Primers used for diagnostic RT-PCR on RNA from RSV infected Vero cells.

(8) Table IV. Results cotton rat immunization experiments, protection against RSV infection and RSV-induced pathology by ΔG-RSV isolate X immunization.

EXAMPLES

(9) The current invention is illustrated by the following non limiting examples that are merely used to illustrate specific embodiments of the invention and should not be read as limiting the general scope or any aspect of the invention.

Example 1

Viral Isolate, Virus Isolation, Propagation and Storage

(10) The basis for the recombinant h-RSV clone is a clinical RSV isolate, obtained from the Leiden University Medical Centre diagnostic laboratory. This virus, named 98-25147-X, coded after the patient from which it was isolated, was derived from a diagnostic test on Hep-2 cells in the period 21-24 Dec. 1998. It was later determined to be a subtype A isolate and is designated RSV isolate X. The virus was passaged 4 times on Hep-2 cells in T75 bottles in DMEM (Gibco), 10% FCS, pen/strep/glu and subsequently five times on Vero cells in T75 bottles on in DMEM (Gibco), 10% PCS, pen/strep/glu. The resulting RSV isolate X virus was used as working stock and stored at −135° C. in 25% or 45% sucrose.

Example 2

Construction of RSV-X cDNA Encoding Viral Genome

(11) Total RNA was obtained by phenol-guanidine isothiocyanate extraction (Trizol, Invitrogen) of stock RSV isolate X infected Vero cells. cDNA was prepared by reverse transcription using Thermoscript (Invitrogen) reverse transcriptase using random hexamer primers. This cDNA was used as template for PCR using High fidelity Taq polymerase (Invitrogen) using specific primers containing restriction enzyme recognition sites (Table I and sequence listing). Primers were designed based on the published sequences of RSV-A2 (Genbank accession no M74568) and RSV-RSS2 (Genbank accession no U39662).

(12) PCR products were first cloned individually in different vectors: primer pairs, vectors, restriction enzyme recognition sites and resulting vector name are listed below. RSV021/RSV047: pCAP vector (Roche), bluntly into Mlu N1, pCAP3 (SH/M/P region) RSV018/019: pCAP vector, bluntly into Mlu N1, pCAP2 (G region) RSV016/RSV017: PUC21, Mlu I/Bam HI, pUK5 (M2-2/M2-1F region) RSV024/RSV025a: PUC21, Bam HI/Afl II, pUK1 (NS2/NS1 region) RSV022/RSV023: PUC21, EcoR V, pUK4 (N region) RSV014/RSV015: PUC21, Kpn I/Mlu I, pUK2 (L region)

(13) At least two individual clones derived from two independent cDNA templates were sequenced; regions containing differences between the two clones were sequenced on a third clone. If necessary, clones were repaired using standard molecular biology techniques known by the skilled person. Additional PCR products covering the binding sites of the primers used for cloning were obtained and sequenced. The κ′ genomic termini were determined by poly-adenylation of genomic RNA, followed by

(14) TABLE-US-00001 RT-PCR with an oligo(d)T containing primer ALG018 (SEQ ID NO: 34): TTAAAAGCTTTTTTTTTTTTTTTTTTTT and an NS1 gene primer RSV126 (SEQ ID NO: 35): AATTCTGCAGGCCCATCTCTAACCAAAGGAGT.
This fragment was cloned into pUC21 using Hind III/Pst I. The 3′-end was determined by RACE (rapid amplification of cDNA ends) ligation PCR. All sequences were assembled to yield the RSV-X consensus sequence (Seq ID No. 1).

(15) All sequences were confirmed by PCR cycle sequencing using the BigDye terminator kit (Applied Biosystems) and analysed by an ABI Prism 310 genetic analyser.

