Anti-tumor traditional Chinese medicine microbial fermentation preparation and a preparation method and application thereof
10987389 · 2021-04-27
Inventors
Cpc classification
A61K36/899
HUMAN NECESSITIES
A61K35/36
HUMAN NECESSITIES
A61K36/899
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2236/19
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
A61K36/03
HUMAN NECESSITIES
A61K36/03
HUMAN NECESSITIES
A61K35/618
HUMAN NECESSITIES
International classification
A61K36/899
HUMAN NECESSITIES
A61K35/36
HUMAN NECESSITIES
A61K35/618
HUMAN NECESSITIES
A61K36/03
HUMAN NECESSITIES
Abstract
An anti-tumor traditional Chinese medicine, a preparation method therefor, and uses thereof. This traditional Chinese medicine is prepared by leavening of Pleurotus sp. and Dioscorea bulbifera, pangolin scales, rhubarb, oyster, stiff silkworm, kelp, selfheal, Ligusticum wallichii, barbat skullcap, honeysuckle flower, Oldenlandia diffusa, Radix trichosanthis, Rhizoma anemarrhenae Scutellaria baicalensis, Angelica sinensis, Psoralea corylifolia, Lucid ganoderma, and coix seed.
Claims
1. An anti-tumor Chinese medicine microbial fermentation preparation, comprising a mixture of raw Chinese medicines and a fermentation extract, wherein the raw medicines comprise the following components in part by weight: 15 to 40 parts of Dioscorea bulbifera, 2 to 30 parts of pangolin scales, 5 to 35 parts of Rheum officinale, 2 to 30 parts of Concha ostreae, 5 to 40 parts of Bombyx batryticatus, 5 to 25 parts of kelp, 5 to 30 parts of Prunella vulgaris, 2 to 20 parts of Ligusticum wallichii, 2 to 30 parts of Sculellaria barbata, 2 to 30 parts of Flos lonicerae, 8 to 40 parts of Oldenlandia diffusa, 2 to 30 parts of Radix trichosanthis, 2 to 40 parts of Rhizoma anemarrhenae, 2 to 35 parts of Radix scutellariae, 2 to 35 parts of Radix angelicae sinensis, 8 to 30 parts of Fructus psoraleae, 2 to 30 parts of Lucid ganoderma, and 2 to 30 parts of Semen coicis; wherein there are 15 to 40 parts by weight of the fermentation extract; and the fermentation extract is Pleurotus sp.
2. The anti-tumor Chinese medicine microbial fermentation preparation of claim 1, wherein the raw medicines comprise the following components in part by weight: 25 parts of Dioscorea bulbifera, 10 parts of pangolin scales, 15 parts of Rheum officinale, 10 parts of Concha ostreae, 15 parts of Bombyx batryticatus, 12 parts of kelp, 15 parts of Prunella vulgaris, 10 parts of Ligusticum wallichii, 15 parts of Sculellaria barbata, 15 parts of Flos lonicerae, 20 parts of Oldenlandia diffusa, 15 parts of Radix trichosanthis, 12 parts of Rhizoma anemarrhenae, 15 parts of Radix scutellariae, 15 parts of Radix angelicae sinensis, 20 parts of Fructus psoraleae, 15 parts of Lucid ganoderma, and 15 parts of Semen coicis; and there are 25 parts by weight of the fermentation extract.
3. The anti-tumor Chinese medicine microbial fermentation preparation of claim 1, wherein a preparation method of the fermentation extract Pleurotus sp. is as follows: Pleurotus sp. is inoculated to a PDA solid culture medium and then cultured for 70 h to 120 h at 20° C. to 35° C. to obtain a purely cultured single colony of Pleurotus sp. for extraction to obtain the fermentation extract of Pleurotus sp.
4. The anti-tumor Chinese medicine microbial fermentation preparation of claim 1, wherein the fermentation extract Pleurotus sp, comprises the extract preserved in China General Microbiological Culture Collection Center (CGMCC) on Apr. 14, 2014, having preservation number CGMCC No. 9060.
5. The anti-tumor Chinese medicine microbial fermentation preparation of claim 1, wherein the Chinese medicine preparation is one of a capsule, a tablet, a pill, powder and/or oral liquid.
