Products and Methods for Treatment of Familial Amyotrophic Lateral Sclerosis

20210108209 · 2021-04-15

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to RNA-based methods for inhibiting the expression of the superoxide dismutase 1 (SOD-1) gene. Recombinant adeno-associated viruses of the invention deliver DNAs encoding RNAs that knock down the expression of SOD-1. The methods have application in the treatment of amyotrophic lateral sclerosis.

    Claims

    1-3. (canceled)

    4. A method of delivering a SOD1 shRNA-encoding DNA, to a subject in need thereof, comprising administering to the subject a recombinant adeno-associated virus comprising the SOD1 shRNA-encoding DNA, a sequence selected from the group consisting of: TABLE-US-00005 (SEQ ID NO: 1) GCATCATCAATTTCGAGCAGAAGGAA, (SEQ ID NO: 2) GAAGCATTAAAGGACTGACTGAA, (SEQ ID NO: 3) CTGACTGAAGGCCTGCATGGATT, (SEQ ID NO: 4) CATGGATTCCATGTTCATGA, (SEQ ID NO: 5) GCATGGATTCCATGTTCATGA, (SEQ ID NO: 6) GGTCTGGCCTATAAAGTAGTC, (SEQ ID NO: 7) GGGCATCATCAATTTCGAGCA, (SEQ ID NO: 8) GCATCATCAATTTCGAGCAGA, (SEQ ID NO: 9) GCCTGCATGGATTCCATGTTC, (SEQ ID NO: 10) GGAGGTCTGGCCTATAAAGTA, (SEQ ID NO: 11) GATTCCATGTTCATGAGTTTG, (SEQ ID NO: 12) GGAGATAATACAGCAGGCTGT, (SEQ ID NO: 13) GCTTTAAAGTACCTGTAGTGA, (SEQ ID NO: 14) GCATTAAAGGACTGACTGAAG, (SEQ ID NO: 16) TCGAGCAGAAGGAAAGTAA, (SEQ ID NO: 17) GCCTGCATGGATTCCATGT, (SEQ ID NO: 18) TCACTCTCAGGAGACCATT, and (SEQ ID NO: 19) GCTTTAAAGTACCTGTAGT; wherein the recombinant adeno-associated virus genome lacks rep and cap genes.

    5-11. (canceled)

    12. The method of claim 4, wherein the subject has amyotrophic lateral sclerosis (ALS).

    13. The method of claim 12, wherein the ALS is associated with one or more SOD1 mutations.

    14. The method of claim 4, wherein the adeno-associated virus further comprises an H1 promoter operably linked to the SOD1 shRNA-encoding DNA.

    15. The method of claim 14, wherein the H1 promoter comprises nucleotides 966 to 1064 of SEQ ID NO:20.

    16. The method of claim 4, wherein the virus genome is a self-complementary genome.

    17. The method of claim 4, wherein the recombinant adeno-associated virus is an rAAV2, rAAV9 or rAAVrh74 virus.

    18. The method of claim 17, wherein the recombinant adeno-associated virus is rAAV9.

    19. The method of claim 4, wherein the adeno-associated virus further comprises a stuffer sequence.

    20. The method of claim 19, wherein the stuffer sequence comprises SEQ ID NO: 22.

    21. The method of claim 4, wherein the SOD1 shRNA-encoding DNA comprises SEQ ID NO: 4.

    22. The method of claim 4, wherein the SOD1 shRNA-encoding DNA comprises, from 5′ to 3′: a) nucleotides 104-123 of SEQ ID NO: 21; b) a stem loop; and c) nucleotides 133-152 of SEQ ID NO: 21.

    23. The method of claim 4, wherein recombinant adeno-associated virus is administered by parenteral, intravenous, intrathecal introcerebroventricular, or cisterna magna administration.

    24. The method of claim 23, wherein the recombinant adeno-associated virus is administered by intrathecal administration.

    25. The method of claim 24, wherein the intrathecal administration is by lumbar puncture.

    26. A superoxide dismutase 1 (SOD1) shRNA-encoding DNA comprising: TABLE-US-00006 (SEQ ID NO: 1) GCATCATCAATTTCGAGCAGAAGGAA, (SEQ ID NO: 2) GAAGCATTAAAGGACTGACTGAA, (SEQ ID NO: 3) CTGACTGAAGGCCTGCATGGATT, (SEQ ID NO: 4) CATGGATTCCATGTTCATGA, (SEQ ID NO: 5) GCATGGATTCCATGTTCATGA, (SEQ ID NO: 6) GGTCTGGCCTATAAAGTAGTC, (SEQ ID NO: 7) GGGCATCATCAATTTCGAGCA, (SEQ ID NO: 8) GCATCATCAATTTCGAGCAGA, (SEQ ID NO: 9) GCCTGCATGGATTCCATGTTC, (SEQ ID NO: 10) GGAGGTCTGGCCTATAAAGTA, (SEQ ID NO: 11) GATTCCATGTTCATGAGTTTG, (SEQ ID NO: 12) GGAGATAATACAGCAGGCTGT, (SEQ ID NO: 13) GCTTTAAAGTACCTGTAGTGA, (SEQ ID NO: 14) GCATTAAAGGACTGACTGAAG, (SEQ ID NO: 16) TCGAGCAGAAGGAAAGTAA, (SEQ ID NO: 17) GCCTGCATGGATTCCATGT, (SEQ ID NO: 18) TCACTCTCAGGAGACCATT, or (SEQ ID NO: 19) GCTTTAAAGTACCTGTAGT.

    27. A DNA plasmid comprising a recombinant adeno-associated virus genome comprising a superoxide dismutase 1 (SOD1) shRNA-encoding DNA comprising a sequence selected from the group consisting of: TABLE-US-00007 (SEQ ID NO: 1) GCATCATCAATTTCGAGCAGAAGGAA, (SEQ ID NO: 2) GAAGCATTAAAGGACTGACTGAA, (SEQ ID NO: 3) CTGACTGAAGGCCTGCATGGATT, (SEQ ID NO: 4) CATGGATTCCATGTTCATGA, (SEQ ID NO: 5) GCATGGATTCCATGTTCATGA, (SEQ ID NO: 6) GGTCTGGCCTATAAAGTAGTC, (SEQ ID NO: 7) GGGCATCATCAATTTCGAGCA, (SEQ ID NO: 8) GCATCATCAATTTCGAGCAGA, (SEQ ID NO: 9) GCCTGCATGGATTCCATGTTC, (SEQ ID NO: 10) GGAGGTCTGGCCTATAAAGTA, (SEQ ID NO: 11) GATTCCATGTTCATGAGTTTG, (SEQ ID NO: 12) GGAGATAATACAGCAGGCTGT, (SEQ ID NO: 13) GCTTTAAAGTACCTGTAGTGA, (SEQ ID NO: 14) GCATTAAAGGACTGACTGAAG, (SEQ ID NO: 16) TCGAGCAGAAGGAAAGTAA, (SEQ ID NO: 17) GCCTGCATGGATTCCATGT, (SEQ ID NO: 18) TCACTCTCAGGAGACCATT, and (SEQ ID NO: 19) GCTTTAAAGTACCTGTAGT, wherein the recombinant adeno-associated virus genome lacks rep and cap genes.

    28. A packaging cell comprising the DNA plasmid of claim 27.

    Description

    BRIEF DESCRPTION OF THE DRAWINGS

    [0037] FIGS. 1A-1U. AAV9 transduction pattern and persistence in SOD1.sup.G93A mice. SOD1.sup.G93A mice were injected intravenously with AAV9-CB-GFP at P1, P21 and euthanized 21 days post injection (n=3 per time point). Spinal cords were examined for GFP, ChAT (motor neuron marker) and GFAP (astrocyte marker) expression. Temporal vein injection of AAV9-CB-GFP at P1 resulted in efficient transduction of motor neurons and glia in SOD1.sup.G93A mice (FIGS. 1A, 1F, 1K, and 1P). Tail vein injection at P21 (FIG. 1B, FIG. 1G, FIG. 1L, FIG. 1Q) predominantly targeted astrocytes with few GFP positive motor neurons. To test the persistence of transduced cells, AAV9-CB-GFP was intravenously injected at P1 and P21 in SOD1.sup.G93A animals that were sacrificed at end stage (˜P130). Immunofluorescence analysis of lumbar ventral horn (FIG. 1C, FIG. 1D, FIG. 1H, FIG. 1I, FIG. 1M, FIG. 1N, FIG. 1R, FIG. 1S) demonstrated that GFP expression was maintained in astrocytes throughout the disease course. To determine whether SOD1 mediated inflammation and damage would affect AAV9 transduction, we intravenously injected SOD1.sup.G93A mice at P85 and harvested their spinal cords at endstage. There was no difference observed in the transduction pattern of SOD1.sup.G93A mice treated at P21 or P85. Insets in (FIG. 1R, FIG. 1S, FIG. 1T) show co-localization between GFP and GFAP signal. (FIG. 1U) Quantification of transduced cells in ALS spinal cords (for each group tissues were analyzed from 3 animals). GFP and ChAT columns show numbers of cells counted. Bars=100 μm. AAV, adeno-associated virus; P1, postnatal day 1; P21, postnatal day 21; P85, postnatal day 85; GFP, green fluorescent protein; ChAT, choline acetyltransferase; GFAP, glial fibrillary acidic protein.

