Enzyme-linked immunosorbent assay (ELISA) for the detection of anti-mycoplasma hyorhinis IgG in swine serum

Abstract

This disclosure presents an Enzyme-Linked Immunosorbent Assay (ELISA) for the selective detection of anti-Mycoplasma hyorhinis IgG in porcine serum, which may contain antibodies specific to multiple other Mycoplasma spp.

Claims

1. A purified, recombinant, non-naturally occurring, non-post-translationally modified, Mycoplasma hyorhinis (M. hyorhinis) p37 polypeptide having a sequence with at least 98% identity to the sequence as set forth in SEQ ID NO:5; wherein the polypeptide is useful for the selective detection of M. hyorhinis antibodies.

2. The polypeptide of claim 1, wherein the polypeptide has the sequence as set forth in SEQ ID NO:5.

3. An Enzyme-Linked Immunosorbent Assay kit comprising the polypeptide of claim 1.

4. A method for making an ELISA plate, for use as a component of the kit of claim 3, comprising the following steps: a) suspending the polypeptide of claim 1 in carbonate/bicarbonate buffer to a concentration of about 80 μg/mL to about 120 μg/mL, to produce a coating solution; b) adding from about 80 μL to about 120 μL of the coating solution to each well; c) incubating the plate for at least about 12 hours at about 4° C.; d) removing the coating solution; e) blocking the plate; f) washing the plate; thereby preparing the ELISA assay plate.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 Western blot and SDS-PAGE gel of recombinant p37 protein fractions. L1: Standard; L2: Whole cell lysate L3: BPER soluble extract L4: Urea soluble extract L5: purified protein. This figure shows how the p37 protein partitions during purification and demonstrates the purity of the final antigen preparation;

(2) FIG. 2 is a graph showing swine anti-p37 S/P ration at day 35, for the following M. hyorhinis (isolate 10-1625-1) vaccine groups: A) 3.715×10{circumflex over ( )}8, 10% TRIGEN™; B) 3.715×10{circumflex over ( )}7, 10% TRIGEN™; C) no treatment. These results show that the disclosed assay was able to differentiate between vaccinated and non-vaccinated animals;

(3) FIG. 3 is a graph showing the mean S/P ratio per group M. hyosynoviae study on M. hyorhinis p37 antigen. The groups were vaccinated as follows: A) 5.012×10{circumflex over ( )}8, 10% TRIGEN™; B) 5.012×10{circumflex over ( )}8, 66% TS6; C) 5.012×10{circumflex over ( )}7, 10% TRIGEN™; D) 5.012×10{circumflex over ( )}7, 66% TS6; and E) no treatment. This trial was done to verify that animals vaccinated with M. hyosynoviae would not seroconvert against the p37 antigen, which was used in the M. hyorhinis assay. The results show that serum from animals vaccinated with the M. hyosynoviae antigen do not react positively in the M. hyorhinis test;

(4) FIG. 4 is a graph showing M. hyopneumoniae vaccine/non-vaccinated animals on M. hyorhinis and M. hyopneumoniae assays. For Group A, twenty animals were given a commercial M. hyo vaccine (VACCINE NAME); and for Group B, nineteen animals were given a commercial PCV2 vaccine (CIRCOVAC®). The results show that serum from animals vaccinated with M. hyopneumoniae does not react positively in the M. hyorhinis test;

(5) FIG. 5 is a graph showing the mean S/P response for animals vaccinated with M. hyorhinis (isolate 10-1625-1), at varied dose levels and formulated with varied adjuvants. Groups: A) 3.998×10.sup.8, 10% Trigen; B) 3.998×10.sup.7, 10% Trigen; C) 3.998×10.sup.6, 10% Trigen; D) 3.998×10.sup.8, 10% TS6; E) 3.998×10.sup.7, 10% TS6; F) 3.998×10.sup.6, 10% TS6; G) 3.998×10.sup.8, 66% TS6; H) 3.998×10.sup.7, 66% TS6; I) 3.998×10.sup.6, 66% TS6; W) 1.06×10.sup.8 non-concentrated, 10% Trigen; X) 1.06×10.sup.7 non-concentrated, 10% Trigen; Y) 1.06×10.sup.6 non-concentrated, 10% Trigen; and J) Controls. The results show that an optimal response is obtained using TS6 at 66% volume. A dose titration can clearly be seen across dose level in every set of adjuvant groups. This result demonstrates the ability of the test to measure the magnitude of the immune response against the antigen.

