NEW ATTENUATED STRAINS OF APICOMPLEXA AND THEIR USE AS ANTIGEN VECTORS FOR THE PREVENTION OF INFECTIOUS DISEASES

20210139883 · 2021-05-13

    Inventors

    Cpc classification

    International classification

    Abstract

    Disclosed is a mutant strain of Sarcocystidae in which the two genes mic1 and mic3 are deleted containing two specific recombination sites of an enzyme allowing a specific recombination, in particular Cre-recombinase, the specific recombination sites being at the respective locus of each of the deleted genes, the specific recombination site of the enzyme allowing specific recombination, in particular of the Cre-recombinase, at the locus of the deleted mic1 gene being different from that of the deleted mic3 gene.

    Claims

    1-15. (canceled)

    16. A mutant Sarcocystidae strain in which the two genes mic1 and mic3 are deleted containing two sites of specific recombination of an enzyme allowing specific recombination, said specific recombination sites being at the respective locus of each of the said deleted genes, the site of specific recombination of the enzyme allowing specific recombination at the locus of the deleted mic1 gene being different to that at the locus of the deleted mic3 gene.

    17. The mutant strain according to claim 16, wherein said mutant strain is a strain of the genus Neospora spp.

    18. The mutant strain according to claim 16, wherein said mutant strain is a strain of the species Neospora caninum.

    19. The mutant strain according to claim 16, wherein said mutant strain is a strain of the genus Toxoplasma spp.

    20. The mutant strain according to claim 16, wherein said mutant strain is a strain of the species Toxoplasma gondii.

    21. The mutant strain according to claim 16, wherein both mic1 and mic3 genes are deleted, containing two specific recombination sites of an enzyme allowing specific recombination, at the respective locus of each of said deleted genes, the specific recombination site of the enzyme allowing specific recombination, at the locus of the deleted mic1 gene being different from that at the locus of the deleted mic3 gene, and not containing heterologous DNA, other than heterologous DNA corresponding to the specific recombination sites of the enzyme allowing specific recombination, at the respective locus of each of the said deleted genes.

    22. The mutant strain according to claim 16, wherein both mic1 and mic3 genes are deleted, containing two specific recombination sites of an enzyme allowing specific recombination, at the respective locus of each of said deleted genes, the specific recombination site of the enzyme allowing specific recombination, at the locus of the deleted mic1 gene being different from that at the locus of the deleted mic3 gene, and not containing heterologous DNA, other than heterologous DNA corresponding to the specific recombination sites of the enzyme allowing specific recombination, at the respective locus of each of the said deleted genes, said enzyme allowing a specific recombination being the Cre-recombinase, and the specific recombination sites of Cre-recombinase at the respective locus of each of said deleted genes being selected from: LoxN of SEQ ID NO: 5, LoxP of SEQ ID NO: 12 and Lox2272 of SEQ ID NO: 68.

    23. The mutant strain according to claim 16, said strain containing heterologous DNA at the locus of the deleted mic1 gene or at the locus of the deleted mic3 gene, different from heterologous DNA corresponding to the enzyme-specific recombination sites allowing recombination specific to the respective locus of each of said deleted genes, said heterologous DNA being flanked: a first enzyme-specific recombination site allowing specific recombination, corresponding to the enzyme-specific recombination site allowing specific recombination at the locus of the deleted mic1 gene or the locus of the deleted mic3 gene and, a second specific recombination site identical to said first specific recombination site, corresponding to the enzyme-specific recombination site allowing specific recombination, at the locus of the deleted mic1 gene or the locus of the deleted mic3 gene and, and the means necessary for its transcription.

    24. The mutant strain according to claim 16, said strain containing heterologous DNA at the locus of the deleted mic1 gene or at the locus of the deleted mic3 gene, different from heterologous DNA corresponding to the specific recombination sites of the enzyme allowing recombination specific to the respective locus of each of said deleted mic1 and mic3 genes, said heterologous DNA coding for a protein and being flanked: a first enzyme-specific recombination site allowing specific recombination, corresponding to the enzyme-specific recombination site allowing specific recombination at the locus of the deleted mic1 gene or the locus of the deleted mic3 gene and, a second specific recombination site identical to said first specific recombination site, corresponding to the enzyme-specific recombination site allowing specific recombination, at the locus of the deleted mic1 gene or the locus of the deleted mic3 gene and, and the means necessary for the protein expression of the said heterologous DNA, said enzyme allowing specific recombination being Cre-recombinase and the specific recombination sites of Cre-recombinase being chosen from: LoxN of SEQ ID NO: 5, LoxP of SEQ ID NO: 12 and Lox2272 of SEQ ID NO: 68.

    25. The mutant strain according to claim 16, containing heterologous DNA at the locus of the deleted mic1 gene or at the locus of the deleted mic3 gene, different from heterologous DNA corresponding to the specific recombination sites of an enzyme allowing specific recombination, said enzyme being the Cre-recombinase, at the respective locus of each of the said mic1 and mic3 genes deleted and containing three specific recombination sites which are respectively: site A corresponding to the specific recombination site of the Cre-recombinase at the locus of the deleted mic1 gene, site B corresponding to the specific recombination site of Cre-recombinase at the locus of the deleted mic3 gene, and site C corresponding to said second specific recombination site which flanks said second heterologous DNA identical to said first specific recombination site, said first Cre-recombinase specific recombination site corresponding to said Cre-recombinase specific recombination site at the locus of the deleted mic1 gene (site A) or said Cre-recombinase specific recombination site at the locus of the deleted mic3 gene (site B) said three specific recombination sites A, B and C being selected from the following sites: LoxN of SEQ ID NO: 5, LoxP of SEQ ID NO: 12 and Lox2272 of SEQ ID NO: 68, so that said site A and said site B are different, and said site C is identical to said site A or said site B.

    26. The mutant strain according to claim 16, containing heterologous DNA at the locus of the deleted mic1 gene or at the locus of the deleted mic3 gene, different from heterologous DNA corresponding to the specific recombination sites of an enzyme allowing specific recombination, said enzyme being the Cre-recombinase, at the respective locus of each of the said mic1 and mic3 genes deleted and containing three specific recombination sites which are respectively: site A corresponding to the specific recombination site of the Cre-recombinase at the locus of the deleted mic1 gene, site B corresponding to the specific recombination site of Cre-recombinase at the locus of the deleted mic3 gene, and site C corresponding to said second specific recombination site which flanks said second heterologous DNA identical to said first specific recombination site, said first Cre-recombinase specific recombination site corresponding to said Cre-recombinase specific recombination site at the locus of the deleted mic1 gene (site A) or said Cre-recombinase specific recombination site at the locus of the deleted mic3 gene (site B) said three specific recombination sites A, B and C being selected from the following sites: LoxN of SEQ ID NO: 5, LoxP of SEQ ID NO: 12 and Lox2272 of SEQ ID NO: 68, so that said site A and said site B are different, and said site C is identical to said site A or said site B; such as said site A is the LoxN site of SEQ ID NO: 5 said site B is the LoxP site of SEQ ID NO: 12, and said site C is the LoxN site of SEQ ID NO: 5, said first specific recombination site of Cre-recombinase being site A; or such as said site A is the LoxN site of SEQ ID NO: 5 said site B is the LoxP site of SEQ ID NO: 12, and said site C is the LoxP site of SEQ ID NO: 12, said first specific recombination site of Cre-recombinase being site B, or such as said site A is the LoxP site of SEQ ID NO: 12 said site B is site LoxN of SEQ ID NO: 5, and said site C is the LoxP site of SEQ ID NO: 12, said first specific recombination site of Cre-recombinase being site A; or such as said site A is the LoxP site of SEQ ID NO: 12 said site B is site LoxN of SEQ ID NO: 5, and said site C is the LoxN site of SEQ ID NO: 5, said first specific recombination site of Cre-recombinase being site B.

    27. The mutant strain according to claim 16, wherein said mutant strain is a mutant strain of Toxoplasma spp., and wherein the rop16I gene is deleted and contains an enzyme-specific recombination site allowing locus-specific recombination of said deleted rop16I gene, said site being different from said specific recombination site located at the locus of the deleted mic1 gene and said specific recombination site located at the locus of the deleted mica gene and said mutant strain comprising a gene encoding the protein GRA15II, as well as the means necessary for the expression of said protein at the locus of said deleted rop16I gene, said gene encoding the protein GRA15II at the locus of said deleted rop16I gene, being flanked upstream by said enzyme-specific recombination site allowing locus-specific recombination of said deleted rop16I gene.

    28. The mutant strain according to claim 16, wherein said mutant strain is a mutant strain of Toxoplasma spp., and wherein the rop16I gene is deleted and contains an enzyme-specific recombination site allowing locus-specific recombination of said deleted rop16I gene, said site being different from said specific recombination site located at the locus of the deleted mic1 gene and said specific recombination site located at the locus of the deleted mica gene and said mutant strain comprising a gene encoding the protein GRA15II, as well as the means necessary for the expression of said protein at the locus of said deleted rop16I gene, said gene encoding the protein GRA15II at the locus of said deleted rop16I gene, being flanked upstream by said enzyme-specific recombination site allowing locus-specific recombination of said deleted rop16I gene, in which said enzyme allowing specific recombination is Cre-recombinase, and said specific recombination site of an enzyme allowing locus-specific recombination of said deleted rop16I gene is a specific recombination site of Cre-recombinase chosen from the following sites: LoxN of SEQ ID NO: 5, LoxP of SEQ ID NO: 12 and Lox2272 of SEQ ID NO: 68, this specific recombination site being different from the specific recombination sites of Cre-recombinase at the locus of the deleted mic1 gene and at the locus of the deleted mic3 gene, said strain containing three specific recombination sites which are respectively: site A corresponding to the specific recombination site of the Cre-recombinase at the locus of the deleted mic1 gene site B corresponding to the specific recombination site of Cre-recombinase at the locus of the deleted mic3 gene, and site D corresponding to the specific recombination site of the Cre-recombinase at the locus of said deleted rop16I gene such as said site A is the LoxN site of SEQ ID NO: 5, said site B is the LoxP site of SEQ ID NO: 12, said site D is the Lox2272 site of SEQ ID NO: 68.

    29. The mutant strain according to claim 16, wherein said mutant strain is a mutant strain of Toxoplasma spp., said enzyme allowing specific recombination is Cre-recombinase, in which the rop16I gene is deleted and said strain contains a specific recombination site of the Cre-recombinase, at the locus of said deleted rop16I gene, said strain containing four specific recombination sites which are respectively: site A corresponding to the specific recombination site of the Cre-recombinase at the locus of the deleted mic1 gene site B corresponding to the specific recombination site of Cre-recombinase at the locus of the deleted mic3 gene, and the site C corresponding to said second specific recombination site which flanks said heterologous DNA identical to said first specific recombination site, said first Cre-recombinase specific recombination site corresponding to said Cre-recombinase specific recombination site at the locus of the deleted mic1 gene (site A) or said Cre-recombinase specific recombination site at the locus of the deleted mica gene (site B) site D corresponding to the specific recombination site of the Cre-recombinase at the locus of said deleted rop16I gene such as said site A is the LoxN site of SEQ ID NO: 5 said site B is the LoxP site of SEQ ID NO: 12, said site C is the LoxN site of SEQ ID NO: 5, said first specific recombination site of Cre-recombinase being site A, and said site D is the Lox2272 site of SEQ ID NO: 68; or such as said site A is the LoxN site of SEQ ID NO: 5 said site B is the LoxP site of SEQ ID NO: 12, said site C is the LoxP site of SEQ ID NO: 12, said first specific recombination site of Cre-recombinase being site B, and said site D is the Lox2272 site of SEQ ID NO: 68.

    30. The mutant strain according to claim 16, wherein said heterologous DNA encodes an immunogenic heterologous antigen of virus, parasite or bacterium.

    31. The mutant strain according to claim 16, wherein said heterologous DNA consists of the nucleotide sequence SEQ ID NO: 173, encoding the influenza virus antigen SEQ ID NO: 167

    32. The mutant strain according to claim 16, wherein said mutant strain is a strain of Toxoplasma gondii selected from a strain in which the mic1 gene and the mic3 gene are deleted and wherein the specific recombination site of the Cre-recombinase at the locus of the deleted mic1 gene is the LoxN site of SEQ ID NO: 5 and the specific recombination site of Cre-recombinase at locus of the deleted mic3 gene is the LoxP site of SEQ ID NO: 12. a strain in which the mic 1 gene, the mic 3 gene and the rop16I gene are deleted, and comprising a gene encoding the protein GRA15II, as well as the means necessary for the expression of said protein, at the locus of said deleted rop16I gene, said gene encoding the protein GRA15II at the locus of said deleted rop16I gene, being flanked upstream by a specific recombination site of the Cre-recombinase, in which the specific recombination site of Cre-recombinase at the locus of the deleted mic1 gene is the LoxN site of SEQ ID NO: 5, and the specific recombination site of Cre-recombinase at the locus of the deleted mic3 gene is the LoxP site of SEQ ID NO: 12, and said Cre-recombinase specific recombination site which upstream flanks said gene encoding the GRA15II protein at the locus of the deleted rop16I gene, is the Lox2272 site of SEQ ID NO: 68.

    33. The mutant strain according to claim 16, wherein said mutant strain is a Neospora caninum strain and wherein the mic1 gene and the mic3 gene are deleted and wherein the specific recombination site of Cre-recombinase at the locus of the deleted mic1 gene is the LoxP site of SEQ ID NO: 12 and the specific recombination site of Cre-recombinase at the locus of the deleted mic3 gene is the LoxN site of SEQ ID NO: 5.

    34. A method for the targeted insertion of heterologous DNA using a mutant strain according to claim 16, not containing heterologous DNA different from heterologous DNA corresponding to the specific recombination sites of Cre-recombinase at the respective locus of each of said deleted genes.

    35. A mutant strain of Toxoplasma spp. wherein the genes mic1, mic3 and rop16I are deleted, containing three Cre-recombinase specific recombination sites, at the respective locus of each of said deleted genes, the Cre-recombinase specific recombination site, at the locus of the deleted mic1 gene being different from that at the locus of the deleted mic3 gene and the recombination site specific to the locus of the deleted rop16I gene being different from the recombination sites specific to the loci of the deleted mic1 and mic3 genes and said strain containing DNA heterologous to the locus of the deleted mic1 gene or the locus of the deleted mic3 gene or the locus of the deleted rop16I gene, said heterologous DNA being different from heterologous DNA corresponding to the specific recombination sites of the Cre-recombinase, at the respective locus of each of the deleted mic1, mic3 and rop16I genes, in such a way that: when said heterologous DNA is inserted at the locus of the deleted mic1 gene, it is flanked: a first Cre-recombinase-specific recombination site, corresponding to a Cre-recombinase-specific recombination site, at the locus of the deleted mic1 gene (site A), and a second Cre-recombinase specific recombination site (site C), identical to the first Cre-recombinase specific recombination site located at the locus of the deleted mic1 gene (site A), when said heterologous DNA is inserted at the locus of the deleted mic3 gene, it is flanked: a first Cre-recombinase-specific recombination site, corresponding to a Cre-recombinase-specific recombination site, at the locus of the deleted mic3 gene (site B), and a second Cre-recombinase specific recombination site (site C), identical to the first Cre-recombinase specific recombination site located at the locus of the deleted mic3 gene (site B), when said heterologous DNA is inserted at the locus of the deleted rop16I gene, it is flanked: a first Cre-recombinase-specific recombination site, corresponding to a Cre-recombinase-specific recombination site, at the locus of the deleted rop16I gene (site D), and a second Cre-recombinase specific recombination site (site C), identical to the first Cre-recombinase specific recombination site located at the locus of the deleted rop16I gene (site D), said strain comprising the elements necessary for the transcription of said heterologous DNA, or the means necessary for the expression of said heterologous DNA when said heterologous DNA encodes at least one protein, said mutant strain then containing four specific recombination sites of the Cre-recombinase defined as follows: site A corresponding to said specific recombination site of the Cre-recombinase at the locus of the deleted mic1 gene site B corresponding to said specific recombination site of the Cre-recombinase at the locus of the deleted mic3 gene, and site C corresponding to a specific recombination site of the Cre-recombinase at the locus of the deleted mic1 gene (site A) when heterologous DNA is inserted at the locus of the deleted mic1 gene or corresponding to a specific recombination site of Cre-recombinase at the locus of the deleted mic3 gene (site B) when heterologous DNA is inserted at the locus of the deleted mic3 gene, or corresponding to a specific recombination site of Cre-recombinase at the locus of the deleted rop16I gene (site D) when heterologous DNA is inserted at the locus of the deleted rop16I gene site D corresponding to said specific recombination site of the Cre-recombinase at the locus of said deleted rop16I gene such as, when heterologous DNA is inserted at the locus of the deleted mic1 gene, said site A corresponds to a LoxN site of SEQ ID NO: 5 said site B corresponds to a LoxP site of SEQ ID NO: 12 said site C corresponds to a LoxN site of SEQ ID NO: 5 said site D corresponds to a Lox2272 site of SEQ ID NO: 68; or such as when heterologous DNA is inserted at the locus of the deleted mica gene, said site A corresponds to a LoxN site of SEQ ID NO: 5 said site B corresponds to a LoxP site of SEQ ID NO: 12 said site C corresponds to a LoxP site of SEQ ID NO: 12 said site D corresponds to a Lox2272 site of SEQ ID NO: 68; or such as when heterologous DNA is inserted at the locus of the deleted rop16I gene, said site A corresponds to a LoxN site of SEQ ID NO: 5 said site B corresponds to a LoxP site of SEQ ID NO: 12 said site C corresponds to a Lox2272 site of SEQ ID NO: 68 said site D corresponds to a Lox2272 site of SEQ ID NO: 68.

    Description

    DESCRIPTION OF THE FIGURES

    [0536] FIG. 1: this figure is a schematic representation of recombination by the Cre/LoxP system applied to the X gene framed by identical LoxP sites.

    [0537] FIG. 2-A: This figure is a schematic representation of the plasmid pNcMIC3-KO-CAT-GFP LoxN. This 10063 base pair plasmid includes the selection gene encoding the chimeric protein CAT-GFP under the control of the promoter of α-tubulin of Toxoplasma gondii to allow expression of the gene in the parasite. This selection cassette is framed by two identical LoxN sites of the same orientation, added by PCR. On either side of the cassette were inserted the homologous regions flanking the ncmic3 gene.

    [0538] FIG. 2-B: This figure is a schematic representation of the plasmid pNcMIC1-KO-CAT-GFP LoxP. This plasmid of 10069 base pairs includes the selection gene encoding the chimeric protein CAT-GFP under the control of the promoter of α-tubulin of Toxoplasma gondii to allow the expression of the gene in the parasite. This selection cassette is framed by two identical LoxP sites of the same orientation, added by PCR. On either side of the cassette were inserted the homologous regions flanking the ncmic1 gene.

    [0539] FIG. 2-C: This figure is a schematic representation of the plasmid pTSAG1-Cre Recombinase. This 4,694 base pair plasmid includes the gene encoding the CRE-Recombinase protein under the control of the promoter of the sag1 gene of Toxoplasma gondii to allow the expression of the gene in the parasite. Downstream of the gene encoding Cre Recombinase, the 3′ UTR sequence of the sag1 gene of Toxoplasma gondii is inserted to stabilize the mRNA encoding the Cre Recombinase protein.

    [0540] FIG. 3-A: This figure illustrates the 4 steps to obtain the Neo ncmic1-3 KO 2G strain. The first homologous recombination step allows the integration of the gene encoding the CAT-GFP enzyme at the mic3 gene. Selection by chloramphenicol allows the simple mutant strain Neo ncmic3 KO to be amplified. In a second step, the gene encoding the CAT-GFP protein is deleted by action of Cre Recombinase. The third step allows the integration of the gene encoding the CAT-GFP enzyme at the mic1 gene. Selection by chloramphenicol amplifies the simple mutant strain Neo ncmic1-3 KO. Finally, in a final step, the gene encoding the CAT-GFP protein is deleted by the action of Cre Recombinase.