    [0038] FIGS. 2A-2E. shRNA constructs show efficient reduction of human SOD1 protein in vitro and in vivo. (FIG. 2A) Sequence alignments between human and mouse SOD1 for the regions targeted by the 4 different shRNA constructs tested. (FIG. 2B) shRNA sequences were cloned into an H1 expression construct and transiently transfected into 293 cells. Lysates were collected 72 hours post transfection and analyzed by western blot. (FIG. 2C) Quantification of in vitro suppression of human SOD1 from three separate transient transfections showed >50% reduction in SOD1. (FIG. 2D) shRNA 130 was packaged into AAV9 and injected into SOD1.sup.93A mice at either P1 or P21. Spinal cords (n=3 per time point) were harvested three weeks post injection and analyzed by western blot for human SOD1 protein levels. (FIG. 2E) Quantification of in vivo suppression of human SOD1 within the spinal cord of ALS mice. P1 and P21 injected spinal cords showed 60% and 45% reductions in mutant SOD1 protein, respectively. hSOD1, human superoxide dismutase 1; mSOD1, mouse superoxide dismutase 1; GAPDH, glyceraldehyde 3 phosphate dehydrogenase.

    [0039] FIGS. 3A-3H. Intravenous delivery of AAV9-SOD1-shRNA improves survival and motor performance in SOD1.sup.G93A mice. SOD1.sup.G93A mice received a single intravenous injection of AAV9-SOD1-shRNA at P1 (n=6, green), P21 (n=9, red) or P85 (n=5, blue). Treated mice were monitored up to end stage and compared with non-injected control SOD1.sup.G93A mice (n=15, gray). (FIG. 3A, FIG. 3B, FIG. 3C) AAV9-SOD1-shRNA injection into P1 SOD1.sup.G93A mice significantly delayed median disease onset 39.5 days compared to control animals (unnjected, 103 d; P1, 142.5 d; p<0.05). Injection in P21 (red) or P85 (blue) ALS animals had no effect on disease onset (P21, 110 d; P85, 105 d). However, AAV9-SOD1-shRNA administered at P1, P21 or P85 all significantly extended median survival (FIG. 3B, FIG. 3E) (uninjected, 132 d; P1, 183.5 d P21, 171 d; P85, 162 d; all comparisons to control p<0.001). The P21 group had a significant extension in median disease duration (FIG. 3D) indicating a slowing of disease (uninjected, 29.5 d; P1, 41 d; P21, 49 d; P85, 40 d; Wilcoxon Signed Rank Test p=0.06, 0.01 and 0.12, respectively). (FIG. 3F, FIG. 3G, FIG. 3H) P1 and P21 treated animals maintained their weights, had better hind limb grip strength and rotarod performance when compared to age-matched controls, indicating treated animals retained muscle tone and motor function during their prolonged survival. Lines between bars in (c-e) indicate statistically significant differences. *p<0.05. P1, postnatal day 1; P21, postnatal day 21; P85, postnatal day 85.

    [0040] FIGS. 4A-4T. Intravenous injection of AAV9-SOD1-shRNA reduces mutant protein in spinal cords of SOD1.sup.G93A mice. (FIG. 4A, FIG. 4B, FIG. 4C, FIG. 4D) Images of lumbar spinal cord sections from uninjected (FIG. 4A), P1 injected (FIG. 4B), P21 injected (FIG. 4C) and P85 injected (FIG. 4D) mice were captured with identical microscope settings to qualitatively show SOD1 levels at end stage. SOD1 levels inversely correlate with survival. (FIG. 4E, FIG. 4F, FIG. 4G, FIG. 4H, FIG. 4I, FIG. 4J, FIG. 4K, FIG. 4L, FIG. 4M, FIG. 4N, FIG. 4O, FIG. 4P, FIG. 4Q, FIG. 4R, FIG. 4S, FIG. 4T) Co-labeling for GFP, ChAT and SOD1 shows that AAV9 transduced motor neurons had reduced SOD1 expression (arrows) while cells that lacked GFP maintained high levels of mutant protein (arrowheads). As described in FIG. 1u, higher MN transduction and corresponding SOD1 reduction was observed in P1 injected mice (FIG. 4I, FIG. 4J, FIG. 4K, FIG. 4L) as compared to P21 injected (FIG. 4M, FIG. 4N, FIG. 4O, FIG. 4P) and P85 injected (FIG. 4Q, FIG. 4R, FIG. 4S, FIG. 4T) mice. Bar=100 μm. P1, postnatal day 1; P21, postnatal day 21; P85, postnatal day 85; SOD1, superoxide dismutase 1; GFP, green fluorescent protein; ChAT, choline acetyltransferase.

    [0041] FIGS. 5A-5G. AAV9-SOD1-shRNA improves survival and motor performance in SOD1.sup.G37R mice treated after disease onset. (FIG. 5A) There was no difference in median disease onset between AAV9-SOD1-shRNA and control treated mice. (average age at treatment=215 d versus median onset of 194 d control and 197 d treated; Log Rank Test p=0.46). (FIG. 5B, FIG. 5F) Median survival of AAV9-SOD1-shRNA treated SOD1.sup.G37R mice (n=25) was significantly extended versus control mice (n=21). (control, n=21, 392 d; SOD1 shRNA, n=25, 478.5 d; Log Rank Test p<0.0001) (FIG. 5C, FIG. 5D, FIG. 5E). The early phase of disease was significantly slowed by 73 days in treated mice as compared to control mice (control, 89 d; SOD1 shRNA, 162 d; p<0.0001 Wilcoxon Signed Rank Test) while the late phase of disease showed a non-significant slowing (control, 63 d; SOD1 shRNA, 81 d; p=0.14 Wilcoxon Signed Rank Test). Together this amounted to a 66 day increase in median disease duration (control, 173 d; SOD1 shRNA, 239 d; p<0.0001 Wilcoxon Signed Rank Test). (FIG. 5G) A trend to improved hind limb grip strength appeared in AAV9-SOD1-shRNA treated mice compared to control mice.

    [0042] FIGS. 6A-6P. Intravenous injection of AAV9 in adult SOD1.sup.G37R mice targets astrocytes and motor neurons within the spinal cord. (FIG. 6A, FIG. 6B, FIG. 6C, FIG. 6D, FIG. 6E, FIG. 6F, FIG. 6G, FIG. 6H) Immunofluorescence analysis revealed neuronal as well as glial transduction in both AAV9-CB-GFP (FIG. 6A, FIG. 6B, FIG. 6C, FIG. 6D) and AAV9-SOD1-shRNA treated (FIG. 6E, FIG. 6F, FIG. 6G, FIG. 6H) mice. (FIG. 6, FIG. 6J, FIG. 6K, FIG. 6L, FIG. 6M, FIG. 6N, FIG. 6O, FIG. 6P) Human SOD1 levels appeared reduced in AAV9-SOD1-shRNA treated mice (FIG. 6O) compared with AAV9-GFP treated mice (FIG. 6K). Bar=100 μm. GFP, green fluorescent protein; ChAT, choline acetyltransferase; GFAP, glial fibrillary acidic protein; SOD1, superoxide dismutase 1.

    [0043] FIGS. 7A-7H. Intrathecal infusion of AAV9-SOD1-shRNA in non-human primates leads to efficient reduction in SOD1 levels. (FIG. 7A) A myelogram shortly after intrathecal infusion of AAV9-SOD1-shRNA mixed with contrast shows proper delivery into the subarachnoid space of a cynomolgus macaque. Arrows show diffusion of the contrast agent along the entire spinal cord. (FIG. 7B) Lumbar spinal cord sections from treated monkeys (n=3) were harvested two weeks post injection and stained for GFP using DAB staining. Sections had widespread GFP expression throughout the grey and white matter. (FIG. 7C, FIG. 7D, FIG. 7E) Immunofluorescence analysis of the lumbar spinal cord sections showed robust GFP (FIG. 7C) expression within ChAT (FIG. 7D) positive cells indicating motor neuron transduction (FIG. 7E, merge). (FIG. 7F) Western blot analysis of the lumbar spinal cords showed significant reduction in SOD1 levels in AAV9-SOD1-shRNA injected animals as compared to controls. (FIG. 7G) In vivo quantification of SOD1 knockdown in monkey lumbar spinal cord homogenate (n=3) showed an 87% reduction in animals that received AAV9-SOD1-shRNA compared to uninjected controls. (FIG. 7H) Laser capture microdissection was used to collect motor neurons or surrounding neuropil from injected and control lumbar monkey sections. Collected cells were analyzed for SOD1 levels by qRT-PCR. Motor neurons collected from AAV9-SOD1-shRNA animals (n=3) had a 95±3% reduction in SOD1 RNA. Non-neurons had a 66±9% reduction in SOD1 RNA in AAV9-SOD1-shRNA treated animals. Scale Bars: b=100 μm; e=50 μm. SOD1: Superoxide dismutase 1.