6. The anti-tumor Chinese medicine microbial fermentation preparation of claim 1, wherein the Chinese medicine preparation is powder.
7. A preparation method of the anti-tumor Chinese medicine microbial fermentation preparation of claim 6, comprising: (1) weighing the raw medicine components and grinding these components into fine powder; (2) weighing the fermentation extract matched to the components in step (1); and (3) mixing the components in step (1) with the fermentation extract in step (2) to obtain the preparation.
Description
DETAILED DESCRIPTION OF THE PRESENT INVENTION
(1) In order to further describe the present invention, the present invention will be specifically described by the following embodiments.
(2) An anti-tumor traditional Chinese medicine microbial fermentation preparation is provided, which is prepared by mixing raw traditional Chinese medicines and a fermentation extract, wherein the raw medicines include the following components in part by weight: 15 to 40 parts of Dioscorea bulbifera, 2 to 30 parts of pangolin scales, 5 to 35 parts of Rheum officinale, 2 to 30 parts of Concha ostreae, 5 to 40 parts of Bombyx batryticatus, 5 to 25 parts of kelp, 5 to 30 parts of Prunella vulgaris, 2 to 20 parts of Ligusticum wallichii, 2 to 30 parts of Sculellaria barbata, 2 to 30 parts of Flos lonicerae, 8 to 40 parts of Oldenlandia diffusa, 2 to 30 parts of Radix trichosanthis, 2 to 40 parts of Rhizoma anemarrhenae, 2 to 35 parts of Radix scutellariae, 2 to 35 parts of Radix angelicae sinensis, 8 to 30 parts of Fructus psoraleae, 2 to 30 parts of lucid ganoderma, and 2 to 30 parts of Semen coicis;
(3) there are 15 to 40 parts by weight of the fermentation extract; and
(4) the fermentation extract is Pleurotus sp., which has been preserved in China General Microbiological Culture Collection Center (CGMCC) on Apr. 14, 2014, and the preservation number is CGMCC No. 9060.
(5) A preparation method of the fermentation extract Pleurotus sp. is as follows: Pleurotus sp. is inoculated to a FDA solid culture medium and then cultured for 70 h to 120 h at 20° C. to 35° C. to obtain a purely cultured single colony of Pleurotus sp., i.e., a fermentation extract of Pleurotus sp.
(6) The traditional Chinese medicine preparation is capsules, tablets, pills, powder and/or oral liquid.
(7) A preparation method of the powdery traditional Chinese medicine preparation is provided, including the following steps of:
(8) (1) weighing raw medicine components and grinding these components into fine powder;
(9) (2) weighing a fermentation extract matched to the components in step (1); and
(10) (3) mixing the components in step (1) with the fermentation extract in step (2) to obtain the preparation.
(11) An application in medicines for treading tumor diseases is provided.
(12) The tumor diseases include lung cancer, gastric cancer, esophagus cancer, rectal cancer and the like.
Embodiment 1
(13) In the traditional Chinese medicine compound powder prepared by the above method, raw medicines by weight are as follows: 15 kg of Dioscorea bulbifera, 2 kg of pangolin scales, 5 kg of Rheum officinale, 2 kg of Concha ostreae, 5 kg of Bombyx batryticatus, 5 kg of kelp, 5 kg of Prunella vulgaris, 2 kg of Ligusticum wallichii, 2 kg of Sculellaria barbata, 2 kg of floc lonicerae, 8 kg of Oldenlandia diffusa, 2 kg of Radix trichosanthis, 2 kg of Rhizoma anemarrhenae, 2 kg of Radix scutellariae, 2 kg of Radix angelicae sinensis, 8 kg of Fructus psoraleae, 2 kg of Lucid ganoderma, and 2 kg of Semen coicis; and there is 15 kg by weight of the fermentation extract.
(14) A preparation method of the fermentation extract Pleurotus sp. is as follows: Pleurotus ostreatus (i.e., Pleurotus sp.) is inoculated to a FDA solid culture medium and then cultured for 70 h at 20° C. to obtain a purely cultured single colony of Pleurotus sp., i.e., a fermentation extract of Pleurotus sp.