    [0541] FIG. 3-B: This figure represents the electrophoretic profiles of the PCR products obtained respectively with the wild strain NC-1 of Neospora caninum, the strain Neo ncmic3 KO, the strain Neo ncmic3 KO 2G, the strain Neo ncmic1-3 KO and the strain Neo ncmic1-3 KO 2G using the PCR primer sets in Table 3.

    [0542] FIG. 3-C: This figure represents the results of the sequencing obtained on the Neo ncmic1-3 KO 2G strain and confirms that the mic1 and mic3 genes have been deleted and replaced by LoxP and LoxN scars respectively.

    [0543] FIG. 4-A: This figure illustrates the immunofluorescence analysis of the detection of MIC3 protein obtained respectively with the wild Neospora caninum strain NC-1 and Neo ncmic1-3 KO 2G using an antibody specifically directed against MIC3 protein.

    [0544] FIG. 4-B: This figure illustrates the immunofluorescence analysis of CATGFP protein detection obtained respectively with wild Neospora caninum strain NC-1 and mutant Neospora caninum strains using the intrinsic fluorescence of CATGFP protein. This figure shows the presence of the CATGFP protein or the absence of the CATGFP protein following the action of Cre Recombinase.

    [0545] FIG. 5-A: This figure is a schematic representation of the plasmid pTgMIC3-KO-CAT-GFP LoxP. This plasmid of 9,931 base pairs includes the selection gene encoding the chimeric protein CAT-GFP under the control of the promoter of α-tubulin of Toxoplasma gondii to allow the expression of the gene in the parasite. This selection cassette is framed by two identical LoxP sites of the same orientation, added by PCR. On either side of the cassette were inserted the homologous regions flanking the tgmic3 gene.

    [0546] FIG. 5-B: This figure is a schematic representation of the plasmid pTgMIC1-KO-CAT-GFP LoxN. This plasmid of 10,285 base pairs includes the selection gene encoding the chimeric protein CAT-GFP under the control of the promoter of α-tubulin of Toxoplasma gondii to allow expression of the gene in the parasite. This selection cassette is framed by two identical LoxN sites of the same orientation, added by PCR. On either side of the cassette were inserted the homologous regions flanking the tgmic1 gene.

    [0547] FIG. 6-A: This figure illustrates the 4 steps to obtain the Toxo tgmic1-3 KO 2G strain. The first homologous recombination step allows the integration of the gene encoding the CAT-GFP enzyme at the mic3 gene. Selection by chloramphenicol amplifies the simple mutant strain Toxo tgmic3 KO. In a second step, the gene encoding the CAT-GFP protein is deleted by action of Cre Recombinase. The third step allows the integration of the gene encoding the CAT-GFP enzyme at the mic1 gene. Selection by chloramphenicol amplifies the simple mutant strain Toxo tgmic1-3 KO. Finally, in a final step, the gene encoding the CAT-GFP protein is deleted by the action of Cre Recombinase.

    [0548] FIG. 6-B: This figure represents the electrophoretic profiles of the PCR products obtained respectively with the wild RH strain of Toxoplasma gondii, the Toxo tgmic3 KO strain, the Toxo tgmic3 KO 2G strain, the Toxo tgmic1-3 KO strain and the final Toxo tgmic1-3 KO 2G strain using the PCR primer sets in Table 7.

    [0549] FIG. 6-C: This figure represents the results of the sequencing obtained on the Toxo tgmic1-3 KO 2G strain and confirms that the mic1 and mic3 genes have been deleted and replaced by LoxN and LoxP scars respectively.

    [0550] FIG. 7: this figure illustrates the immunofluorescence analysis of the detection of MIC1, MIC3 or CAT-GFP proteins obtained respectively with the wild RH strain of Toxoplasma gondii, the Toxo tgmic3 KO strain, the Toxo tgmic3 KO 2G strain, the Toxo tgmic1-3 KO strain and the Toxo tgmic1-3 KO 2G strain using an antibody specifically directed against the MIC1, MIC3 protein or directly with the intrinsic fluorescent properties of the CAT-GFP protein.

    [0551] FIG. 8: This figure is a schematic representation of the plasmid pTgRop16KO-Gra15IIKI-CAT-GFP Lox2272. This plasmid of 12721 base pairs includes the selection gene encoding the chimeric protein CAT-GFP under the control of the promoter of α-tubulin of Toxoplasma gondii to allow the expression of the gene in the parasite. This selection cassette is framed by two identical Lox2272 sites of the same orientation, added by PCR. Downstream of this cassette was integrated the expression cassette used to code the Gra51HAII protein. Then on either side of these cassettes were inserted the homologous regions flanking the tgrop16 gene.

    [0552] FIG. 9-A: This figure illustrates the 2 steps to obtain the Toxo tgmic1-3 KO rop16 KO GRA15II KI-2G strain. The first homologous recombination step allows the integration of the gene encoding the enzyme CAT-GFP and the gene gra15IIHA at the locus of the rop16 gene. Selection by chloramphenicol amplifies the mutant strain Toxo tgmic1-3 KO rop16 KO GRA15II KI. In a second step, the gene encoding the CAT-GFP protein is deleted by action of Cre Recombinase to obtain the Toxo tgmic1-3 KO rop16 KO GRA15II KI-2G strain.

    [0553] FIG. 9-B: This figure represents the electrophoretic profiles of the PCR products obtained respectively with the strains Toxo tgmic1-3 KO 2G, Toxo tgmic1-3 KO rop16 KO GRA15II KI and Toxo tgmic1-3 KO rop16 KO GRA15II KI 2G.

    [0554] FIG. 9-C: This figure represents the results of the sequencing obtained on the Toxo tgmic1-3 KO rop16 KO rop16 KO GRA15II KI 2G strain and confirms that the rop16 and cat-gfp genes have been deleted and replaced by the Lox2272 scar and the gra15HAII gene.

    [0555] FIG. 10: This figure illustrates the immunofluorescence analysis of the detection of the GRA15 protein (via the HA tag) obtained respectively with the strains Toxo tgmic1-3 KO rop16 KO GRA15II KI and Toxo tgmic1-3 KO rop16 KO GRA15II KI-2G using an antibody specifically directed against the HA tag. This figure also illustrates the removal of the CATGFP cassette with the disappearance of GFP fluorescence for the Toxo tgmic1-3 KO rop16 KO GRA15II KI-2G strain.

    [0556] FIG. 11-A: This figure illustrates the position of the nucleic primers used in this invention to detect the presence of the three genes ncmic3, ncmic1, cat-gfp in wild strains and/or mutant strains of Neo ncmic3 KO and/or Neo ncmic3 KO 2G and/or Neo ncmic1-3 KO and/or Neo ncmic1-3 KO 2G from Neospora caninum. The digits represent the numbering of the primer sequences (SEQ ID NO: x) defined in this application.

    [0557] FIG. 11-B: This figure illustrates the position of the nucleic primers used in this invention to detect the presence of the three genes tgmic3, tgmic1, cat-gfp in wild strains and/or mutant strains of Toxo tgmic3 KO and/or Toxo tgmic3 KO 2G and/or Toxo tgmic1-3 KO and/or Toxo tgmic1-3 KO 2G from Toxoplasma gondii. The digits represent the numbering of the primer sequences (SEQ ID NO: x) defined in this application.

    [0558] FIG. 11-C: This figure illustrates the position of the nucleic primers used in this invention to detect the presence of the three genes tgrop16, gra15II, cat-gfp in wild strains and/or mutant strains of Toxo tgmic1-3 KO rop16 KO Gra15II KI from Toxoplasma gondii. The digits represent the numbering of the primer sequences (SEQ ID NO: x) defined in this application.

    [0559] FIG. 12: This figure illustrates the specific antibody titration against Neospora caninum in the serum of mice vaccinated 30 days previously with the NeoKO 2G strain. The vehicle having been used in control. n=2 per group. ANOVA two-way . . . .

    [0560] FIG. 13-A: This figure illustrates the follow-up of clinical scores observed for mice.

    [0561] FIG. 13-B: This figure illustrates the specific antibody titration against T. gondii in mouse serum at D-2, J28 and J129. ANOVA one way (****: p<0.0001, *: p<0.05).

    [0562] FIG. 13-C: This figure illustrates the dosage of IFNγ following a restimulation of splenocytes with the total extract of T. gondii 72 hours after restimulation. ANOVA one way (****: p<0.0001, *: p<0.05). Batch 1 corresponds to the control group, batch 2 corresponds to the challenge group 76K, batch 3 corresponds to the Toxo tgmic group 1-3 KO 2G and batch 4 corresponds to the Toxo tgmic group 1-3 KO 2G+challenge 76K.

    [0563] FIG. 13-D: This figure illustrates the number of brain cysts detected in mothers. ANOVA one way (*: p<0.05). Batch 1 corresponds to the control group, batch 2 corresponds to the challenge group 76K, batch 3 corresponds to the Toxo tgmic group 1-3 KO 2G and batch 4 corresponds to the Toxo tgmic group 1-3 KO 2G+challenge 76K.

    [0564] FIG. 13-E: This figure illustrates the prolificity obtained for each batch.

    [0565] FIG. 13-F: This figure illustrates the sex ratio obtained for each batch. Two-way ANOVA (**: p<0.01), *: p<0.05).

    [0566] FIG. 13-G: This figure illustrates the results obtained for mortality.

    [0567] FIG. 13-H: This figure illustrates the results obtained for observed mortality by litter for each batch. ANOVA one way (****: p<0.0001, ***: p<0.001). Batch 1 corresponds to the control group, batch 2 corresponds to the challenge group 76K, batch 3 corresponds to the Toxo tgmic group 1-3KO 2G and batch 4 corresponds to the Toxo tgmic group 1-3 KO 2G+challenge 76K.

    [0568] FIG. 13-I: This figure illustrates the percentage of survival obtained for mice over 32 days. Log-rank (Mantel-Cox) test (****: p<0.0001). Batch 1 corresponds to the control group, batch 2 corresponds to the challenge group 76K, batch 3 corresponds to the Toxo tgmic group 1-3 KO 2G and batch 4 corresponds to the Toxo tgmic group 1-3 KO 2G+challenge 76K.

    [0569] FIG. 13-J: This figure illustrates the follow-up of clinical scores observed for mice.

    [0570] FIG. 13-K: This figure illustrates the specific IgM titration directed against T. gondii in the mouse serum of each batch. ANOVA one way (****: p<0.0001, **: p<0.01).

    EXAMPLE 1: CONSTRUCTION OF THE NEO NCMIC1-3 KO-2G STRAIN

    [0571] Haploidy of the Neospora caninum genome during the proliferative phase allows the invalidation of a gene into a single homologous recombination.

    [0572] Cultivation of Parasites

    [0573] All tachyzoites of the Neospora caninum strain used were produced as human fibroblasts (HFF Hs27 ATCC CRL-1634) grown in a minimal Dulbecco medium (DMEM) supplemented with 10% fetal calf serum (SVF), 2 mM glutamine, 100 U/mL penicillin and 100 U/mL streptomycin. They were collected after mechanical lysis of the host cells by 3 passages in 25G syringes.

    [0574] Plasmid Construction

    [0575] Plasmid pNcMIC3-KO-CAT-GFP LoxN

    [0576] The plasmid pNcMic3KO-CAT-GFP LoxN of SEQ ID NO: 1 contains a CAT-GFP selection cassette SEQ ID NO: 6 comprising the cat-gfp selection gene SEQ ID NO: 2 encoding the fusion protein CAT-GFP allowing both chloramphenicol resistance (CAT) and green fluorescence (GFP: Green Fluorescent Protein), under the control of the promoter of α-tubulin of Toxoplasma gondii SEQ ID NO: 3 to allow the expression of the gene in the parasite. Downstream of the cat-gfp gene SEQ ID: 2, the sequence 3′ UTR of the sag1 gene of Toxoplasma gondii SEQ ID NO: 4 is inserted. The objective of this sequence is to stabilize the mRNA encoding the CAT/GFP fusion protein. This SEQ ID NO: 6 selection cassette is framed by two identical SEQ ID NO: 5 LoxN sites of the same orientation.

    [0577] To obtain this plasmid, the CAT-GFP selection cassette SEQ ID NO: 6 was amplified by PCR on the plasmid pT230 CAT-GFP SEQ ID NO: 9 with the cat-gfp LoxN For SEQ ID NO: 7 and catgfp LoxN rev SEQ ID NO: 8 (2380pb), digested by the restriction enzymes ClaI and XbaI (2348 bp) and cloned in the plasmid pNcMic3KO-DHFR SEQ ID NO: 10 digested by ClaI and XbaI (7715 bp).

    [0578] The plasmid then obtained is the plasmid pNcMic3KO-CAT-GFP LoxN of SEQ ID NO: 1.

    [0579] The sequences of the primers are shown in Table 1 below. The plasmid pNcMic3KO-CAT-GFP-GFP LoxN therefore contains a CAT-GFP cassette SEQ ID NO: 6 framed by a 5′ HR sequence of the ncmic3 gene SEQ ID NO: 98 and a 3′ HR sequence of the ncmic3 gene SEQ ID NO: 97.

    TABLE-US-00001 TABLE 1 List of primers used for the construction of the plasmid pNcMIC3-KO-CAT-GFP LoxN  catgfp loxN For SEQ ID NO: 7 ClaI TCCGCTCTCAGAGAATCGAT LoxN GAAGCTTATAACTTCGTATA GTATACCTTATACGAAGTTA TGATATGCATGTCCGCGTTC GTGAAATCTC catgfp loxN rev SEQ ID NO: 8 XbaI ATACGTAAACTTCTAGATCC loxN ATAACTTCGTATAAGGTATA CTATACGAAGTTATCCCTCG GGGGGGCAAGAATTGTGTTA ACCGGTTCGA

    [0580] Plasmid pNcMIC1-KO-CAT-GFP Lox

    [0581] The plasmid pNcMic1KO-CAT-GFP LoxP of SEQ ID NO: 11 contains a CAT-GFP selection cassette SEQ ID NO: 6 comprising the cat-gfp selection gene SEQ ID NO: 2 encoding a CAT-GFP fusion protein allowing both chloramphenicol resistance (CAT) and green fluorescence (GFP: Green Fluorescent Protein), under the control of the promoter of α-tubulin of Toxoplasma gondii SEQ ID NO: 3 to allow the expression of the gene in the parasite. Downstream of the CAT-GFP coding sequence, the 3′ UTR sequence of the sag1 gene of Toxoplasma gondii SEQ ID NO: 4 is inserted. The objective of this sequence is to stabilize the mRNA encoding the CAT/GFP fusion protein. This SEQ ID NO: 6 selection cassette is framed by two identical LoxP sites SEQ ID NO: 12 of the same orientation.

    [0582] To obtain this plasmid, the CAT-GFP selection cassette SEQ ID NO: 6 was amplified by PCR on the plasmid pT230 CAT-GFP SEQ ID NO: 9 with CN10 primers SEQ ID NO: 13 and CN11 SEQ ID NO: 14 allowing the addition of the LoxP sites SEQ ID NO: 12 (2394 bp), digested by the restriction enzymes HindIII and BamHI (2339 bp) and cloned in the plasmid pT230-ble SEQ ID NO: 37 digested by HindIII and BamHI (2931 bp). The plasmid then obtained is the plasmid pT230 CAT-GFP LoxP of SEQ ID NO: 113.

    [0583] The 3 HR region of the ncmic1 gene was amplified by PCR from the genomic DNA of Neospora caninum strain NC-1. For amplification, the 3 HR NCmic1 F KpnI and 3 HR NCmic1 R HindIII primers (SEQ ID NO: 114 and SEQ ID NO: 115) allow the amplification of the 3 HR region of the ncmic1 gene and the creation of two restriction sites that were used to clone the 3HR fragment upstream of the CAT-GFP selection cassette in pT230 CAT-GFP LoxP of SEQ ID NO: 113. The plasmid obtained is called pNcmic1-3HR CATGFP LoxP SEQ ID NO: 118.

    [0584] The 5 HR region of the ncmic1 gene was amplified by PCR from the genomic DNA of Neospora caninum strain NC-1. For amplification, the 5 HR NCmic1 F BamHI and 5 HR NCmic1 R NotI primers (SEQ ID NO: 116 and SEQ ID NO: 117) allow the amplification of the 5′ UTR region of the ncmic1 gene and the creation of two restriction sites that were used to clone the 5HR fragment downstream of the CAT-GFP selection cassette in the plasmid pNcmic1-3HR CATGFP LoxP of SEQ ID NO: 118 (BamHI-NotI).

    [0585] The plasmid then obtained is the plasmid pNcMic1KO-CAT-GFP LoxP of SEQ ID NO: 11. pNcMic1KO-CAT-GFP LoxP therefore contains a CAT-GFP cassette SEQ ID NO: 6 framed by a 5′ HR sequence of the ncmic1 gene SEQ ID NO: 96 and a 3′ HR sequence of the ncmic1 gene SEQ ID NO: 95.

    [0586] The sequences of the primers are shown in Table 2 below.

    TABLE-US-00002 TABLE 2 list of primers used for the construction of the plasmid pNcmic1 KO CATGFP LoxP Construction of the plasmid pNcmic1 KO CATGFP LoxP CN10 SEQ ID NO: 13 HindIII, GCGGCCAAGCTTATAACTT loxP CGTATAATGTATGCTATAC GAAGTTATGATATGCATGT CCGCgttcgtgaaatctct gatcaagcgg CN11 SEQ ID NO: 14 SpeI, cgacgcacgctgtcactca BamHI, acttgctGCTAGAACTAGT loxP GGATCCATAACTTCGTATA GCATACATTATACGAAGTT ATCCCTCGGGGGGGCAAGA ATT 3 HR SEQ ID NO: 114 KpnI NCmic1 F CGCGGTACCAGGCAGAAGT KpnI AAAGAAGGTTCCTC 3 HR SEQ ID NO: 115 HindIII NCmic1 R CGCAAGCTTTGATCACGCA HindIII AGAAAAGAAGC 5 HR SEQ ID NO: 116 BamHI NCmic1 F CGCGGATCCCATTTGTAGA BamHI TACGGTTGCACAC 5 HR SEQ ID NO: 117 NotI NCmicl R CGCGCGGCCGCACATTCAG Notl ACGGCAGAACTCTG

    [0587] Plasmid pTSAG1-Cre Recombinase

    [0588] The plasmid pT-SAG1-Cre-Recombinase SEQ ID NO: 15 was constructed to transiently express in the parasite Toxoplasma gondii and its genetically modified derivatives the gene encoding the Cre Recombinase protein derived from bacteriophage P1 (Brecht et al., 1999, same reference as above).

    [0589] The plasmid pT-SAG1-Cre-Recombinase SEQ ID NO: 15 is derived from the plasmid pUC18 (commercial plasmid), which contains a cassette for the expression of Cre Recombinase from bacteriophage P1.

    [0590] In the plasmid pT-SAG1-Cre-Recombinase SEQ ID NO: 15, the gene encoding the Cre Recombinase SEQ ID NO: 16 is placed under the dependence of the promoter of the sag1 gene of Toxoplasma gondii SEQ ID NO: 17, which allows the expression of the Cre Recombinase protein in transfected Toxoplasma gondii parasites. Downstream of the gene encoding Cre Recombinase, the 3′ UTR sequence of the sag1 gene of Toxoplasma gondii SEQ ID NO: 4 is inserted. The objective of this sequence is to stabilize the mRNA encoding the Cre Recombinase protein.

    [0591] The absence of a specific selection cassette does not allow a stable integration of the transfected genetic material but only a transient expression of Cre Recombinase.