(16) TABLE-US-00002 TABLE I Primers used for RT-PCR cloning of RSV isolate X Template Primer region name Sequence L RSV014 AATTGGTACCTAATACGACTCACTATAGGGACGAGA AAAAAAGTGTC RSV015 TTAAACGCGTCATCAAACTATTAACTC M2-2/M2-1/F RSV016 AATTACGCGTTAAGCATTAGGATTGAGTG RSV017 TTAAGGATCCGCGCGCTATTATTGCAAAAAGCC G RSV018 AATTGCGCGTTTTTAATGACTACTGG RSV019 TTAAGGATCCGTACGTTGGGGCAAATGCAAACATGT CC SH/M/P RSV021 TTAACCCGGGGCAAATAAAACATCATGG RSV047 AATTCGTACGTATTGTTAGTCTTAATATCTTAGTTCA TTGTTATGA N RSV022 AATTCCCGGGATTTTTTTTATTAACTCAAAGC RSV023 TTAAACCTGGTAAGATGAAAGATGGGGCAAATACAA AAATGGC NS2/NS1 R5V024 AATTGGATCCACCAGGTCTCTCCTTAATTTTAAATTA C RSV025a AATTCTTAAGGGACCGCGAGGAGGTGGAGATGCCAT GCCGACCCACGCGAAAAAATGCGTACAAC HDVR RSV026 GTCCGACCTGGGCATCCGAAGGAGGACG RSV027 ACGTCCTCCTTCGGATGCCCAGGTCG HDVR-T7phi RSV028 TCGTCCACTCGGATGGCTAAGGGAATAACCCCTTGG GGCCTCTAAACGGGTCTTGAGGGGTTTTTTGC RSV029 GGCCGCAAAAAACCCCTCAAGACCCGTTTAGAGGCC CCAAGGGGTTATTCCCTTAGCCATCCGAGTGGACG

Example 3

Construction of ΔG-RSV Isolate X Full Length Plasmid

(17) The full-length cDNA spanning the entire RSV isolate X genome was assembled by sequential ligation of PCR fragments (FIG. 1). The “trailer” end is preceded by the promoter for the bacteriophage T7 polymerase. To generate correct 3′ ends the cDNA “leader” end is fused to the hepatitis delta virus ribozyme (HDVR), followed by a terminator of the T7 RNA polymerase transcription (see FIG. 1).

(18) First, two sets of complementary oligomers encoding the HDVR and the T7 terminator RSV026/RSV027 oligo's and RSV028/029 oligo's were phosphorylated with T4 DNA kinase, hybridised and ligated into clone pUK1 (containing genes NS1/NS2) via Rsr II/Not I, giving plasmid pUK3. Then, the Xma I/SexA I fragment of clone pUK4 containing N was ligated into plasmid pUK3 via Xma I/SexA I. This plasmid (pUK6) contains the region from the N gene up to the 3′ leader sequence, fused to the HDVR and a T7 terminator.

(19) Secondly, the Xma I/Eco RV fragment of plasmid pCAP3 was inserted in plasmid pUK5 using Xma I and a filled-in Hind III site. This yields plasmid pUK8. Subsequently, pUK 8 was digested with BssH II and BsiW I, ends were filled-in with Klenow polymerase and religated. This plasmid contains the genes M2-2, M2-1, F, SH, M and P and is named pUK9.

(20) To synthesise a low-copy number vector for the RSV isolate X cDNA, two complementary oligomers, RSV011 (SEQ ID NO:36): AGCTTGCGGCCGCGTCGACCCGGGACGCGTCGATCGGGTACCAT and RSV012 (SEQ ID NO: 37): CGATGGTACCCGATCGACGCGTCCCGGGTCGACGCGGCCGCA were phosphorylated with T4 DNA kinase, hybridised and inserted in the alkaline phosphatase treated and Cla I/Hind III digested plasmid pACYC184 (New England Biolabs). The resulting plasmid is named pACYC184-MCS. Subsequently a Mlu I-Knp I fragment of pUK2 containing the T7 promoter and L gene was inserted, this intermediate plasmid is named pACYC1. Then, the region from the N gene up to the 3′-leader sequence, including the fused HDVR and T7 terminator sequence of pUK6 was added to pACYC1 using Xma I/Not I. This gives intermediate plasmid pACYC2. Finally, the Xma I/Mlu I fragment of pUK9 containing the M2-2, M2-1, F, SH, M and P genes was inserted into pACYC2, yielding plasmid pACYC3, comprising the whole RSV genome of strain X lacking the G gene. Sequence analysis of the latter plasmid revealed a deletion in the HDVR region, which was repaired and the resulting plasmid is named pRSVXΔG.

