BI- OR MULTI-DIFFERENTIATED ORGANOID

Abstract

An in vitro method of producing a bi- or multi-differentiated tissue with at least two tissue types is provided. The method includes the steps of developing a first tissue to a stage of differentiation of interest; developing a second tissue to a stage of differentiation of interest differing from the stage of differentiation of interest of the first tissue; placing the first and second tissue in a vicinity sufficient for fusion by growth, allowing the first and second tissue to grow and fuse to each other, thereby producing a bi- or multi-differentiated tissue including the first and second tissue with different stages of differentiation; bi- or multi-differentiated tissue obtained by such a method; uses of the tissue and kits for performing the method.

Claims

1-15. (canceled)

16. An in vitro method of producing a bi- or multi-differentiated neuronal tissue with at least two neuronal tissue types comprising the steps of: providing a first neuronal tissue that is developed to a stage of differentiation of interest; providing a second neuronal tissue that is developed to a stage of differentiation of interest differing from the stage of differentiation of interest of the first neuronal tissue; placing said first and second neuronal tissue in vicinity sufficient for fusion by growth; allowing the first and second neuronal tissue to grow and fuse to each other; thereby producing a bi- or multi-differentiated neuronal tissue comprising the first and second neuronal tissue with different stages of differentiation; preferably wherein the first and/or the second neuronal tissue, especially both, are derived from an in-vitro culture of pluripotent stem cells, in particular induced pluripotent stem cells.

17. The method of claim 16, comprising developing the first neuronal tissue to a stage of differentiation of interest separate from developing the second neuronal tissue to a stage of differentiation of interest differing.

18. The method of claim 16, wherein at least the first and/or second neuronal tissue comprises neural progenitor cells and neurons.

19. The method of claim 18, wherein the stages of differentiation of the first neuronal tissue comprises a ventral forebrain progenitor tissue or a rostroventral forebrain tissue.

20. The method of claim 18, wherein the stages of differentiation of the second neuronal tissue comprises dorsal forebrain tissue or neuroectoderm without differentiation to ventral or dorsal forebrain.

21. The method of claim 16, wherein the steps of placing said first and second neuronal tissue in a vicinity sufficient for fusion by growth and allowing the first and second neuronal tissue to grow and fuse to each other are performed in suspension culture.

22. The method of claim 16, wherein the bi- or multi-differentiated neuronal tissue is differentiated to develop a neural plate.

23. The method of claim 16, wherein the first and second neuronal tissue are grown to a size of at least 100 μm, preferably at least 150 μm, especially preferred at least 200 μm.

24. The method of claim 16, wherein the first and/or second neuronal tissue expresses a detectable marker that is not expressed by the other from the group of the first and second neuronal tissue.

25. A bi- or multi-differentiated neuronal tissue with at least two neuronal tissue types of different stages of differentiation, wherein at least one of the neuronal tissue types comprises ventral neuronal tissue and the at least another tissue type is substantially non-ventral but containing migrated cells from the ventral neuronal tissue constituting not more than 5% of the cells of the substantially non-ventral tissue and the bi- or multi-differentiated tissue having a size of 100 μm to 10 mm in its longest dimension.

26. The bi- or multi-differentiated neuronal tissue of claim 25, wherein at least one of the neuronal tissue types expresses a detectable marker, preferably a fluorescence marker, not expressed by another tissue type of the bi- or multi-differentiated neuronal tissue.

27. The bi- or multi-differentiated neuronal tissue of claim 25, in form of a globular body or in form of a tissue slice.

28. A method of testing or screening a candidate compound for influencing differentiation of bi- or multi-differentiated neuronal tissue, comprising contacting the neuronal tissue of claim 25 with the candidate compound and maintaining said contacted tissue in culture, and observing any differentiation changes in the tissue as compared to said tissue without contacting by said candidate compound.

29. Use of a kit in a method according to claim 16, wherein the kit comprises a: (i) a WNT inhibitor and/or a SHH enhancer and (ii) a SHH inhibitor.

Description

FIGURES

[0077] FIG. 1. Ventral drug-treatment produces ventral-forebrain containing cerebral organoids. (A) Schematic of cerebral organoid protocol with ventral drug-patterning application (2.5 μM IWP2 and 100 nM SAG) during the neural induction step. (B) Schematic of a human coronal brain slice indicating the regional expression of the patterning markers used for qPCR/IHC analysis. (C) qPCR analysis of the expression of different brain regional markers showing an increase in ventral and decrease in dorsal forebrain identity in ventral cerebral organoids. Values are plotted as relative expression level (2.sup.−ΔCt) to the reference gene TBP. Each data point corresponds to a pooled batch of 8-10 organoids. Data is represented as mean±SD, and statistical significance was tested using the student's t-test (df=9) for control (n=6 batches) versus IWP2+SAG (n=5 batches) treatment. (D-E) Widefield images of immunostaining analysis of control and ventral cerebral organoids indicating the ventral-forebrain identity of ventral organoids (D), and the dorsal-forebrain identity of control organoids (E). Scale bars are 200 μm.

[0078] FIG. 2. Fusion of cerebral organoids allows cell migration between ventral and dorsal forebrain tissue. (A) The experimental outline of the cerebral organoid fusion co-culture method. (B) Representative widefield images at different stages throughout the organoid fusion procedure. (C) Tile-scan image of an immunostained cryosection of a ventral::dorsal organoid fusion indicates the combination of ventral (NKX2-1.sup.+) and dorsal (TBR1.sup.+) regions. (D) Immunostained ventral::dorsal organoid fusion cryosections from organoids of different ages shows the time course of GFP.sup.+ cells migrating from ventral into dorsal tissue. (E) The GFP.sup.+ cell density in dorsal tissue was quantified in sections from 32 (n=3 organoids) 46 (n=3), 58 (n=4), and 80 (n=4) day-old organoids. The data is presented as mean±SD and statistical significance tested using the one-way ANOVA [F(3,10)=12.59, p=0.0010] with posthoc Tukey's test for between group comparisons. Scale bars are 500 μm.