    [0592] Construction of the Neomic1-3 KO-2G Strain

    [0593] The construction of the second generation attenuated live strain, called Neo ncmic1-3 KO-2G, is done in 4 distinct steps: [0594] 1. Deletion by homologous recombination of the ncmic3 gene and its replacement by the CAT-GFP selection cassette SEQ ID NO: 6 framed by LoxN sequences SEQ ID NO: 5. [0595] To obtain this strain, the wild strain NC-1 of Neospora caninum is electroporated with the plasmid pNcMIC3-KO-CAT-GFP LoxN of SEQ ID NO: 1. 20 μg of plasmid purified and linearized by KpnI are added to 10.sup.7 parasites suspended in the CYTOMIX electroporation medium containing ATP (3 mM) and Glutathione (3 mM) (Van den Hoff et al, Nucleic Acid Research, June 11; 20(11):2902), and electroporation was performed in a 4 mm gap cell, in a volume of 800 μL on a BioRad device (Parameters: 2000V, 50 ohms, 25 μF, with two electric shocks). After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. For mutant selection, the culture medium is replaced and supplemented by the selection agent (chloramphenicol 20 μM) 24 hours after electroporation. 10 to 15 days after selection, the parasites are subcloned in 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after performing DNA genomic DNA extraction from the clones of interest. The strain obtained is called Neo ncmic3 KO. In this strain, the mic3 gene has been deleted and replaced by the CATGFP selection cassette SEQ ID NO: 6. Thus, the theoretical sequence at the locus of the deleted mic3 gene containing the CATGFP selection cassette is SEQ ID NO: 101. Since the mic1 gene is not deleted, the sequence of the mic1 gene SEQ ID NO: 106 is present in the genome of the strain. [0596] 2. Deletion of the selection cassette SEQ ID NO: 6: the obtained Neo ncmic3 KO strain is electroporated with the plasmid pT-SAG1-CRE-Recombinase SEQ ID NO: 15. [0597] The transiently expressed enzyme will allow the excision of the CAT-GFP selection cassette SEQ ID NO: 6. The electroporation protocol is similar to the previous one. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. After 2 to 7 days of culture, the parasites are subcloned in 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after performing DNA genomic DNA extraction from the clones of interest. The strain obtained is called Neo ncmic3 KO-2G. [0598] In this strain, the mic3 gene was deleted and the CATGFP selection cassette SEQ ID NO: 6 was excised. Thus, the theoretical sequence at the locus of the deleted mic3 gene containing a single LoxP site SEQ ID NO: 12, is SEQ ID NO: 18. Since the mic1 gene is not deleted, the sequence of the mic1 gene SEQ ID NO: 106 is present in the genome of the strain. [0599] 3. Deletion by homologous recombination of the ncmic1 gene and its replacement by the CAT-GFP selection cassette SEQ ID NO: 6 framed by LoxP sequences SEQ ID NO: 12. [0600] To obtain this strain, the Neo ncmic3 KO-2G strain is electroporated with the plasmid pNcMIC1-KO-CAT-GFP LoxP of SEQ ID NO: 11 linearized by KpnI, according to the protocol previously described. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. For mutant selection, the culture medium is replaced and supplemented by the selection agent (chloramphenicol 20 μM) 24 hours after electroporation. 10 to 15 days after selection, the parasites are subcloned in 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after performing genomic DNA extraction from the clones of interest. The strain obtained is called Neo ncmic1-3 KO. [0601] In this strain, the mic3 gene was deleted and the CATGFP selection cassette SEQ ID NO: 6 was excised. Thus, the theoretical sequence at the locus of the deleted mic3 gene containing a single LoxP site SEQ ID NO: 12, is SEQ ID NO: 18. In this strain, the mic1 gene has been deleted and replaced by the CATGFP selection cassette SEQ ID NO: 6, so the theoretical sequence at the locus of the deleted mic1 gene containing the CATGFP selection cassette is SEQ ID NO: 102. [0602] 4. Deletion of the selection cassette SEQ ID NO: 6: the obtained Neo ncmic1-3 KO strain is electroporated with the plasmid pT-SAG1-CRE-Recombinase SEQ ID NO: 15. [0603] The transiently expressed enzyme will allow the excision of the CAT-GFP selection cassette SEQ ID NO: 6. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. After 2 to 7 days of culture, the parasites are subcloned in 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after performing DNA genomic DNA extraction from the clones of interest. The strain obtained is called Neo ncmic1-3 KO-2G. [0604] In this strain, the mic3 gene was deleted and the CATGFP selection cassette SEQ ID NO: 6 was excised. Thus, the theoretical sequence at the locus of the deleted mic3 gene containing a single LoxP site SEQ ID NO: 12, is SEQ ID NO: 18. [0605] In this strain, the mic1 gene was deleted and the CATGFP selection cassette SEQ ID NO: 6 was excised. Thus, the theoretical sequence at the locus of the deleted mic1 gene containing a single LoxP site SEQ ID NO: 12, is SEQ ID NO: 91.

    [0606] Validation of the Neo Ncmic1-3 KO-2G Strain by PCR

    [0607] To validate the Neo ncmic1-3 KO-2G strain, PCR analyses are carried out using genomic DNA extracted with DNAzol from a parasitic pellet composed of 10.sup.7 parasites. The primers used for PCR are described in FIG. 11-A and are detailed in Table 3 below. PCR products are analyzed by agarose gel electrophoresis (FIG. 3-B). Their expected and observed sizes are also described in Table 4 below. For more clarity on FIG. 3-B, only the 3 steps of the realization are represented (ncmic3, ncmic3KO CATGFP and ncmic3KO LoxN (2G) or ncmic1, ncmic1KO CATGFP and ncmic1KO LoxP(2G)), the results obtained are in accordance with the expected sizes

    TABLE-US-00003 TABLE 3 List of primers used for strain validation. Primer F Sequence Primer R Sequence Ncmic3 c Nc mic3 F SEQ ID NO: 22 d Nc mic3 R SEQ ID NO: 23 (mix1) TTTCCCTTCTAAA CCTTCAGTGGTTT CACAGTCG TCTCCATGAGT Validation i Integ SEQ ID NO: 24 j ORF SEQ ID NO: 25 KO NCmic3 F GAAAGTGTCAGTG CATGFP R CCGTTTGGTGTGG 5′Ncmic3 GTAGAGACTGC ATGTCTCTCTCT (mix2) Validation k ORF SEQ ID NO: 26 l Integ SEQ ID NO: 27 KO CATGFP F GCATCGACTTCAA NCmic3 R TGTTTACAGGTCA 3′Ncmic3 GGAGGAGGAC TCCAGAAAAGG (mix3) Scar g AF3 SEQ ID NO: 32 h AF4 SEQ ID NO: 33 Ncmic3 GTCATCGACCGCC GCAGAGAGGTTCT (mix4) GCCGGAACTAGTA GCGTATCTAACAC GT ACGG Ncmic1 a Nc mic1 F SEQ ID NO: 20 b Nc mic1 R SEQ ID NO: 21 (mix5) ACCCGGAGAATTA TTCTCCAGGCACT TCGCCTA CACCTCACCT Validation m Integ SEQ ID NO: 28 j ORF SEQ ID NO: 25 KO NCmic1 F CCGAGCAAGTTAG CATGFP R CCGTTTGGTGTGG 5′Ncmic1 CAAGTTAGCAAGT ATGTCTCTCTC (mix6) CC Validation k ORF SEQ ID NO: 26 n Integ SEQ ID NO: 29 KO CATGFP F GCATCGACTTCAA NCmic1 R CTTGTGTCCGTCA 3′Ncmic1 GGAGGAGGAC CATCGTTTG (mix7) Scar e ncmic1creLox SEQ ID NO: 30 f ncmic1creLox SEQ ID NO: 31 Ncmic1 F B B GGCGACATACTGC R B B GATCGGAGTCTCT (mix8) ATTGGAT GTCCCTCAA

    TABLE-US-00004 TABLE 4 Expected amplicon size (in base pairs) of the different PCRs for validation of the construction of KO strains of Neospora caninum Neo Neo Neo Neo ncmic3 ncmic3 ncmic1-3 ncmic1-3 NC-1 KO KO LoxN KO LoxP KO 2G Ncmic3 (mix1)  850 — — — — Validation KO — 2960 — — — 5′Ncmic3 (mix2) Validation KO — 3668 — — — 3′Ncmic3 (mix3) Scar Ncmic3 (mix4) 2163 2575 276  276 276 Ncmic1 (mix5)  701  701 701 — — Validation KO — — — 3359 — 5′Ncmic1 (mix6) Validation KO — — — 3421 — 3′Ncmic1 (mix7) Scar Ncmic1 (mix8) 3161 3161 3161  2560 261

    [0608] The electrophoresis of the PCR products performed with the primers c SEQ ID NO: 22 and d SEQ ID NO: 23 (mix 1) allow to highlight a band with 850 base pairs for the NC-1 strain, in accordance with the expected band size and confirming the presence of the ncmic3 gene SEQ ID NO: 105 in this strain. This band is not detected in the strains Neo ncmic3 KO, Neo ncmic3 KO-2G, Neo ncmic1-3 KO and Neo ncmic1-3 KO-2G confirming the suppression of the gene in these strains.

    [0609] The electrophoresis of the PCR products carried out with the primers i SEQ ID NO: 24 and j SEQ ID NO: 25 and the primers k SEQ ID NO: 26 and SEQ ID NO: 27 (mix Ncmic3) allow to highlight respectively a band at 2960 and 3668 base pairs for the Neo ncmic3 KO strain, according to the expected band size and confirming the presence of the cat-gfp selection gene in this strain instead of the ncmic3 gene. This band is not detected in NC-1, Neo ncmic3 KO-2G, Neo ncmic1-3 KO and Neo ncmic1-3 KO-2G strains confirming the absence of the cat-gfp selection gene SEQ ID NO: 2 at the ncmic 3 locus in these strains.

    [0610] The electrophoresis of the PCR products made with the primers g SEQ ID NO: 32 and h SEQ ID NO: 33 (Ncmic3 scar) allow to highlight different bands according to the expected band size. A band with 2163 base pairs for the NC-1 strain confirms the presence of the ncmic3 gene SEQ ID NO: 105 in this strain. A tape of 2575 base pairs is highlighted for the Neo ncmic3 KO strain confirming the presence of the CATGFP selection cassette SEQ ID NO: 6 in place of the ncmic3 gene. Finally, a band of 276 base pairs is highlighted for the strains Neo ncmic3 KO-2G Neo ncmic1-3 KO and Neo ncmic1-3 KO-2G confirming the deletion of the cat-gfp selection gene SEQ ID NO: 2 in these strains, leaving a LoxN scar SEQ ID NO: 5 in the genome.

    [0611] The electrophoresis of the PCR products carried out with the primers a SEQ ID NO: 20 and b SEQ ID NO: 21 (mix Ncmic1) allow to highlight a band with 644 base pairs for the strains NC-1, Neo ncmic3 KO, Neo ncmic3 KO-2G, according to the expected band sizes and confirming the presence of the gene ncmic1 SEQ ID NO: 106 in these strains. These bands are not detected in the strains Neo ncmic1-3 KO and Neo ncmic1-3 KO-2G confirming the suppression of the gene in these strains.

    [0612] The electrophoresis of the PCR products carried out with the primers m SEQ ID NO: 28 and j SEQ ID NO: 25 and the primers k SEQ ID NO: 26 and n SEQ ID NO: 29 (mix Ncmic1) allow to highlight respectively a band at 3359 and 3421 base pairs for the Neo ncmic1-3 KO strain, according to the expected band size and confirming the presence of the cat-gfp selection gene SEQ ID NO: 2 in this strain instead of the ncmic1 gene. This band is not detected in the wild NC-1 strains of N. caninum, Neo ncmic3 KO, Neo ncmic3 KO-2G, and Neo ncmic1-3 KO-2G confirming the absence of the at-gfp selection gene SEQ ID NO: 2 at locus ncmic 1 in these strains.

    [0613] The electrophoresis of the PCR products made with the primers SEQ ID NO: 30 and f SEQ ID NO: 31 (scar Ncmic1) allow to highlight different bands according to the expected band size. A band of 2182 base pairs for the strains NC-1, Neo ncmic3 KO, Neo ncmic3 KO-2G confirms the presence of the ncmic1 gene in these strains. A tape of 2560 base pairs is highlighted for the Neo ncmic1-3 KO strain confirming the presence of the CATGFP selection cassette SEQ ID NO: 6 in place of the ncmic1 gene. Finally, a band of 261 base pairs is highlighted for the Neo ncmic1-3 KO-2G strain confirming the deletion of the cat-gfp selection gene SEQ ID NO: 2 in this strain, leaving a LoxP scar SEQ ID NO: 12 in the genome.

    [0614] The “scar” PCR products (mix 4 and 8) were sequenced and the sequencing confirmed that: [0615] the ncmic3 gene SEQ ID NO: 105 has been deleted and that the CAT-GFP selection cassette SEQ ID NO: 6 has been deleted by the action of the Cre-Recombinase leaving a LoxN scar SEQ ID NO: 5 in accordance with the expected sequence (FIG. 3C). [0616] the ncmic1 gene SEQ ID NO: 106 has been deleted and that the CAT-GFP selection cassette SEQ ID NO: 6 has been deleted by the action of the Cre-Recombinase leaving a LoxP scar SEQ ID NO: 12 in accordance with the expected sequence (FIG. 3C).

    [0617] Validation of the Neo Ncmic1-3 KO-2G Strain by Immunofluorescence

    [0618] Tachyzoites grown 24 hours on glass lamellae covered with a monolayer of HFF cells. The infected cells were washed twice with PBS1×, and fixed with 4% formaldehyde for 30 minutes. After 3 washes in PBS1×, the infected HFF cells were permeabilized with 0.1% Triton X-100 in PBS1× for 5 min. After 3 washes with PBS 1×, a saturation step is performed with a solution of PBS 1×/SVF 10% for 30 min. The cells were then incubated with the primary antibody diluted in 2% SVF for 1 hour, washed 3 times with PBS1× and incubated with a secondary antibody diluted in 2% PBS/SVF solution for 1 hour. After 2 washes with PBS1×, the glass slides are mounted on a slide with Immu-Mount™ and observed under a fluorescence microscope.

    [0619] The primary antibody Tgmic3 allows a recognition of the protein Ncmic3, it allows to detect the expression of the protein NcMIC3 SEQ ID NO: 118 in the parasite (rabbit antibody anti-mic3: rnAb anti-MIC3 s3) and the commercial secondary antibody used is Alexa Fluor® 594 goat anti rabbit (Life technologies ref. A-11012).

    [0620] The results show that no fluorescence is detectable at the apical pole of the parasite, indicating the absence of MIC3 proteins (FIG. 4-A).

    [0621] The primary antibody Tgmic 1 does not allow recognition of the NcMIC1 protein SEQ ID NO: 119.

    [0622] The results show that the parasites express a green fluorescent reflecting the expression of the CATGFP protein SEQ ID NO: 120 following the realization of gene deletions (Neo ncmic3 KO and Neo ncmic1-3 KO) while after the action of recombinase Cre, the Neo ncmic3 KO-2G and Neo ncmic1-3 KO-2G strains are no longer fluorescent (removal of the CATGFP cassette SEQ ID NO: 6) (FIG. 4-B).

    EXAMPLE 2: CONSTRUCTION OF THE TOXO TGMIC1-3 KO-2G STRAIN

    [0623] Haploidy of the Toxoplasma gondii genome during the proliferative phase allows the invalidation of a gene into a single homologous recombination.

    [0624] Cultivation of Parasites

    [0625] All tachyzoites of the Toxoplasma gondii strain used were produced in human fibroblasts (HFF Hs27 ATCC CRL-1634) grown in a minimal Dulbecco medium (DMEM) supplemented with 10% fetal calf serum (SVF), 2 mM glutamine, 100 U/mL penicillin and 100 U/mL streptomycin. They were collected after mechanical lysis of the host cells by 3 passages in 25G syringes.

    [0626] Plasmid Construction

    [0627] Plasmid pTgMIC3-KO-CAT-GFP LoxP

    [0628] The plasmid pTgMIC3-KO-CAT-GFP LoxP of SEQ ID NO: 34 (FIG. 5A) was constructed to remove the gene encoding the TgMIC3 protein from Toxoplasma gondii (ATCC reference: RH Pra310 strain) by homologous recombination.

    [0629] The plasmid pTgMic3KO-CAT-GFP LoxP of SEQ ID NO: 34 contains a CAT-GFP selection cassette SEQ ID NO: 6 comprising a cat-gfp selection gene SEQ ID NO: 2 encoding a CAT-GFP fusion protein allowing both chloramphenicol (CAT) resistance and green fluorescence (GFP: Green Fluorescent Protein), under the control of the promoter of α-tubulin of Toxoplasma gondii SEQ ID NO: 3. Downstream of the cat-gfp gene SEQ ID NO: 2, the sequence 3′ UTR of the sag1 gene of Toxoplasma gondii SEQ ID NO: 4 is inserted. SEQ ID NO: 6 was amplified from the plasmid pT230 CAT-GFP SEQ ID NO: 9 using the primers SEQ ID NO: 35 and SEQ ID NO: 36 which allow the addition of LoxP sites (SEQ ID NO: 12) and HindIII and SpeI restriction sites. The nucleotide sequence amplified by PCR (2389 bp) was then cloned in the plasmid pT230TUB Ble SEQ ID NO: 37 by enzymatic digestion with the restriction enzymes HindIII and SpeI. The plasmid obtained is called pCATGFP LoxP of SEQ ID NO: 38.

    [0630] The 3′ HR region of the tgmic3 gene SEQ ID NO: 39 was obtained by the double enzymatic digestion of the plasmid pmic3KO-2 SEQ ID NO: 40 with the restriction enzymes KpnI and HindIII (2145pb), then cloned in the plasmid pCATGFP LoxP of SEQ ID NO: 38 digested by KpnI and HindIII (5238pb). The plasmid obtained is called p3′ UTRmic3-CATGFP LoxP of SEQ ID NO: 41.

    [0631] The 5′HR region of the tgmic3 gene SEQ ID NO: 42 was amplified by PCR from the genomic DNA of the RH strain of T. gondii. For amplification, the primers SEQ ID NO: 43 and SEQ ID NO: 44 allow the amplification of the 5′ UTR region of the tgmic3 gene and the creation of two restriction sites (2568pb/SpeI and XbaI sites). These restriction sites were used to clone the 5HR fragment digested by SpeI and XbaI (2548pb) into the plasmid p3′ UTRmic3-CATGFP LoxP of SEQ ID NO: 38 downstream of the CAT-GFP selection cassette SEQ ID NO: 6 at the SpeI site of the plasmid previously described (7383pb) to obtain the plasmid pTgMic3KO-CAT-GFP LoxP of SEQ ID NO: 34.

    [0632] The sequences of the primers are shown in Table 5 below.

    TABLE-US-00005 TABLE 5 Sequences of primers used for the construction of the plasmid pTgMIC3-KO-CAT- GFP LoxP.  Construction of the plasmid pTgmic3KO CAT-GFP LoxP SEQ ID NO: 35 GCGGCCAAGCTTATAACTTCGTA HindIII, TAATGTATGCTATACGAAGTTAT loxP GATATGCATGTCCGCgttcgtga aatctctgatcaagcgg SEQ ID NO: 36 cgacgcacgctgtcactcaactt SpeI, BamHI, gctGCTAGAACTAGTGGATCCAT loxP AACTTCGTATAGCATACATTATA CGAAGTTATCCCTCGG SEQ ID NO: 43 GGGATCCACTAGTTTACGTATCG BamHI, SpeI, CGACTAGCAGCAAGTTGAGTGAC SnaBI, NruI AGCG SEQ ID NO: 44 GCTGCAGTCTAGAGATATCCACG PstI, XbaI, TGGAATTCCTCTTGGGAAGAACA EcoRV PmlI AT

    [0633] Plasmid pTgMIC1-KO-CAT-GFP LoxN

    [0634] The plasmid pTgMIC1-KO-CAT-GFP LoxN of SEQ ID NO: 45 (FIG. 5-B) was constructed to remove the gene encoding the TgMIC1 protein from Toxoplasma gondii by homologous recombination.