    [0044] FIGS. 8A-8E. Lumbar intrathecal infusion of AAV9-SOD1-shRNA leads to efficient transduction of motor neurons and non-neuronal cells in the cervical, thoracic and lumbar cord resulting in reduction of SOD1. (FIG. 8A, FIG. 8B, FIG. 8C) Immunofluorescence analysis of the three segments of the spinal cord; cervical (FIG. 8A), thoracic (FIG. 8B) and lumbar (FIG. 8C), showed robust GFP (green) expression within Chat (red) positive cells indicating motor neuron transduction. (FIG. 8D) GFP+/Chat+ cell counts show a caudal to rostral gradient of motor neuron transduction ranging from 85% of transduced cells in the lumbar region to more than 50% in the cervical region. (FIG. 8E) SOD1 mRNA levels in cervical, thoracic and lumbar cord section homogenates analyzed by qRT-PCR show significant reduction in SOD1 transcript, consistently with motor neuron transduction. SOD1 levels were normalized to β-actin and AAV9-SOD1-shRNA injected animals were compared to an AAV9-CB-GFP injected control. Scale bars: (FIG. 8A, FIG. 8B, FIG. 8C)=50 μm; Error bars: (FIG. 8D, FIG. 8E)=SD.

    [0045] FIGS. 9A-B. Design of a clinical SOD1 shRNA construct. (FIG. 9A) Original AAV SOD1 shRNA construct contains shRNA sequence against human SOD1 under H1 promoter followed by the expression cassette for GFP which includes CMV enhancer, CBA promoter, modified SV40 intron, and GFP transgene sequence followed by bGH PolyA terminator. SOD1 shRNA expression cassette and GFP expression cassette are flanked by AAV2 ITRs which ensures the packaging of the complete flanked sequence in AAV9 capsid. (FIG. 9B) In clinical SOD1 shRNA construct, the GFP expression cassette is replaced by a stuffer element that contains tandem, noncoding sequences from FDA approved DNA vaccines. ITR: inverted terminal repeats; shRNA, small hairpin RNA; SOD1, superoxide dismutase 1; CMV, cytomegalo virus enhancer; CBA, Chicken β-actin promoter; GFP, green fluorescent protein; bGH pA, bovine growth hormone poly A terminator.

    [0046] FIG. 10. Schematic of clinical SOD1 shRNA construct. Different restriction sites are placed in the clinical SOD1 shRNA construct that allow the cloning of multiple shRNA expression cassettes while maintaining the total distance between the two ITRs.

    [0047] FIGS. 11A-11J. In vitro transfection of clinical SOD1 shRNA construct efficiently reduces human SOD1 protein in HEK293 cells. Representative microscopic fields showing bright-field images of non-transfected control (FIG. 11A), AAV SOD1 shRNA transfected (FIG. 11B) and shuttle vector pJet SOD1 shRNA transfected (FIG. 11C, FIG. 11D) HEK 293 cells, 72 hrs post transfection. Corresponding fluorescence images reveal the lack of GFP fluorescence from pJet SOD1 shRNA transfected HEK 293 cells (FIG. 11G, FIG. 11H) as compared to AAV SOD1 shRNA transfected cells (FIG. 11F). (FIG. 11I) Western blot analysis of the cell lysates confirms the efficient knockdown of human SOD1 protein in pJet SOD1 shRNA transfected cells as compared to the non-transfected control cells. Immunoblot analysis also confirms removal of GFP transgene from pJet SOD1 shRNA construct. (FIG. 11J) Quantification of the in vitro downregulation of SOD1 by pJet SOD1 shRNA. pJet SOD1 shRNA reduces the protein levels of human SOD1 by almost 50% in HEK293 cells as compared to control. This reduction is similar to that achieved with AAV SOD1 shRNA construct.

    [0048] FIG. 12. Schematic of cloning strategy for clinical AAV SOD1 shRNA vector. Clinical SOD1 shRNA construct was cloned into AAV CB MCS vector using Kpn1/SPh1 sites. Kpn1/SPh1 double digest of AAV CB MCS plasmid results in the release of the complete transgene expression cassette from this vector which is further replaced with clinical SOD1 shRNA construct carrying SOD1 shRNA expression cassette and stuffer sequence.

    [0049] FIGS. 13A-13H. Clinical AAV SOD1 shRNA efficiently reduces human SOD1 levels in vitro. HEK293 cells were transfected with clinical AAV SOD1 shRNA plasmid by Calcium phosphate method. Representative microscopic fields showing brightfield images of non-transfected control, AAV SOD1 shRNA and Clinical AAV SOD1 shRNA transfected cells respectively, 72 hrs post-transfection (FIG. 13A, FIG. 13B, FIG. 13C). Successful removal of GFP from clinical AAV SOD1 shRNA was confirmed by lack of GFP expression in Clinical AAV SOD1 shRNA transfected cells (FIG. 13F, FIG. 13G. (FIG. 13G) Western blot analysis of cell lysates, harvested 72 hrs post-transfection confirmed efficient downregulation of SOD1 in clinical AAV SOD1 shRNA transfected cells as compared to control. AAV SOD1 shRNA was used as a positive control. (FIG. 13H) Quantification of the in vitro knockdown of SOD1 by clinical AAV SOD1 shRNA.

    [0050] Figures S1A-SF. AAV9-shRNA-SOD1 administration is well tolerated in WT mice. Female and male WT animals were injected with AAV9-SOD1-shRNA at P1 or P21 and monitored up to 6 months of age. (Figure S1A, Figure SB) Both male and female treated mice showed steady increase in body mass as compared to control animals. (Figure S1C, Figure S1D) Rotarod performance and (Figure S1E, Figure S1F) hind limb grip strength were not affected by P1 or P21 treatment in both groups as compared to respective controls. n=5 per group. WT, wild type; P1, postnatal day 1; P21, postnatal day 21.

    [0051] Figures S2A-S2W. Hematology and Serum Chemistry of AAV9-SOD1-shRNA treated WT animals. (Figure S2A, Figure S2B, Figure S2C, Figure S2D, Figure S2E, Figure S2 F, Figure S2G, Figure S2H, Figure S2I, Figure S2J, Figure S2K, Figure S2L, Figure S2M) Blood was collected from P1 (green) or P21 (red) treated and control (gray) WT animals at 150 days of age for hematology studies. No significant differences were observed between treated and control animals. (Figure S2N, Figure S2O, Figure S2P, Figure S2Q, Figure S2R, Figure S2S, Figure S2T, Figure S2U, Figure S2V, Figure S2W) Serum samples collected at 180 days of age from the same mice showed no significant differences in serum chemistry profile. Mean±SEM. n=5 per group. P1, postnatal day 1; P21, postnatal day 21.

    [0052] Figures S3A-S3H. AAV9-SOD1-shRNA treatment in SOD1.sup.G93A mice reduces astrogliosis. End stage sections from control and AAV9-SOD1-shRNA treated animals were harvested and stained for GFAP, an astrocyte activation marker. P1 (Figure S3B) and P85 (Figure S3D) injected mice showed reduced levels of astrogliosis as compared to control (Figure S3A) mice while P21 (Figure S3C) injected mice showed the maximum reduction. This was consistent with the percent astrocyte transduction achieved in these mice (FIG. 1u). However, no effect was observed on microglia reactivity (Figure S3E, Figure S3F, Figure S3G, Figure S3H). Bar=100 μm. P1, postnatal day 1; P21, postnatal day 21; P85, postnatal day 85.

    [0053] Figures S4A-S4B. Intravenous injection of AAV9-SOD1-shRNA efficiently reduces levels of mutant SOD1 protein in spinal cords of SOD1.sup.G37R mice. (Figure S4A) Following disease onset, AAV9-CB-GFP or AAV9-SOD1-shRNA was injected in SOD1.sup.G37R mice and spinal cords were harvested at end stage and analyzed by western blot for human SOD1 protein levels. (Figure S4B) Quantification of a) shows suppression of human SOD1 within the spinal cord of SOD1.sup.G37R mice (n=4 per group). hSOD1, human superoxide dismutase 1; GAPDH, glyceraldehyde 3 phosphate dehydrogenase.

    [0054] Figures S5A-S5B shRNA 130 efficiently reduces the levels of monkey SOD1 in vitro. (Figure S5A) Sequence alignment of the region targeted by SOD1 shRNA 130 and a single mismatch with the monkey sequence. Monkey sequence corresponds to SOD1 sequence from Rhesus monkey (NM 001032804.1), Cynomolgus monkey (sequenced in-house) and African green monkey. (Figure S5B) The shRNA 130 expression cassette was cloned into lentiviral vector and used to infect Cos-7 cells. Lysates were analyzed 72 hours post infection by qRT PCR for SOD1. shRNA 130 reduced SOD1 transcript levels by 75% in Cos-7 cells.

    EXAMPLES

    [0055] The present invention is illustrated by the following examples. While the present invention has been described in terms of various embodiments and examples, it is understood that variations and improvements will occur to those skilled in the art. Therefore, only such limitations as appear in the claims should be placed on the invention.