Embodiment 2
(15) In the traditional Chinese medicine compound powder prepared by the above method, raw medicines by weight are as follows: 25 kg of Dioscorea bulbifera, 10 kg of pangolin scales, 15 kg of Rheum officinale, 10 kg of Concha ostreae, 15 kg of Bombyx batryticatus, 12 kg of kelp, 15 kg of Prunella vulgaris, 10 kg of Ligusticum wallichii, 15 kg of Sculellaria barbata, 15 kg of Flos lonicerae, 20 kg of Oldenlandia diffusa, 15 kg of Radix trichosanthis, 12 kg of Rhizoma anemarrhenae, 15 kg of Radix scutellariae, 15 kg of Radix angelicae sinensis, 20 kg of Fructus psoraleae, 15 kg of Lucid ganoderma, and 15 kg of Semen coicis; and there is 25 kg by weight of the fermentation extract.
(16) A preparation method of the fermentation extract Pleurotus sp. is as follows: Pleurotus ostreatus (i.e., Pleurotus sp.) is inoculated to a FDA solid culture medium and then cultured for 96 h at 28° C. to obtain a purely cultured single colony of Pleurotus a fermentation extract of Pleurotus sp.
Embodiment 3
(17) In the traditional Chinese medicine compound powder prepared by the above method, raw medicines by weight are as follows: 40 kg of Dioscorea bulbifera, 30 kg of pangolin scales, 35 kg of Rheum officinale, 30 kg of Concha ostreae, 40 kg of Bombyx batryticatus, 25 kg of kelp, 30 kg of Prunella vulgaris, 20 kg of Ligusticum wallichii, 30 kg of Sculellaria barbata, 30 kg of Flos lonicerae, 40 kg of Oldenlandia diffusa, 30 kg of Radix trichosanthis, 40 kg of Rhizoma anemarrhenae, 35 kg of Radix scutellariae, 35 kg of Radix angelicae sinensis, 30 kg of Fructus psoraleae, 30 kg of Lucid ganoderma, and 30 kg of Semen coicis; and there is 40 kg by weight of the fermentation extract.
(18) A preparation method of the fermentation extract Pleurotus sp. is as follows: Pleurotus ostreatus (i.e., Pleurotus sp.) is inoculated to a FDA solid culture medium and then cultured for 120 h at 35° C. to obtain a purely cultured single colony of Pleurotus sp., i.e., a fermentation extract of Pleurotus sp.
(19) Experiment
(20) A suspension of 10% was prepared from the traditional Chinese medicine compound powder provided by the present invention and then stored in a refrigerator. The suspension would be shaken up before use.
(21) Tumor strain: Heps, S180 and ESC were all commercially available products.
(22) Animal: Kunming mice provided by the animal laboratories of Shenyang Pharmaceutical University and China Pharmaceutical University.
(23) Method: referring to the following literatures:
(24) Literature 1: chief editor Xu Shuyun. Methodology of Pharmacological Experiment, Beijing: People's Medical Publishing House 1982, 1115-1125.
(25) Literature 2: China Academic Conference on Tumor Pharmacology and Chemotherapy: In-vivo Efficacy Test Procedures of Anticancer Drugs, internal data. 1989.
(26) 1. Effects of the Traditional Chinese Medicine Compound Powder on Heps Solid Tumor
(27) The results in Table 1 indicated that the traditional Chinese medicine compound powder provided by the present invention had a significant anticancer activity to the mouse transplantable Heps solid tumor when the oral administration dosage was 0.4 ml/10 g, 0.2 ml/10 g and 0.1 ml/10 g. The maximum inhibition rate at a high dosage was 59.54%, the minimum inhibition rate at a low dosage was 33.09%, and the P value was less than 0.05 after statistical treatment.