    [0635] The plasmid pTgMic1KO-CAT-GFP LoxN of SEQ ID NO: 45 contains a CAT-GFP selection cassette SEQ ID NO: 6 comprising the cat-gfp selection gene SEQ ID NO: 2 encoding the fusion protein CAT-GFP allowing both chloramphenicol (CAT) resistance and green fluorescence (GFP: Green Fluorescent Protein), under the control of the Toxoplasma gondii promoter α-tubulin SEQ ID NO: 3. Downstream of the cat-gfp gene SEQ ID NO: 2, the sequence 3′ UTR of the sag1 gene of Toxoplasma gondii SEQ ID NO: 4 was inserted. SEQ ID NO: 6 was amplified from the plasmid pT230 CAT-GFP SEQ ID NO: 9 using the primers SEQ ID NO: 46 and SEQ ID NO: 47 which allow the addition of LoxN sites (SEQ ID NO: 5) and ClaI and XbaI restriction sites. The nucleotide sequence amplified by PCR was then cloned in the plasmid pNcMic3KO-DHFR SEQ ID NO: 10 digested by ClaI and XbaI (7715 bp) by enzymatic digestion with the restriction enzymes ClaI and XbaI. The plasmid obtained is called pNCmic3KO CATGFP LoxN of SEQ ID NO: 48.

    [0636] The 5HR tgmic1 fragment SEQ ID NO: 49 was amplified by PCR with the primers SEQ ID NO: 50 and SEQ ID NO: 51 (2364pb), the restriction sites KpnI and ClaI were added by PCR. The amplified fragment is digested by the restriction enzymes KpnI and ClaI (2337pb) and cloned in the plasmid pNCmic3KO CATGFP LoxN of SEQ ID NO: 48 (see example 1 for obtaining the plasmid pNCmic3KO CATGFP LoxN) digested by KpnI and ClaI (7740pb) to replace the 5HR ncmic3 fragment (fragment digested by KpnI and ClaI). The plasmid obtained is called pTgmic1KO5HR-NCmic3KO3KO3HR CATGFP LoxN of SEQ ID NO: 111.

    [0637] Then the 3HR tgmic1 fragment SEQ ID NO: 52 was amplified by PCR with the primers SEQ ID NO: 53 and SEQ ID NO: 54 (2750pb), the restriction sites XbaI and NotI were added by PCR. The amplified fragment is digested by the restriction enzymes XbaI and NotI (2720 bp) and then cloned in the plasmid pTgmic1KO5HR-NCmic3KO3KO3HR CATGFP LoxN of SEQ ID NO: 111 digested by the restriction enzymes XbaI and NotI (7565 bp) to replace the 3HR ncmic3 fragment (fragment digested by XbaI and NotI). The plasmid obtained is called pTgmic1KO CAT-GFP LoxN of SEQ ID NO: 45.

    [0638] The primers used for PCRs are detailed in Table 6 below.

    TABLE-US-00006 TABLE 6 Primers for the construction of the plasmid pTgmic3KO CAT-GFP LoxP Construction of the plasmid pTgmic3KO CAT-GFP LoxP SEQ ID NO: 46 TCCGCTCTCAGAGAATCGAT ClaI GAAGCTTATAACTTCGTATA LoxN GTATACCTTATACGAAGTTA TGATATGCATGTCCGCGTTC GTGAAATCTC SEQ ID NO: 47 ATACGTAAACTTCTAGATCC XbaI ATAACTTCGTATAAGGTATA loxN CTATACGAAGTTATCCCTCG GGGGGGCAAGAATTGTGTTA ACCGGTTCGA SEQ ID NO: 50 GTAGCAAGGTACCACAAGCT 5HR AAAGAAAGTAGTGCCTCTTC tgmic1For TAAA KpnI SEQ ID NO: 51 TAAACGGGCTGATCGATGCA 5HR GGTAAATTCTATAGCCGGGT tgmic1 Rev ClaI SEQ ID NO: 53 TAAACGGGCTGATCGATGCA 3HR GGTAAATTCTATAGCCGGGT tgmic1For XbaI SEQ ID NO: 54 AAAAACTCGGTGGCGGCCGC 3HR ATAAAGAAGAGCAAGGAAAA tgmic1rev NotI

    [0639] Plasmid pTSAG1-Cre Recombinase

    [0640] The plasmid pT-SAG1-Cre-Recombinase SEQ ID NO: 15 was constructed to transiently express in the parasite Toxoplasma gondii and its genetically modified derivatives the gene encoding the Cre Recombinase protein derived from bacteriophage P1 (Brecht et al., 1999, same reference as above).

    [0641] The plasmid pT-SAG1-Cre-Recombinase SEQ ID NO: 15 is derived from the plasmid pUC18 (commercial plasmid) which contains an expression cassette of the Cre Recombinase of bacteriophage P1. In the plasmid pT-SAG1-Cre-Recombinase SEQ ID NO: 15, the gene encoding the Cre Recombinase SEQ ID NO: 16, is placed under the dependence of the promoter of the sag1 gene of Toxoplasma gondii SEQ ID NO: 17, which allows the expression of the Cre Recombinase protein in transfected Toxoplasma gondii parasites. Downstream of the gene encoding the Cre Recombinase SEQ ID NO: 16, the 3′ UTR sequence of the sag1 gene of Toxoplasma gondii SEQ ID NO: 4 is inserted. The objective of this sequence is to stabilize the mRNA encoding the Cre Recombinase protein. The absence of a specific selection cassette does not allow a stable integration of the transfected genetic material but only a transient expression of Cre Recombinase.

    [0642] Construction of the Toxo Tgmic1-3 KO-2G Strain

    [0643] The construction of the second generation attenuated live strain, called Toxo tgmic1-3 KO-2G, is done in 4 distinct steps (FIG. 6-A): [0644] 1. Deletion by homologous recombination of the tgmic3 gene and its replacement by the CAT-GFP selection cassette SEQ ID NO: 6 framed by LoxP sequences SEQ ID NO: 12. [0645] To obtain this strain, the wild strain of Toxoplasma gondii RH (reference ATCC: PRA-310) is electroporated with the plasmid pTgMIC3-KO-CAT-GFP LoxP SEQ ID NO: 34. 20 μg of plasmid purified and linearized by KpnI are added to 10.sup.7 parasites suspended in the CYTOMIX electroporation medium containing ATP (3 mM) and Glutathione (3 mM) (Van den Hoff et al, Nucleic Acid Research, June 11; 20(11):2902), and electroporation was performed in a 4 mm gap cell, in a volume of 800 μL on a BioRad device (Parameters: 2000V, 50 ohms, 25 μF, with two electric shocks). After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. For mutant selection, the culture medium is replaced and supplemented by the selection agent (chloramphenicol 20 μM) 24 hours after electroporation. 10 to 15 days after selection, the parasites are subcloned in 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after performing DNA genomic DNA extraction from the clones of interest. The strain obtained is called Toxo tgmic3 KO. [0646] In this strain, the mic3 gene has been deleted and replaced by the CATGFP selection cassette SEQ ID NO: 6. Thus, the theoretical sequence at the locus of the deleted mic3 gene containing the CATGFP selection cassette is SEQ ID NO: 103. Since the mic1 gene is not deleted, the sequence of the mic1 gene SEQ ID NO: 108 is present in the genome of the strain. [0647] 2. Deletion of the selection cassette SEQ ID NO: 6: the Toxo tgmic3 KO strain obtained is electroporated with the plasmid pT-SAG1-CRE-Recombinase SEQ ID NO: 15. [0648] The transiently expressed enzyme will allow the excision of the CAT-GFP selection cassette SEQ ID NO: 6. The electroporation protocol is similar to the previous one. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. After 2 to 7 days of culture, the parasites are subcloned in 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after performing DNA genomic DNA extraction from the clones of interest. The strain obtained is called Toxo tgmic3 KO-2G. [0649] 3. In this strain, the mic3 gene was deleted and the CATGFP selection cassette SEQ ID NO: 6 was excised. Thus, the theoretical sequence at the locus of the deleted mic3 gene containing a single LoxP site SEQ ID NO: 12, is SEQ ID NO: 19. since the mic1 gene is not deleted, the sequence of the mic1 gene SEQ ID NO: 108 is present in the genome of the strain. Deletion by homologous recombination of the tgmic1 gene and its replacement by the CAT-GFP selection cassette SEQ ID NO: 6 framed by LoxN sequences SEQ ID NO: 5. To obtain this strain, the Toxo tgmic3 KO-2G strain is electroporated with the plasmid pTgMIC1-KO-CAT-GFP LoxN of SEQ ID NO: 45 linearized by PciI, according to the protocol previously described. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. For mutant selection, the culture medium is replaced and supplemented by the selection agent (chloramphenicol 20 μM) 24 hours after electroporation. 10 to 15 days after selection, the parasites are subcloned in 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after performing genomic DNA extraction from the clones of interest. The strain obtained is called Toxo tgmic1-3 KO. [0650] 4. In this strain, the mic3 gene was deleted and the CATGFP selection cassette SEQ ID NO: 6 was excised. Thus, the theoretical sequence at the locus of the deleted mic3 gene containing a single LoxP site SEQ ID NO: 12, is SEQ ID NO: 19. [0651] In this strain, the mic1 gene has been deleted and replaced by the CATGFP selection cassette SEQ ID NO: 6. Thus, the theoretical sequence at the locus of the deleted mic1 gene containing the CATGFP selection cassette is SEQ ID NO: 104. [0652] 5. Deletion of the selection cassette SEQ ID NO: 6: the Toxo tgmic1-3 KO strain obtained is electroporated with the plasmid pT-SAG1-CRE-Recombinase SEQ ID NO: 15. The transiently expressed enzyme will allow the excision of the CAT-GFP selection cassette SEQ ID NO: 6. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. After 2 to 7 days of culture, the parasites are subcloned in 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after performing DNA genomic DNA extraction from the clones of interest. The strain obtained is called Toxo tgmic1-3 KO-2G. [0653] In this strain, the mic3 gene was deleted and the CATGFP selection cassette SEQ ID NO: 6 was excised. Thus, the theoretical sequence at the locus of the deleted mic3 gene containing a single LoxP site SEQ ID NO: 12, is SEQ ID NO: 19. [0654] In this strain, the mic1 gene was deleted and the CATGFP selection cassette SEQ ID NO: 6 was excised. Thus, the theoretical sequence at the locus of the deleted mic1 gene containing a single LoxN site SEQ ID NO: 5, is SEQ ID NO: 92.

    [0655] Validation of the Toxo Tgmic1-3 KO-2G Strain by PCR

    [0656] To validate the Toxo tgmic1-3 KO-2G strain, PCR analyses are carried out using genomic DNA extracted with DNAzol from a parasitic pellet composed of 10.sup.7 parasites. The primers used for PCR are described in FIG. 11-B and detailed in Table 7 below. PCR products are analyzed by agarose gel electrophoresis (FIG. 6-B). Their expected and observed sizes are also described in Table 8 below. For greater clarity in FIG. 6-B, only the 3 steps of the realization are represented (tgmic3, tgmic3KO CATGFP and tgmic3KO LoxP (2G) or tgmic1, tgmic1KO CATGFP and tgmic1KO LoxN (2G)), the results obtained are in accordance with the expected sizes.

    TABLE-US-00007 TABLE 7 List of primers used for strain validation. Tgmic3 5 TgMIC3 SEQ ID NO 61:  6 TgMIC3 SEQ ID NO 62: (mix1) For CCTCCGATGTGTGA Rev GATCCTCCGAGCA CTTTTGGT AGTCAAGTCAAC Validation 13   CN58 SEQ ID NO. 63: j ORF SEQ ID NO 25: KO ATACGAAGGGATTC CATGF CCGTTTGGTGGAT 5′Tgmic3 GACGTG PR GTGTCTCTCT (mix2) Validation k ORF SEQ ID NO. 26: 14  HR SEQ ID NO 64 KO CATGFP GCATCGACTTCAAG Mic3 ATATGCGGATGAG 3′Tgmic3 F GAGGAGGAC RL GAGTGAGTGCTCG (mix3) AATT Scar 9 Tgmic3 SEQ ID NO 65: 10  Tgmic3 SEQ ID NO. 66: Tgmic3 LoxN F GTGTGGAGACTACT LoxN R CCTCCGATGTGAC (mix4) TTTTTACTTCGTTA TTTTGGT C Tgmic1 3 TgMIC1 SEQ ID NO 55:  4 TgMIC1 SEQ ID NO 56: (mix5) For ATGCGCGCGCTATA Rev AGAAACAACGCCT AAAGAATCG GGCCCAT Validation 11  tgmic1K SEQ ID NO. 57: j ORF SEQ ID NO 25: KO O integ GTGCGATGACGTGA CATGF CCGTTTGGTGGAT 5′Tgmic1 F CGTGGGGCTTCTCT P R GTGTCTCTCT (mix6) ATCATCATGTGTGT Validation k ORF SEQ ID NO. 26: 12  tgmic1K SEQ ID NO. 58: KO CATGFP GCATCGACTTCAAG O integ GATTCGCTTCGTC 3′Tgmic1 F GAGGAGGAC R AGTCACTTCTGGG (mix7) GTACGGATGC Scar 7 Tgmic1 SEQ ID NO 59:  8 Tgmic1 SEQ ID NO 60: Tgmic1 LoxN F CCCGTCTAGCAAGA LoxN R TCGGTGCTGCTGC (mix8) CACCTCAAA TCAGTAATTG

    TABLE-US-00008 TABLE 8 Expected amplicon size (in base pairs) of the different PCRs for validation of the construction of KO strains of Toxoplasma gondii Toxo Toxo Toxo Toxo tgmic3 tgmic3 tgmic1-3 tgmic1-3 HR KO KO - 2G KO KO - 2G Tgmic3 (mix1)  808 — — — — Validation KO — 3253 — — — 5′Tgmic3 (mix2) Validation KO — 3309 — — — 3′Tgmic3 (mix3) Scar Tgmic3 (mix4) 1596 2525 226  226 226 Tgmic1 (mix5)  608  608 608 — — Validation KO — — — 3040 — 5′Tgmic1 (mix6) Validation KO — — — 3593 — 3′Tgmic1 (mix7) Scar Tgmic1 (mix8) 4198 4198 4198  3129 830

    [0657] The electrophoresis of the PCR products produced with primers 5 SEQ ID NO: 61 and 6 SEQ ID NO: 62 (mix 1) allow to highlight a band with 808 base pairs for the RH strain, in accordance with the expected band size and confirming the presence of the tgmic3 gene in this strain. This band is not detected in Toxo tgmic3 KO, Toxo tgmic3 KO-2G, Toxo tgmic1-3 KO and Toxo tgmic1-3 KO-2G strains confirming gene suppression in these strains.

    [0658] The electrophoresis of the PCR products made with the primers 13 SEQ ID NO: 63 and j SEQ ID NO: 25, and the primers k SEQ ID NO: 26 and 14 SEQ ID NO: 64 (mix 2 and 3) allow to highlight respectively a band at 3253 and 3537 base pairs for the Toxo tgmic3 KO strain, in accordance with the expected band size and confirming the presence of the cat-gfp selection gene SEQ ID NO: 2 in this strain instead of the tgmic3 gene SEQ ID NO: 107. This band is not detected in RH strains, Toxo tgmic3 KO-2G, Toxo tgmic1-3 KO and Toxo tgmic1-3 KO-2G confirming the absence of the cat-gfp selection gene SEQ ID NO: 2 at Tgmic 3 in these strains.

    [0659] The electrophoresis of the PCR products made with the primers 9 SEQ ID NO: 65 and 10 SEQ ID NO: 66 (mix 4) allow to highlight different bands according to the expected band size. A band with 1596 base pairs for the RH strain confirms the presence of the tgmic3 gene SEQ ID NO: 107 in this strain. A tape of 2525 base pairs is highlighted for the Toxo tgmic3 KO strain confirming the presence of the CATGFP selection cassette SEQ ID NO: 6 in place of the tgmic3 gene. Finally, a band of 226 base pairs is highlighted for the strains Toxo tgmic3 KO-2G, Toxo tgmic1-3 KO and Toxo tgmic1-3 KO-2G confirming the deletion of the cat-gfp selection gene SEQ ID NO: 2 in these strains, leaving a LoxP scar SEQ ID NO: 12 in the genome.

    [0660] The electrophoresis of the PCR products produced with primers 3 SEQ ID NO: 55 and 4 SEQ ID NO: 56 (mix 5) allow to highlight a band with 608 base pairs for the RH, Toxo tgmic3 KO and Toxo tgmic3 KO-2G strains, according to the expected band sizes and confirming the presence of the tgmic1 gene SEQ ID NO: 108 in these strains. These bands are not detected in Toxo tgmic1-3 KO and Toxo tgmic1-3 KO-2G strains confirming the suppression of the gene in these strains.

    [0661] The electrophoresis of the PCR products made with primers 11 SEQ ID NO: 57 and j SEQ ID NO: 25, and primers k SEQ ID NO: 26 and 12 SEQ ID NO: 58 (mix 6 and 7) allow to highlight respectively a 3040 and 3593 base pairs band for the Toxo tgmic1-3 KO strain, in accordance with the expected band size and confirming the presence of the cat-gfp selection gene SEQ ID NO: 2 in this strain instead of the tgmic3 gene SEQ ID NO: 107. This band is not detected in the wild RH strains of T. gondii (ATCC reference: PRA-310), Toxo tgmic3 KO, Toxo tgmic3 KO-2G, and Toxo tgmic1-3 KO-2G confirming the absence of the cat-gfp SEQ ID NO: 2 selection gene at the Tgmic1 locus in these strains.

    [0662] The electrophoresis of the PCR products made with primers 7 SEQ ID NO: 59 and 8 SEQ ID NO: 60 (mix 8) allow to highlight different bands according to the expected band size. A band of 4198 base pairs for the RH, Toxo tgmic3 KO and Toxo tgmic3 KO-2G strains confirms the presence of the tgmic1 gene SEQ ID NO: 108 in these strains. A tape of 3129 base pairs is highlighted for the Toxo tgmic1-3 KO strain confirming the presence of the CATGFP selection cassette SEQ ID NO: 6 in place of the tgmic1 gene. Finally, a band of 830 base pairs is highlighted for the Toxo tgmic1-3 KO-2G strain confirming the deletion of the cat-gfp selection gene SEQ ID NO: 2 in this strain, leaving a LoxN scar SEQ ID NO: 5 in the genome.

    [0663] The “scar” PCR products (mix 4 and 8) were sequenced and the sequencing confirmed that: [0664] the tgmic3 gene SEQ ID NO: 107 has been deleted and that the CAT-GFP selection cassette SEQ ID NO: 6 has been deleted by the action of Cre-Recombinase leaving a LoxP scar SEQ ID NO: 12 in accordance with the expected sequence (FIG. 6-C). [0665] the tgmic1 gene SEQ ID NO: 108 has been deleted and that the CAT-GFP selection cassette SEQ ID NO: 6 has been deleted by action of the CRE-Recombinase leaving a LoxN scar SEQ ID NO: 5 in accordance with the expected sequence (FIG. 6-C).