    Example 1

    AAV9 Transduction Pattern and Persistence in SOD1.SUP.G93A .Mice

    [0056] We first evaluated the efficiency of AAV9 transduction in the SOD1.sup.G93A mouse model that develops fatal paralytic disease. High copy SOD1.sup.G93A mice were obtained from Jackson Laboratories (Bar Harbor, Me.) and bred within the Kaspar lab. Animals were genotyped before the treatment to obtain SOD1.sup.G93A expressing mice and their wild type littermates. Only female mice were included in the SOD1.sup.G93A experiments. Animals were injected intravenously at postnatal day 1 or day 21 (to be referred to as P1 and P21, respectively) with self-complementary AAV9 expressing GFP from the CMV enhancer/beta-actin (CB) promoter (AAV9-CB-GFP) (n=3 per group). Three weeks post-injection, animals were sacrificed, and spinal cords examined for GFP expression (FIG. 1A, FIG. 1B, FIG. 1C, FIG. 1D, FIG. 1E, FIG. 1F, FIG. 1G, FIG. 1H, FIG. 1I, FIG. 1J, FIG. 1K, FIG. 1L, FIG. 1M, FIG. 1N, FIG. 1O, FIG. 1P, FIG. 1Q, FIG. 1R, FIG. 1S, FIG. 1T, FIG. 1U).

    [0057] All procedures with animals described herein were performed in accordance with the NIH Guidelines and approved by the Research Institute at Nationwide Children's Hospital (Columbus, Ohio), University of California (San Diego, Calif.) or Mannheimer Foundation (Homestead, Fla.) Institutional Animal Care and Use Committees.

    [0058] Transduction efficiency was high in SOD1.sup.G93A astrocytes with GFP expressed in 34±2% and 54±3%, respectively, of P1 and P21 injected spinal grey matter astrocytes (defined by immunoreactivity for GFAP). This efficiency was similar to our previous report of 64±1% in P21 injected wild type animals.sup.18. Motor neurons were a prominent cell type transduced at all levels of the spinal cords of P1 injected SOD1.sup.G93A animals (62±1%), compared with significantly lower targeting to motor neurons in P21 injected animals (8±1%).

    [0059] Although we have previously reported that transduced astrocytes in wild type spinal cords persist with continued GFP accumulation for at least 7 weeks post injection.sup.18, longevity of mutant SOD1 astrocytes (and their continued synthesis of genes encoded by the AAV9 episome) during active ALS-like disease was untested. Therefore, SOD1.sup.G93A mice were injected at P1 and P21 with AAV9-CB-GFP and followed to end-stage (˜P130, n=3 per group) (FIGS. 1c,d,h,i,m,n,r,s). Immunofluorescent examination of the end-stage SOD1.sup.G93A spinal cords from animals injected at P1 and P21 showed a comparable number of GFP-expressing astrocytes as were found 21 days after AAV9 injection (P1: 42±2%, P21: 61±2%). These data are consistent with survival of transduced astrocytes for the duration of disease (˜110 days post injection at P21) in SOD1.sup.G93A mice and that AAV9-encoded gene expression is maintained.

    [0060] Further, recognizing that SOD1 mutant mediated damage, including astrocytic and microglial activation and early changes in the blood brain barrier develop during disease in mice in SOD1 mutant mice.sup.20, we tested if this damage affected AAV9 transduction. SOD1.sup.G93A mice were injected at P85 with AAV9-CB-GFP and sacrificed at endstage (n=3) (FIGS. 1e,j,o,t). Analysis of the spinal cords revealed that the transduction pattern seen in P85 animals was similar to P21 treated animals with astrocytes as the predominant cell type transduced at all levels (51±6% GFP+/GFAP+ cells in lumbar grey matter).

    Example 2

    [0061] Development of an shRNA Sequence Specific for Human SOD1

    [0062] To specifically target the human SOD1 mRNA, four shRNA constructs targeting human SOD1 were generated and obtained from the Life Technologies design tool. The constructs that had a minimum of four base mismatches compared to the mouse mRNA sequence (FIG. 2A). The base numbers for the human sequences shown correspond to record number CCDS33536.1 in the NCBI CCDS database. These constructs were cloned in pSilencer 3.1 (Genscript) under the human H1 promoter and tested in vitro. shRNA 130 along with H1 promoter was further cloned into an AAV vector along with a reporter GFP under Chicken Beta-Actin promoter to identify the transduced cells. Human 293 cells were transfected with each cassette. The HEK-293 cells were maintained in IMDM medium containing 10% FBS, 1% L-glutamine and 1% penicillin/streptomycin. Upon reaching ˜60% confluence, cells were transfected with pSilencer 3.1 containing the shRNAs being tested. Protein lysates were prepared 72 hours post transfection and analyzed for SOD1 levels by western blot. All four sequences reduced SOD1 protein levels by >50% (FIG. 2B, FIG. 2C

    [0063] shRNA130 was selected for further experiments because it produced the most consistent knockdown across three separate transfection experiments. It was cloned into a self-complementary AAV9 vector that also contained a GFP gene whose expression would identify transduced cells (referred to as AAV9-SOD1-shRNA). Self-complementary AAV9-SOD1-shRNA was produced by transient transfection procedures using a double-stranded AAV2-ITR-based CB-GFP vector, with a plasmid encoding Rep2Cap9 sequence as previously described along with an adenoviral helper plasmid pHelper (Stratagene, Santa Clara, Calif.) in 293 cells.sup.18.

    [0064] To confirm that the shRNA could suppress accumulation of human SOD1, SOD1.sup.G93A mice (n=3) were injected intravenously with AAV9-SOD1-shRNA at either P1 or P21. For neonatal mouse injections, postnatal day 1-2 SOD1.sup.G3A pups were utilized. Total volume of 50 μl containing 5×10.sup.11 DNAse resistant viral particles of AAV9-SOD1-shRNA (Virapur LLC, San Diego, Calif.) was injected via temporal vein as previously described.sup.18. A correct injection was verified by noting blanching of the vein. After the injection, pups were returned to their cage. Animals were euthanized three weeks post injection and the spinal cords were harvested and analyzed by immunoblotting for both human (mutant) and murine (wild-type) SOD1 protein. P1 and P21 injected spinal cords showed 60% and 45% reductions in mutant SOD1 protein, respectively (FIGS. 2d,e). Murine SOD1 levels remained unchanged in response to human SOD1 knockdown.

    Example 3

    AAV9-SOD1-shRNA is Safe and Well Tolerated in Wild Type Mice

    [0065] To determine whether high dose AAV9-SOD1-shRNA would be safe, normal mice of both sexes were intravenously injected at P1 or P21 (P1=5 males, 5 females at 5×10.sup.11 vg; P21=5 males, 5 females at 2×10.sup.12 vector genomes (vg)) and then monitored up to 6 months of age. Both P1 and P21 injected mice showed a steady increase in body mass similar to untreated mice (Figure S1A-S1F). Weekly behavioral tests observed no significant differences between injected and control groups in motor skills (measured by rotarod) as well as in hind limb grip strength. At 150 and 180 days of age, blood samples were collected. Complete and differential blood counts of both treated and untreated groups showed similar blood chemistry parameters (Figure S2). Serum samples from both groups showed no significant differences in the levels of alkaline phosphatase, creatinine, blood urea nitrogen, potassium, sodium and chloride. Finally, all the animals were sacrificed at the age of 180 days. Histopathological analyses by a pathologist blinded to treatment group revealed no significant alterations in the AAV9-SOD1-shRNA treated animals compared to uninjected controls (data not shown). We conclude that both administration of AAV9 and sustained shRNA expression were apparently safe and well tolerated.

    Example 4

    Extended Survival of SOD1.SUP.G93A .Mice from

    AAV9 Mediated Reduction in Mutant SOD1 Even when Initiated Mid-Disease

    [0066] To test the efficacy of AAV9-mediated SOD1 reduction, we treated cohorts of SOD1.sup.G93A mice with a single intravenous injection of AAV9-SOD1-shRNA before (P1, 5×10.sup.11 vg, n=6 and P21, 2×10.sup.12 vg, n=9) or after (P85, 3×10.sup.2 vg, n=5) onset, recognizing that many astrocytes, but few motor neurons, would be transduced at the two later time points. For adult tail vein injections, animals were placed in a restraint that positioned the mouse tail in a lighted, heated groove. The tail was swabbed with alcohol then injected intravenously with AAV9-SOD1-shRNA.