(28) TABLE-US-00001 TABLE 1 Effects of the oral administration of the traditional Chinese medicine compound powder provided by the present invention on mouse Heps solid tumor Dosage Number of Tumor (ml/10 g × cases Weight (g) weight (g) Inhibition Group &) Beginning/End Beginning/End (X ± SD) rate P NS 0.2 × 8 20/20 21.76/24.63 3.27 ± 0.97 0.15% 5-Fu 0.1 × 8 10/10 21.30/24.80 1.12 ± 0.85 65.75% <0.01 10% 0.4 × 8 10/8 21.50/21.00 1.32 ± 0.53 59.54% <0.01 compound 0.2 × 8 10/10 22.55/22.50 1.59 ± 0.31 51.45% <0.01 powder 0.1 × 8 10/10 21.65/23.25 1.69 ± 0.65 48.40% <0.01 NS 0.2 × 8 20/20 18.20/22.40 1.36 ± 0.39 0.15% 5-Fu 0.1 × 8 10/9 18.95/20.22 0.59 ± 0.27 56.62% <0.01 10% 0.4 × 8 9/9 19.22/21.67 0.76 ± 0.24 44.12% <0.05 compound 0.2 × 8 9/8 19.00/21.56 0.81 ± 0.16 40.44% <0.05 powder 0.1 × 8 9/9 18.67/21.39 0.91 ± 0.03 33.09% <0.05 NS 0.2 × 9 12/12 21.63/24.50 2.53 ± 0.38 0.15% 5-Fu 0.1 × 9 9/8 21.00/25.86 1.05 ± 0.54 58.55% <0.01 10% 0.4 × 9 9/9 20.72/24.00 1.13 ± 0.52 55.27% <0.01 compound 0.2 × 9 9/9 20.78/26.00 1.41 ± 0.44 44.27% <0.01 powder 0.1 × 9 9/9 21.00/22.78 1.48 ± 0.83 41.50% <0.01
(29) 2. Effects of the Traditional Chinese Medicine Compound Powder on S180 Solid Tumor
(30) The results in Table 2 indicated that the traditional Chinese medicine compound powder provided by the present invention had a significant anticancer activity to the mouse transplantable S180 solid tumor when the oral administration dosage was 0.4 ml/10 g, 0.2 ml/10 g and 0.1 ml/10 g. The maximum inhibition rate at a high dosage was 62.36%, the minimum inhibition rate at a low dosage was 30.46%, and the P value was less than 0.05 after statistical treatment.
(31) TABLE-US-00002 TABLE 2 Effects of the oral administration of the compound powder on mouse S180 solid tumor Dosage Number of Tumor (ml/10 g × cases Weight (g) weight (g) Inhibition Group &) Beginning/End Beginning/End (X ± SD) rate P NS 0.2 × 9 13/13 21.40/24.04 3.25 ± 0.70 0.15% 5-Fu 0.2 × 9 9/9 20.78/20.00 1.87 ± 1.03 42.62% <0.01 10% 0.4 × 9 9/7 21.28/21.00 1.39 ± 0.53 57.41% <0.01 compound 0.2 × 9 9/9 21.38/22.11 2.05 ± 0.91 36.92% <0.05 powder 0.1 × 9 9/8 21.11/21.14 2.26 ± 0.81 30.46% <0.05 NS 0.2 × 9 20/18 21.15/24.39 3.56 ± 0.54 0.15% 5-Fu 0.2 × 9 10/10 21.80/24.70 1.36 ± 0.44 61.80% <0.01 10% 0.4 × 9 10/9 21.20/25.40 1.34 ± 0.33 62.36% <0.01 compound 0.2 × 9 10/8 21.70/23.35 1.91 ± 0.33 46.63% <0.01 powder 0.1 × 9 10/9 21.5/23.56 2.06 ± 0.41 42.14% <0.01 NS 0.2 × 9 20/18 21.20/25.13 3.37 ± 0.43 0.15% 5-Fu 0.2 × 9 10/10 21.30/23.60 1.33 ± 0.31 60.53% <0.01 10% 0.4 × 9 10/10 21.30/24.50 1.46 ± 0.53 56.68% <0.01 compound 0.2 × 9 10/8 21.50/25.38 1.72 ± 0.46 43.96% <0.01 powder 0.1 × 9 10/9 21.70/26.56 2.03 ± 0.58 39.76% <0.01
(32) 3. Effects of the Traditional Chinese Medicine Compound Powder on ESC Solid Tumor
(33) The results in Table 3 indicated that the traditional Chinese medicine compound powder provided by the present invention had a significant anticancer activity to the mouse transplantable ESC solid tumor when the oral administration dosage was 0.4 ml/10 g, 0.2 ml/10 g and 0.1 ml/10 g. The maximum inhibition rate at a high dosage was 62.84%, the minimum inhibition rate at a low dosage was 41.98%, and the P value was less than 0.01 after statistical treatment.