[0079] FIG. 3. Mixing the tissue components of cerebral organoid fusions indicates the most robust migration from ventral into dorsal regions. (A) Cerebral organoid fusions were created containing different combinations of ventral (V), control (C) or dorsal (D) treated tissue. The components were labeled with either GFP (green) or tdTomato (red). (A) Whole mount images of ˜80 day old organoid fusions show the emergence of GFP.sup.+ spots (arrows) in tdTomato.sup.+ tissue in ventral-control and ventral-dorsal organoid fusions. (B) Tile-scan confocal images of immunostained mixed organoid fusion cyrosections shows migration of GFP.sup.+ cells across the midline (dashed line) into the GFP-organoid. (C) Quantification of GFP.sup.+ cell density in GFP.sup.− tissue from tissue sections. Each data point corresponds to an individual organoid, and the data is represented as mean±SD with statistical significance tested using one-way ANOVA [F(3,19)=8.214, p=0.0010] with posthoc Tukey's test for between group comparisons. The ventral::control (n=7 organoids) and ventral::dorsal (n=8) fusions show the most migration of GFP.sup.+ cells compared to control::control (n=4) and dorsal::dorsal (n=4) fusions. Scale bars are 500 μm.

[0080] FIG. 4. GABAergic interneurons migrate between fused dorsal-ventral cerebral organoids. (A) A whole organoid confocal tile-scan image of an immunostained 80-day old ventral::dorsal organoid fusion cryosection. GFP.sup.+ cells can be observed migrating across the fusion midline (dashed line) from GFP.sup.+ ventral into GFP.sup.− dorsal tissue. The GABAergic marker GAD1 can be observed in a similar pattern as GFP (arrowheads). (B-C) A magnified view of peripheral (B) and internal regions (C) of the organoid fusion in (A). GFP.sup.+ cells expressing GAD1 can be observed in both regions (arrows). (D) A confocal image of GFP/RELN immunostaining in the dorsal region of an 80-day old ventral::dorsal organoid fusion cryosection showing that migrated GFP.sup.+ cells (arrows) do not express RELN. (E) A confocal image of GFP/DCX/NeuN immunostaining in the dorsal region of a 58-day old ventral::dorsal organoid fusion cryosection showing that migrating GFP.sup.+ cells are DCX.sup.+ immature neurons (yellow arrows), and some are mature (DCX.sup.+/NeuN.sup.+) neurons (blue arrows). Scale bars are (A) 500 μm, (B-E) 20 μm.

[0081] FIG. 5. Migrating interneurons in ventral::dorsal cerebral organoid fusions express various interneuron subtype markers. (A-H) Confocal images of immunostaining in dorsal regions of 80-day old ventral::dorsal organoid fusion cryosections. Expression of the GABAergic markers GAD1 or VGAT were used to identify interneurons. Examples of various migrated GFP.sup.+ interneurons expressing either GAD1 or VGAT were observed expressing the MGE-derived interneuron marker SOX6 (A) or subtype markers SOM (B), NPY (C), CB (D), and PV (E). Migrated GFP.sup.+ interneurons also expressed the LGE/CGE-derived interneuron markers SP8 (F), COUP-TFII (G), or the subtype marker CR (H). Scale bars are 20 μm. Abbreviations: SOM=somatostatin, NPY=neuropeptide Y, CB=calbindin, PV=parvalbumin, CR=calretinin, VGAT=vesicular GABA transporter, GAD1=glutamate decarboxylase 1.

[0082] FIG. 6. Migrating cells in cerebral organoid fusions exhibit the migratory dynamics of tangentially migrating interneurons and are sensitive to CXCR4 activity. (A) A schematic representation of the organoid fusion slice culture assay for either short-term time-lapse imaging of migratory dynamics, or long-term drug-treatments. A representative tile-scan image of an entire ventral::dorsal organoid fusion slice is shown with the ventral GFP.sup.+ regions labeled in green and the unlabeled or tdTomato dorsal regions outlined in red. A region containing the migrating cell shown in (B) is noted by a yellow box. (B) Still images from a 3-day time-lapse experiment showing a migrating GFP.sup.+ cell. The branched leading process exhibits both extending (closed arrowheads) and retracting (open arrowheads) branches as the cell body follows one of the leading processes. (C) An extending neurite (closed arrowhead) with a tuft that appears to be an axon growth cone travels in one direction across the field of view. (D) A widefield image of GFP.sup.+ cells that migrated into the tdTomato.sup.+ dorsal region (red outline) from long-term organoid fusion slice cultures that were either untreated (control) or treated with a the CXCR4 inhibitor (AMD3100). (E) Quantification of the migrated GFP.sup.+ cell density with data represented as mean±SD with statistical significance tested using the student's t-test (df=4) comparing control (n=3 organoids) to AMD3100 (n=3) treatment. Each data point represents a one slice from individual organoids. Fewer migrating cells are observed in AMD3100-treated slice cultures. Scale bars are (A) 500 μm, (B-C) 50 μm, and (D) 500 μm.

EXAMPLES

Example 1: Cell Culture

[0083] Feeder-dependent human induced pluripotent stem cells (hiPSCs) (Systems Biosciences, cat. no. SC101A-1) were obtained from System Biosciences with pluripotent verification and contamination-free. Feeder-dependent hiPSCs were cultured with irradiated mouse embryonic fibroblast (MEF) feeder cells (MTI-GlobalStem, cat. no. 6001G) on gelatin coated (0.1% gelatin in PBS) 6-well culture plates using human embryonic stem cell (hESC) medium: DMEM/F12 (Invitrogen) containing 20 ng/mL bFGF (produced by IMBA institute Molecular Biology Service core facility), 3.5 μL/500 mL media of 2-mercaptoethanol, 20% KnockOut Serum (Invitrogen), 1% GlutaMAX (Invitrogen), 1% MEM-NEAA (Sigma), and 3% FBS). Feeder free H9 human embryonic stem cells (hESCs) were obtained from WiCell with verified normal karyotype and contamination-free. Feeder-free hESCs were cultured on hESC-qualified Matrigel (Corning cat. no. 354277) coated 6-well plates using mTeSR1 (Stemcell Technologies). All stem cells were maintained in a 5% CO.sub.2 incubator at 37° C. Standard procedures were used for culturing and splitting hPSCs as explained previously (Lancaster & Knoblich Nat Protoc 9, 2329-2340 (2014)). All cell lines were routinely tested for contamination and confirmed mycoplasma-negative.