    [0067] Onset of disease (measured by weight loss from denervation-induced muscle atrophy) was significantly delayed by a median of 39.5 days (FIG. 3A, FIG. 3C; uninjected, 103 d; P1, 142.5 d; p<0.05, Wilcoxon Signed Rank Test) in the P1 injected cohort, but was not affected by either of the later injections (P21, 110 d; P85, 105 d). P1 and P21 treated animals maintained their weights, had better rotarod performance and hind limb grip strength when compared to age-matched controls, indicating treated animals maintained muscle tone and motor function during their prolonged survival (FIG. 3F, FIG. 3G, FIG. 3H). Survival was significantly extended by AAV9 injection at all three ages, yielding survival times 30-51.5 days beyond that of uninjected SOD1.sup.93A mice (uninjected, 132 d; P1, 183.5 d; P21, 171 d; P85, 162 d; Log-Rank Test p=<0.0001, 0.0003 and 0.001, respectively) (FIG. 3B, FIG. 3E). Defining disease duration as the time from onset to end-stage revealed that the P21 treatment group had significantly increased duration, indicative of slowed disease progression, compared to uninjected controls (uninjected, 29.5 d; P21, 49 d; Wilcoxon Signed Rank Test p=0.01), with trends toward slowed progression in animals injected at the other two ages (P1, 41 d; P85, 40 d; p=0.06 and 0.12, respectively) (FIG. 3D). The lower percentage of targeted non-neuronal cells at P1 versus those targeted at P21 (FIG. 1U) suggests that a minimum number of non-neuronal cells must be targeted to slow disease progression in the fast progressive SOD1.sup.G93A model (FIG. 1U).

    Example 5

    Reduction of Mutant SOD1 in AAV9 Infected Cells in Treated SOD1.SUP.G93A .Mice

    [0068] Indirect immunofluorescence with an antibody that recognizes human, but not mouse SOD1, was used to determine accumulated mutant SOD1 levels in end-stage spinal cords of treated and control mice. Human SOD1 levels in end-stage spinal cord sections inversely correlated with increased survival (FIG. 4A, FIG. 4B, FIG. 4C, FIG. 4D). At end-stage, P1 (FIG. 4B), P21 (FIG. 4C) and P85 (FIG. 4D) AAV9-SOD1-shRNA injected animals had lower levels of mutant SOD1 when compared with uninjected SOD1.sup.G93A animals (FIG. 4A). SOD1 expression within transduced motor neurons (identified by GFP and ChAT expressing cells) was reduced compared to surrounding neurons that had not been transduced to express viral encoded GFP (FIG. 4H, FIG. 4L, FIG. 4P, FIG. 4T; arrows versus arrowheads). Moreover, immunofluorescence imaging of end-stage spinal cords revealed corresponding reduction in astrogliosis, but no difference in microgliosis in AAV9-SOD1-shRNA treated animals versus controls (Figures S3A-S3H).

    Example 6

    Therapeutic Slowing of Disease Progression with Peripheral Injection of AAV9 after Onset

    [0069] To determine if AAV9-mediated mutant SOD1 reduction would slow disease progression, a cohort of SOD1.sup.G37R mice.sup.6 were injected intravenously with AAV9-SOD1-shRNA after disease onset (average age at treatment=215 d versus median onset of 197 d in treated animals; Log Rank Test p=0.46; FIG. 5A). loxSOD1.sup.G37R ALS mice, carrying a human mutant SOD1.sup.G37R transgene flanked by lox p sites under its endogenous promoter, were maintained in as previously described.sup.37. A combination of AAV9-CB-GFP (n=9) and uninjected (n=12) littermates were used as controls.

    [0070] Post hoc analysis showed no differences between GFP and uninjected animals, therefore the groups were compiled as “control” in FIGS. 5A-5G. Animals were evaluated weekly for body weight and hind limb grip strength and monitored until end-stage. AAV9-SOD1-shRNA treatment after disease onset significantly extended median survival by 86.5 days over control animals (control, n=21, 392 d; SOD1 shRNA, n=25, 478.5 d; Log Rank Test p<0.0001). Early disease duration, defined by the time from peak weight to 10% weight loss, was significantly slowed (control, 89 d; SOD1 shRNA treated mice, 162 days; Wilcoxon Signed Rank Test p<0.01; FIG. 5C). A continuing trend toward slowing of later disease (10% weight loss to end stage) was also seen (control, 63 d; SOD1 shRNA treated mice, 81 d; Wilcoxon Signed Rank Test p=0.1389; FIG. 5D). Overall disease duration following AAV9-SOD1-shRNA therapy rose to 239 d after disease onset versus 173 d in control mice (Wilcoxon Signed Rank Test p<0.0001; FIG. 5E). Consistent with the slowed progression, AAV9 therapy maintained grip strength relative to control SOD1 mutant animals (FIG. 5g). The 86.5 day extension in survival surpassed the 62 day extension seen in transgenic studies that used astrocyte-specific Cre expression to inactivate the mutant SOD1.sup.G37R transgene.sup.8, presumably reflecting efficient AAV9 transduction of astrocytes after peripheral delivery and the possible transduction of other cell types (especially microglia.sup.6) whose synthesis of mutant SOD1 accelerates disease progression.

    [0071] Histological examination of end-stage SOD1.sup.G37R treated animals revealed similar levels of intraspinal cell transduction in animals treated with AAV9-SOD1-shRNA or AAV9-GFP (FIGS. 6A-6P). GFP expression was predominantly observed within motor neurons and astrocytes of both groups, and SOD1 expression was detectably decreased only in animals that received AAV9-SOD1-shRNA (FIG. 6K, FIG. 6O). Immunoblotting of whole spinal cord extracts from end stage SOD1.sup.G37R mice revealed an 80% reduction in hSOD1 protein levels in AAV9-SOD1-shRNA treated animals compared to controls (Figures S4A-S4B).

    Example 7

    AAV9 Mediated Suppression of SOD1 in Non-Human Primates

    [0072] To test whether SOD1 levels could be efficiently lowered using AAV9 in the non-human primate spinal cord, AAV9 was injected intrathecally via lumbar puncture. This method was chosen over systemic delivery to decrease the amount of virus required and to minimize any effects from reduction of SOD1 in peripheral tissues. One year old cynomolgus macaques (Macaca fascicularis) with average body weight of 2 kg were used for this study at the Mannheimer Foundation. Regular monitoring of overall health and body weight was performed prior and after the injections to assess the welfare of the animals.

    [0073] Sequencing of cDNA copied from mRNA isolated from African Green Monkey (COS cells) and the Cynomolgus macaque verified that the 130 shRNA had a single base mismatch to either sequence (Figure S5A-S5B). The 130 shRNA expression cassette was inserted into a lentiviral vector which was then used to transduce COS cells. Cos-7 cells were maintained in DMEM with 10% FBS and 1% penicillin/streptomycin. Cells were infected with a lentiviral vector expressing SOD1 shRNA 130 under the H1 promoter and RFP under CMV promoter. RNA was extracted from infected and non-infected cells 72 hours post infection using an RNAeasy Kit (Qiagen). cDNA was prepared using RT.sup.2 First strand synthesis kit (SABiosciences). SOD1 transcript levels were analyzed by qRT-PCR which revealed that the monkey SOD1 mRNA was reduced by ˜75% in 130 shRNA transduced cells compared to mock transduced control cells (Figure S5A-S5B).

    [0074] The AAV9-SOD1-shRNA virus (1×10.sup.13 vg/kg) was infused along with contrast agent via lumbar puncture into the subarachnoid space of three male cynomolgus macaques and one control subject was injected with AAV9-CB-GFP (1×10.sup.13 vg/kg) (FIG. 7A). Each intrathecal injection was performed by lumbar puncture into the subarachnoid space of the lumbar thecal sac. AAV9 was resuspended with omnipaque (iohexol), an iodinated compound routinely used in the clinical setting. Iohexol is used to validate successful subarachnoid space cannulation and was administered at a dose of 100 mg/Kg. The subject was placed in the lateral decubitus position and the posterior midline injection site at ˜L4/5 level identified (below the conus of the spinal cord). Under sterile conditions, a spinal needle with stylet was inserted and subarachnoid cannulation was confirmed with the flow of clear CSF from the needle. In order to decrease the pressure in the subarachnoid space, 0.8 ml of CSF was drained, immediately followed by injection with a mixture containing 0.7 mL iohexol (300 mg/ml formulation) mixed with 2.1 mL of virus (2.8 ml total).

    [0075] No side effects from the treatments were identified. Two weeks post injection, the spinal cords were harvested for analysis of GFP expression and SOD1 RNA levels. GFP expression was seen broadly in neuronal and astrocytic cells throughout the grey and white matter of the lumbar spinal cord, the area closest to the site of injection (FIG. 7B, FIG. 7C, FIG. 7D, FIG. 7E). Immunoblotting of extracts of lumbar spinal cord revealed 87% reduction in monkey SOD1 protein levels (FIG. 7F, FIG. 7G). Laser capture microdissection was then used to isolate total RNA from motor neurons as well as from glia in the nearby neuropil. Analysis by quantitative RT-PCR using primers specific for monkey SOD1 (and normalized to actin) confirmed a 95±3% knockdown in the motor neuron pool and a 66±9% knockdown in the neuropil pool when compared to samples from a control animal (FIG. 7H).