(21) In addition to construct pRSVXΔG, construct pACYC24 was generated in which the genomic RSV isolate X insert is reverse complemented via inverse PCR. From the construct, antigenomic RSV RNA can be synthesised. In pACYC24, the T7 promoter precedes the 3′-leader sequence, whereas the HDVR and T7 terminator are fused to the 5′-trailer sequence.

(22) All restriction enzyme recognition sites used to construct pRSVXΔG are located inside the RSV intergenic regions and do not alter coding sequences or affect transcription signals (as shown in FIGS. 2A and 2B).

Example 4

Construction of Helper Plasmids

(23) Helper plasmids expressing several RSV proteins were constructed as follows. All required genes are derived from lab-strain RSV-A2 (ATCC # VR1302). Virus was plaque-purified on Hep-2 cells and subsequently used to infect Vero cells. Total RNA was isolated from these cells by phenol-guanidine isothiocyanate extraction (Trizol, Invitrogen) and subjected to RT-PCR using High Fidelity Taq polymerase (Invitrogen) and a set of primers specific for RSV genes L, P, N and M2-1 respectively (see Table II). PCR products were subsequently cloned into expression plasmids pcDNA3, pcDNA6 or pCI, using restriction enzyme recognition sites as indicated in the table II. Clone sequences were confirmed by PCR cycle sequencing using the BigDye terminator kit (Applied Biosystems) and analysed by an ABI Prism 310 genetic analyser.

(24) TABLE-US-00003 TABLE II Primers used for cloning of helper plasmids and for plasmids used for construction of stable cell lines. Primer Restriction Gene name Sequence sites L RSV045 TTAACTCGAGTTATTCATTATGAAAGTTG xho I RSv046 AATTGGTAcCGGGACAAAATGGATCCC Kpn I P RSV043 TTAATCTAGATTGTAACTATATTATAG Xba I RSV012a AATTGGATCCGGGGCAAATAAATCATCAT BamH I GG N RSV010 AATTGGATCCGGGGCAAATACAAGATGG BamH I C RSV011 TTAACTCGAGATTAACTCAAAGCTCTACA Xho I TC M2-1 RSV124 AATTGGATCCGGGGCAAATATGTCACGAA BamH I GG RSV125 TTAATCTAGATCAGGTAGTATCATTATTTT XbaI TGGC A2-G R5V042 TTAATCTAGAAGTAACTACTGGCGTG Xba I RSV004a AATTGGATCCGGGGCAAATACAAACATGT BamH I CCAAAAACAAGGACC RSV151 AATTCCATGGGGTCCAAAACCAAGGACC Nco I AACG A2- RSV033a AAAAGTATACTTAATGTGATTIGTGCTAT Acc I GAM48 AG RSV034 TTTTGTATACTGGCAGCTATAATCTCAACT Acc I TCACTTATAATTGC X-G RSV004a AATTGGATCCGGGGCAAATACAAACATGT BamH I CCAAAAACAAGGACC RSV018a AATTTCTAGATTTTTAATGACTACTGG Xba I T7 pol ALG022 TTAATCTAGACMACGCGAACGCGAAGT Xba I CC ALG023 AATTAAGCTTACCATGGACACGATTAACA Hind III TCGCTAAGAACG

Example 5

Construction of G-Producing Vero Cell-Lines

(25) Cell lines producing RSV-G protein were constructed using several methods:

(26) In method 1, the G gene from either RSV-A2 or RSV isolate X, or the G gene from RSV-A2, in which the internal translation initiation codon had been disabled by modification using primers RSV033 and RSV034, were cloned into expression vector pcDNA3 or pcDNA6 (Invitrogen) using RT-PCR on RNA from RSV-A2 or RSV isolate X infected Vero cells using primers as indicated in Table II. The plasmids were introduced into Vero cells using either chemical agents CaCl.sub.2, co-precipitation, liposome-based or electroporation (Ausubel 1989). Two methods for isolating stable cell lines were used. In the first method, 72 hours after transfection, cells were split using various dilutions into fresh medium containing selective medium, zeocin for pcDNA3 and blasticidin for pcDNA6. Cells were fed with selective medium every 3-4 days until cell foci were identified. Single colonies were picked and transferred in to 96-well plate, or seeded in various dilutions to obtain single cells in a 96 well plate. Antibiotic resistant colonies were tested on expression of RSV-G by immunostaining techniques or FACS using RSV G-specific antibodies. Colonies expressing G were passaged, and were designated as stable cell lines expressing G. The second method comprises FACS sorting using RSV-G specific antibodies 72 hours after transfection. RSV-G expressing cells were seeded in a serial dilution to obtain single cells in a 96-well plate and cultured with selective medium. Single cell colonies were passaged on selective medium and subsequently tested again for expression of RSV-G, resulting in cell lines expressing RSV-G.

(27) In method 2, the Flp-In system (Invitrogen) is used to produce Vero cells with target gene insertion sites at chromosomal positions which allow different levels of target gene expression. The RSV-G gene, derived from the plasmids from method 1 but with a modification (introduced using primer RSV151: Table II) of the G translation initiation codon surrounding sequence to allow higher translation levels, were inserted in each of these cell lines using the system-generic method, resulting in Vero cell lines stably expressing different levels of G protein.

(28) In method 3, Vero cells were transiently made to express the G protein, by either transfection with the expression plasmids containing the G gene from method 1, or by infection with Modified vaccinia virus Ankara (MVA) (Sutter 1992) or fowlpox viruses (Spehner 1990) expressing the G protein.

Example 6

Construction of Bacteriophage T7-Polymerase-Producing Cell Lines

(29) The bacteriophage T7 polymerase gene is PCR amplified from plasmid pPRT7 (van Gennip 1997), containing the gene, using primers ALG022 and ALG023 (Table II). The PCR product is cloned into pcDNA6b vector, using Hind III/Xba I, yielding plasmid pc6T7pol. Vero cells were transfected using lipofectamine 2000 as recommended by the manufacturer (Invitrogen). 72 hours after transfection cells were split and grown in fresh medium containing blasticidin. Cells were fed fresh medium every 3-4 days and split twice to obtain larger culture volumes. 20 days after transfection, blasticidin resistant cells were transfected with reporter plasmid pT7-IRES2-EGFP using lipofectamine 2000. For the construction of plasmid pT7-IRES2-EGFP, first plasmid pT7-EGFP was constructed by inserting via HindIII/BamHI in plasmid p-EGFP-N1 (Clonetech) a set of complementary oligomers encoding for the T7 promoter sequence (ALG32 (SEQ ID NO: 38): AGCTAATACGACTCACTATAGGGAGACGCGT and ALG33 (SEQ ID NO: 39): GATCACGCGTCTCCCTATAGTGAGTCGTATT). Plasmid pT7-IRES2-EGFP was then constructed by cloning the 17-EGFP fragment of plasmid pT7-EGFP into plasmid p-IRES2-EGFP via XmaI-NotI. Cells expressing EGFP were sorted by FACS and grown in limited dilution to obtain single cell colonies. Single colonies expressing T7 RNA polymerase were tested for stability, grown to larger culture volumes and stored.