Example 2: Cloning/Molecular Biology/Generating hPSC Lines

[0084] For ubiquitous fluorescent labeling of cells, a reporter construct was inserted into the safe-harbor AAVS1 locus in hPSCs as done previously with TALEN technology (Hockemeyer et al. Nat. Biotechnol. 27, 851-857 (2009)) using the AAVS1 SA-2A-Puro donor vector as a template. A modified backbone was created containing flanking tandem repeats of the core chicken HS4 insulator (2×CHS4). Fluorescent reporter expression cassettes were inserted between the flanking insulator sequences. The following expression constructs were inserted into iPSCs: 1) 2×CHS4-EF1α-eGFP-SV40-2×CHS4, 2) 2×CHS4-EF1α-tdTomato-SV40-2×CHS4. In feeder-free H9 hESCS, a 2×CHS4-CAG-eGFP-WPRE-SV40-2×CHS4 construct was inserted to enhance the GFP expression for time-lapse imaging experiments.

[0085] hPSCs were prepared for nucleofection as a single-cell suspension using the same cell dissociation procedures as for making EBs.sup.11. The Amaxa nucleofector (Lonza) was used with Stem Cell Kit 1 using 800,000 cells per nucleofection containing 1 μg each of the TALEN guides, and 3 μg of the donor plasmid DNA following manufacturer guidelines. After nucleofection, 200 μL of the total 600 μL nucleofection solution was plated onto a 10 cm cell culture dish. Colonies from single cells were grown for 4 days, and then treated with puromycin (Puro) (Jena Bioscience, cat. no. NU-931-5). For feeder-dependent cells, 1.1 μg/mL puro was applied, and for feeder-free cells 0.7 μg/mL was applied. The puro treatment continued for 5-7 days until the surviving colonies were large enough to be picked manually and transferred into a 24-well plate. When splitting the colonies from a 24-well plate, half of the cells were used for genotyping, while the other half was expanded into 12 and then 6-well formats, and then used for further experiments. For genotyping, DNA was extracted using the QuickExtract solution (EpiCentre), and PCR was performed using the following primers to identify correctly targeted AAVS1 insertions: 1) Puro (AAVS1 Puro-fwd: tcccctcttccgatgttgag (SEQ ID NO: 1) and AAVS1 Puro-rev: gttcttgcagctcggtgac (SEQ ID NO: 2)), 2) eGFP (AAVS1 eGFP-fwd: GAACGGCATCAAGGTGAACT (SEQ ID NO: 3) and AAVS1 eGFP-rev: cttcttggccacgtaacctg (SEQ ID NO: 4)), and 3) tdTomato (AAVS1 tdTomato-fwd: ctacaaggtgaagatgcgcg (SEQ ID NO: 5)) and (AAVS1_tdTomato-rev: tccagcccctcctactctag (SEQ ID NO: 6)). To determine whether the insertion was heterozygous or homozygous, the presence of a WT allele was tested using additional PCR primers: 4) WT (AAVS1 WT-fwd: tcccctcttccgatgttgag (SEQ ID NO: 7), and AAVS1 WT-rev: tccagcccctcctactctag (SEQ ID NO: 8)). Cell clones with correctly targeted heteroyzygous or homozygous insertions were archived by freezing with Cell Banker 2 solution (Amsbio, cat. no. 11891) and/or cultured for further experiments.

Example 3: Cerebral Organoid Generation and Fusion

[0086] Cerebral organoids were generated following the previous protocol described in WO2014/090993, Lancaster et al., Nature 501, 373-379 (2013), Lancaster & Knoblich, Science 345, 1247125-1247125 (2014) and Lancaster & Knoblich, Nat Protoc 9, 2329-2340 (2014) with slight modifications. A drug-patterning treatment was applied during the neural induction step of the protocol (˜day 5-11) using one of the following treatments: 1) Control, no drugs, 2) Ventral, 2.5 μM IWP2 (Sigma, cat. no. 10536) and 100 nM SAG (Millipore, cat. no. 566660), 3) Dorsal, 5 μM CycA (Calbiochem, cat. no. 239803). Stock drug solutions were created as follows: IWP2 (5 mM in DMSO), SAG (1 mM in H.sub.2O), and CycA (5 mM in DMSO). Following embedding in Matrigel (Corning, cat. no. 356235), organoids were grown in 10 cm cell culture dishes containing 25 mL of differentiation medium, and after the first media exchange maintained on an orbital shaker with medium exchange every 5-7 days. After day 40 of the protocol, when organoids begin to grow out of the Matrigel droplet, the differentiation medium was supplemented with 1% Matrigel.

[0087] To create organoid fusions, EBs were grown separately and individually patterned using either control, dorsal, or ventral protocols as described above. During Matrigel embedding, two EBs were transferred into the same parafilm well and embedded in a single droplet (˜30 μL) of Matrigel. The EBs were gently pushed as close together as possible using a 20 μL pipet tip to ensure the EBs would remain in close proximity within the middle of the solidified Matrigel droplet.

Example 4: RNA Extraction/qPCR

[0088] For each drug-patterning treatment group, 8-12 organoids were collected at day 30-40 into 2 mL RNAse-free tubes and chilled on ice throughout the procedure. The organoids were washed 3× in cold PBS, then the Matrigel was dissolved by incubating the organoids in chilled Cell Recovery Solution (Corning, cat. no. 354253) for 1 hr at 4° C. The dissolved Matrigel was removed by rinsing 3× in cold PBS. RNA was extracted using the RNeasy mini kit (Qiagen). cDNA synthesis was performed using 2 μg of total RNA and the Superscript II (Invitrogen) enzyme according to the manufacturer protocols. qPCR reactions were performed using Sybr Green master mix (Promega) on a BioRad 384-well machine (CXF384) using the following reaction protocol: 1) 95° C. for 3 min, 2) 95° C. for 10 s, 3) 62° C. for 10 s, 4) 72° C. for 40 s, 5) go to 2, 40 cycles, 6) 95° C. for 1 min, 7) 50° C. for 10 s. Quantification was performed in excel by calculating the ΔCt value using TBP as a reference gene. Data is presented as expression level (2-act) relative to TBP.