(6) FIG. 6 ClustalW alignment of p37 sequences from M. hyorhinis strains versus the sequence of the p37-His recombinant protein. This alignment shows that the p37 antigen is conserved amongst different strains and shares homology with the disclosed recombinant protein.

DETAILED DESCRIPTION OF THE INVENTION

(7) In the work disclosed herein a related approach was used to determine if p37 could be used as a diagnostic marker for measuring exposure to M. hyorhinis through both vaccination and natural exposure in swine. Previous studies have shown that the protein bears some similarity to other proteins present in Mycoplasma species.sup.15 and Influenza A virus hemagglutinin.sup.24 at the amino acid and structural levels. In the present disclosure, the p37 protein was used as a means of measuring the IgG response of swine to vaccination with inactivated, whole cell M. hyorhinis vaccines derived from three different strains of the pathogen. The assay was further validated to ensure that results of the test would not be confounded by vaccination with either M. hyopneumoniae or M. hyosynoviae. Finally, the assay was used to estimate the degree of exposure that might be encountered when testing animals in the field in order to get an idea as to the prevalence of this pathogen on a typical farm.

(8) In particular, recombinantly expressed M. hyorhinis p37 protein was used to monitor exposure to the pathogen in the field as well as the magnitude of the IgG response in vaccinated animals. The results indicated that the assay had a high degree of specificity in terms of its ability to distinguish animals vaccinated with M. hyorhinis versus other important Mycoplasma species, for example, M. hyopneumoniae and M. hyosynoviae. Vaccines used to protect animals against this pathogen appear to induce a strong antibody response against the p37 protein. Additionally, the degree of field prevalence determined using the ELISA in the swine herds tested ranged from 27% to as high as 67%.

Definitions

(9) By “antigen” or “immunogen” means a substance that induces a specific immune response in a host animal. The antigen may comprise a whole organism, killed, attenuated or live; a subunit or portion of an organism; a recombinant vector containing an insert with immunogenic properties; a piece or fragment of DNA capable of inducing an immune response upon presentation to a host animal; a polypeptide, an epitope, a hapten, or any combination thereof. Alternately, the immunogen or antigen may comprise a toxin or antitoxin.

(10) The terms “protein”, “peptide”, “polypeptide” and “polypeptide fragment” are used interchangeably herein to refer to polymers of amino acid residues of any length. The polymer can be linear or branched, it may comprise modified amino acids or amino acid analogs, and it may be interrupted by chemical moieties other than amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling or bioactive component.

(11) The term “immunogenic or antigenic polypeptide” as used herein includes polypeptides that are immunologically active in the sense that once administered to the host, it is able to evoke an immune response of the humoral and/or cellular type directed against the protein. Preferably the protein fragment is such that it has substantially the same immunological activity as the total protein. Thus, a protein fragment according to the invention comprises or consists essentially of or consists of at least one epitope or antigenic determinant. An “immunogenic” protein or polypeptide, as used herein, includes the full-length sequence of the protein, analogs thereof, or immunogenic fragments thereof. By “immunogenic fragment” is meant a fragment of a protein which includes one or more epitopes and thus elicits the immunological response described above. Such fragments can be identified using any number of epitope mapping techniques, well known in the art. See, e.g., Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66 (Glenn E. Morris, Ed., 1996). For example, linear epitopes may be determined by e.g., concurrently synthesizing large numbers of peptides on solid supports, the peptides corresponding to portions of the protein molecule, and reacting the peptides with antibodies while the peptides are still attached to the supports. Such techniques are known in the art and described in, e.g., U.S. Pat. No. 4,708,871; Geysen et al., 1984; Geysen et al., 1986. Similarly, conformational epitopes are readily identified by determining spatial conformation of amino acids such as by, e.g., x-ray crystallography and 2-dimensional nuclear magnetic resonance. See, e.g., Epitope Mapping Protocols, supra. Methods especially applicable to the proteins of T. parva are fully described in PCT/US2004/022605 incorporated herein by reference in its entirety.