Example 7

Method to Produce Recombinant ΔG-RSV Isolate X Virus

(30) Hep-2 cells were cultivated in DMEM+10% FCS (foetal calf serum)+penicillin/streptomycin/glutamine, whereas Vero cells and derivatives thereof are cultivated in M199+5% FCS+pen/strep/glu. Cells were grown overnight to 80% confluence in 10 mm.sup.2 dishes at 37° C. For Vero and Hep-2 cells, cells were infected with modified virus Ankara-T7 (MVA-T7) (Sutter 1992, Wyatt 1995) or fowlpox-T7 virus (Britton 1996) at MOI=3 (multiplicity of infection 3) and incubated at 32° C. for 60 min prior to transfection, to allow expression of bacteriophage T7 polymerase. The cells (Hep-2, Vero or Vero-T7 cells) were washed with Optimem medium (Optimem 1 with glutamax, Invitrogen) and subsequently transfected with helper plasmids encoding the N, P, L and M2.1 genes of RSV and with plasmid pRSVXΔG, using Lipofectamine2000 (Invitrogen) in Optimem (total volume 500 μl). The following amounts of plasmids were added: 1.6 μg pRSVXΔG, 1.6 μg pcDNA6-A2-N, 1.2 μg pcDNA3-P, 0.4 μg pcDNA6-A2-L, 0.8 μg pcDNA6-A2-M2.1. After 3-4 hrs of incubation at 32° C., 500 μl of Optimem medium with 2% FCS was added and the cells were incubated at 32° C. for 3 days. Cells were then scraped and the mixture of scraped cells and medium containing the rescued virus was used to infect fresh cultures of Vero or Hep-2 cells grown in DMEM+2% FCS+pen/strep/glu. The latter procedure was repeated for 4-5 times to obtain high titre virus stocks.

(31) Identity of ΔG-RSV isolate X virus was confirmed by RT-PCR on RNA isolated from ΔG-RSV isolate X infected Vero cells and digestion of the obtained products with the unique restriction enzymes whose recognition sites were introduced into pRSVXΔG (FIGS. 2A and 2B). RSV isolate X was used as control.

(32) For the identification of sequence markers in RSV, Vero cells were infected with RSV isolate X or with ΔG-RSV isolate X with an MOI=0.1. 72 hrs after infection, RNA from culture supernatants was isolated and used as template for RT-PCR. Primers were designed to flank the inserted sequence markers in the recombinant ΔG-RSV isolate X virus. After RT-PCR, the obtained products were digested with the appropriate restriction enzymes. The following digestion products were obtained (FIG. 3):

(33) a) PCR with primer RSV065 (SEQ ID NO: 40) (GTCCATTGTTGGATTTAATC) and RSV093 (SEQ ID NO: 41) (CAAGATAAGAGTGTACAATACTGTC) and digestion with Mlu-I yielded the expected fragments of 937 bp for RSV isolate X, and 459 and 478 bp for ΔG-RSV isolate X

(34) b) PCR with primers RSV105 (SEQ ID NO: 42) (GTTGGATTGAGAGACACTT) and RSV113 (SEQ ID NO: 43) (AGTATTAGGCAATGCTGC) followed by digestion with Xma-I yielded the expected fragments of 880 by for RSV isolate X, and 656 and 224 by for ΔG-RSV isolate X

(35) c) PCR with primers RSV112 (SEQ ID NO:44) (CCCAGTGAATTTATGATTAG) and RSV160 (SEQ ID NO:45) (AATTGGATCCATGGACACAACCCACAATGA) and digestion with SexA-I yielded the expected fragments of 694 bp for RSV isolate X, and 492 and 202 bp for ΔG-RSV isolate X

(36) d) PCR with primers RSV098 (SEQ ID NO:46) (TGGTAGTTCTCTTCTGGCTCG) and RSV114 (SEQ ID NO:47) (ATCCCCAAGTCATTGTTCA) followed by digestion with SnaB-I yielded the expected fragments of 1820 bp for RSV isolate X, and 507 and 387 bp for ΔG-RSV isolate X.

(37) Growth characteristics of ΔG-RSV isolate X compared to RSV isolate X were determined on Vero and on Hep-2 cells (FIGS. 4A and 4B).