    [0076] Next we examined the level of cell transduction throughout the spinal cord including cervical, thoracic and lumbar segments. GFP was found to be expressed broadly within all sections analyzed (FIG. 8A-8C). Motor neuron counts revealed a caudal to rostral gradient in cell transduction, with the cervical region showing more than 50% of GFP/Chat+ motor neurons, increasing to 65% in the thoracic region and reaching a remarkable 80% in the lumbar region (FIG. 8D). In order to determine the overall level of SOD1 knockdown achieved with this transduction pattern, qRT-PCR for SOD1 was performed on whole section homogenates from cervical, thoracic and lumbar cord segments. The results confirmed robust SOD1 reduction at all three spinal cord levels, ranging from a 60% decrease in the cervical segment, a 70% decrease in the thoracic region and an 88% decrease in the lumbar region (FIG. 8E), consistent with the proportion of cells transduced in each region.

    DISCUSSION

    [0077] The examples above show that intravenous administration of AAV9-SOD1-shRNA is safe and well tolerated in wild type mice, with the absence of adverse effects after long-term assessment. This approach have achieved one of the longest extensions in survival ever reported in the rapidly progressive SOD1.sup.G93A mouse model of ALS (increasing survival by 39% when treatment is initiated at birth). Even more encouraging, markedly slowed disease progression is seen even when AAV9 therapy to reduce mutant SOD1 synthesis is applied after disease onset in SOD1.sup.G37R mice, thereby significantly extending survival. Thus, the vascular delivery paradigm in mice represents a proof of concept that mutant SOD1 knockdown after disease onset can be beneficial in both rapid and more slowly progressive models of ALS at clinically relevant points in disease. Together, these data show that robust targeting and suppression of SOD1 levels via AAV9-mediated delivery of shRNA is effective in slowing disease progression in mouse models of ALS, critically even when treatment is initiated after onset.

    [0078] Multiple recent studies have brought forward the hypothesis that wild-type SOD1 may contribute through misfolding to the pathogenic mechanism(s) that underlie sporadic ALS through a pathway similar to that triggered by mutant SOD1.sup.14, 30-32 Included in this body of evidence is our own demonstration that astrocytes produced from sporadic ALS patients are toxic to co-cultured motor neurons and that toxicity is alleviated by siRNA-mediated reduction in wild type SOD1.sup.30. This evidence creates the potential that a proportion of sporadic ALS patients could also benefit from an AAV9-mediated SOD1 reduction approach that we have demonstrated to be effective in slowing disease progression in mice that develop fatal, ALS-like disease from expressing ALS-causing mutations in SOD1.

    [0079] Finally, for translation of an AAV9-mediated suppression of SOD1 synthesis to the human setting, we have determined that infusion directly into the CSF at the lumbar level in a non-human primate produce substantial SOD1 reduction by targeting both motor neurons and non-neuronal cells. This outcome provides strong support for extending these efforts to an adult human by direct injection into CSF, as previously proposed.sup.33, 34, so as to 1) limit the cost of viral production, 2) reduce the possibility that chronic suppression of SOD1 in the periphery may have deleterious consequences, and 3) reduce viral exposure to the peripheral immune system.sup.33. These data strongly indicate AAV9-SOD1-shRNA as a treatment for ALS.

    Techniques/Methods Used in Examples 1-7

    [0080] Perfusion and Tissue Processing. Control and treated SOD1.sup.G93A mice were sacrificed at either 21 days post injection or at endstage for immunohistochemical analysis. Animals were anesthetized with xylazene/ketamine cocktail, transcardially perfused with 0.9% saline, followed by 4% paraformaldehyde. Spinal cords were harvested, cut into blocks of tissue 5-6 mm in length, and then cut into 40 μm thick transverse sections on a vibratome (Leica, Bannockburn, Ill.). Serial sections were kept in a 96-well plate that contained 4% paraformaldehyde and were stored at 4° C. End stage loxSOD1.sup.G37R mice were anesthetized using isoflurane and perfused with 4% paraformaldehyde. Spinal cord segments, including cervical, thoracic and lumbar segments were dissected. Following cryoprotection with 20% sucrose/4% paraformaldehyde overnight, spinal cords were frozen in isopentane at −65° C., and serial 30 μm coronal sections were collected free floating using sliding microtome.

    [0081] For safety studies, P1, P21 treated and control wild type mice were sacrificed at 180 days of age. Animals were anesthetized using xylazene/ketamine cocktail and perfused with 0.9% saline. Different tissues were removed and stored in 10% buffered formalin. These tissues were further processed, blocked and mounted for hematoxilin & eosin staining by the Nationwide Children's Hospital Morphology Core.

    [0082] Cynomolgus monkeys injected with virus were euthanized 2 weeks post injection. Animals were anesthetized with sodium pentobarbital at the dose of 80-100 mg/kg intravenously and perfused with saline solution. Brain and spinal cord dissection were performed immediately and tissues were processed either for nucleic acid isolation (snap frozen) or post-fixed in 4% paraformaldehyde and subsequently cryoprotected with 30% sucrose and frozen in isopentane at −65° C. 12 μm coronal sections were collected from lumbar cord using a cryostat for free floating immunostaining.

    [0083] Immunohistochemistry. Mouse spinal cords were stained as floating sections. Tissues were washed three-times for 10 minutes each in TBS, then blocked in a solution containing 10% donkey serum, 1% Triton X-100 and 1% penicillin/streptomycin for two hours at room temperature. All the antibodies were diluted with the blocking solution. Primary antibodies used were as follows: rabbit anti-GFP (1:400, Invitrogen, Carlsbad, Calif.), rabbit anti-SOD1 (1:200, Cell signaling, Danvers, Mass.), goat anti-ChAT (1:50 Millipore, Billerica, Mass.), mouse anti-GFAP (1:200, Millipore, Billerica, Mass.), chicken anti GFAP (1:400, Abcam, Cambridge, Mass.), and rabbit anti-Iba1 (1:400, Wako, Richmond Va.). Tissues were incubated in primary antibody at 4° C. for 48-72 hours then washed three times with TBS. After washing, tissues were incubated for 2 hours at room temperature in the appropriate FITC-, Cy3-, or Cy5-conjugated secondary antibodies (1:200 Jackson Immunoresearch, Westgrove, Pa.) and DAPI (1:1000, Invitrogen, Carlsbad, Calif.). Tissues were then washed three times with TBS, mounted onto slides then coverslipped with PVA-DABCO. All images were captured on a Zeiss-laser-scanning confocal microscope.

    [0084] For DAB staining, monkey spinal cord sections were washed three times in TBS, blocked for 2 h at RT in 10% donkey serum and 1% Triton X-100. Sections were then incubated overnight at 4° C. with rabbit anti-GFP primary antibody (1:1000 Invitrogen, Carlsbad, Calif.) diluted in blocking buffer. The following day, tissues were washed with TBS 3 times, incubated with biotinylated secondary antibody anti-rabbit (1:200 Jackson Immunoresearch, Westgrove, Pa.) in blocking buffer for 30 min at RT, washed 3 times in TBS and incubated for 30 min at RT with ABC (Vector, Burlingame, Calif.). Sections were then washed for 3 times in TBS and incubated for 2 min with DAB solution at RT and washed with distilled water. These were then mounted onto slides and covered with coverslips in mounting medium. All images were captured with the Zeiss Axioscope.

    [0085] Motor neuron and astrocyte quantification. For MN quantification, serial 40 μm thick lumbar spinal cord sections, each separated by 480 μm, were labeled as described for GFP and ChAT expression. Stained sections were serially mounted on slides from rostral to caudal, then coverslipped. Sections were evaluated using confocal microscopy (Zeiss) with a 40× objective and simultaneous FITC and Cy3 filters. The total number of ChAT positive cells found in the ventral horns with defined soma was tallied by careful examination through the entire z-extent of the section. GFP labeled cells were quantified in the same manner, while checking for co-localization with ChAT. For astrocyte quantification, as with MNs, serial sections were stained for GFP, GFAP and then mounted. Using confocal microscopy with a 63× objective and simultaneous FITC and Cy5 filters, random fields in the ventral horns of lumbar spinal cord sections from tail vein injected animals were selected. The total numbers of GFP and GFAP positive cells were counted from a minimum of at least 24-fields per animal while focusing through the entire z extent of the section. Spinal cord sections of 3 animals per group were examined for MN and astrocyte quantification.

    [0086] Immunoblot analysis. Spinal cords were harvested from P1, P21 injected and control SOD1.sup.G93A mice 21 days post injection and from treated and control monkeys 2 weeks post injection of AAV9-SOD1-shRNA. Spinal cords were homogenized and protein lysates were prepared using T-Per (Pierce) with protease inhibitor cocktail. Samples were resolved on SDS-PAGE according to manufacturer's instructions. Primary antibodies used were rabbit anti-SOD1 (1:750, Cell signaling, Danvers, Mass.) mouse anti-SOD1 (1:750, Millipore, Billerica, Mass.), rabbit anti-SOD1 (1:1000, Abcam, Cambridge, Mass.), rabbit anti-Actin (1:1000, Abcam, Cambridge, Mass.) and mouse anti-GAPDH (1:1000, Millipore, Billerica, Mass.). Secondary antibodies used were anti-rabbit HRP (1:10000-1:50000) and anti-mouse HRP (1:10000). Densitometric analysis was performed using Image J software.