(12) As discussed herein, the invention encompasses active fragments and variants of the antigenic polypeptide. Thus, the term “immunogenic or antigenic polypeptide” further contemplates deletions, additions and substitutions to the sequence, so long as the polypeptide functions to produce an immunological response as defined herein. The term “conservative variation” denotes the replacement of an amino acid residue by another biologically similar residue, or the replacement of a nucleotide in a nucleic acid sequence such that the encoded amino acid residue does not change or is another biologically similar residue. In this regard, particularly preferred substitutions will generally be conservative in nature, i.e., those substitutions that take place within a family of amino acids. For example, amino acids are generally divided into four families: (1) acidic—aspartate and glutamate; (2) basic—lysine, arginine, histidine; (3) non-polar—alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar—glycine, asparagine, glutamine, cystine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids. Examples of conservative variations include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another hydrophobic residue, or the substitution of one polar residue for another polar residue, such as the substitution of arginine for lysine, glutamic acid for aspartic acid, or glutamine for asparagine, and the like; or a similar conservative replacement of an amino acid with a structurally related amino acid that will not have a major effect on the biological activity. Proteins having substantially the same amino acid sequence as the reference molecule but possessing minor amino acid substitutions that do not substantially affect the immunogenicity of the protein are, therefore, within the definition of the reference polypeptide. All of the polypeptides produced by these modifications are included herein. The term “conservative variation” also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid provided that antibodies raised to the substituted polypeptide also immunoreact with the unsubstituted polypeptide.

(13) The term “epitope” refers to the site on an antigen or hapten to which specific B cells and/or T cells respond. The term is also used interchangeably with “antigenic determinant” or “antigenic determinant site”. Antibodies that recognize the same epitope can be identified in a simple immunoassay showing the ability of one antibody to block the binding of another antibody to a target antigen.

(14) An “immunological response” to a composition or vaccine is the development in the host of a cellular and/or antibody-mediated immune response to a composition or vaccine of interest. Usually, an “immunological response” includes but is not limited to one or more of the following effects: the production of antibodies, B cells, helper T cells, and/or cytotoxic T cells, directed specifically to an antigen or antigens included in the composition or vaccine of interest. Preferably, the host will display either a therapeutic or protective immunological response such that resistance to new infection will be enhanced and/or the clinical severity of the disease reduced. Such protection will be demonstrated by either a reduction or lack of symptoms and/or clinical disease signs normally displayed by an infected host, a quicker recovery time and/or a lowered viral titer in the infected host.

(15) By “animal” is intended mammals, birds, and the like. Animal or host as used herein includes mammals and human. The animal may be selected from the group consisting of equine (e.g., horse), canine (e.g., dogs, wolves, foxes, coyotes, jackals), feline (e.g., lions, tigers, domestic cats, wild cats, other big cats, and other felines including cheetahs and lynx), ovine (e.g., sheep), bovine (e.g., cattle, calves, steers, bulls), porcine (e.g., pig), avian (e.g., chicken, duck, goose, turkey, quail, pheasant, parrot, finches, hawk, crow, ostrich, emu and cassowary), primate (e.g., prosimian, tarsier, monkey, gibbon, ape), ferrets, seals, and fish. The term “animal” also includes an individual animal in all stages of development, including newborn, embryonic and fetal stages.

(16) Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The singular terms “a”, “an”, and “the” include plural referents unless context clearly indicates otherwise. Similarly, the word “or” is intended to include “and” unless the context clearly indicate otherwise.

(17) It is noted that in this disclosure and particularly in the claims and/or paragraphs, terms such as “comprises”, “comprised”, “comprising” and the like can have the meaning attributed to it in U.S. Patent law; e.g., they can mean “includes”, “included”, “including”, and the like; and that terms such as “consisting essentially of” and “consists essentially of” have the meaning ascribed to them in U.S. Patent law, e.g., they allow for elements not explicitly recited, but exclude elements that are found in the prior art or that affect a basic or novel characteristic of the invention.