(38) TABLE-US-00004 TABLE III Primers used for diagnostic RT-PCR on RNA from RSV infected Vero cells. Primer name Sequence SEQ ID NO: RSV065 GTCCATTGTTGGATTTAATC 40 RSV093 CAAGATAAGAGTGTACAATACTGTC 41 RSV098 TGGTAGTTCTCTTCTGGCTCG 46 RSV105 GTTGGATTGAGAGACACTT 42 RSV112 CCCAGTGAATTTATGATTAG 44 RSV113 AGTATTAGGCAATGCTGC 43 RSV114 ATCCCCAAGTCATTGTTCA 47 RSV160 AATTGGATCCATGCACACAACCCACAATGA 45

Example 8

Method to Produce Recombinant ΔG+G-RSV Isolate X Virus

(39) ΔG-RSV isolate X virus, derived from transfected Vero cells, was passaged several times to obtain titres of at least 10.sup.5 pfu/ml (plaqrsv045ue forming units per ml). Different moi's of this virus were then used to infect the Vero cell line producing RSV-G protein. The resulting ΔG+G-RSV isolate X was harvested from the medium and/or from the cells and analysed for the presence of the G protein in the virions by immunodetection techniques. Infectivity titres were determined on Vero or Hep-2 cells, and the integrity of the ΔG-genome was determined using RT-PCR on viral RNA extracted from cells infected with ΔG+G-RSV isolate X virus. Virus was stored at −135° C. in 25% or 40% sucrose.

Example 9

Method to Protect in a Cotton Rat Animal Model Against RSV Infection and RSV-Induced Pathology By ΔG-RSV Isolate X Immunization

(40) Protection experiments were performed in cotton rats (Sigmodon hispidus, 5-6 weeks old, 4-6 animals per group and both sexes), in initial experiments, this animal was shown to be sensitive to RSV infection and to exhibit severe vaccine-mediated lung pathology as described by Prince, 2001 and which closely mimics the human situation. After intranasal application of RSV lung pathology was characterized by inflammation infiltrate in and around bronchus/bronchioli and hyperplasia of epithelium. A more severe pathology was seen upon intramuscular immunization with formalin-inactivated RSV-A2 followed by an intranasal challenge with RSV-A2. In addition to the above-mentioned pathology, perivascular and peribronchiolar infiltrate and alveolitis were observed, characteristic for an immune-mediated pathology. These observations were used as “internal” reference for all immunization and challenge experiments. Infection and immunization of cotton rats with RSV preparations was done intranasally, in both nostrils. Cotton rat lungs were examined for pathology lightmicroscopically and virus titres at different time points post-challenge or post-infection/immunization were determined on Vero cells using serial dilutions of lung homogenates with RSV specific ELISA to yield CCID.sub.50 titres and immunostaining using RSV specific abs to yield pfu titres. After immunization twice with ΔG-RSV isolate X cotton rats were fully protected against infection and pathology caused by RSV isolate X in the lungs. The results from several experiments are summarized in Table IV.

(41) TABLE-US-00005 TABLE IV infection lung pathology day with: t.sup.1 V.sup.2 5 post infection lung t.sup.3 ΔG-RSV isolate X 5 100 yes, moderate below detection RSV-A2 5 100 yes, strong 2*5 RSV isolate X 5 100 yes, strong 4*5 immunization challenge lung pathology day day 0 and 21 t.sup.1 V.sup.2 day 42 t.sup.1 V.sup.2 5 post challenge lung t.sup.3 2x ΔG-RSV isolate X 5 100 RSV isolate X 5 100 no below detection mock 100 RSV isolate X 5 100 yes, strong 5 .sup.1virus titres in logs pfu/ml .sup.2volume in μl per animal, which is half this volume in each nostril .sup.3virus titres in logs per gram lung, detection limit is 10.sup.2 CCID.sub.50

REFERENCES

(42) Alwan W H, Record F M, Openshaw P J. Phenotypic and functional characterisation of T cell lines specific for individual respiratory syncytial virus proteins. J Immunol. 1993, 150(12):5211-8.