Example 5: Cerebral Organoid Slice Culture and Drug-Treatment

[0089] Slice cultures were generated by vibratome sectioning organoid fusions. The organoid fusion tissue was embedded in 4% low melt agarose (Biozym, cat. no. 850080), and sectioned in ice-cold PBS (without Ca.sup.2+/Mg.sup.2+) to create 200-250 μm sections. The sections were transferred onto Millicell organotypic inserts (Millipore, cat. no. PICM01250) in 6-well cell culture plates. For time-lapse imaging, sections were cultured for 1-2 days before mounting for imaging using a spinning disk confocal microscope (VisiScope). Sections were cut away from the culture insert membrane and inverted onto a glass-bottom dish. The section was immobilized by placing a cell culture insert on top of the section, and attaching it to the dish using vacuum grease. For drug-treatment, long-term slice cultures were initially cultured overnight in differentiation media (+5% FBS). Then the media was exchanged for fresh media (control) or media containing the CXCR4 inhibitor AMD3100 (Sigma, #A5602) and cultured for an additional 3 weeks before tissue fixation and further immunofluorescent processing.

Example 6: Histology/Cryosectioning/Immunofluorescence

[0090] Organoid tissue was collected at the desired age, rinsed 3× in PBS, and fixed in 4% PFA overnight at 4° C. The next day the tissue was rinsed 3× in PBS, and cryoprotected in 30% sucrose in PBS overnight at 4° C. Then the tissue was incubated 2-4 hours in a 1:1 mixture of 30% sucrose/PBS and O.C.T. cryoembedding medium (Sakura, cat. no. 4583). Next, groups of 2-4 organoids were transferred from the sucrose/OCT mixture into a cryomold and filled with O.C.T. The embedded tissue was frozen on dry ice, then placed in −80° C. for long term storage until cryostat sectioning. Frozen organoid tissue was sliced into 20 μm sections using a cryostat (Leica), and collected on superfrost Ultra Plus slides. Tissue sections were arranged such that every 10th slice was collected sequentially until each slide contained 8-10 sections per block of tissue. The sections were dried overnight, and then used for immunofluorescent labeling, or stored at −20° C. until ready to stain.

[0091] Immunofluorescence was performed on tissue sections directly on slides. The O.C.T. was removed by washing 10 minutes in PBS using a slide rack (Sigma, Wash-N-Dry). The sections were postfixed directly on the slides using 4% PFA for 10 minutes at RT followed by washing 3×10 minutes in PBS. The tissue area was outlined using a hydrophobic PAP pen. Permeabilization/blocking was performed using 5% BSA/0.3% TX100 in PBS with 0.05% sodium azide and incubated 30 minutes at room temperature (RT) within a dark humidified slide box. Primary antibodies (a table of used primary and secondary antibodies can be found at the end of the method section) were added at the desired dilutions in antibody solution (5% BSA, 0.1% TX100 in PBS with 0.05% sodium azide) and incubated overnight at 4° C. Slides were rinsed 3× in PBS and then washed 3×10 minutes in PBST at RT on an orbital shaker. Secondary antibodies were added at 1:500 in antibody solution and incubated at RT for 2 hours. DAPI solution (2 μg/mL) was added for 5 minutes, then slides were washed as done after primary antibody application, with the final washing using PBS. Coverslips were mounted using DAKO mounting medium (Agilent Pathology Solutions, cat. no. 53023) and allowed to harden overnight. Slides were then stored at 4° C. until imaging, or at −20° C. for long-term storage.

[0092] For long-term slice cultures, slices grown on cell culture inserts were rinsed in PBS, and then fixed in 4% PFA for 2 days at 4° C. The sections were washed 3×10 minutes in PBS, then permeabilized/blocked as performed for cryosections on slides. Primary and secondary antibody incubations were performed overnight at 4° C., followed by washing 3×10 minutes in PBS after each step. The sections were mounted in Vectashield containing DAPI (Vector Labs).

Example 7: Imaging/Microscopy

[0093] Fluorescent cell culture imaging was performed using a Zeiss Axio Vert.A1 widefield microscope and an Axiocam ERc 5s camera (Zeiss, Zeiss GmbH) using Zeiss Plan-Neofluar 2.5×0.085 and Zeiss LD A-Plan 10×0.25 Ph1 objectives. Both tdtomato and GFP channels were recorded separately and subsequently pseudocolored and merged using the Fiji package of ImageJ.

[0094] Widefield imaging of IHC stainings and long-term slice cultures was performed using an Axio Imager Z2 (Zeiss, Zeiss GmbH) using a Sola SM2 illumination source, (5×0.15 plan-neofluar, 10×0.3 plan-neofluar, 20×0.5 plan-neofluar) objective and a Hamamatsu Orca Flash 4 camera. Filters used were Ex360/40 nm Em 445/50 nm, Ex480/40 nm Em 535/50 nm and Ex560/55 nm Em 645/75 nm. Confocal imaging was performed using a Zeiss LSM700 AxioImager with a 20×0.8 plan-apochromat dry objective. Lasers of 405 nm (5 mW), 488 nm (10 mW), 555 nm (10 mW) and 639 nm (5 mW) together with, corresponding to wavelength, filters SP490, SP555, SP640 and LP490, LP560, LP640 were used for recording. For whole organoid tile scans the XY Scanning Stage and the Zeiss Zen implemented stitching algorithm was used. For colocalization of markers, Z-scans at 20× were performed.

[0095] Imaging of GFP stained slides used for cell density counting, and time-lapse migration were acquired using a Yokogawa W1 spinning disk confocal microscope (VisiScope, Visitron Systems GmbH, Puchheim, Germany) controlled with the Visitron VisiView software and mounted on the Eclipse Ti-E microscope (Nikon, Nikon Instruments BV) using ex 488 laser and em filter 525/50. Measurements were recorded using the 10×0.45 CFI plan Apo lambda (Nikon, Nikon Instruments BV) objective with the sCMOS camera PCO edge 4.2m. Whole IHC slice imaging for cell counting was performed using the tile scan acquisition function. Tile scans were then stitched using the Grid/Collection stitching plugin.sup.51 in Fiji. For time lapse movies, tile scan Z-stacks were recorded. After stitching as performed for cell counting, a maximum Z-projection was created, and the Z-projection time stacks used for global visualization of cell migration. Cropped regions were created using Fiji and saved as uncompressed AVI files. The AVI files were converted to the mp4 format using Handbrake software to generate the supplemental movies.