Embodiments

(18) In an embodiment, the invention provides a purified, recombinant, non-naturally occurring, non-post-translationally modified, Mycoplasma hyorhinis (M. hyorhinis) p37 polypeptide having a sequence with at least 98% identity to the sequence as set forth in SEQ ID NO:5; wherein the polypeptide is useful for the selective detection of M. hyorhinis antibodies.

(19) In an embodiment, the polypeptide of has the sequence as set forth in SEQ ID NO:5.

(20) In another embodiment, the invention provides an Enzyme-Linked Immunosorbent Assay kit comprising the M. hyorhinis polypeptide disclosed herein.

(21) In another aspect of the invention, there is provided a method for making an ELISA plate, for use as a component of the disclosed ELISA kit, comprising the following steps: a) suspending the polypeptide in carbonate/bicarbonate buffer to a concentration of about 80 μg/mL to about 120 μg/mL, to produce a coating solution; b) adding from about 80 μL to about 120 μL of the coating solution to each well; c) incubating the plate for at least about 12 hours at about 4° C.; d) removing the coating solution; e) blocking the plate; f) washing the plate; thereby preparing the ELISA assay plate.

(22) In another embodiment, the invention provides a method for selectively detecting the presence of M. hyorhinis in a sample comprising the following steps: a) providing the ELISA plate of claim 4; b) providing at least an experimental sample, at least one negative control sample, and at least one sample containing antibodies specific to at least one Mycoplasma species other than M. hyorhinis; c) diluting the sample(s) in blocking buffer; d) adding an amount of diluted sample(s) into the wells of the plate; e) incubating the plates; f) washing the wells of the plates to remove the diluted sample(s); g) developing the plates using a chromogen; h) stopping the chromogen reaction; i) reading the plate at a wavelength appropriate for the chromogen used; j) collecting and recording the absorbance data for the wells; k) determining that M. hyorhinis is present where the sample has significantly more absorbance than the negative control samples; thereby selectively detecting the presence of M. hyorhinis in the sample(s).

(23) In yet another embodiment, the invention provides a method for selectively detecting the presence of M. hyorhinis P37 antibodies in a test sample, comprising the steps of: a) providing a test sample suspected of containing P37 antibodies; b) adding a quantity of the polypeptide to the test sample, the quantity being sufficient to produce a detectable level of binding activity by anti-P37 antibodies in the test sample; and c) detecting the presence of P37 antibodies bound to said polypeptide in the test sample.

(24) In another embodiment, the invention provides a method for selectively detecting the presence of M. hyorhinis P37 antibodies in a test sample, comprising the steps of: a) providing a test sample suspected of containing P37 antibodies; b) adding a quantity of an immunogenic fragment of the polypeptide to the test sample, the quantity being sufficient to produce a detectable level of binding activity by anti-P37 antibodies in the test sample; and c) detecting the presence of P37 antibodies bound to said polypeptide in the test sample.

(25) A diagnostic kit for the selective diagnosis of the presence in a biological sample of M. hyorhinis P37 antibodies; wherein even if the biological sample contains M. hyosynoviae and M. hyopneumoniae antibodies against orthologous, homologous or paralogous P37, the kit will not yield a positive result unless M. hyorhinis antibodies are present. In an embodiment, this kit contains the polypeptide having the sequence as set forth in SEQ ID NO:5.

(26) In still another embodiment, the invention provides a method of detecting exposure to M. hyorhinis in an animal or in a biological sample from said animal, comprising the step of detecting the presence or absence of an immune response to the polypeptide having the amino acid sequence shown as SEQ ID NO:5.

EXAMPLES

Example 1

(27) Materials and Methods

(28) Analysis of p37 Gene Sequences:

(29) The M. hyorhinis p37 gene sequence was translated in Clone Manager and a BLASTP.sup.26 search was performed against the NCBI “nr” database. All proteins with maximum identity greater than or equal to 35% are reported in Table 1.