(34) TABLE-US-00003 TABLE 3 Effects of the oral administration of the compound powder on mouse Ehrlich Ascites Cancer (EAC) solid tumor Dosage Number of Tumor (ml/10 g × cases Weight (g) weight (g) Inhibition Group &) Beginning/End Beginning/End (X ± SD) rate P NS 0.2 × 9 19/19 22.58/25.79 3.83 ± 0.72 0.15% 5-Fu 0.2 × 9 10/10 20.85/26.90 1.33 ± 0.63 65.36% <0.01 10% 0.4 × 9 10/9 20.80/29.69 1.51 ± 0.26 60.21% <0.01 compound 0.2 × 9 10/10 21.20/28.00 1.82 ± 0.65 52.43% <0.01 powder 0.1 × 9 10/10 20.20/29.80 2.22 ± 0.47 41.98% <0.01 NS 0.2 × 9 20/19 20.60/25.89 3.69 ± 0.62 0.15% 5-Fu 0.2 × 9 10/10 20.90/26.80 1.23 ± 0.43 64.85% <0.01 10% 0.4 × 9 10/8 20.80/28.50 1.41 ± 0.64 61.58% <0.01 compound 0.2 × 9 10/9 21.00/30.44 1.53 ± 0.85 58.31% <0.01 powder 0.1 × 9 10/9 20.80/31.43 1.59 ± 0.56 56.68% <0.01 NS 0.2 × 9 20/20 20.03/23.55 3.96 ± 0.53 0.15% 5-Fu 0.2 × 9 10/10 21.45/22.20 1.31 ± 0.65 66.85% <0.01 10% 0.4 × 9 10/9 21.05/20.61 1.87 ± 0.77 62.84% <0.01 compound 0.2 × 9 10/9 21.65/22.98 1.63 ± 0.36 58.82% <0.01 powder 0.1 × 9 10/9 20.85/22.56 2.04 ± 0.46 48.39% <0.01
(35) 4. Acute Toxicity Test
(36) 20 mice with half males and half females were prepared. The mice took orally the traditional Chinese medicine compound powder provided by the present invention at a ratio of 5 g/kg (water) and continuously observed for 7 days, and no one had died. It was indicated that the LD50 of the traditional Chinese medicine compound powder provided by the present invention is above 5 g/kg.
(37) In addition, the effects of the traditional Chinese medicine compound powder provided by the present invention on the EAC ascites had been preliminarily observed. The results indicated that the traditional Chinese medicine compound powder provided by the present invention were ineffective to the ascites.
(38) In conclusion, the results of this research indicated that the traditional Chinese medicine compound powder provided by the present invention had the significant anticancer activity to the three tumor strains after the compound powder was continuously orally administrated for 9 days at a ratio of 4 g/kg, 2 g.Math.kg and 1 g/kg. The inhibition rate could reach or exceed the standard (30) regulated in China, so it was indicated that the traditional Chinese medicine compound powder provided by the present invention had a significant antitumor effect. The acute toxicity test proved that the LD50 of the oral administration of the traditional Chinese medicine compound powder provided by the present invention was greater than 5 g/kg, and the toxicity was small. The current clinical observation also indicates that the traditional Chinese medicine compound powder provided by the present invention had a good curative effect on various malignant tumors. Therefore, it is worth performing deep clinical and preparation researches on the traditional Chinese medicine compound powder provided by the present invention.
(39) 5. Clinical Test
(40) All patients had the diagnostic reports, the reports of X-ray photographs and CT photographs, pathological section reports and microscopic examination reports in hospitals around China, and 500 cases were observed. After half-year's observation, the cancers and symptoms such as lung cancer, intestinal cancer, gastric cancer and esophagus cancer had been improved to different extents. After the patients took the traditional Chinese medicine compound powder, their appetites and weights were increased, and they felt much better. Through the comparative observation before and after medication, the compound powder provided by the present invention has an anticancer function and has effects of controlling the tumor and improving body immunity.