(43) F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A., Smith, K. Struhl, Current Protocols in Molecular Biology, John Wiley and Sons, New York, 1997

(44) Bembridge G P, Rodriguez N, Garcia-Beato R, Nicolson C, Melero J A, Taylor G. DNA encoding the attachment (G) or fusion (F) protein of respiratory syncytial virus induces protection in the absence of pulmonary inflammation. J Gen Virol. 2000, 81 (Pt 10):2519-23,

(45) Britton P, Green P, Kottier S, Mawditt K L, Penzes Z, Cavanagh D, Skinner M A. Expression of bacteriophage T7 RNA polymerase in avian and mammalian cells by a recombinant fowlpox virus. J Gen Virol. 1996, 77 (Pt 5):963-7.

(46) Buchholz U J, Granzow H, Schuldt K, Whitehead S S, Murphy B R, Collins P L. Chimeric bovine respiratory syncytial virus with glycoprotein gene substitutions from human respiratory syncytial virus (HRSV): effects on host range and evaluation as a live-attenuated HRSV vaccine. J Virol. 2000, 74(3):1187-99.

(47) Cane P A, Matthews D A, Pringle C R. Identification of variable domains of the attachment (G) protein of subgroup A respiratory syncytial viruses. J Gen Virol, 1991, 72 (Pt 9):2091-6.

(48) Collins P L, Purcell R H, London W T, Lawrence L A, Chanock R M, Murphy B R. Evaluation in chimpanzees of vaccinia virus recombinants that express the surface glycoproteins of human respiratory syncytial virus. Vaccine. 1990, 8(2):164-8

(49) Crowe J E Jr. Immune responses of infants to infection with respiratory viruses and live attenuated respiratory virus candidate vaccines. Vaccine. 1998, 16(14-15):1423-32, Review.

(50) Gonzalez I M, Karron R A, Eichelberger M, Walsh E E, Delagarza V W, Bennett R, Chanock R M, Murphy B R, Clements-Mann M L, Falsey A R. Evaluation of the live attenuated cpts 248/404 RSV vaccine in combination with a subunit RSV vaccine (PFP-2) in healthy young and older adults. Vaccine. 2000, 18(17):1763-72.

(51) Greenough A, Thomas M. Respiratory syncytial virus prevention: past and present strategies. Expert Opin Pharmacother. 2000, 1(6):1 195-201.

(52) Jin H, Cheng X, Traina-Dorge V L, Park H J, Zhou H, Soike K, Kemble G. Evaluation of recombinant respiratory syncytial virus gene deletion mutants in African green monkeys for their potential as live attenuated vaccine candidates. Vaccine. 2003, 21(25-26):3647-52.

(53) Karron R A, Buonagurio D A, Georgiu A F, Whitehead S S, Adamus J E, Clements-Mann M L, Harris D O, Randolph V B, Wein S A, Murphy B R, Sidhu M S. Respiratory syncytial virus (RSV) SH and G proteins are not essential for viral replication in vitro: clinical evaluation and molecular characterisation of a cold-passaged, attenuated RSV subgroup B mutant. Proc Natl Acad Sci USA. 1997, 94(25):13961-6.

(54) Kim H W, Canchola J G, Brandt C D, Pyles G, Chanock R M, Jensen K, Parrott R H. Respiratory syncytial virus disease in infants despite prior administration of antigenic inactivated vaccine. Am J Epidemiol. 1969, 89(4):422-34.

(55) Li X, Sambhara S, Li C X, Ewasyshyn M, Parrington M, Caterini J, James O, Cates G. Du R P, Klein M. Protection against respiratory syncytial virus infection by DNA immunization. J Exp Med. 1998, 188(4):681-8.

(56) Lofland J H, O'Connor J P, Chatterton M L, Moxey E D, Paddock L E, Nash D B, Desai S A. Palivizumab for respiratory syncytial virus prophylaxis in high-risk infants: a cost-effectiveness analysis. Clin Ther. 2000, 22(11):1357-69.

(57) Mufson M A, Belshe R B, Orveli C, Norrby E. Respiratory syncytial virus epidemics: variable dominance of subgroups A and B strains among children, 1981-1986. J Infect Dis. 1988, 157(1):143-8.

(58) Neumann G, Whitt M A, Kawaoka Y. A decade after the generation of a negative-sense RNA virus from cloned cDNA—what have we learned? J Gen Virol. 2002, 83(Pt 11):2635-62. Review.