(30) TABLE-US-00001 TABLE 1 Mycoplasma Max sp. Protein Name Coverage Identity NCBI Accession M. conjunctivae P37-like ABC transporter 98% 44% YP 002960563.1 M. ovipneumoniae DNA repair protein HhH-GDP 98% 38% WP 010321138.1 M. flocculare P37-like ABC transporter 95% 39% WP 002557691.1 substrate-binding protein M. pulmonis P37-like ABC transporter 98% 39% NP 326056.1 substrate-binding protein M. hyopneumoniae P37-like ABC transporter 93% 40% YP 287754.1 substrate-binding lipoprotein M. genitalium alkylphosphate ABC 64% 39% YP 006600321.1 transporter substrate-binding protein M. arginini alkylphosphate ABC 65% 40% WP 004416279.1 transporter substrate-binding component M. penetrans high affinity transport system 80% 35% NP 0758050.1 protein M. hominis ABC transporter substrate- 82% 38% YP 003302899.1 binding lipoprotein M. gallisepticum HatA 63% 41% YP 006581118.1 M. anatis high affinity transport system 61% 40% WP 006886440.1 protein p37 M. pneumoniae high affinity transport system 63% 37% YP 005175657.1 protein p37 M. iowae high affinity transport system 72% 36% WP 004025038.1 protein p37 M. alkalescens P37-like ABC transporter 64% 36% WP 002881335.1 substrate-binding lipoprotein
Sequencing p37 Genes from M. hyorhinis Isolates:

(31) M. hyorhinis strains were inoculated into Mycoplasma culture medium and grown for three days at 37° C. A 10 mL volume of each culture was then centrifuged at 7500×G for 20 minutes in order to pellet cells. Following this centrifugation the supernatant was discarded and genomic DNA was obtained from the cell pellet by phenol:chloroform extraction and ethanol precipitation. Briefly, the cell pellets were resuspended in 1 mL of phosphate buffered saline and 1 mL of a 1:1 mixture of phenol:chloroform was added. The samples were then homogenized by vigorous mixing. Next, phase separation was achieved by centrifuging the samples at 19000×G for one minute. The aqueous phase was removed from each sample and placed into a new tube. Next, an equal volume of chloroform was added to each tube and samples were mixed by hand. Samples were then centrifuged again for 1 minute at 19000×G and the aqueous phase was removed to a new tube. To each sample, a 1/10 volume of 3M sodium acetate was added. Next, three volumes of 100% ethanol were added to each sample and the samples were allowed to incubate on ice for fifteen minutes. Samples were then centrifuged at 14000×G for thirty minutes at 4° C. to pellet the DNA. The supernatant was removed from each tube and pellets were resuspended in 1 mL of 70% v/v ethanol to remove any remaining contaminants. Samples were then centrifuged again at 14000×G for 15 minutes at 4° C. Finally, pellets were resuspended in 10 mM Tris buffer and frozen at −20° C. until they were sent for PCR sequencing. The p37 gene sequences from various isolates listed in table 2 were amplified using the following set of forward and reverse primers; Forward-5′ GGGATTGAAGTGGTTGTCTGATTTAAG 3′ (SEQ ID NO:1), Reverse-5′ CAATGAACCAGATGCAGAACAATC 3′ (SEQ ID NO:2). PCR assays were carried out in a final, 25 μl volume with GoTaqH PCR SuperMix (Promega Inc., Madison, Wis., USA) with 0.2 mM of each primer and 10 ng of genomic DNA from each isolate respectively. The PCR cycling conditions consisted of an initial denaturation at 95° C. for 5 min followed by 35 cycles of denaturation at 95° C. for 30 sec, annealing at 55° C. for 30 sec, and extension at 68° C. for 90 sec, and a final elongation at 72° C. for 5 min. All PCR products were visualized after electrophoresis in 1.0% agarose gels run at 7.0 V/cm by staining with ethidium bromide (EtBr) and sequenced by Sanger di-deoxy chain termination method.