    [0666] Validation of the Toxo Tgmic1-3 KO-2G Strain by Immunofluorescence

    [0667] Tachyzoites are grown 24 hours on glass lamellae covered with a monolayer of HFF cells. The infected cells were washed twice with PBS1×, and fixed with 4% formaldehyde for 30 minutes. After 3 washes in PBS1×, the infected HFF cells were permeabilized with 0.1% Triton X-100 in PBS1× for 5 min. After 3 washes with PBS 1×, a saturation step is performed with a solution of PBS 1×/SVF 10% for 30 min. The cells were then incubated with the primary antibody diluted in 2% SVF for 1 hour, washed 3 times with PBS1× and incubated with a secondary antibody diluted in 2% PBS/SVF solution for 1 hour. After 2 washes with PBS1×, the glass slides are mounted on a slide with Immu-Mount™ and observed under a fluorescence microscope.

    [0668] The primary antibody Tgmic3 used is an antibody that detects the expression of the protein TgMIC3 SEQ ID NO: 121 in the parasite (rabbit anti-mic3 antibody: rnAb anti-MIC3 s3) and the secondary commercial antibody used is Alexa Fluor® 594 goat anti rabbit (Life technologies ref. A-11012).

    [0669] The primary antibody Tgmic1 used is an antibody that detects the expression of the protein TgMIC1 SEQ ID NO: 122 in the parasite (mouse anti-mic 1 antibody: mAb anti-MIC1 T104F8E12) and the secondary commercial antibody used is Alexa Fluor® 594 goat anti-mouse, Life technologies ref. A-11005).

    [0670] The results show that no fluorescence is detectable at the apical pole of the parasite revealing the absence of MIC1 and MIC3 proteins in tachyzoites Toxo tgmic1-3 KO-2G while fluorescence at the apical pole of the parasite of the wild strain demonstrates the expression of MIC1 and MIC3 proteins (FIG. 7).

    [0671] The results show that the parasites express a green fluorescent reflecting the expression of the CATGFP protein SEQ ID NO: 120 following the completion of gene deletions (Toxo tgmic3 KO and Toxo tgmic1-3 KO) while after the action of Cre recombinase, the Toxo tgmic3 KO-2G and Toxo tgmic1-3 KO-2G strains are no longer fluorescent (CATGFP cassette removal) (FIG. 7).

    EXAMPLE 3: CONSTRUCTION OF THE TOXO TGMIC1-3 KO ROP16 KO GRA15II KI STRAIN

    [0672] Material and Method

    [0673] Haploidy of the Toxoplasma gondii genome during the proliferative phase allows the invalidation of a gene into a single homologous recombination.

    [0674] Cultivation of Parasites

    [0675] All tachyzoites of the Toxoplasma gondii strain used were produced as human fibroblasts (HFF) grown in minimal Dulbecco medium (DMEM) supplemented with 10% fetal calf serum (SVF), 2 mM glutamine, 100 U/mL penicillin and 100 U/mL streptomycin. They were collected after mechanical lysis of the host cells by 3 passages in 25G syringes.

    [0676] Plasmid Construction

    [0677] The plasmid pTgRop16KO-Gra15IIKI-CAT-GFP Lox2272 of SEQ ID NO: 67 (FIG. 8) contains the CAT-GFP selection cassette SEQ ID NO: 6 comprising the cat-gfp selection gene SEQ ID NO: 2, encoding the fusion protein CAT-GFP conferring chloramphenicol resistance (CAT) and green fluorescence (GFP), under the control of the promoter of α-tubulin of Toxoplasma gondii SEQ ID NO: 3 to allow gene expression in the parasite. Downstream of the selection gene SEQ ID NO: 2, the sequence 3′ UTR of the sag1 gene of Toxoplasma gondii SEQ ID NO: 4 is inserted. The objective of this sequence is to stabilize the mRNA encoding the CAT-GFP fusion protein.

    [0678] The selection cassette SEQ ID NO: 6 is framed by two Lox2272 sites SEQ ID NO: 68, recognition sites specifically recognized by the Cre Recombinase and which will later be used to delete the CAT-GFP selection cassette.

    [0679] Downstream of the second Lox2272 site, an expression cassette of the gra15II gene SEQ ID NO: 69 was cloned. This expression cassette consists of the gra15II promoter amplified from the genomic DNA of the ME49 strain and the gra15II gene SEQ ID NO: 70 amplified from the genomic DNA of the ME49 strain, including an HA tag in 3′ SEQ ID NO: 72 to facilitate the location and the 3′ UTR sequence of the sag1 gene of T. gondii SEQ ID NO: 4 amplified from the genomic DNA of the RH strain. This plasmid therefore allows the simultaneous realization of a rop16KO Lox2272 CATGFP Lox2272 mutant and the insertion of gra15IIHA at the rop16 locus.

    [0680] The plasmid pTgROP16-KO-CAT-tdTomato SEQ ID NO: 73 contains a CAT-tdTomato cassette SEQ ID NO: 125—framed by a 5′ HR sequence of the tgrop16 gene SEQ ID NO: 99 and a 3′ HR sequence of the tgrop16 gene SEQ ID NO: 100.

    [0681] Cloning was done from the plasmid pTgROP16-KO-CAT-tdTomato SEQ ID NO: 73 digested by the enzymes SphI and AgeI (6073pb). This cloning required 4 independent PCRs.

    [0682] The first PCR allowed the amplification from the plasmid pCATGFP LoxP of SEQ ID NO: 38, of a CAT-GFP selection cassette SEQ ID NO: 6 comprising the promoter αTubuline, the cat-gfp selection gene and the 3′ UTR region of sag1 of T. gondii, with the addition of the Lox2272 site of SEQ ID NO: 68 with the F AgeI tub primers SEQ ID NO: 74 and 3 UTR Lox2272 R SEQ ID NO: 75 (2090pb).

    [0683] The second PCR allowed amplification from the plasmid pT230 2G gra15II SEQ ID NO: 76, of the promoter gra15II SEQ ID NO: 71 with addition of the site Lox2272 of SEQ ID NO: 68 in 5′ with the primers pGra15 F Lox2272 of SEQ ID NO: 77 and P Gra15 R SEQ ID NO: 78 (1975pb).

    [0684] The third PCR allowed the amplification from the plasmid pT230 2G gra15II SEQ ID NO: 76, of the gene gra15II HA with the 3′ UTR of sag1 SEQ ID NO: 79 (2092 bp) with the primers Gra15F SEQ ID NO 126 and UTR sag1 rop16 R SEQ ID NO 127.

    [0685] The primers used for the construction of this plasmid are listed in Table 9 below.

    TABLE-US-00009 TABLE 9 Primers used for the construction of the plasmid pT230 2G Gra15II tub F AgeI SEQ ID NO: 74: GTGATCCTGGTTGGACCGGT 3 UTR 1ox2272 R SEQ ID NO: 75: ATAACTTCGTATAAAGTATC CTATACGAAGTTATCGGTTC GACTAGAACAACTG pGra15 F 1ox2272 SEQ ID NO: 77: CTTTATACGAAGTTATGGAT CCACTAGTTGACTGCC P Gra15 R SEQ ID NO: 78: GTCACCATTGTTGAATGC Gra15F SEQ ID NO: 126: GCATTCAACAATGGTGAC UTR sagl rop16 R SEQ ID NO: 127: CGAATTTCGGGAGTTCTC GGGGGGGCAAGAATTGTG Ropl6F SEQ ID NO: 81: GAACTCCCGAAATTCGTCAA Rop16R SphI SEQ ID NO: 82: AATACACGCGACCGCATGC

    [0686] The last PCR allowed the amplification of a part of 3′Rop16 SEQ ID NO: 80 with the primers Rop16F SEQ ID NO: 81 and Rop16R SphI SEQ ID NO: 82 (570pb) on the plasmid pTgrop16 KO CAT-tdTomato SEQ ID NO: 73 as matrix.

    [0687] The 4 amplified PCR fragments were directly cloned in the vector pTgrop16 KO CAT-tdTomato SEQ ID NO: 73 digested by AgeI and SphI using the Ozyme In-Fusion® kit (In-Fusion® HD Cloning Kit—Clonetech). In-Fusion® cloning technology allows one-step cloning without purification or digestion of one or more PCR products in a linearized vector. Complementary ends at the ends of adjacent fragments are added by PCR. The reaction is done according to the manufacturer's recommendations. The plasmid obtained is called pTgRop16KO-Gra15IIKI-CAT-GFP Lox2272 of SEQ ID NO: 67. The plasmid named pTgRop16KO-Gra15IIKI-CAT-GFP Lox2272 of SEQ ID NO: 67 therefore contains a CAT-GFP cassette SEQ ID NO: 6 and a gra15HAII expression cassette SEQ ID NO: 69, framed by a 5′ HR sequence of the tgrop16 gene SEQ ID NO: 99 and a 3′ HR sequence of the tgrop16 gene SEQ ID NO: 100.

    [0688] Construction of the Toxo Tgmic1-3 KO Rop16 KO Gra15II KI-2G Strain

    [0689] The construction of the second generation attenuated live strain, called Toxo tgmic1-3 KO rop16 KO Gra15II KI-2G, is done in 2 distinct steps: [0690] 1. Deletion by homologous recombination of the rop16 gene and its replacement by the CAT-GFP selection cassette SEQ ID NO: 6 framed by sequences Lox2272 SEQ ID NO: 38 and the cassette gra15II SEQ ID NO: 69. [0691] To obtain this strain, the Toxo tgmic3 KO-2G strain is electroporated with the plasmid pTgRop16KO-Gra15IIKI-CAT-GFP Lox2272 of SEQ ID NO: 67 (20 μg) linearized by PciI, according to the protocol previously described. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. For mutant selection, the culture medium is replaced and supplemented by the selection agent (chloramphenicol 20 μM) 24 hours after electroporation. 10 to 15 days after selection, the parasites are subcloned in 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after performing genomic DNA extraction from the clones of interest. The strain obtained is called Toxo tgmic1-3 KO rop16 KO Gra15II KI. [0692] In this strain, the rop16 gene has been deleted and replaced by the CATGFP selection cassette SEQ ID NO: 6 and the expression cassette of gra15HAII SEQ ID NO: 69. Thus, the theoretical sequence at the locus of the deleted rop16 gene containing the CATGFP selection cassette and the gra15HAII expression cassette is SEQ ID NO: 112. [0693] In this strain, the mic3 gene was deleted and the CATGFP selection cassette SEQ ID NO: 6 was excised. Thus, the theoretical sequence at the locus of the deleted mic3 gene containing a single LoxP site SEQ ID NO: 12, is SEQ ID NO: 19. [0694] In this strain, the mic1 gene was deleted and the CATGFP selection cassette SEQ ID NO: 6 was excised. Thus, the theoretical sequence at the locus of the deleted mic1 gene containing a single LoxN site SEQ ID NO: 5, is SEQ ID NO: 92. [0695] 2. Deletion of the selection cassette: the obtained Toxo tgmic1-3 KO rop16 KO Gra15II KI strain is electroporated with the plasmid pT-SAG1-CRE-Recombinase SEQ ID NO: 15 (FIG. 2-C). The transiently expressed enzyme will allow the excision of the CAT-GFP selection cassette. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. After 2 to 7 days of culture, the parasites are subcloned in 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after performing DNA genomic DNA extraction from the clones of interest. The strain obtained is called Toxo tgmic1-3 KO rop16 KO Gra15II KI-2G. [0696] In this strain, the rop16 gene was deleted and replaced by the expression cassette of gra15HAII SEQ ID NO: 69 and the CATGFP selection cassette of SEQ ID NO: 6 was excised. Thus, the theoretical sequence at the locus of the deleted rop16 gene containing the single site Lox2272 cassette SEQ ID NO: 68 and the expression cassette of gra15HAII is SEQ ID NO: 93. [0697] In this strain, the mic3 gene was deleted and the CATGFP selection cassette SEQ ID NO: 6 was excised. Thus, the theoretical sequence at the locus of the deleted mic3 gene containing a single LoxP site SEQ ID NO: 12, is SEQ ID NO: 19. [0698] In this strain, the mic1 gene was deleted and the CATGFP selection cassette SEQ ID NO: 6 was excised. Thus, the theoretical sequence at the locus of the deleted mic1 gene containing a single LoxN site SEQ ID NO: 5, is SEQ ID NO: 92.

    [0699] Validation of the Toxo Tgmic1-3 KO Rop16 KO Gra15II KI-2G Strain by PCR

    [0700] To validate the Toxo tgmic1-3 KO rop16 KO Gra15II KI 2G strain, PCR analyses are performed using genomic DNA extracted with DNAzol from a parasitic pellet composed of 10.sup.7 parasites. The primers used for PCR are described in FIG. 11-C and are detailed in Table 10 below. PCR products are analyzed by agarose gel electrophoresis (FIG. 9-B). Their expected and observed sizes are also described in Table 11 below.

    TABLE-US-00010 TABLE 10 List of primers used for the validation of the Toxo tgmic1-3 KO rop16 KO Gra15II KI 2G strain.  Primer Primer F Sequence R Sequence Tgrop16 Rg 1 AGD rop SEQ ID NO: 83 Rg 2 AGD rop SEQ ID NO: 84 (mix1) 16CDS F GTTTGAGGAAGCGC 16CDS R TGCTGTGATTTCGC AAAAAG AAGTTC Upstream Rg 3 Rop 16KO SEQ ID NO: 85 Rg 4 Amont SEQ ID NO: 86 KO valid ACCCCCTGACCCCT ropl6R TCGTCGTGGTATTC validation 5F1 TGTCTG ACTCCA (mix2) Downstream Rg 5 Gra15 SEQ ID NO: 87 Rg 6 Aval SEQ ID NO: 88 KO qPCR 2F CACGTACACAACCC ropl6R AAAACGAATGCGAA validation ATCTCG GGAAGA (mix3) Scar Rg 7 cicropl6 SEQ ID NO: 89 Rg 8 cicrop16 SEQ ID NO: 90 rop16KO loxF CAGTACCAGCCACG loxGra R CAAGCAATCTGTGG gra15 TTAGCA CAAAAA LoxP gra15 (mix4) Gra15I/II Gra15I/ SEQ ID NO: 109 Gra15I/ SEQ ID NO: 110 (mix5) II F GTGCAAAGCCAACT II F GGACCTGGATCAGA TCCACT GATCGT

    TABLE-US-00011 TABLE 11 Expected amplicon size (in base pairs) of the different PCRs validating the construction of the Toxo tgmic1-3 KO rop16 KO Gra15II KI 2G strain Toxo Toxo tgmic1-3 Toxo tgmic1-3 tgmic1-3 KO rop16 KO KO rop16 KO KO - 2G Gra15II KI Gra15II KI -2G Tgrop16 (mix1) 1682 — — Validation KO — 2759 — 5′ Tgrop16 (mix2) Validation KO — 2870 2870 3′ Tgrop16 (mix3) Scar rop16KO — 2550  321 gra15LoxP (mix4) Gra15I/II (mix5)  560 560 and 308 560 and 308

    [0701] The electrophoresis of the PCR products produced with the primers rg1 SEQ ID NO: 83 and rg2 SEQ ID NO: 84 (mix 1) allow to highlight a band with 1682 base pairs for the Toxo tgmic1-3 KO-2G strain, according to the expected band size and confirming the presence of the tgrop16 gene in this strain. This band is not detected in Toxo tgmic1-3 KO rop16 KO Gra15II KI and Toxo tgmic1-3 KO rop16 KO Gra15II KI-2G strains confirming gene suppression in these strains.

    [0702] The electrophoresis of the PCR products produced with the primers rg3 SEQ ID NO: 85 and rg4 SEQ ID NO: 86 (mix 2) make it possible to highlight a band with 2759 base pairs for the Toxo tgmic1-3 KO rop16 KO Gra15II KI strain, in accordance with the size of the expected bands and confirming the suppression of the tgrop16 gene in this strain and the insertion of the CATGFP and gra15II selection genes instead of the tgrop16 gene. This band is not detected in Toxo tgmic1-3 KO-2G and Toxo tgmic1-3 KO rop16 KO Gra15II KI-2G strains. The electrophoresis of the PCR products made with the primers rg5 SEQ ID NO: 87 and rg6 SEQ ID NO: 88 (mix 3) allow to highlight a band with 2870 base pairs for the strains Toxo tgmic1-3 KO rop16 KO Gra15II KI and Toxo tgmic1-3 KO rop16 KO Gra15II KI-2G, according to the size of the expected bands and confirming the suppression of the tgrop16 gene in this strain and the insertion of the gra15II gene instead of the tgrop16 gene. This band is not detected in the Toxo tgmic1-3 KO-2G strain.

    [0703] The electrophoresis of the PCR products produced with the primers rg7 SEQ ID NO: 89 and rg8 SEQ ID NO: 90 (mix 4) allow to highlight a band of 2550 base pairs for the Toxo tgmic1-3 KO rop16 KO Gra15II KI strain confirming the presence of the CATGFP selection cassette SEQ ID NO: 6 in place of the tgrop16 gene. Finally, a band of 321 base pairs is identified for the Toxo tgmic1-3 KO rop16 KO Gra15II KI-2G strain confirming the deletion of the cat-gfp selection gene SEQ ID NO: 2 in this strain, leaving a Lox2272 of SEQ ID NO: 68 scar in the genome. No bands are not detected in the Toxo tgmic1-3 KO-2G strain.

    [0704] The “scar” PCR product obtained for the Toxo tgmic1-3 KO rop16 KO Gra15II KI-2G strain (321 base pairs) was sequenced and the sequencing confirmed that: [0705] the tgrop16 gene has been deleted and that the CAT-GFP selection cassette SEQ ID NO: 6 has been deleted by the action of Cre-Recombinase leaving a Lox2272 scar SEQ ID NO: 68 in accordance with the expected sequence (FIG. 9-C).

    [0706] The electrophoresis of the PCR products produced with the primers SEQ ID NO: 109 and SEQ ID NO: 110 (mix 5) make it possible to highlight a band with 560 base pairs for the Toxo tgmic1-3 KO-2G strains, in accordance with the expected band size and confirming the presence of the tggra15 gene in this strain. An additional band of 308 base pairs is detected in Toxo tgmic1-3 KO rop16 KO Gra15II KI and Toxo tgmic1-3 KO rop16 KO Gra15II KI-2G strains confirming the presence of the gra15HAII gene in these strains.

    [0707] Validation of the Toxo Tgmic1-3 KO Rop16 KO Gra15II KI-2G Strain by Immunofluorescence

    [0708] Tachyzoites are grown 24 hours on glass lamellae covered with a monolayer of HFF cells. The infected cells were washed twice with PBS1×, and fixed with 4% formaldehyde for 30 minutes. After 3 washes in PBS1×, the infected HFF cells were permeabilized with 0.1% Triton X-100 in PBS1× for 5 min. After 3 washes with PBS 1×, a saturation step is performed with a solution of PBS 1×/SVF 10% for 30 min. The cells were then incubated with the primary antibody diluted in 2% SVF for 1 hour, washed 3 times with PBS1× and incubated with a secondary antibody diluted in 2% PBS/SVF solution for 1 hour. After 2 washes with PBS1×, the glass slides are mounted on a slide with Immu-Mount™ and observed under a fluorescence microscope.

    [0709] The primary antibody used is the anti-HA mouse antibody which detects the expression of the protein GRA15II-HA SEQ ID NO: 123 in the parasite. The secondary antibody is the commercial secondary antibody: Alexa Fluor® 594 anti rabbit goat (Life Technologies A-11012). The antibodies are diluted 1/1000 times in 2% SVF PBS.

    [0710] For the wild strain Toxo tgmic1-3 KO 2G, no red fluorescence is observed at the apical pole of the parasite, revealing the absence of the protein GRA15II-HA. On the contrary, for the Toxo tgmic1-3 KO rop16 KO gra15II KI strain, a red fluorescence is observed showing the protein GRA15II-HA. The Toxo tgmic1-3 KO rop16 KO gra15II KI strain expresses a green fluorescent reflecting the expression of the CATGFP protein SEQ ID NO: 120 whereas after the action of the Cre recombinase, the Toxo tgmic1-3 KO rop16 KO gra15II KI Lox2272 strain is no longer fluorescent (FIG. 10).