(59) Openshaw P J, Dean G S, Culley F J. Links between respiratory syncytial virus bronchiolitis and childhood asthma: clinical and research approaches. Pediatr Infect Dis J. 2003, 22(2 Suppl):S58-64; discussion S64-5. Review.

(60) Peebles R S Jr, Hashimoto K, Graham B S. The complex relationship between respiratory syncytial virus and allergy in lung disease. Viral immunol. 2003; 16(1):25-34. Review.

(61) Plotnicky H, Siegrist C A, Aubry J P, Bonnefoy J Y, Corvaia N, Nguyen T N, Power UR. Enhanced pulmonary immunopathology following neonatal priming with formalin-inactivated respiratory syncytial virus but not with the BBG2NA vaccine candidate. Vaccine. 2003, 21(19-20):2651-60.

(62) Power U F, Plotnicky-Gilquin H, Huss T, Robert A, Trudel M, Stahl S, Uhlen M, Nguyen T N, Binz H. Induction of protective immunity in rodents by vaccination with a prokaryotically expressed recombinant fusion protein containing a respiratory syncytial virus G protein fragment. Virology. 1997, 230(2):155-66.

(63) Prince G A, Curtis S J, Yim K C, Porter D D. Vaccine-enhanced respiratory syncytial virus disease in cotton rats following immunization with Lot 100 or a newly prepared reference vaccine. J Gen Virol. 2001, 82:2881-8.

(64) Robinson R F, Nahata M C. Respiratory syncytial virus (RSV) immune globulin and palivizumab for prevention of RSV infection. Am J Health Svst Pharm. 2000, 57(3):259-64. Review. Erratum in: Am J Health Syst Pharm 2000 Apr. 1; 57(7):699.

(65) Sambrook J., Fritsch E F, Maniatis T. Molecular Cloning. A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989

(66) Schmidt U, Beyer J, Polster U, Gershwin L J, Buchholz U J. Mucosal immunization with live recombinant bovine respiratory syncytial virus (BRSV) and recombinant BRSV lacking the envelope glycoprotein G protects against challenge with wild-type BRSV. J Virol. 2002, 76(23):12355-9.

(67) Siegrist C A, Plotnicky-Gilquin H, Cordova M, Berney M, Bonnefoy J Y, Nguyen T N, Lambert P H, Power U F. Protective efficacy against respiratory syncytial virus following murine neonatal immunization with BBG2Na vaccine: influence of adjuvants and maternal antibodies. J Infect Dis. 1999, 179(6):1326-33.

(68) Spehner D, Drillien R, Lecocq J P. Construction of fowlpox virus vectors with intergenic insertions: expression of the beta-galactosidase gene and the measles virus fusion gene. J Virol. 1990, 64(2):527-33.

(69) Srikiatkhachorn A, Braciale T J. Virus-specific CD8+ T lymphocytes downregulate T helper cell type 2 cytokine secretion and pulmonary eosinophilia during experimental murine respiratory syncytial virus infection. J Exp Med. 1997a, 186(3):421-32.

(70) Srikiatkhachorn A, Braciale T J. Virus-specific memory and effector lymphocytes exhibit different cytokine responses to antigens during experimental murine respiratory syncytial virus infection. J Virol. 1997b, 71(1):678-85.

(71) Sutter G, Moss B. Nonreplicating vaccinia vector efficiently expresses recombinant genes. Proc Nati Acad Sci USA. 1992, 89(22):10847-51.

(72) Van Gennip H G, van Rijn P A, Widjojoatmodjo M N, Moormann R J. Recovery of infectious classical swine fever virus (CSFV) from full-length genomic cDNA clones by a swine kidney cell line expressing bacteriophage T7 RNA polymerase. J Virol Methods. 1999, 78(1-2):117-28.

(73) Wyatt L S, Moss B, Rozenblatt S. Replication-deficient vaccinia virus encoding bacteriophage T7 RNA polymerase for transient gene expression in mammalian cells. Virology. 1995, 210(1):202-5.