[0096] For generation of figures and presenting images, the “crop” function, and changing the max/min levels using the “Brightness/Contrast” function of Fiji were used.

Example 8: Cell Density Quantification

[0097] The number of GFP.sup.+ cells migrating into GFP.sup.− target regions of cerebral organoid fusions was counted manually using the “Cell Counter” plugin of Fiji. The GFP.sup.− area in organoid fusions was outlined with the ROI tool and the area calculated using the “measure” function. The cell counts were divided by the area to determine the density of migrated GFP.sup.+ cells. For the migration time course (FIG. 2E,F) and organoid fusion mixing (FIG. 3B,C) experiments, confocal tile scan images of tissue cryosections were used for quantification. For the long-term slice culture experiment (FIG. 6D,E), a wide-field 5× image containing the GFP.sup.− region was used for counting.

Example 9: Statistics

[0098] All graphs and statistical analyses were generated using Prism 7 (GraphPad). When comparing only two groups (FIG. 1C, 6E) an unpaired two-tailed Student's t-test was performed, for the remaining data comparing multiple groups a one-way ANOVA with posthoc Tukey's test was used (FIG. 2F, 3C). Samples were tested for normality prior to testing statistical significance. No statistical methods were used to predetermine the sample size. Sample sizes for experiments were estimated based on previous experience with a similar setup that showed significance. Experiments were not randomized and investigator was not blinded.

[0099] Primary Antibodies

TABLE-US-00001 Species Antigen Company Catalog no. Dilution Rb FoxG1 Abcam ab18259 1:200 Rb TBR1 Abcam ab31940 1:300 Rb PV Swant PV27 1:1000 Rb Calbindin Swant CD38a D-28K 1:1000 Ms Calretinin Swant ? 1:1000 Ms GAD1/GAD67 Millipore MAB5406 1:800 Rb VGAT Synaptic 131 013 1:500 Systems Chk GFP Abcam ab13970 1:1000 Rb NPY Abcam ab30914 1:1000 Ms Reelin Millipore MAB5366 1:200 Rb SOX6 Abcam ab30455 1:500 Ms COUP-TFII Perseus 1:300 Proteomics Gt Sp8 Santa Cruz sc-104661 1:300 Rb VIP Immunostar 20077 1:750 Gt DCX Santa Cruz sc-8066 1:200 Ms NeuN Millipore MAB377 1:500 Rat SOM Millipore MAB354 1:200 Ms Nkx2.1 Dako M3575 1:50 Ms PAX6 DSHB PAX6-S 1:200 Rb DsRed/tdtomato Clontech 632496 1:250

[0100] Secondary Antibodies

TABLE-US-00002 Host Recognizes Fluophore Company Catalog no. Dilution Donkey rabbit Alexa Fluor 568 Invitrogen A10042 1:500 Donkey rabbit Alexa Fluor 647 Invitrogen A31573 1:500 Donkey mouse IgG Alexa Fluor 568 Invitrogen A10036 1:500 Donkey mouse IgG Alexa Fluor 647 Invitrogen A31571 1:500 Donkey chicken Alexa Fluor 488 Jackson Immuno 703-605-155 1:500 Donkey goat Alexa flour 647 Invitrogen A21447 1:500 Donkey rat Alexa Fluor 647 Jackson Immuno 712-605-150 1:500

[0101] qPCR Primers

TABLE-US-00003 Gene Primer 1 sequence Primer 2 sequence DLX2 ACGTCCCTTACTCCGCCAAG AGTAGATGGTGCGGGGTTTCC (SEQ ID NO: 9) (SEQ ID NO: 10) FOXG1 TGGCCCATGTCGCCCTTCCT GCCGACGTGGTGCCGTTGTA (SEQ ID NO: 11) (SEQ ID NO: 12) GSX2 CACCGCCACCACCTACAAC CAGGAGTTGCGTGCTAGTGA (SEQ ID NO: 13) (SEQ ID NO: 14) LHX6 CCGTCTGCAGGCAAGAACAT GACACACGGAGCACTCGAG (SEQ ID NO: 15) (SEQ ID NO: 16) NKX2-1 GCCGTACCAGGACACCATG ATGTTCTTGCTCACGTCCCC (SEQ ID NO: 17) (SEQ ID NO: 18) TBP GGGCACCACTCCACTGTATC CGAAGTGCAATGGTCTTTAGG (SEQ ID NO: 19) (SEQ ID NO: 20) TBR1 CTCAGTTCATCGCCGTCACC AGCCGGTGTAGATCGTGTCATA (SEQ ID NO: 21) (SEQ ID NO: 22)

Example 10: Differentiation by Drug-Patterning of Cerebral Organoid Tissues Enhances the Production of Ventral Forebrain Identity