    EXAMPLE 4: CONSTRUCTION OF RECOMBINANT STRAINS EXPRESSING THE M2eGPI PROTEIN AFTER TARGETED INTEGRATION

    [0711] The objective of this experiment is to evaluate whether the strains Toxo tgmic1-3 KO 2G and Neo ncmic1-3 KO 2G can express heterologous antigens.

    [0712] Cultivation of Parasites

    [0713] All tachyzoites of the Toxoplasma gondii strain used were produced as human fibroblasts (HFF) grown in minimal Dulbecco medium (DMEM) supplemented with 10% fetal calf serum (SVF), 2 mM glutamine, 100 U/mL penicillin and 100 U/mL streptomycin. They were collected after mechanical lysis of the host cells by 3 passages in 25G syringes.

    [0714] Plasmid Construction

    [0715] Plasmid pUC 4G2 ICreI

    [0716] The plasmid pUC 4G2 ICreI SEQ ID NO: 156 was constructed to allow the integration of a heterologous transgene into the strains Toxo tgmic1-3 KO 2G, Neo ncmic1-3 KO 2G and Toxo tgmic1-3 KO rop16 KO gra15II KI.

    [0717] The plasmid is notably composed of: [0718] 1—a selection cassette dhfr*-ty-tk SEQ ID NO: 229 (Donald & Roos, Proc Natl Acad Sci U S S A. 1993 Dec. 15; 90(24):11703-7; Scahill et al., (Mol Biochem Parasitol. 2008 January; 157(1):73-82. Epub 2007 Oct. 6.)), placed under the dependence of the dhfr* promoter SEQ ID NO: 230 of T. gondii and downstream of the 3′ UTR sequence of the dhfr* gene SEQ ID NO: 231 of Toxoplasma gondii. This selection cassette encodes the fusion protein DHFR*TYTK SEQ ID NO: 207 and allows positive selection by pyrimethamine and negative selection by ganciclovir. [0719] 2—an expression cassette consisting of the promoter of α-Tub8 SEQ ID NO: 128 (Soldati et al., Mol Cell Biol. 1995 January; 15(1):87-93—fusion of part of the promoter of Tgsag1 and Tgtub), an MCS multiple cloning site to allow future integration of heterologous transgene and the 3′ UTR sequence of the tgsag1 gene SEQ ID NO: 4 which should stabilize the mRNA of the heterologous gene.

    [0720] The dhfr*-ty-tk selection cassette was made from 3 PCR fragments obtained with the primers in Table 20: [0721] The amplification of the first PCR fragment SEQ ID NO: 129 was performed on the plasmid pUC18DHFR* SEQ ID NO: 130 (Donald & Roos 1993, same reference as above) with the Dhtk1 primers SEQ ID NO: 131 and Dhtk2 SEQ ID NO: 132 (674pb) and allows the amplification of the end of the coding sequence of DHFR* SEQ ID NO: 133 and to add the sequence coding the TY in 3′ SEQ ID NO: 134. [0722] The second PCR was performed on a synthesized sequence of the Human herpesvirus 1 (TK) Thymidine Kinase gene SEQ ID NO: 135 with Dhtk3 SEQ ID NO: 136 and Dhtk4 SEQ ID NO: 137 (1161pb) primers and allows the amplification of the Thymidine Kinase coding sequence with the addition of the TY coding sequence in 5′ SEQ ID NO: 138. [0723] The amplification of the third PCR fragment was performed on pUC18DHFR* SEQ ID NO: 130 with Dhtk5 primers SEQ ID NO: 139 and Dhtk6 SEQ ID NO: 140 (363pb) and allows the amplification of the end of the coding sequence of Thymidine Kinase and the 3′ UTR of DHFR* SEQ ID NO: 141.

    [0724] The second and third PCR fragments are fused by overlapping PCR with the primers Dhtk3 SEQ ID NO: 136 and Dhtk6 SEQ ID NO: 140 (1501pb) to give the sequence SEQ ID NO: 191. Finally, the first fragment SEQ ID NO: 129 digested by BamHI and BglII (646pb) and the fusion of the other two PCR SEQ ID NO: 191 digested by BamHI and XbaI (1474pb) are cloned in the plasmid pUC18DHFR* SEQ ID NO: 130 digested by BglII and XbaI (5258pb). The plasmid obtained is called pUC18DHFR*TYTK SEQ ID NO: 142.

    TABLE-US-00012 TABLE 20 List of primers used Dhtk AF SEQ ID NO: 131 Dhtk AF SEQ ID NO: 132 1 DHFRi CTGAGAAGGGCGTG 2 DHFR GTCAAGTGGATCCT nt AAGATC TY R GGTTAGTATGGACC Bgl TCGACAGCCATCTC F CATCTGGATTCG Dhtk TY SEQ ID NO: 136 Dhtk HSVT SEQ ID NO: 137 3 HSVT GAGGTCCATACTAA 4 K stop TTAGTTAGCCTCCC K F CCAGGATCCACTTG TAA R CCATCTCCC ACATGGCTTCGTAC CCCTGCCATCA Dhtk AFHS SEQ ID NO: 139 Dhtk AF SEQ ID NO: 140 5 VTK3 GGGAGATGGGGGAG 6 3UTR TTTTTCTAGAATCC UTRD GCTAACTAACGGAA DHFR TGCAAGTGCATAGA HFRF ATACAGAAGCTGCC XbaR AGGAA CGTCTCT

    [0725] The expression cassette is composed of the promoter of α-Tub8 SEQ ID NO: 128 (Soldati et al, 1995, same reference as above), a multiple cloning site to allow future integration of heterologous transgene and the 3′ UTR sequence of the sag1 gene SEQ ID NO: 4 which should stabilize the mRNA of the heterologous gene. The promoter part of α-Tub8 SEQ ID NO: 128 was obtained by PCR with the primers K7mcs1 SEQ ID NO: 143 and K7mcs2 SEQ ID NO: 144 (530pb) on the pTUB8TY TAIL SEQ ID NO: 145 (Meissner et al., J Cell Sci. 2002; 115:563-574). The 3′ UTR sequence of the sag1 gene SEQ ID NO: 4 was obtained by PCR with the primers K7mcs3 SEQ ID NO: 146 and K7mcs4 SEQ ID NO: 147 (395 bp). Then the two PCR fragments were fused by overlapping PCR with the primers K7mcs1 SEQ ID NO: 143 and K7mcs4 SEQ ID NO: 147 (914pb) to give the sequence SEQ ID NO: 192. The overlapping PCR SEQ ID NO: 192 digested by KpnI and SacI (902pb) was cloned in pUC18 (commercial plasmid) KpnI SacI (2682pb). The primers used for PCRs are detailed in Table 12 below. The plasmid obtained is pUC 18-Tub8MCS 3UTR SEQ ID NO: 148.

    TABLE-US-00013 TABLE 12 List of primers used for the construction of the expression cassette Primer Primer F Sequence R Sequence K7mcs1 pTUB8 SEQ ID K7mcs2 Tub 8 SEQ ID MCS 4 NO: 143 Ter R NO: 144 F AAAGGTA AACTTAAG CCTCTAG AATTTTGT AAGTATA TTAAACAG CTATTCG GG AAAAACT AGTATCG ATAAGCT GAACAC K7mcs3 MCS SEQ ID K7mcs4 MCS SEQ ID 3UTR NO: 146 3UT R NO: 147 TER F TTTAAAC TER R TTTGAGCT AAAATTC CTCTAGAA TTAAGTT TTTAAATC GCGGC CTAGG

    [0726] The expression cassette Tub8MCS 3UTR SEQ ID NO: 149 obtained by digesting pUC 18-Tub8MCS 3UTR SEQ ID NO: 148 with the enzyme XbaI (890pb) was then cloned in the plasmid pUC18 DHFR*TYTK SEQ ID NO: 142 digested by XbaI and dephosphorylated (7378pb). The plasmid obtained has its Tub8MCS 3UTR expression cassette transcribed in the opposite direction to the DHFR*TYTK cassette. The plasmid obtained is called pUC4G2 SEQ ID NO: 150.

    [0727] The PCR fragment SEQ ID NO: 193 amplified with the primers IcreI1 SEQ ID NO: 151 and IcreI2 SEQ ID NO: 152 on the pTsag1IcreI αβγ SEQ ID NO: 153 (142pb) and the PCR fragment SEQ ID NO: 194 amplified with the primers IcreI3 SEQ ID NO: 154 and IcreI4 SEQ ID NO: 155 on pUC4G2 SEQ ID NO: 150 (153pb) allow the addition of the sequence αβ IcreI SEQ ID NO: 157. The two PCR fragments SEQ ID NO: 193 and SEQ ID NO: 194 were directly cloned in the plasmid pUC4G2 SEQ ID NO: 150 digested by the restriction enzymes Pml I and KasI (7990pb) with the Ozyme In-Fusion technique.

    [0728] Then the fragment of PCR SEQ ID NO: 195 amplified with the primers IcreI5 SEQ ID NO: 159 and IcreI6 SEQ ID NO: 160 on the pTIcreI100 SEQ ID NO: 158 (546pb) and the fragment of PCR SEQ ID NO: 196 amplified with the primers IcreI7 SEQ ID NO: 161 and IcreI8 SEQ ID NO: 162 on pTsag1IcreI αβγ SEQ ID NO: 153 (133pb) allow the addition of the sequence IcreI βγ SEQ ID NO: 163 in the plasmid previously described digested by the restriction enzymes NsiI and AvrII (7734pb). The plasmid obtained is called pUc4G2 IcreI SEQ ID NO: 164. The primers used for PCRs are detailed in Table 21 below.

    TABLE-US-00014 TABLE 21 List of primers used Icrei PCR SEQ ID NO: 151 Icrei oz4g SEQ ID NO: 152 1 oz4g AATACCGCATCAGGCGCCTAGAA 2 mn1Ic AAAACGTCGTGAGA mn1 CCTGTTAAAAATAT reIr CAGTTTGGTGAGAT F ATCTTCAAAAGATA TATAGC Icrei oz4g SEQ ID NO: 154 Icrei oz4g SEQ ID NO: 155 3 mn2 GTCTCACGACGTTTTGAACCCAGcustom-character 4 mn2 R CGGATATGGTTACA IcreIF custom-character CGTG Icrei oz4g SEQ ID NO: 159 Icrei oz4g3 SEQ ID NO: 160 5 3F CGCCTCCGTCCCATGCAT 6 cre R CCAAACTGTCTCAC GACGTT Icrei oz4g4 SEQ ID NO: 161 Icrei oz4g4 SEQ ID NO: 162 7 FIcreI CGTGAGACAGTTTGGCTAAAAATT 8 Ravr GAGGCGCGCCAACC TATTTTAAATAATCTTAT II TAGGAGGGCCCGGG CGCCATGGC

    [0729] Plasmid pUC 4G2 IcreI M2eGPI SEQ ID NO: 164

    [0730] This plasmid will allow the production of a fusion protein sag1 M2eGPI SEQ ID NO: 165, comprising the protein SAG1 of Toxoplasma gondii SEQ ID NO: 166, a 5 M2e repetition (Nter fragment of Influenza virus protein M2) spaced by linkers (Lee et al, 2015, PLoS ONE 10(9): e0137822. doi:10.1371/day.pone.0137822) SEQ ID NO: 167 and Cter a GPI anchoring sequence of the SAG1 protein of Toxoplasma gondii SEQ ID NO: 169. The amplification of 3 PCR fragments was necessary for this construction. The amplification of the first PCR fragment SEQ ID NO: 197 was performed on the genomic DNA of Toxoplasma gondii of the coding sequence of sag1 SEQ ID NO: 170 with the primers da SEQ ID NO: 171 and db SEQ ID NO: 172 (906pb). The second PCR SEQ ID NO: 198 was performed on a synthesized sequence comprising a repetition of 5 M2e SEQ ID NO: 173 (Lee et al) with primers dc SEQ ID NO: 174 and dd SEQ ID NO: 175 (588pb). This M2e sequence has been optimized for expression in Toxoplasma gondii. The amplification of the third PCR fragment SEQ ID NO: 199 was performed on the genomic DNA of Toxoplasma gondii of the coding sequence of sag1 (GPI anchor part) SEQ ID NO: 176 with the primers of SEQ ID NO: 177 and df SEQ ID NO: 178 (98pb). The primers used for PCRs are detailed in Table 13 below.

    TABLE-US-00015 TABLE 13 List of primers used for the construction of plasmids pUC 4G2 IcreI M2eGPI  Primer Primer F Sequence R Sequence da Ozsa SEQ ID NO: 171 db Sag1 SEQ ID NO: 172 g14G F CTTGAATTCCCTGT M2e R TCAGCAAGGACCTA TTAAACGACAAAAt GGTGCAGCCCCGGC gtttccgaaggcag AA tg dc M2e F SEQ ID NO: 174 dd OzM2e SEQ ID NO: 175 CCTAGGTCCTTGCT GPI R GGCTGTTCCCGCAG GACTGA CCGTAGAATCGAGA CCGAGGA de oZ SEQ ID NO: 177 df oZ SEQ ID NO: 178 GPI F GCTGCGGGAACAGC GPI R ACCATGGAAGCGGC CAGTCA CGCTTACGCGACAC AAGCTGCGAT

    [0731] The PCR fragments were directly cloned in the plasmid p4G2 ICreI SEQ ID NO: 156 digested by the enzymes PmeI and NotI (8344pb) with the Ozyme In-Fusion technique.

    [0732] Plasmid pUC 4G2 IcreI M2eGPI LoxP of SEQ ID NO: 179

    [0733] The LoxP site of SEQ ID NO: 12 was introduced by PCR into the plasmid PUC 4G2 IcreI M2eGPI SEQ ID NO: 164 digested PciI and PmeI (8901 bp). The PCR fragment SEQ ID NO: 200 obtained with the primers aa SEQ ID NO: 180 and ab SEQ ID NO: 181 (438pb) and the PCR fragment SEQ ID NO: 201 obtained with the primers ac SEQ ID NO: 182 and ad SEQ ID NO: 183 (534pb) were cloned with the Ozyme In-Fusion technique in the plasmid PUC 4G2 IcreI M2eGPI SEQ ID NO: 164 digested PciI and PmeI. The primers used for PCRs are detailed in Table 14 below.

    TABLE-US-00016 TABLE 14 List of primers used for the introduction of the LoxP site Primer Primer F Sequence R Sequence aa pUC4G SEQ ID NO: 180 ab Puc4G SEQ ID NO: 181 PciI F GCTGGCCTTTTGCT loxP R TATAGCATACATTA CACATGT TACGAAGTTATTAG TATACTTCTAGAGG ATCC ac Puc4G SEQ ID NO: 182 ad pUC4G SEQ ID NO: 183 loxP F TATAATGTATGCTA PmeI R GAAACATTTTGTCG TACGAAGTTATAAA TTTAAAC CTAGTATCGATAAG CTTG

    [0734] Plasmid pUC 4G2 IcreI M2eGPI LoxN of SEQ ID NO: 184

    [0735] The LoxN site SEQ ID NO: 5 was introduced by PCR into the plasmid PUC 4G2 IcreI M2eGPI SEQ ID NO: 164 digested PciI and PmeI (8901 bp). The PCR fragment SEQ ID NO: 202 obtained with the primers aa SEQ ID NO: 180 and bb SEQ ID NO: 181 (438pb) and the PCR fragment SEQ ID NO: 203 obtained with the primers be SEQ ID NO: 182 and ad SEQ ID NO: 183 (534pb) were cloned with the Ozyme In-Fusion technique in the plasmid PUC 4G2 IcreI M2eGPI SEQ ID NO: 164 digested PciI and PmeI. The primers used for PCRs are detailed in Table 15 below.

    TABLE-US-00017 TABLE 15 List of primers used for the introduction of the LoxN site Primer Primer F Sequence R Sequence aa pUC4G SEQ ID NO: 180 bb Puc4G SEQ ID NO: 185 PciI GCTGGCCTTTTGCT loxN R TATAAGGTATACTA F CACATGT TACGAAGTTATTAG TATACTTCTAGAGG ATCC bc Puc4G SEQ ID NO: 186 ad pUC4G SEQ ID NO: 183 loxN TATAGTATACCTTA PmeI R GAAACATTTTGTCG F TACGAAGTTATAAA TTTAAAC CTAGTATCGATAAG CTTG

    [0736] Construction of Toxo Tgmic1-3 KO-2G M2eGPI Strains Targeted or Random Integration. Targeted Integration into the LoxP Site

    [0737] The ToxoKO mic1-3KO 2G strain is electroporated with 20 μg of purified circular plasmids pUC 4G2 IcreI M2eGPI LoxP of SEQ ID NO: 179 and pTsag1 Cre recombinase SEQ ID NO: 15 according to the previously described protocol. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. For mutant selection, the culture medium is replaced and supplemented by the selection agent (chloramphenicol 20 μM) 24 hours after electroporation. 10 to 15 days after selection, the parasites are subcloned in 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after performing genomic DNA extraction from the clones of interest. The strain obtained is called Toxo tgmic1-3 KO-2G M2eGPI LoxP.

    [0738] Targeted Integration into the LoxN Site

    [0739] The ToxoKO mic1-3KO 2G strain is electroporated with 20 μg of purified circular plasmids pUC 4G2 IcreI M2eGPI LoxN of SEQ ID NO: 184 and pTsag1 Cre recombinase SEQ ID NO: 15 according to the protocol previously described. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. For mutant selection, the culture medium is replaced and supplemented by the selection agent (chloramphenicol 20 μM) 24 hours after electroporation. 10 to 15 days after selection, the parasites are subcloned in 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after performing genomic DNA extraction from the clones of interest. The strain obtained is called Toxo tgmic1-3 KO-2G M2eGPI LoxN.

    [0740] Random Integration

    [0741] The ToxoKO mic1-3KO 2G strain is electroporated with 20 μg of the purified linearized plasmid pUC 4G2 IcreI M2eGPI LoxP of SEQ ID NO: 179 or pUC 4G2 IcreI M2eGPI LoxN of SEQ ID NO: 184 according to the previously described protocol. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. For mutant selection, the culture medium is replaced and supplemented by the selection agent (chloramphenicol 20 μM) 24 hours after electroporation. 10 to 15 days after selection, the parasites are analyzed for the expression of the fusion protein SAG1 M2eGPI SEQ ID NO: 165 (analysis on the total population).

    [0742] Validation Toxo Tgmic1-3 KO-2G M2eGPI Targeted Integration by PCR Targeted Integration into the LoxP Site

    [0743] Two PCRs are performed to validate clones that have selectively integrated the plasmid. To validate strains that have integrated the plasmids pUC 4G2 IcreI M2eGPI LoxP SEQ ID NO: 179, PCR analyses are performed from genomic DNA extracted with DNAzol from a parasitic pellet composed of 10.sup.7 parasites. The primers used for PCRs are detailed in Table 16 below. PCR products are analyzed by agarose gel electrophoresis. The clones that integrated the plasmid were validated by PCR with the primers ea SEQ ID NO: 187 and eb SEQ ID NO: 188 by obtaining the fragment SEQ ID NO: 204 (1719pb).

    [0744] The second PCR validates the location of the plasmid insertion at the Tgmic3 LoxP locus. The clones having integrated one of the plasmids were validated by PCR with the primers ec SEQ ID NO: 189 and eb SEQ ID NO: 188 by obtaining the fragment SEQ ID NO: 205 (2704 bp).