(41) The compound powder had treated 249 cases of lung cancer, the symptoms were improved, and the tumor was stably lessened to different extents through before-and-after comparison. Such clinical effects were significant. After the patients took the compound powder, they felt much better, their appetites and weights were increased, their pains were relieved, and their cough and dyspnea also got better. Moreover, majority of the patients who were completely bedridden could take part in outdoor activities, and some of the patients could work normally. The therapeutic effects were as shown in Table 4.
(42) TABLE-US-00004 TABLE 4 Treatment analysis of the compound powder Total Effective Effectual number (the (the Heal (the Ineffective of number number number (the patients: of Proportion of Proportion of Proportion number of Proportion 500 patients) (%) patients) (%) patients) (%) patients) (%) Lung 249 221 88.7 60 24.1 6 2.4 28 11.3 cancer Gastric 78 71 91.1 24 30.8 1 1.3 7 8.9 cancer Esophagus 66 59 89.3 18 27.2 1 1.5 7 10.7 cancer Rectal 68 63 92.6 21 30.9 2 2.9 5 7.4 cancer
(43) The total tumor inhibition rate was 82.8%, and the total effective rate was 96.5%.
(44) Note: 39 patients were not visited due to unclear recorded addresses, so these patients were not recorded.
(45) The results indicated that: through the clinical observation of the trail, the compound powder had a significant inhibition effect on patients having intermediate-stage or advanced-stage cancers, and could resist against the centers and lessen the tumors. Cancer cells were killed or dissolved, and then vanished from water or blood. The compound powder could prolong life, and is free of toxic and side effects, convenient to use, safe and reliable.
(46) Detection of DNA of Pleurotus sp.
(47) I. DNA Extraction
(48) The fungi DNA was extracted by a FastDNA SPIN soil DNA extraction kit (MP Biomedicals, Santa Ana, Calif.).
(49) II. PCR Amplification
(50) PCR Amplification Primers:
(51) TABLE-US-00005 ITS1: 5′ CTTG GTCA TTTA GAGG AAGTAA3′ ITS4: 5′ TCCT CCGC TTAT TGAT ATGC3′
(52) PCR Amplification Procedure:
(53) TABLE-US-00006 94° C. 2 min 94° C. 30 s 55° C. 45 s 72° C. 1 min {close oversize brace} 35 cycles 72° C. 7 min 10° C. forever
III. Sequencing
(54) The FOR product was sequenced by Shanghai Biotechnology Co., Ltd.
(55) The result of the gene sequence was as follows:
(56) TABLE-US-00007 CTCTCCGGGGGGAACCTTGGGGAGGGTCCTTTAATGATTCCCTTAG GGAGTGGTGGTGGCCTTTAGGGGCCAGGTCCCGGTTCCATAGTTTTTTC ACCCCCCGTGGACTTTTGAAAGGTTTGGGGAATTGTTTTTCCAATTGTT CAGATTGGTTTGCTGGGATTTAAACGTCTCGGTGTGACTACGCAGTCTA TTTACTTACCCCCCCCCAAAGGAAGTTTTCGAAAGTCCATTAAAGGGCC CTGGGCCTTTTAACCCTTAATCCAACTTTCACCAAGGATTTTTTGGCTT TTGCCATGAAGGAAGAAGCAAGGAAAATGGGTAAAGAAAGGGAAATGCC GAAATCCAGGGATCCTTGGATTCTTGGACCCCCCCTGCCCCCCCTGGTA TTTCGGGGGGCCAGCCCGGTTGGGGGGCCATTAATTTTTCAAATCCCTT TGGTTTTTTTCCAATTGTGATGTTTGGATTGTTGGGGGCTGCTGGCCTT GACAGGTCGGCTCCTCTTAAATGCATTAGCAGGACTTCTCATTGCCTCT GCGCATGATGTGATAATTATCACTCATCAATAGCACGCATGAATAGAGT CCAGCTCTCTAATCGTCCGCAAGGACAATTTGACAATTGACCTCAAATC AGGTAGACAGCCGGATTCT
IV. Comparison Results
(57) Through Comparison With the Database of NCBI (National Center of Biotechnology Information as of the filing date of the present patent application, the results were as follows:
(58) Pleurotus ostreatus isolate NW42618S ribosomal RNA gene (login ID: EU622251.1)
(59) Pleurotus ostreatus, i.e., Pleurotus sp.