[0102] The cerebral organoid method (WO2014/090993, Lancaster et al., both Lancaster & Knoblich, all supra) is capable of producing many different brain regions, including dorsal and ventral forebrain. As it relies on intrinsic patterning, however, the production of some regions is variable and infrequent, especially more ventral (NKX2-1+) interneuron progenitor regions. To increase the consistency and yield of ventral-forebrain interneuron progenitor regions, we included a ventral drug-treatment (FIG. 1A). We utilized a combination of WNT-inhibition and enhanced SHH signaling to promote a rostro-ventral forebrain identity. qPCR analysis of the ventral organoids revealed a significant increase in expression of the forebrain marker FOXG1 (FIG. 1B,C). The dorsal forebrain marker TBR1 became undetectable, while the ventral forebrain marker DLX2 was dramatically increased in ventral organoids compared to control organoids (FIG. 1B,C). To further confirm the successful ventralization of cerebral organoid tissue, we examined the expression of specific markers of ventral forebrain ganglionic eminence (GE) subregions that produce interneurons of different subtypes. GSX2 is expressed in the dorsal-lateral GE (LGE) and caudal GE (CGE), NKX2-1 is expressed in the ventral-medial GE (MGE), while LHX6 is expressed in a subregion of the MGE producing more ventral-derived MGE (vMGE) interneurons (FIG. 1B). GSX2 was expressed in control organoids, but further increased in ventral organoids (FIG. 1C). Expression of NKX2-1 and LHX6 was undetectable in control organoids, but largely increased in ventral organoids (FIG. 1C). Finally, immunostaining confirmed the qPCR results indicating widespread expression of FOXG1 in control and ventral organoids, but only ventral organoids expressed the ventral forebrain marker NKX2-1 (FIG. 1D). Intriguingly, control organoids widely expressed dorsal forebrain markers for both progenitors (PAX6) and early born neurons (TBR1) (FIG. 1E). In contrast, ventral organoids contained only small regions of PAX6.sup.+ or TBR1.sup.+ tissue (FIG. 1E). Therefore, these results confirm the successful production of ventral cerebral organoids at the expense of dorsal tissue upon ventral drug-treatment.

Example 11: Fused Cerebral Organoid Tissues Recapitulate a Continuous Dorsal-Ventral Forebrain Axis and Long-Distance Cell Migration

[0103] To recreate the complete dorsal-ventral identity axis in a single tissue, we developed an organoid tissue co-culture method, which we termed organoid “fusion”. Control organoids produced mostly dorsal forebrain tissue (FIG. 1C,E). However, inhibition of SHH activity with the smoothened receptor inhibitor cyclopamine A (CycA) can enhance dorsal forebrain identity in 2D neuronal differentiation from hPSCs. Therefore, to support dorsal identity, organoids were treated with CycA during the neural induction step of the cerebral organoid protocol (FIG. 2A). In this approach, embryoid bodies (EBs) are individually differentiated and patterned into either dorsal (CycA) or ventral (IWP2+SAG) forebrain organoids (FIG. 2A,B). After differentiation treatments, a ventral and a dorsal EB are embedded together within a single Matrigel droplet (FIG. 2A), and over time the organoids grow together and become fused (FIG. 2B). Immunostaining of fused ventral::dorsal organoids revealed the production of a continuous tissue where one side was highly positive for the ventral marker NKX2-1, while the opposite side was positive for the dorsal marker TBR1 (FIG. 2C). Therefore, the organoid fusion method allows dorsal and ventral forebrain regions to be juxtaposed in an arrangement similar to that occurring during brain development.

[0104] To test whether cells could migrate between the fused organoids we used cell lines containing a ubiquitous GFP reporter to create ventral/GFP.sup.+::dorsal organoid fusions. Immunofluorescent analysis showed many GFP.sup.+ cells from the ventral organoid within the GFP.sup.− dorsal organoid (FIG. 2D). Migrating cells were observed in small numbers around day 30 (FIG. 2D,E). Their density drastically increased from day 30 to 46, but we did not observe a significant increase from day 46 to 80 (FIG. 2E). Since the organoids increase in size with age, the absolute numbers of migrated cells must increase over time to maintain a similar density. Moreover, the cells appeared more dispersed throughout the dorsal regions in 80 day old organoids (FIG. 2D). Therefore, based on these results, we focused our future analysis on organoids older than 60 days old.

Example 12: Mixing the Tissue Components of Cerebral Organoid Bi-Differentiated Fusions Indicates Directed Ventral-to-Dorsal Cortical Cell Migration

[0105] During in vivo brain development, GABAergic interneurons originate in ventral forebrain progenitor regions before they migrate to their dorsal forebrain target. To test whether this directionality is recapitulated in fused organoids, we varied the identities of their individual tissue components (FIG. 3). We consistently labeled one organoid with GFP and the other with tdTomato, and delineated the fusions in an origin::target (GFP::tdTomato) arrangement. Using this paradigm, we analyzed the number of migrating cells when differentially controlling the dorsal/ventral identity of the origin and target regions of cerebral organoid fusions. Whole-mount imaging of ventral::control and ventral::dorsal fusions indicated the occurrence of GFP.sup.+ spots within the tdTomato.sup.+ tissue (FIG. 3A). Conversely, the spots were rarely observed in control::control or dorsal::dorsal fusions (FIG. 3A). This difference was even more striking when analyzing immunostained cyrosections of organoid fusion tissue. The highest amount of migrating cells occurred in ventral::control and ventral::dorsal fusions, while the least migration occurred in dorsal::dorsal fusions (FIG. 3B,C). Although the average density of migrating cells in ventral::control fusions was not significantly different than ventral::dorsal fusions, the ventral::dorsal fusions more consistently contained a high amount of migrating cells (FIG. 3C). These data confirm our initial observation of directionally biased migration from ventral into dorsal organoid tissue, and strongly suggests that the migration between fused organoids resembles interneuron migration. Finally, this experiment shows that ventral::dorsal fused organoids produce the most robust migration between organoid tissues.

Example 13: GABAergic Interneurons Migrate Between Fused Cerebral Organoid Tissues

[0106] Since example 12 suggested that the migration in ventral::dorsal organoid fusions resembles interneuron migration, we first tested whether the migrating cells were GABAergic by examining whether the migrating GFP.sup.+ cells expressed GAD1, one of the key enzymes for the synthesis of GABA. Immunostaining revealed that the GFP.sup.+ cells that had migrated into the target organoid broadly expressed GAD1 (FIG. 4A-C). Strikingly, when visualizing the entire organoid, GAD1 was expressed in a similar pattern as the GFP.sup.+ migrating cells (FIG. 4A). Additionally, the expression of GAD1 appeared stronger in regions near the edge of the organoid (FIG. 4B), and farther away from the origin of the migrating cells. Therefore, interneurons can migrate from ventral into dorsal regions within organoid fusions.