    TABLE-US-00018 TABLE 16 List of primers used for clone validation Primer Primer F Sequence R Sequence ea seq SEQ ID NO: 187 eb seq SEQ ID NO: 188 TUB AACCCGCGCAGAAG 3utr ATGGGGCACATGCT MCS F ACATCC MCS R GCACGAA ec CN3 SEQ ID NO: 189 eb seq SEQ ID NO: 188 AGAGGTTGACACCG 3utr ATGGGGCACATGCT ACAAAG MCS R GCACGAA

    [0745] Targeted Integration into the LoxN Site

    [0746] Two PCRs are performed to validate clones that have selectively integrated one of the plasmids. To validate strains that have integrated the plasmid pUC 4G2 IcreI M2eGPI LoxN of SEQ ID NO: 184, PCR analyses are performed from genomic DNA extracted with DNAzol from a parasitic pellet composed of 10.sup.7 parasites. The primers used for PCRs are detailed in Table 17 below. PCR products are analyzed by agarose gel electrophoresis. The clones having integrated one of the plasmids were validated by PCR with the primers ea SEQ ID NO: 187 and eb SEQ ID NO: 188 (1719pb) by obtaining the fragment SEQ ID NO: 204.

    [0747] The second PCR is used to validate the location of the plasmid insertion at the Tgmic1 LoxN locus. The clones having integrated one of the plasmids were validated by PCR with the primers ed SEQ ID NO: 55 and eb SEQ ID NO: 54 (2366pb) by obtaining the fragment SEQ ID NO: 206.

    TABLE-US-00019 TABLE 17 List of primers used for clone validation Primer Primer F Sequence R Sequence ed Tg SEQ ID NO: 190 eb seq SEQ ID NO: 188 mic1 CCCGTCTAGCAAGA 3utr ATGGGGCACATGCT loxN CCTCAA MCS R GCACGAA

    [0748] Analysis by Flow Cytometry.

    [0749] The expression level of M2eGPI SEQ ID NO: 165 was analyzed for different populations of recombinant parasites following specific labelling with an anti-M2 antibody (anti-influenza A virus M2 Protein antibody ab5416—Abcam). The expression of the M2eGPI transgene is similar or slightly higher for clones whose transgene is inserted in a targeted manner (located at the LoxP and LoxN scars at the mic1 or mic3 locus) than for populations whose transgene is inserted in a random manner. This result shows that the Toxo tgmic1-3 KO 2G strain is an expression vector optimized for transgene expression.

    EXAMPLE 5: CONSTRUCTION OF RECOMBINANT STRAINS OF TOXO TGMIC1-3 KO EXPRESSING THE CAT-GFP PROTEIN AFTER TARGETED OR RANDOM INTEGRATION OF THE CAT-GFP TRANSGENE

    [0750] The objective of this experiment is to study the level of expression of the cat-gpf gene after random or targeted integration at the LoxP or LoxN site of the transgene.

    [0751] Cultivation of Parasites

    [0752] All tachyzoites of the Toxoplasma gondii strain used were produced as human fibroblasts (HFF) grown in minimal Dulbecco medium (DMEM) supplemented with 10% fetal calf serum (SVF), 2 mM glutamine, 100 U/mL penicillin and 100 U/mL streptomycin. They were collected after mechanical lysis of the host cells by 3 passages in 25G syringes.

    [0753] Plasmid Construction

    [0754] Plasmid pUC 4G2 IcreI CAT-GFP LoxP LoxP of SEQ ID NO: 221

    [0755] The CATGFP fragment SEQ ID NO: 222 was amplified by PCR with the primers ca SEQ ID NO: 223 and cb SEQ ID NO: 224 (1488 bp) on the pCATGFP SEQ ID NO: 9. This PCR fragment was cloned with the In-Fusion technique of Ozyme in the plasmid pUC 4G2 IcreI M2eGPI LoxP of SEQ ID NO: 179 was digested by PmeI and NotI (8372pb-replacing M2eGPI by CATGFP). The primers used for PCRs are detailed in Table 18 below.

    TABLE-US-00020 TABLE 18 List of primers used for the construction of plasmids pUC 4G2 IcreI CAT-GFP Primer Sequence Primer F R Sequence ca Oz SEQ ID NO: 223 cb Oz SEQ ID NO: 224 CAT TTGAATTCCCTGTT CAT ACCATGGAAGCGGC GFP TCGACAAAATGCAT GFP CGCTTAATCGAGCG 4G F GAGAA 4G R GGTCCTGG

    [0756] Plasmid pUC 4G2 IcreI CAT-GFP LoxN of SEQ ID NO: 225

    [0757] The CATGFP fragment SEQ ID NO: 222 was amplified by PCR with the primers ca SEQ ID NO: 223 and cb SEQ ID NO: 224 (1488 bp) on the pCATGFP SEQ ID NO: 9. This PCR fragment was cloned with the In-Fusion technique of Ozyme in the plasmid pUC 4G2 IcreI M2eGPI LoxN of SEQ ID NO: 184 was digested by PmeI and NotI (8372pb-replacing M2eGPI by CATGFP). The primers used for PCRs are detailed in Table 18 above.

    [0758] Construction of Toxo Tgmic1-3 KO-2G CATGFP Strains Targeted or Random Integration.

    [0759] Targeted Integration into the LoxP Site

    [0760] The ToxoKO mic1-3KO 2G strain is electroporated with 20 μg of purified circular plasmids pUC 4G2 IcreI CATGFP LoxP of SEQ ID NO: 221 and pTsag1 Cre recombinase SEQ ID NO: 15 according to the protocol previously described. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. For mutant selection, the culture medium is replaced and supplemented by the selection agent (chloramphenicol 20 μM) 24 hours after electroporation. 10 to 15 days after selection, the parasites are subcloned in 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after performing genomic DNA extraction from the clones of interest. The strain obtained is called Toxo tgmic1-3 KO-2G CATGFP LoxP.

    [0761] Targeted Integration into the LoxN Site

    [0762] The ToxoKO mic1-3KO 2G strain is electroporated with 20 μg of purified circular plasmids pUC 4G2 IcreI CATGFP LoxN of SEQ ID NO: 225 and pTsag1 Cre recombinase SEQ ID NO: 15 according to the protocol previously described. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. For mutant selection, the culture medium is replaced and supplemented by the selection agent (chloramphenicol 20 μM) 24 hours after electroporation. 10 to 15 days after selection, the parasites are subcloned in 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after performing genomic DNA extraction from the clones of interest. The strain obtained is called Toxo tgmic1-3 KO-2G CATGFP LoxN.

    [0763] Random Integration

    [0764] The ToxoKO mic1-3KO 2G strain is electroporated with 20 μg of the purified linearized plasmid pUC 4G2 IcreI CATGFP LoxP of SEQ ID NO: 221 or pUC 4G2 IcreI CATGFP LoxN of SEQ ID NO: 225 according to the previously described protocol. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. For mutant selection, the culture medium is replaced and supplemented by the selection agent (chloramphenicol 20 μM) 24 hours after electroporation. 10 to 15 days after selection, the parasites are analyzed for the expression of the CATGFP protein SEQ ID NO: 120 (analysis on the total population).

    [0765] Validation Toxo Tgmic1-3 KO-2G CATGFP Targeted Integration by PCR

    [0766] Targeted Integration into the LoxP Site

    [0767] Two PCRs are performed to validate clones that have selectively integrated the plasmid. To validate strains that have integrated the plasmids pUC 4G2 IcreI CATGFP LoxP SEQ ID NO: 221, PCR analyses are performed from genomic DNA extracted with DNAzol from a parasitic pellet composed of 10.sup.7 parasites. The primers used for PCRs are detailed in Table 16 above. PCR products are analyzed by agarose gel electrophoresis. The clones that integrated the plasmid were validated by PCR with the primers ea SEQ ID NO: 187 and eb SEQ ID NO: 188 and obtaining a fragment SEQ ID NO: 226 (1647pb).

    [0768] The second PCR validates the location of the plasmid insertion at the Tgmic3 LoxP locus. The clones having integrated one of the plasmids were validated by PCR with the primers ec SEQ ID NO: 189 and eb SEQ ID NO: 188 and obtaining a fragment SEQ ID NO: 227 (2600 bp). The primers used for PCRs are detailed in Table 16.

    [0769] Targeted Integration into the LoxN Site

    [0770] Two PCRs are performed to validate clones that have selectively integrated the plasmid. To validate strains that have integrated the plasmid pUC 4G2 IcreI CATGFP LoxN SEQ ID NO: 225, PCR analyses are performed from genomic DNA extracted with DNAzol from a parasitic pellet composed of 10.sup.7 parasites. The primers used for PCRs are detailed in Table 17 above. PCR products are analyzed by agarose gel electrophoresis. The clones having integrated one of the plasmids were validated by PCR with the primers ea SEQ ID NO: 187 and eb SEQ ID NO: 188 and obtaining a fragment SEQ ID NO: 226 (1647pb). The primers used for PCRs are detailed in Table 16.

    [0771] The second PCR is used to validate the location of the plasmid insertion at the Tgmic1 LoxN locus. The clones having integrated one of the plasmids were validated by PCR with the primers ed SEQ ID NO: 190 and eb SEQ ID NO: 188 and obtaining a fragment SEQ ID NO: 228 (2294 bp). The primers used for PCRs are detailed in Table 17.

    [0772] Flow Cytometry Analysis

    [0773] The expression level of CAT-GFP SEQ ID NO: 120 was analyzed in the different populations of recombinant parasites (Table 19). The expression of the CATGFP transgene is systematically slightly higher for clones whose transgene is inserted in a targeted manner (located at the LoxP and LoxN scars at the mic1 or mic3 locus) than for populations whose transgene is inserted in a random manner.

    TABLE-US-00021 TABLE 19 Geometric mean fluorescence intensity of recombinant CATGFP strains. Geometric mean fluorescence Geometric mean fluorescence Parasite intensity (GFP) Parasite intensity (GFP) ToxoKO 2G 912 ToxoKO 2G 912 ToxoKO 2G M2eGPI LoxP 6078 ToxoKO 2G M2eGPI LoxN 5496 targeted at mic3 locus targeted at mic3 locus ToxoKO 2G2G M2eGPI 4850 ToxoKO 2G2G M2eGPI 5340 LoxP random 1 LoxN random 1 ToxoKO 2G2G M2eGPI 1998 ToxoKO 2G2G M2eGPI 3978 LoxP random 2 LoxN random 2 ToxoKO 2G2G M2eGPI 4561 ToxoKO 2G2G M2eGPI 4936 LoxP random 3 LoxN random 3 ToxoKO 2G2G M2eGPI 5237 ToxoKO 2G2G M2eGPI 5268 LoxP random 4 LoxN random 4 ToxoKO 2G2G M2eGPI 4778 ToxoKO 2G2G M2eGPI 4519 LoxP random 5 LoxN random 5 ToxoKO 2G2G M2eGPI 4899 LoxN random 6

    [0774] This result shows that the Toxo tgmic1-3 KO strain is an expression vector optimized for transgene expression.

    EXAMPLE 6: EFFICACY STUDY OF THE NEO NCMIC1-3 KO-2G STRAIN IN THE PREVENTION OF LETHAL NEOSPOROSIS IN A MOUSE MODEL

    [0775] In this study, the attenuated live strain Neo ncmic1-3 KO-2G was tested as a preventive vaccine for neosporosis. The objective is to determine whether or not the vaccine strain Neo ncmic1-3 KO-2G prevents dissemination and acute infection in a mouse model of lethal neosporosis.

    [0776] Materials and Methods

    [0777] Production of Neo Ncmic1-3 KO-2G Parasites and the Nc-1 Strain.

    [0778] The parasites Neo ncmic1-3 KO-2G and Nc-1 (used for the challenge) are produced on a confluent mat of VERO cells (ATCC CCL81) in a complete medium containing DMEM 1.5 g/L NaHCO.sub.3, 12% (v/v) SVF decompleted, 100 UI/mL Penicillin-100 UI/mL Streptomycin.

    [0779] Before infection of the cell wall, the cells are maintained independently of parasites. Each time VERO cells are passed, the mat is washed three times with 5 mL HBSS, detached with 1 mL pure trypsin, re-suspended in full medium, distributed at a rate of 7.5,.sup.105 cells per 25 cm2 of culture surface. The cells are incubated at 37° C. with 5% CO2 and are available for parasitic amplification three days later.

    [0780] At D-4, the cell mat is infected with 1.Math.10.sup.6 parasites per 25 cm.sup.2 of confluence cell culture.

    [0781] The vaccine parasites are harvested 4 days later. In short, the parasite-infected cell mat is washed with a complete medium to remove extracellular parasites. The cellular mat, containing the parasites, is scrapped and passed through a 27G syringe. The preparation is centrifuged for 10 min at 1500 g. The supernatant is removed and the pellet re-suspended in a DMEM solution with 0.1M Sucrose, 0.1M Trehalose, 2.5% inulin, 0.1M GSH, 1% proline and 1% ectoin added. The solution is prepared extemporaneously on the day of vaccination. The exact concentration of parasites, as well as viability, is estimated by counting in flow cytometry parasites with or without propidium iodide (P4864-10ML, Sigma). The final prepared solution was diluted to contain 2.Math.10.sup.7 parasites per millilitre.

    [0782] Design of the Study

    [0783] Mice were immunized intraperitoneally (IP) to DO with a single dose of 1.Math.10.sup.7 tachyzoites of the Neo ncmic1-3 KO-2G strain. Control mice were inoculated by the vehicle. Two mice from each genetic background were inoculated per group, or four mice per group.

    [0784] At D60, immunized mice were infected intraperitoneally at the lethal dose of 2.Math.10.sup.7 tachyzoites of virulent strain Nc-1. Two criteria are used to evaluate vaccine efficacy, mortality rate evaluation and humoral response against Neospora caninum at 30 days after vaccination.

    [0785] Animals

    [0786] Eight C57BL/6 and Balb/C mice with EOPS (Specific Pathogen Free) status were included in the study (Janvier Labs, . . . ). They have been raised in ventilated racks in an A2 animal house, in full compliance with current European ethical and regulatory standards.

    [0787] IgG Determination by ELISA

    [0788] The production of total serum specific IgG of N. caninum was determined by ELISA. The total parasitic extract of the Nc-1 strain was diluted in 0.05M pH9.6 carbonate/bicarbonate buffer to obtain a final concentration of 10 μg/mL. 100 μL per well of this mixture were deposited on a plate 96 flat-bottomed wells (Nunc MaxiSorp). After one night at +4° C., the wells were washed three times with 300 μL PBS buffer, Tween 20 0.05% (v/v), then saturated with 200 μL PBS, Tween 20 0.05%, BSA 4% (w/v) for 1 h30 at 37° C. After 3 washes with 300 μL per PBS well, Tween 20 0.05%, 100 μL per serum well of interest, previously diluted 1/50th in PBS, Tween 20 0.05%, were deposited on the plate and diluted in cascade by series of 2 in 2 (deposit on 11 wells/serum of interest). In control, (i) a serum, diluted in the same way as before and for which the specific total IgG titration is known and important, will serve as the reference control and (ii) a pool of serum diluted to 1/50th from mice inoculated by vehicles will serve as the negative control. Finally, 100 μL of PBS, Tween 20 0.05% were also deposited in 8 wells to serve as a “white” control. After 1 h incubation at 37° C. and three washes with 300 μL per PBS well, Tween 20 0.05%, 100 μL per well of the secondary anti-Mouse IgG antibody coupled to alkaline phosphatase (Sigma A3562) and diluted 1/5000e in PBS-Tween 20 0.05% were deposited. After 1 hour of incubation at 37° C. and three washes with 300 μL per well of PBS, Tween 20 0.05% followed by three washes with 300 μL per well of H2O mQ, the revelation was performed by adding 100 μL per well of a disodium para-nitrophenyl phosphate (PnPP) (Sigma) solution diluted at 1 mg/mL in a 1M Diethanolamine-HCl pH9.8 buffer. After 60 minutes of incubation at +24° C. and protected from light, the absorbance was measured at λ=405 nm with a counter reading at λ=620 nm using a plate reader (Infinite M200 Pro NanoQuant, Tecam). The D.O. values were subtracted from the average D.O. of the “white” control. Neospora caninum specific total serum IgG levels were expressed as antibody titres. Two methods were used for titration. The IgG titre is the inverse of the highest dilution of the serum of interest with an O.D. at least 2.5 times greater than that obtained with the negative control, or with an O.D. of 0.2.

    [0789] Results

    [0790] The efficacy of Neo ncmic1-3 KO-2G was estimated on a lethal wall model.

    [0791] Clinical Sign

    [0792] After vaccination, the vaccinated animals showed no specific clinical signs, no weight alterations and no significant increase in body temperature, suggesting a good tolerance of mice to the Neo ncmic1-3 KO-2G strain.

    [0793] Evaluation of the Humoral Response

    [0794] At 30 days after vaccination, blood samples were taken and the specific IgG antibody titre was measured by ELISA to estimate the quality of the immune response post-vaccination. The results are presented in FIG. 12.

    [0795] None of the unvaccinated mice showed a positive antibody titre. Conversely, all vaccinated mice, regardless of their genetic background, seroconverted and showed an antibody titre significantly different from that of unvaccinated animals.

    [0796] Effectiveness of Vaccination on Mouse Survival

    [0797] The real effectiveness of vaccination is assessed by an infectious challenge with a virulent strain (Nc-1). At D60 days after vaccination, mice were inoculated with the wild strain Nc-1 at a lethal dose of 2.Math.10.sup.7 tachyzoites per animal. All mice that received the control solution died during the experiment, i.e. 100% of lethality. In contrast, 100% of vaccinated mice survived until the end of the experiment, sixty days later. In addition, none of these vaccinated mice showed significant clinical signs, suggesting a complete protective effect on both morbidity and mortality.

    [0798] The results of this experiment demonstrate a clear immune response and protective effect of the Neo ncmic1-3 KO-2G-based vaccine against a lethal challenge with a wild Neospora caninum Nc-1 strain.

    EXAMPLE 7: EFFICACY STUDY OF THE TOXO TGMIC1-3 KO-2G STRAIN IN THE PREVENTION OF CONGENITAL TOXOPLASMOSIS IN A MOUSE MODEL

    [0799] The main purpose of this study is to study the efficacy of the vaccine strain Toxo tgmic1-3 KO-2G against congenital toxoplasmosis in a mouse model.

    [0800] Materials and Methods

    [0801] Parasite Production Toxo Tgmic1-3 KO-2G

    [0802] Toxo tgmic1-3 KO-2G strains are produced in human fibroblasts (HFF Hs27 ATCC CRL-1634) grown in minimal Dulbecco medium (DMEM) supplemented with 12% Australian fetal calf serum (SVF aust). The tachyzoites were collected from the supernatant. The parasites were listed on Malassez cell and diluted in DMEM medium to a concentration of 500 parasites per mL.

    [0803] Design of the Study

    [0804] Vaccination (100 tachyzoites in a volume of 200 μL of DMEM) is performed subcutaneously on female mice at DO with a 27G needle.

    [0805] Before injection (D-2) and 28 days after injection, peripheral venous blood was collected and left at room temperature for a minimum of one hour. The serum was obtained by centrifugation at 5000 g for 10 minutes. The prepared seras were stored at −20° C.

    [0806] Eight weeks after vaccination, 23 seroconverted mice (for T. gondii) per batch were placed in males and then challenged mid-pregnancy per os with 15 cysts of T. gondii strain 76K. The mothers are then isolated and the calving followed. The mice are followed for a period of about a month and then euthanized. A small number of mice will be analyzed after sacrifice. Then the mothers will be sacrificed, their spleens re-cultured to study the cellular response.