    [0087] Laser Capture Microdissection. 12 □m lumbar spinal cord frozen sections were collected onto PEN membrane slides (Zeiss, Munich, Germany) and stained with 1% Cresyl violet (Sigma, St. Louis, Mo.) in methanol. Sections were air dried and stored at −80° C. After thawing, motor neurons were collected within 30 min from staining using the laser capture microdissector PALM Robo3 Zeiss) using the following settings: Cut energy: 48, LPC energy: 20, Cut focus: 80/81, LPC focus: 1, Position speed: 100, Cut speed: 50. About 500 MNs were collected per animal. Non-neuronal cells from the ventral horn were collected from the same sections after collecting the motor neurons.

    [0088] qRT-PCR. RNA from laser captured cells or whole spinal cord sections from the cervical, thoracic and lumbar segments was isolated using the RNaqueous Micro Kit (Ambion, Grand Island, N.Y.) according to manufacturer's instructions. RNA was then reverse-transcribed into cDNA using the RT.sup.2 HT First Strand Kit (SABiosciences, Valencia, Calif.). 12.5 ng RNA were used in each Q-PCR reaction using SyBR Green (Invitrogen, Carlsbad, Calif.) to establish the relative quantity of endogenous monkey SOD1 transcript in animals who had received the AAV9-SOD1-shRNA compared to animals who had received only AAV9-GFP. Each sample was run in triplicate and relative concentration calculated using the ddCt values normalized to endogenous actin transcript.

    [0089] Behavior and Survival Analysis. Treated and control SOD1.sup.G93A mice were monitored for changes in body mass twice a week. loxSOD1.sup.G37R mice were weighed on a weekly basis. Motor coordination was recorded using a rotarod instrument (Columbus Instruments, Columbus, Ohio). Each weekly session consisted of three trials on the accelerating rotarod beginning at 5 rpm/min. The time each mouse remained on the rod was registered. Both SOD1.sup.G93A and loxSOD1.sup.G37R mice were subjected to weekly assessment of hindlimb grip strength using a grip strength meter (Columbus Instruments, Columbus, Ohio). Each weekly session consisted of 3 (SOD1.sup.G93A mice) or 5 (loxSOD1.sup.G37R mice) tests per animal. Survival analysis was performed using Kaplan-Meier survival analysis. End stage was defined as an artificial death point when animals could no longer “right” themselves within 30 sec after being placed on its back. Onset and disease progression were determined from retrospective analysis of the data. Disease onset is defined as the age at which the animal reached its peak weight. Disease duration is defined as the time period between disease onset and end stage. Early disease duration is the period between peak weight and loss of 10% of body weight while late disease duration is defined as the period between 10% loss of body weight until disease end stage. Due to shorter life span of SOD1.sup.G93A animals, we did not assess the distinction between the early and late progression.

    [0090] For toxicity analysis following injection at P1 or P21, treated and control WT mice were subjected to behavioral analysis starting at ˜30 days of age and monitored up to 6 months. Body mass was recorded weekly while rotarod performance and hindlimb grip strength were recorded biweekly.

    [0091] Hematology and Serum Studies. Blood samples were collected in (K2) EDTA microtainer tubes (BD) from treated and control WT mice at 150 days of age by mandibular vein puncture. The same animals were bled at 180 days of age and blood was collected in serum separator microtainer tubes. The blood was allowed to clot for an hour and was then centrifuged at 10,000 rpm for 5 minutes. The clear upper phase (serum) was collected and frozen at −80° C. Hematological and serum analysis were conducted by Ani Lytics Inc, Gaithersburg, Md.

    [0092] Statistical analysis. All statistical tests were performed using the GraphPad Prism (San Diego, Calif.) software package. Kaplan Meier survival analyses were analyzed by the Log Rank Test. Comparisons of median disease durations and survival times were analyzed by the Wilcoxon Signed Rank Test.

    Example 8

    Development of a Clinical SOD1 shRNA Construct

    [0093] The AAV SOD1 shRNA vector described in Example 2 carries shRNA against human SOD1 sequence under the H1 promoter (FIG. 9A). The same vector also contains a GFP expression cassette which expresses GFP under a CBA promoter. The other regulatory elements present in this cassette include CMV enhancer, SV40 intron and bGH PolyA terminator sequence. We show herein that AAV9 SOD1 shRNA administration results in efficient SOD1 downregulation along with robust expression of GFP in vitro as well as in vivo. No significant alterations were observed after the long term assessment of wild-type mice administered with AAV9 SOD1 shRNA. These results suggested that there are no evident off-target effects due to the long-term expression of SOD1 shRNA as well as overexpression of GFP. Although we did not find GFP toxicity in our mice, several reports have shown the adverse effects of GFP overexpression in vitro and in vivo. Therefore, to eliminate the possibility of GFP toxicity altogether, the SOD1 shRNA construct of Example 2 was modified by replacing the GFP expression cassette with a non-coding stuffer sequence while maintaining the size of the total DNA construct flanked by the ITRs (FIG. 9B). This is important as the distance between the two ITR sequences greatly affects the packaging capacity of the flanked construct into AAV9 capsids[321-324].

    [0094] To date, none of the FDA approved stuffer sequences are readily available. There are, however, several plasmid backbones that are approved by FDA for the human administration. Small DNA fragments were picked from these plasmids which do not correspond to any essential DNA sequences necessary for selection and replication of the plasmid or the elements of the transcriptional units. The plasmid backbones are listed in Table 1. The DNA elements from different plasmids were arranged in tandem to generate a complete, 1607 bp stuffer sequence (SEQ ID NO: 22). Finally, a DNA construct containing the SOD1 shRNA expression cassette, followed by the stuffer sequence was synthesized from Genscript.

    TABLE-US-00004 TABLE 1 Plasmid ClinicalTrials.gov Backbone Condition Intervention Phase Identifier pVax1 Early Stage Non- Recombinant DNA- 1 NCT00062907 Small pVAX/L523S Cell Lung Cancer pCDNA3 Chronic Hepatitis B DNA vaccine 1, 2 NCT00536627 pCMVS2.S pUCMV3 Stage III Ovarian pUMVC3-hIGFBP-2 1 NCT01322802 Epithelial Cancer multi-epitope plasmid Stage III Ovarian DNA vaccine Germ Cell Tumor Stage IV Ovarian Epithelial Cancer Stage IV Ovarian Germ Cell Tumor pBK- Prostate Cancer NY-ESO-1 plasmid 1 NCT00199849 CMV Bladder Cancer DNA Cancer Vaccine Non-Small Cell Lung Cancer Esophageal Cancer Sarcoma pGA2 HIV Infections pGA2/JS2 Plasmid DNA 1 NCT00043511 Vaccine

    [0095] Clinical SOD1 shRNA construct has shRNA against human SOD1 under H1 promoter which is followed by the non-coding stuffer sequence. This construct is designed in such a way that multiple shRNA expression cassettes can be added to the final vector by simultaneous removal of the stuffer sequence. Restriction endonuclease sites have been added to the stuffer sequence so that a part of the stuffer can be removed when another shRNA expression cassette is added (FIG. 10). This simultaneous removal and addition of DNA sequences would help maintaining the optimal size of the whole construct between the ITRs (˜2.0 kb) to achieve efficient packaging.

    [0096] Clinical SOD1 shRNA construct from Genscript was cloned into pJet1.2 shuttle vector via EcoRV. This parental clone was screened using various restriction endonucleases designed within the construct to confirm the correct clone. Kpn1/Sph1 double digestion of pJet SOD1 shRNA confirmed the presence of the complete construct (2023 bp) while Xba1 digestion confirmed the presence of SOD1 shRNA expression cassette (414 bp) and the stuffer element, along with pJet backbone (˜3000 bp). EcoRV/Pme1 double digestion also revealed the presence of stuffer element.

    Example 9

    Clinical SOD1 shRNA Efficiently Reduces Human SOD1 Protein Levels In Vitro

    [0097] To determine the efficacy of the de novo synthesized SOD1 shRNA construct to downregulate SOD1 levels, HEK293 cells were transfected with pJet SOD1 shRNA plasmid using Calcium Phosphate method. AAV SOD1 shRNA plasmid was used as a positive control. Immunofluorescence analysis of HEK293 cells, 72 hrs post transfection revealed the lack of native GFP fluorescence from pJet SOD1 shRNA transfected cells as compared to AAV9 SOD1 shRNA transfected cells. Immunoblot analysis of cell lysates from these cells further confirmed the successful replacement of GFP from pJet SOD1 shRNA plasmid. Importantly, pJet SOD1 shRNA resulted in efficient downregulation of SOD1 protein levels (>50%), similar to AAV SOD1 shRNA plasmid. See FIG. 11A-11J.