[0107] Another major population of tangentially migrating cells in the developing human brain are the non-GABAergic Cajal-Retzius cells. These cells are identified by the expression of Reelin (RELN). Therefore, we tested whether the migratory GFP.sup.+ cells in organoid fusions also express RELN. Surprisingly, we observed an apparent lack of expression of RELN by GFP.sup.+ cells (FIG. 4D), despite the substantial presence of GFP.sup.−, RELN.sup.+ cells in the dorsal target region of organoid fusions. Thus, our data indicate that the migratory GFP.sup.+ cells in organoid fusions are not Cajal-Retzius cells, and in combination with our previous results strengthens their identity as GABAergic interneurons.

[0108] Finally, we tested whether the migrating cells could produce mature neurons by analyzing their expression of the immature migrating neuron marker DCX, and/or the mature neuronal marker NeuN. We observed that the GFP.sup.+ cells expressed DCX (FIG. 4E), confirming their neuronal identity, and a subset also expressed NeuN (FIG. 4E). This finding indicates that the migrating GFP.sup.+ cells are migratory neurons (DCX.sup.+), but also that the migratory neurons can become mature neurons (DCX.sup.+/NeuN.sup.+). Taken together, our results show that interneurons can migrate between fused ventral-dorsal organoids, and can become mature neurons.

Example 14: Migrating Interneurons Produce Various LGE/CGE and MGE-Derived Cortical Interneuron Subtypes in Fused Cerebral Organoid Tissues

[0109] Since the migrating GFP.sup.+ cells can become mature neurons (FIG. 4E), and appear to be predominantly GABAergic interneurons (FIG. 4A,B), we next tested which interneuron subtypes are produced. Interneurons are particularly heterogeneous and multiple molecular markers can be used to identify various subtypes that are generated by distinct progenitor subpopulations within the ventral forebrain. In humans, the majority of interneurons are generated from NKX2-1.sup.+ regions of the MGE. We tested whether the migrating GFP.sup.+ cells produce MGE-derived interneuron subtypes. In humans, SOX6 is expressed in the MGE and in immature and mature interneurons emerging from this region. In organoid fusions, we observed multiple SOX6.sup.+ MGE interneurons among the GFP.sup.+ migrating cells GFP.sup.+ cells that were also GAD1.sup.+ (FIG. 5A). Therefore, MGE-derived interneurons can be generated within cerebral organoid fusions. To confirm this finding, we also examined the expression of markers for MGE-derived interneurons. We observed expression of somatostatin (SOM) (FIG. 5B), neuropeptide Y (NPY) (FIG. 5C) calbindin D-28k (CB) (FIG. 5D), and parvalbumin (PV) (FIG. 5E) by GFP.sup.+ migrated interneurons (GAD1+ or VGAT+). Therefore, in organoid fusion tissues, multiple MGE-derived interneuron subtypes can be generated.

[0110] The remaining interneurons in the human brain arise from the LGE/CGE. Similar to SOX6 for MGE, the transcription factors COUP-TFII/NR2F2 and SP8 can be used as LGE/CGE fate-mapping markers for cortical interneurons. Both SP8 (FIG. 5F) and COUP-TFII (FIG. 5G) were expressed by GFP.sup.+ migrating interneurons (GAD1.sup.+) in organoid fusions. As confirmation of this result, we also analyzed the expression of markers for LGE/CGE-derived subtypes. Our previous data already indicated a lack of RELN expression by GFP.sup.+ migrating cells (FIG. 4), which in addition to non-interneuron Cajal-Retzius cells is also expressed by subpopulations of GABAergic MGE and CGE-derived interneurons. We also did not observe any vasoactive intestinal peptide (VIP) expressing GFP.sup.+ interneurons. However, we did observe calretinin (CR) expressing GFP.sup.+ interneurons (VGAT.sup.+) in organoid fusions (FIG. 5H). Collectively, these results indicate that organoid fusions contain many diverse interneuron subtypes originating from the major ventral forebrain subregions (MGE and LGE/CGE).

Example 15: Neuronal Migration in Fused Cerebral Organoid Tissues Resembles the Tangential Migration of Cortical Interneurons

[0111] The migratory dynamics of tangentially migrating cortical interneurons has been extensively documented using time-lapse imaging experiments. This behavior differs from that of radially migrating cortical cells which move along a radial glia fiber, or that of linearly migrating cells, such as the chain migration observed in LGE-derived olfactory bulb interneurons. To determine whether the behavior of migrating GFP.sup.+ cells in organoid fusions resembles that of cortical interneurons, we performed time-lapse recordings of migrating GFP.sup.+ cells in ventral-dorsal organoid fusion slice-cultures (FIG. 6A). The GFP.sup.+ ventral origin region of the organoid fusion could easily be distinguished from the GFP.sup.− dorsal target region (FIG. 6A). Thus, we could easily visualize the morphology of the sparsely labeled GFP.sup.+ cells which had migrated into the dorsal organoid fusion region. Over 3 days, we observed both stationary and motile cells (FIG. 6B), and surprisingly we also observed dynamic neuronal processes resembling axons that extended long distances (FIG. 6C). Strikingly, the migratory cells exhibited dynamics which exactly resembled the dynamics of migrating interneurons in the marginal zone (MZ) and intermediate zone (IZ) of embryonic mouse cortex. Migrating cells contained leading and trailing processes. The leading process was usually branched, and the migratory direction was determined by the branch dynamics. For instance, we observed multiple examples of cells extending a branch in the future direction of travel while retracting a branch that was extended in an alternate direction (FIG. 6B). In addition, cells migrated in multiple directions with frequent abrupt changes in direction, which resembles the multidirectional, wandering behavior exhibited by tangentially migrating cortical interneurons within the cortex.

[0112] The chemoattractant SDF-1 (CXCL12) and its receptor CXCR4 regulate the tangential migration of interneurons. To test if the migration we observed in cerebral organoid fusions is CXCR4-dependent, we created long-term slice cultures of organoid fusions that we treated with the CXCR4 antagonist, AMD3100. Compared to untreated control slices prepared from the same organoid fusion, the density of migrating GFP.sup.+ cells into GFP.sup.− dorsal regions was significantly reduced upon AMD3100 treatment. Therefore, the cell migration in cerebral organoid fusions depends on CXCR4 activity. Combined with our previous data, this result confirms that the cell migration observed in cerebral organoid is consistent with that of tangentially migrating interneurons.