    [0807] Animals

    [0808] The number of mice per batch required for the study is 16 pregnant mice to allow a statistical study. The analysis of the immune response in 16 pregnant mice requires vaccinating a total of 50 mice per batch, taking into account the following parameters: gestation yield and potential mortality associated with the injection of the parasite (the mouse is an animal relatively sensitive to an injection of Toxoplasma gondii and vaccination to obtain effective seroconversion can generate mortality). Thus the vaccinated batches contain 50 animals at the beginning. Mice from batches 1 and 2 were not vaccinated, so 23 mice were sufficient for these batches. The analysis is performed on 16 pregnant mice per batch. The supernumerary mice are sacrificed.

    TABLE-US-00022 TABLE 20 Distribution of animals in the different batches. Number of Initial people of Number of number of female pregnant female mice to females Vaccination challenge mice mate required Batch 1: non-vaccinated, non — — 23 23 16 challenged batch (control) Batch 2: non-vaccinated — Feeding 23 23 16 batch - challenged 15 cysts Batch 3: vaccinated 100 tachyzoites Toxo — 50 23 16 batch - not challenged tgmic1-3 KO - 2G Batch 4: vaccinated 100 tachyzoites Toxo Feeding 50 23 16 batch - challenged tgmic1-3 KO - 2G 15 cysts

    [0809] A total of 146 8-week-old female SWISS mice were included in the study and distributed in different batches (Table 20). The animals were housed and handled in strict compliance with the ethical standards in force in France and the breeding standards imposed by European regulations. Food and drinking water have been distributed ad-libitum throughout the experiment.

    [0810] After a period of 7 days of acclimatization, the mice were individually identified and randomly assigned to 4 groups.

    [0811] IgG and IgM Assay by ELISA

    [0812] A 96-well plate was adsorbed with protein extract from the RH strain of Toxoplasma gondii (10 μg/ml) diluted in carbonate buffer pH 9.6 overnight at 4° C. After 2 washes in PBS 1×/Tween 0.05% and one wash in PBS 1×, the plate was saturated with PBS 3% BSA for 1 h30 at room temperature. Then, for the titration, the series 2 dilutions of 2 of 2 in, in PBS+3% BSA of the murine compounds to be tested were removed.

    [0813] After 1 h incubation at 37° C., the plate was washed twice (PBS 1×/Tween 0.05%), then the secondary antibody (anti-mouse IgG coupled to alkaline phosphatase (Sigma A3562) or anti-mouse IgM coupled to alkaline phosphatase (Sigma A9688) is added and diluted to 1/30 000 to PBS 1×/Tween 0.05%, before a new incubation at 37° C. for 1 h30. After 2 washes in PBS 1×/Tween 0.05% and one wash in PBS 1×, pNPP (4-Nitrophenyl phosphate disodium salt hexahydrate) was used at a concentration of 1 mg/ml diluted in DEA-HCL buffer for revelation, and the plate was incubated for 15 to 20 minutes at room temperature. The reaction is stopped with the addition of 3N NaOH stop solution. The absorbance at 405 nm was read via the Infinite Nanoquant Plate Reader M200 PRO (TECAN).

    [0814] ELISA Determination of IFN-γ Secreted by Splenocytes Stimulated In Vitro

    [0815] After each sampling, the spleen was crushed on a 100 μm sieve placed above a 50 ml Falcon tube with the addition of 5 ml RPMI medium. The shred was then centrifuged for 10 min at 400 g. The pellet was taken up in 300 μl RPMI and then 1 ml lysis buffer was added. The tube was incubated for 3 min at 4° C., and the reaction was stopped with the addition of 2% excess PBS 1×/SVF, then the cells were centrifuged for 10 min at 400 g. The cell pellets obtained were then taken up in 5 ml of stimulation medium. The cells were enumerated on Malassez cells in the presence of trypan blue which colours the dead cells.

    [0816] The cells were cultured in 96 wells in plates at a rate of 5′.sup.105 cells/well. Different stimulants could be added: antigenic extracts of the RH strain of Toxoplasma gondii (10 μg/ml) or concanavalin A (5 μg/ml) as positive controls. The plates were cultured in an oven at 37° C., 5%.sub.CO2 for 72 hours.

    [0817] The IFN-γ assay was performed on splenocyte culture supernatants in the presence of these different stimulants. The assay was performed by an ELISA test according to the protocol of the kit “Mouse IFN-γ ELISA Ready-set-go® (Ebiosciences).

    [0818] Evaluation of the Number of Cysts Present in the Brains of Mice

    [0819] The brains of mothers and mice are sampled to determine the presence or absence of brain cysts. Following the sacrifice of the mice, the brains are removed and crushed. The number of cysts is then counted by microscopic observation of the entire brain crushed material.

    [0820] Results

    [0821] Effectiveness of Vaccination on Mother Mice

    [0822] Survival and Clinical Signs Following Vaccination with the Toxo Tgmic1-3 KO-2G Strain

    [0823] Mice are observed daily from vaccination (DO) until 33rd day after vaccination and clinical signs are noted. An overall clinical score is calculated according to Table 21 of the sign score table. The results are presented in FIG. 13-A.

    TABLE-US-00023 TABLE 21 Scoreboard of clinical signs observed for mice Score/2 Physical appearance Normal 0 Brushed hair 1 Severe piloting 2 Behaviour/mobility Normal 0 Slight prostration/reduced mobility 1 Immobile 2 Weight <10% loss 0 10% to 20% loss 1 >20% loss 2 Injury at the injection site No injury 0 Papule/redness 1 Ulceration/necrosis 2

    [0824] Mice from unvaccinated batches did not show clinical signs, while mice from vaccinated batches showed some moderate clinical signs with a clinical score of less than 2. The peak of clinical signs was observed on D18. These clinical signs were observed up to D33. Mortality in SWISS mice can be observed depending on the injection site and parasitic strains of mortality. A survival rate of 90% (10 dead mice/100 mice for batches 3 and 4) is obtained at D30 for vaccination of mice with the Toxo tgmic1-3 KO-2G strain.

    [0825] Evaluation of the Adaptive Humoral Response

    [0826] The determination of serum IgG against Toxoplasma gondii proteins shows very clearly that the serum IgG from mice before injection does not produce antibodies specific to this strain.

    [0827] Vaccination with the Toxo tgmic1-3 KO-2G strain allows a high IgG production at D28 (batch 3 and 4) and J129 (batch 3). As expected, the challenge (strain 76K) of unvaccinated mice (batch 2) also allows IgG production. The production of IgG for the vaccinated batch is reinforced by the challenge (batch 4 to D129). The results are presented in FIG. 13-B.

    [0828] Evaluation of the Specific Cellular Response

    [0829] In order to evaluate the development of a cellular immune response, IFN-γ (cytokine indicating the development of a Th1-type response) secreted in splenocyte culture supernatants following various stimuli, was measured 72 hours after culture.

    [0830] As expected, the concentration of IFN-γ is increased after a challenge compared to the control group. For all mice vaccinated with Toxo tgmic1-3 KO-2G (having been challenged (batch 4) or not (batch 3)), significant concentrations of IFN-γ are measured when the cells are stimulated with antigenic extracts of the RH strain of Toxoplasma gondii, compared to unvaccinated mice. This suggests a vaccination-induced cellular response. The results are presented in FIG. 13-C.

    [0831] Counting the Number of Cysts Present in the Brains of Mother Mice

    [0832] The mothers were sacrificed on D129. The number of cysts is obtained by microscopic observation of the entire brain crushed material (4 brains per batch). No cysts are detected for batch 1 (unvaccinated, not challenged) while after challenge, an average of 2250.75 cysts per brain is obtained for batch 2 (unvaccinated, challenged). In batch 3 (only vaccinated), a very small number of cysts are observed (0.75 cysts per brain). In batch 4 (vaccinated and challenged), there was a significant decrease in the number of cysts compared to the unvaccinated batch (batch 2), with an average of 52 cysts per brain.

    [0833] Mice vaccinated with the Toxo tgmic1-3 KO-2G strain form very few brain cysts following a challenge with the T. gondii 76K strain. The results are presented in FIG. 13-D.

    [0834] Effectiveness of Vaccination on Mice

    [0835] Effectiveness on Proliferation and Sex Ratio

    [0836] Similar prolificity was obtained for all groups showing that vaccination and/or challenge did not affect the number of mice per litter. On the other hand, a change in sex ratio after T. gondii infection has already been described (Kankova et al, parasitology 2007). We observe a reduced number of males in the control group after challenge while this is not observed for the vaccinated group, suggesting that vaccination prevents sex ratio change. The results are presented in FIGS. 13-E and 13-F.

    [0837] Effectiveness on Stillbirths and Mortality

    [0838] Stillbirths and deaths were increased following the challenge in the absence of vaccination (batch 2 compared to batch 1). For the vaccinated batch only (batch 3), stillbirth and mortality are at a very low level, close to the control group (batch 1). The vaccinated and challenged group (batch 4) shows a significant reduction in the number of stillbirths and mortality compared to the unvaccinated and challenged group (batch 2). Vaccinating mothers therefore protects the offspring from an increase in stillbirths and mortality following a challenge. The results are presented in FIGS. 13-G and 13-H.

    [0839] Effectiveness on Mouse Survival

    [0840] The mice were followed over a 32-day period to study the effectiveness of the vaccination. Survival of mice decreases significantly for the batch whose mothers were challenged but not vaccinated. The other groups have a survival rate close to that obtained for the control batch (batch 1). Vaccinating mothers therefore increases the survival rate of mice following a challenge during gestation. The results are presented in FIG. 13-I.

    [0841] Effectiveness on the Clinical Signs of Mice.

    [0842] Mice are observed daily for 30 days and clinical signs are noted. An overall clinical score is calculated according to the sign score table (see Table 22 below).

    TABLE-US-00024 TABLE 22 Scoreboard of clinical signs observed for mice Score/2 Mobility Normal 0 Limited 1 Immobile 2 Score/1 Isolation No isolation 0 Isolation of 1 mother/nest/mice Growth Normal 0 Slower growth 1

    [0843] The mice from the challenged group (batch 2) have a higher clinical score than the mice from the control group (batch 1). This clinical score is due in particular to a slower growth of mice in this group. For the other batches (vaccinated or vaccinated and challenged), the clinical score is similar to the control group. The vaccination of mothers prevented growth retardation induced by the challenge in mice. The results are presented in FIG. 13-J.

    [0844] Evaluation of the Immature Humoral Response: IgM

    [0845] IgM cannot pass through the placental barrier but could pass to offspring via breast milk. Since IgM has a half-life of 5 days, the 32-day IgM assay reflects the immunity of mice developed in response to T. gondii (vaccine or challenge strain) transmitted by the mother. The humoral response developed by mice (in response to vaccination or the mother's challenge) is therefore evaluated by ELISA assay of IgM immunoglubulin at 32 days of age. The results are presented in FIG. 13-K.

    [0846] The IgM titre is increased for mice in the group from challenged mice (batch 2) compared to those from non-challenged mice (batch 1). For the vaccinated group only (batch 3), the IgM titre is close to the detection limit, indicating that there is no vertical transmission from the strain to the mice. For the vaccinated and challenged group (batch 4), the IgM titre measured for mice is significantly reduced compared to the titre obtained for mice from the challenged group (batch 2). Vaccination of mice has thus made it possible to reduce vertical transmission from the challenge strain to mice.

    [0847] The Toxo tgmic1-3 KO-2G strain thus allowed the implementation in mice of a humoral and cellular immune response directed against the T. gondii parasite. Vaccination of mice with the Toxo tgmic1-3 KO-2G strain resulted in a significant decrease in the cerebral parasitic load observed after a challenge with the virulent 76K strain. In addition, the Toxo tgmic1-3 KO-2G strain has good safety.

    [0848] Finally, the Toxo tgmic1-3 KO-2G strain allowed to protect the offspring from congenital toxoplasmosis (after a challenge with the virulent 76K strain at mid-gestation) with a decrease in stillbirth and mortality, a better clinical score for mice.

    EXAMPLE 8: SAFETY AND IMMUNOGENICITY STUDY OF TOXO TGMIC1-3 KO-2G STRAINS EXPRESSING THE M2EGPI ANTIGEN OF INFLUENZA VIRUS IN A MOUSE MODEL

    [0849] The objective of this experiment is to determine whether the Toxo tgmic1-3 KO-2G strain expressing the M2eGPI antigen of Influenza virus provides a humoral and cellular immune response to the Toxoplasma gondii vector and against the targeted viral antigen.

    [0850] Material and Method

    [0851] Production of Toxo Tgmic1-3 KO-2G Parasites Expressing the Influenza Virus M2eGPI Antigen

    [0852] Toxo tgmic1-3 KO-2G strains expressing influenza virus antigen (Toxo tgmic1-3 KO-2G M2eGPI LoxP, Toxo tgmic1-3 KO-2G M2eGPI LoxN and Toxo tgmic1-3 KO-2G M2eGPI total population-random insertion—example 4) are produced in human fibroblasts (HFF Hs27 ATCC CRL-1634) grown in minimal medium of Dulbecco (DMEM) supplemented by 10% fetal calf serum (SVF), 2 mM glutamine, 100 U/mL penicillin and 100 U/mL streptomycin. The tachyzoites were collected after mechanical lysis of the host cells by 3 passages in 25G syringes. The parasites were listed on Malassez cell and diluted in DMEM medium to a concentration of 500 parasites per mL.

    [0853] Animals

    [0854] A total of 45 6-week-old female SWISS mice were included in the study. The animals were housed and handled in strict compliance with the ethical standards in force in France and the breeding standards imposed by European regulations. Food and drinking water were distributed ad-libitum throughout the experiment.

    [0855] After a 15-day acclimatization period, the mice were individually identified and randomly assigned to 5 groups.

    [0856] Batch 1: Toxo tgmic1-3 KO-2G (n=10)

    [0857] Batch 2: Toxo tgmic1-3 KO-2G M2eGPI LoxP (n=10)

    [0858] Batch 3: Toxo tgmic1-3 KO-2G M2eGPI LoxN (n=10)

    [0859] Batch 4: Toxo tgmic1-3 KO-2G M2eGPI total population-random insertion (n=10)

    [0860] Batch 5: naive (n=5)

    [0861] At D0, 100 tachyzoites were injected intraperitoneally into a volume of 200 μL of DMEM. The animals were then followed and sacrificed 5 weeks after injection (J35) and the rats were collected. Before (D-1) and 34 days after injection, peripheral venous blood was collected and left at room temperature for a minimum of 30 minutes. The serum was obtained by centrifugation at 3000 g for 10 minutes. The prepared seras were stored at −20° C.

    [0862] IgG Determination by ELISA

    [0863] A 96-well plate was adsorbed with a mixture of 4 synthetic M2e peptides at 10 μg/mL (Anaspec) corresponding to the 4 M2e present in the construction of the fusion protein sag1M2eGPÏ or the protein extract of Toxo tgmic1-3 KO-2G (10 μg/ml) diluted in carbonate buffer pH 9.6 overnight at 4° C. After washing with PBS 1×/Tween 0.05%, the plate was saturated with PBS 1×/Tween 0.05%-BSA 4% for 1 h30 at 37° C. Then, for the titration, the series 2 dilutions of 2 of 2 in, in PBS 1×/Tween 0.05% of the murine samples to be tested were removed. After 1 h incubation at 37° C., the plate was washed, then the secondary antibody (IgG anti-mouse IgG coupled to alkaline phosphatase) is added and diluted to 1/30 000 PBS 1×/Tween 0.05%, before further incubation at 37° C. for 1 h30. After washing, pNPP was used at a concentration of 1 mg/ml diluted in DEA-HCL buffer for revelation, and the plate was incubated for 1 h at 37° C. The absorbance at 405 nm of each well with a counter reading at 620 nm was read via the Infinite Nanoquant Plate Reader M200 PRO (TECAN).

    [0864] ELISA Determination of IFN-□ Secreted by Splenocytes Stimulated In Vitro

    [0865] After each sampling, the spleen was crushed on a 100 μm sieve placed above a 50 ml Falcon tube with the addition of 5 ml RPMI medium. The shred was then centrifuged for 10 min at 400 g. The pellet was taken up in 300 μl RPMI and then 1 ml lysis buffer was added. The tube was incubated for 3 min at 4° C., and the reaction was stopped with the addition of 2% excess PBS 1×/SVF, then the cells were centrifuged for 10 min at 400 g. The cell pellets obtained were then taken up in 5 ml of stimulation medium. The cells were enumerated on Malassez cells in the presence of trypan blue which colours the dead cells.

    [0866] The cells were cultured in 96 wells in plates at a rate of 5′.sup.105 cells/well. Different stimulants could be added: antigenic extracts of Toxo tgmic1-3 KO-2G (10 μg/ml), a mix of 4 synthetic M2e peptides at 10 μg/mL (Anaspec) corresponding to the 4 M2e present in the construction of the fusion protein sag1M2eGPI or concanavaline A (5 μg/ml) which serves as positive control. The plates were cultured in an oven at 37° C., 5%.sub.CO2 for 72 hours. The IFN-γ assay was performed on splenocyte culture supernatants in the presence of different stimulants. The assay was performed by an ELISA test according to the protocol of the kit “Mouse IFN-γ ELISA Ready-set-go® (Ebiosciences).

    [0867] Results

    [0868] Survival and Clinical Signs

    [0869] Most mice show clinical signs such as tousled hair, swelling of the abdomen and prostration, with the exception of mice that have not received parasitic strains.

    [0870] Evaluation of the Adaptive Humoral Response to the Vector Toxo Tgmic1-3 KO-2G

    [0871] The determination of serum IgG against Toxo tgmic1-3 KO-2G proteins shows very clearly that they will come from mice before injection and do not produce antibodies specific to this strain. Concerning the samples will be collected 34 days after injection, a strong increase in absorbance synonymous with mouse seroconversion following vaccination with Toxo tgmic1-3 KO-2G or one of the derived strains is observed. A large majority of mice are seroconverted for toxoplasmosis.

    [0872] Evaluation of the Adaptive Humoral Response to the M2e Influenza Antigen

    [0873] Following the injection of Toxo tgmic1-3 KO-2G strains expressing M2eGPI, antibodies specific to the M2e antigen expressed by Toxo tgmic1-3 KO-2G M2eGPI LoxP, Toxo tgmic1-3 KO-2G M2eGPI LoxN and Toxo tgmic1-3 KO-2G M2eGPI total population-random insertion, but no production of antibodies specific for the M2e antigen for the Toxo tgmic1-3 KO-2G strain.

    [0874] The expression of the M2eGPI transgene being similar or slightly higher for clones with a targeted insertion of the transgene (located at the LoxP and LoxN scars) than for populations with a random insertion of the transgene (example 4), a similar or slightly better adaptive humoral response to the antigen is obtained for Toxo tgmic1-3 KO-2G M2eGPI LoxP, Toxo tgmic1-3 KO-2G M2eGPI LoxN strains than for populations where the transgene is randomly inserted.

    [0875] Evaluation of the Specific Cellular Response of Toxo Tgmic1-3 KO-2G or Influenza M2e Antigen

    [0876] In order to evaluate the development of a cellular immune response, IFN-γ (cytokine indicating the development of a Th1-type response) secreted in splenocyte culture supernatants following various stimuli, was measured 72 hours after culture.

    [0877] For all mice vaccinated with Toxo tgmic1-3 KO-2G or Toxo tgmic1-3 KO-2G M2eGPI (targeted insertion in LoxP, LoxN or randomly integrated), significant concentrations of IFN-γ are measured when the cells are stimulated with antigenic extracts of Toxo tgmic1-3 KO-2G, compared to unvaccinated mice.

    [0878] Concerning cells restimulated with M2e, no production of IFN-γ is detectable for all mice, whether naïve, vaccinated with Toxo tgmic1-3 KO-2G or with Toxo tgmic1-3 KO-2G M2eGPI (targeted insertion in LoxP, LoxN or random integration).

    [0879] It was therefore observed the implementation of a humoral immune response to the M2eGPI construction and a humoral and cellular immune response directed against the vector Toxo tgmic1-3 KO-2G.