    Example 10

    Generation of Clinical AAV SOD1 shRNA

    [0098] Clinical SOD1 shRNA construct was further cloned into an AAV.CB.MCS vector using Kpn1/Sph1 sites to generate clinical AAV SOD1 shRNA plasmid (FIG. 12). AAV.CB.MCS was generated from AAV.CB.GFP plasmid obtained from merion Scientific by replacing GFP with a multiple cloning site (MCS). Cloning of clinical SOD1 shRNA construct at Kpn1/Sph1 sites puts it between the two AAV2 ITRs which facilitates the packaging of the construct in AAV9 viral capsids. See FIG. 12.

    [0099] Clinical AAV SOD1 shRNA plasmid was screened with restriction endonucleases to confirm the presence of SOD1 shRNA expression cassette (Xba1 digest), stuffer sequence (EcoRV/Pme1 double digest) and also intact ITR sequences (Sma1 digest).

    Example 11

    Clinical AAV SOD1 shRNA Efficiently Reduces Human SOD1 Protein Levels In Vitro

    [0100] Clinical AAV SOD1 shRNA plasmid was transfected in HEK293 cells to determine its knockdown efficiency. Similar to the pJet SOD1 shRNA plasmid, clinical AAV SOD1 shRNA transfected cells were devoid of any GFP expression as evident by immunofluorescence (FIG. 13A-F) and immunoblot assay (FIG. 13G). More importantly, clinical AAV SOD1 shRNA efficiently reduced human SOD1 protein levels in HEK293 cells by more than 50% (FIG. 13G, FIG. 13H). Altogether, these results confirmed the successful generation of clinical AAV SOD1 shRNA vector with functional SOD1 shRNA expression cassette and complete removal of the transgene expression cassette.

    DOCUMENTS REFERENCED

    [0101] 1. Da Cruz, S. & Cleveland, D. W. Understanding the role of TDP-43 and FUS/TLS in ALS and beyond. Curr Opin Neurobiol 21, 904-919 (2011). [0102] 2. Rosen, D. R. et al. Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature 362, 59-62 (1993). [0103] 3. Ilieva, H., Polymenidou, M. & Cleveland, D. W. Non-cell autonomous toxicity in neurodegenerative disorders: ALS and beyond. The Journal of cell biology 187, 761-772 (2009). [0104] 4. Chattopadhyay, M. & Valentine, J. S. Aggregation of copper-zinc superoxide dismutase in familial and sporadic ALS. Antioxidants & redox signaling 11, 1603-1614 (2009). [0105] 5. Prudencio, M., Hart, P. J., Borchelt, D. R. & Andersen, P. M. Variation in aggregation propensities among ALS-associated variants of SOD1: correlation to human disease. Human molecular genetics 18, 3217-3226 (2009). [0106] 6. Boillee, S. et al. Onset and progression in inherited ALS determined by motor neurons and microglia. Science 312, 1389-1392 (2006). [0107] 7. Kang, S. H. et al. Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis. Nature neuroscience 16, 571-579 (2013). [0108] 8. Yamanaka, K. et al. Astrocytes as determinants of disease progression in inherited amyotrophic lateral sclerosis. Nature neuroscience 11, 251-253 (2008). [0109] 9. Di Giorgio, F. P., Boulting, G. L., Bobrowicz, S. & Eggan, K. C. Human embryonic stem cell-derived motor neurons are sensitive to the toxic effect of glial cells carrying an ALS-causing mutation. Cell Stem Cell 3, 637-648 (2008). [0110] 10. Di Giorgio, F. P., Carrasco, M. A., Siao, M. C., Maniatis, T. & Eggan, K. Non-cell autonomous effect of glia on motor neurons in an embryonic stem cell-based ALS model. Nature neuroscience 10, 608-614 (2007). [0111] 11. Marchetto, M. C. et al. Non-cell-autonomous effect of human SOD1 G37R astrocytes on motor neurons derived from human embryonic stem cells. Cell Stem Cell 3, 649-657 (2008). [0112] 12. Haidet-Phillips, A. M. et al. Astrocytes from familial and sporadic ALS patients are toxic to motor neurons. Nat Biotechnol 29, 824-828 (2011). [0113] 13. Bosco, D. A. et al. Wild-type and mutant SOD1 share an aberrant conformation and a common pathogenic pathway in ALS. Nature neuroscience 13, 1396-1403 (2010). [0114] 14. Pokrishevsky, E. et al. Aberrant localization of FUS and TDP43 is associated with misfolding of SOD1 in amyotrophic lateral sclerosis. PloS one 7, e35050 (2012). [0115] 15. Forsberg, K. et al. Novel antibodies reveal inclusions containing non-native SOD1 in sporadic ALS patients. PLoS One 5, e11552 (2010). [0116] 16. Aggarwal, S. & Cudkowicz, M. ALS drug development: reflections from the past and a way forward. Neurotherapeutics: the journal of the American Society for Experimental NeuroTherapeutics 5, 516-527 (2008). [0117] 17. Gurney, M. E. et al. Benefit of vitamin E, riluzole, and gabapentin in a transgenic model of familial amyotrophic lateral sclerosis. Ann Neurol 39, 147-157 (1996). [0118] 18. Foust, K. D. et al. Intravascular AAV9 preferentially targets neonatal neurons and adult astrocytes. Nature biotechnology 27, 59-65 (2009). [0119] 19. Duque, S. et al. Intravenous administration of self-complementary AAV9 enables transgene delivery to adult motor neurons. Mol Ther 17, 1187-1196 (2009). [0120] 20. Zhong, Z. et al. ALS-causing SOD1 mutants generate vascular changes prior to motor neuron degeneration. Nature neuroscience 11, 420-422 (2008). [0121] 21. Miller, R. G., Mitchell, J. D. & Moore, D. H. Riluzole for amyotrophic lateral sclerosis (ALS)/motor neuron disease (MND). Cochrane Database Syst Rev 3, CD001447 (2012). [0122] 22. Smith, R. A. et al. Antisense oligonucleotide therapy for neurodegenerative disease. The Journal of clinical investigation 116, 2290-2296 (2006). [0123] 23. Raoul, C. et al. Lentiviral-mediated silencing of SOD1 through RNA interference retards disease onset and progression in a mouse model of ALS. Nat Med 11, 423-428 (2005). [0124] 24. Ralph, G. S. et al. Silencing mutant SOD1 using RNAi protects against neurodegeneration and extends survival in an ALS model. Nat Med 11, 429-433 (2005). [0125] 25. Miller, T. M. et al. Virus-delivered small RNA silencing sustains strength in amyotrophic lateral sclerosis. Annals of neurology 57, 773-776 (2005). [0126] 26. Miller, T. M. et al. An antisense oligonucleotide against SOD1 delivered intrathecally for patients with SOD1 familial amyotrophic lateral sclerosis: a phase 1, randomised, first-in-man study. Lancet neurology 12, 435-442 (2013). [0127] 27. Towne, C., Raoul, C., Schneider, B. L. & Aebischer, P. Systemic AAV6 delivery mediating RNA interference against SOD1: neuromuscular transduction does not alter disease progression in fALS mice. Mol Ther 16, 1018-1025 (2008). [0128] 28. Towne, C., Setola, V., Schneider, B. L. & Aebischer, P. Neuroprotection by gene therapy targeting mutant SOD1 in individual pools of motor neurons does not translate into therapeutic benefit in fALS mice. Mol Ther 19, 274-283 (2011). [0129] 29. Mandel, R. J., Lowenstein, P. R. & Byrne, B. J. AAV6-mediated gene silencing fALS short. Mol Ther 19, 231-233 (2011). [0130] 30. Synofzik, M. et al. Mutant superoxide dismutase-1 indistinguishable from wild-type causes ALS. Human molecular genetics 21, 3568-3574 (2012). [0131] 31. Guareschi, S. et al. An over-oxidized form of superoxide dismutase found in sporadic amyotrophic lateral sclerosis with bulbar onset shares a toxic mechanism with mutant SOD1. Proc Natl Acad Sci USA 109, 5074-5079 (2012). [0132] 32. Haidet-Phillips, A. M. et al. Astrocytes from familial and sporadic ALS patients are toxic to motor neurons. Nat Biotechnol 29, 824-828 (2011). [0133] 33. Bevan, A. K. et al. Systemic gene delivery in large species for targeting spinal cord, brain, and peripheral tissues for pediatric disorders. Mol Ther 19, 1971-1980 (2011). [0134] 34. Gray, S. J. et al. Preclinical differences of intravascular AAV9 delivery to neurons and glia: a comparative study of adult mice and nonhuman primates. Mol Ther 19, 1058-1069 (2011). [0135] 35. Lioy, D. T. et al. A role for glia in the progression of Rett's syndrome. Nature 475, 497-500 (2011). [0136] 36. Miranda, C. J. et al. Aging brain microenvironment decreases hippocampal neurogenesis through Wnt-mediated survivin signaling. Aging Cell 11, 542-552 (2012). [0137] 37. Yamanaka, K. et al. Mutant SOD1 in cell types other than motor neurons and oligodendrocytes accelerates onset of disease in ALS mice. Proc Natl Acad Sci USA 105, 7594-7599 (2008).

    [0138] All documents referred to in this application, including priority documents, are hereby incorporated by reference in their entirety with particular attention to the content for which they are referred.