[0113] Observations:

[0114] Migrating GFP.sup.+ cells within the dorsal region of a ventral/GFP::dorsal organoid fusion were observed. An observed cell migrates in a single direction. The leading process is branched with the different branches dynamically extending and retracting seemingly independent of one another. The trailing process follows as the cell body moves forward, and multiple times a leading process becomes a trailing process. As the cell moves forward, one leading process is extended while the remaining processes retract. Then the whole migratory dynamic cycle is repeated as the cell progresses forward.

[0115] A cell exhibiting many changes of direction involving the dynamic extension and retracing of several processes was observed. As the cell body remains static, branches are extended in multiple directions, and then each of the main branches extends additional higher order branches. Finally, a branch is extended in a particular direction followed by the retraction of the other main branch. The cell body is then moved in the direction of the extending branch. The cycle is repeated as the cell decides which direction to migrate.

[0116] Multiple migrating cells were observed. 1) Initially a cell is migrating upward. The upward process is retracted as a new leading process is extended downward and becomes branched. The cell migration direction is then changed downward. The bifurcated leading process is dynamic such that one process is extended as the other process is retraced. The cell body then moved toward the extended leading process. Prior to nucleokinesis, a swelling is observed moving from the cell body into the proximal portion of the leading process. Then the cell body is moved in parallel to the swelling, and finally the cell body moves into the swelling. 2) A second cell migrates and changes direction several times. With each change of direction, the trailing process becomes the leading process. The new leading process is extended toward the direction of travel as the trailing process is retracted.

[0117] Multiple cells migrating in different directions with extending and retracting processes were observed. Beginning around 45 hrs of observation, one cell migrates and travels rapidly in a constant direction, but at around 70 hours the progress is slowed as the leading process branches.

[0118] Multiple migrating cells were observed. Around 6 hours after start of observation, a cell migrates with a branched leading process. At multiple times, 3 branches are observed. As the cell progresses forward, branches are extended in the direction of travel, while other branches are retracted. Around 23 hours the cell changes direction abruptly. This involves an extension of a new process, while the previous leading process is retracted. At around 39 hours, the leading process begins turning then makes a 180-degree turn, and then extends. The cell body then follows the leading process.

[0119] The neurites appearing to be axons with an enlarged tuft at the end the processes which resembles that of a growth cone were observed. The processes are highly dynamic, and exhibit extension in single directions, but also abrupt changes in direction.

Example 16: Cell Migration Assay

[0120] We developed a cell migration assay using fused cerebral organoids. Ventral-dorsal organoid fusions exhibit robust long-distance cell migration resembling that of ventral forebrain-derived cortical inhibitory interneurons. We observed substantially more migration from ventral into dorsal forebrain regions in cerebral organoid fusions. The migrating cells within organoid fusions express GABAergic markers (GAD1/VGAT). The migrated GFP.sup.+ cells can produce a variety of interneuron subtypes. In addition, the lack of RELN expression by migrating GFP.sup.+ cells supports a ventral forebrain-derived interneuron identity. The migration dynamics of the GFP.sup.+ cells in fused organoids resembles the characteristic migratory behavior exhibited by interneurons migrating tangentially within the cortex. Finally, the cell migration in organoid fusions was inhibited by CXCR4 inhibition as observed for tangentially migrating interneurons in developing mouse cortex. In summary, we have recapitulated the migration of human cortical interneurons from ventral in dorsal forebrain regions. Moreover, the observance that these cells exhibit both immature and mature neuronal markers indicates their ability to undergo maturation once arriving in their dorsal cortical forebrain target regions. This represents the exciting opportunity to recreate a developing human cortical circuit containing an enhanced repertoire of cellular diversity than was possible to achieve within the previous singular organoid methods.

[0121] An exciting application of this technique is studying human developmental biology and its relationship to neurological diseases. With this in mind while characterizing this assay, we present different experimental paradigms, each of which can be used to investigate various aspects and scientific questions related to neuronal cell migration. For instance, the labeling of the cells within one of the fused organoids with a fluorescent reporter allows the visualization of long-distance neuronal migration. This can even be continuously monitored over time through whole-mount imaging of intact organoid fusions. In addition, the identity of the cells can be easily examined using immunostaining for identification of neuronal subtypes. This is useful because many psychiatric diseases, such as Schizophrenia, are thought to involve selective deficits in specific interneuron subpopulations (Lewis Current Opinion in Neurobiology 26, 22-26 (2014)). A second type of analysis is dissecting the role of specific molecules on neuronal migration to determine if they are acting in a cell-autonomous or cell non-autonomous manner. For instance, using inventive bi-differentiated tissue, organoids from either the origin of migration or the target can be genetically manipulated independently by deriving the origin and target organoids from distinct cell lines containing either mutant or wild-type alleles of a gene of interest.

[0122] We also present an organoid fusion slice culture paradigm in which confocal time-lapse imaging can be used to analyze the short-term dynamics of neuronal cell migration. This is an important tool because some molecules such as GABA affect the motility of migrating interneurons, which may produce a subtle phenotype in a long-term migration assay, and therefore instead require a higher time-resolution analysis of the dynamics of migrating cells. In addition, long-term slice cultures can be used to test how different drug-treatments can affect cell migration. This allows drug-screens to determine the effect of many different molecules on cell migration.

[0123] Finally, the fused organoid tissues also present unique applications beyond cell migration. As one further example, we observed substantial neurite dynamics with the appearance of axon projections. In addition, although we specifically focused on ventral-dorsal forebrain fusions, the organoid fusion paradigm allows flexibility in the brain regional identities that can be grown together. Combined with the additional brain-region specific organoid protocols (Jo et al. Stem Cell 19, 248-257 (2016); Hockemeyer et al. Nat. Biotechnol. 27, 851-857 (2009); Preibisch et al. Bioinformatics 25, 1463-1465 (2009)), the possible brain circuits that could be modeled using organoid fusions is vast. Therefore, organoid fusion technology greatly enhances the phenotypic analyses possible in cerebral organoids, and the flexibility of the method immensely expands the future development of in vitro models of human neurological diseases.