(32) TABLE-US-00002 TABLE 2 Origin of the isolates used for p37 gene sequence analysis. The isolates were selected from across the United States SEQ ID NO (p37 Isolate Amino Acid) Location 9-4107-1 6 Owatonna, MN 12-1973-2 6 Laurel, NE 12-2665-1 6 Guymon, OK 13-00490-1 6 Dodge Center, MN 10-1625-1 6 Storm Lake, IA 10-2286-1 6 Wesley, IA 10-3162-1 6 Rose Hill, NC 11-0731-1 6 Guymon, OK 11-3945-1 6 Owatonna, MN 12-1416-1 6 Waldorf, MN 12-3129-1 6 Trimont, MN 12-4130-1 6 Albin, WY 12-1276-1 7 Guymon, OK 11-4503-1 7 Faribault, MN 12-4153-1 6 Steen, MN
Molecular Cloning of p37 Protein:

(33) Sequence information for M. hyorhinis p37 was derived from Genbank sequence M37339.1. This sequence was then codon optimized for expression in E. coli by changing the start codon to ATG, the tryptophan codons to TGG, such that the resulting gene could be expressed efficiently in an E. coli host. A synthetic gene was then synthesized at Genscript (how to site them) and the resulting sequence obtained in a pUC57 vector. The gene was then amplified from the vector using primers p37 F (GACGACGACAAGATGCAGGCCTCTGCAGTCGAC) (SEQ ID NO:3) and p37 R (GAGGAGAAGCCCGGTTATTTAATCGCCTTTTCGTAG) (SEQ ID NO:4) using a standard PCR protocol. Once amplified, the gene was purified from the reaction mixture using a Qiagen PCR clean up kit according to the manufacturer's instructions. The purified gene was then ligated into a pET30-LIC vector according to the manufacturer's instructions. The ligated vector was then transformed into One-Shot Top 10 Electrocompetent cells (Invitrogen) and transformed cells were plated out on selection media (LB agar with KAN 50 μg/mL). Clones were then grown overnight in selective media (LB Broth with KAN 50 μg/mL) and plasmid was harvested using a Qiagen plasmid extraction kit. Purified plasmid from each clone was then screened for the presence of insert using (insert primers specific for vector). Positive clones were selected and sent for sequencing (Operon). The plasmid was then transformed into E. coli BL-21 (DE3) cells by electroporation and transformants were selected by overnight incubation on selective media (LB agar with Kan 50 μg/mL)

(34) Expression and Purification of p37 Protein:

(35) A single BL-21 clone was inoculated into 200 mL of (T-BONE—need to get the commercial name) auto-induction media and grown overnight in a shake flask at 37° C. with agitation at 250 rpm. The next day, cells were centrifuged at 5000×G for 25 minutes, and the supernatants discarded. The pellet was then resuspended in 20 mL of a commercial lysis buffer (BPER Thermo Pierce) and gently homogenized by pipetting the suspension up and down over the pellet. Next, DNAse (sigma) was added at a concentration of 20 U/ml and the resulting mixture was allowed to incubate for two hours at room temperature on a Nutator mixing device. The extraction was then centrifuged at 7500×G for 30 minutes. The supernatant was retained for analysis by SDS-PAGE and western blot. The pellet was resuspended in 8M urea and allowed to incubate for two hours at room temperature on a Nutator mixing device. This suspension was then centrifuged again at 7500×G and passed through a 0.2 μm filter to remove any insoluble solids. Prior to purification a sample from the urea and lysis buffer fractions was tested by SDS-PAGE and western blot to determine which fraction the protein had partitioned into. The urea fraction was selected based on the results of this analysis. Next, a 2 mL nickel affinity column was prepared according to methods recommended by the manufacturer using (insert affinity resin& disposable columns Pierce). 10 mLs of equilibration (insert formula for buffer B) buffer was then passed through the column. Next, the entire urea soluble fraction was passed through the column. The column was then washed using 20 mLs of wash buffer (insert formula for buffer C). Finally, the column was eluted using 5 mLs of elution buffer (insert formula for buffer E). The protein concentration of the resulting solution was determined by BCA assay (Thermo Pierce) according to the kit instructions.

(36) SDS-PAGE and Western Blot:

(37) SDS-PAGE and western blot analysis of p37 was performed on two separate gels in parallel. 100 μL samples were mixed with 20 μL of loading buffer (insert Pierce info) and boiled for 5 minutes to reduce and denature the proteins. Next, 10 μL of protein standards (insert pierce info) and 20 μL of boiled sample were loaded onto a 4-20% gradient SDS-PAGE gel (insert pierce info). The gel was then electrophoresed under a constant current of 85V for 90 minutes. Following electrophoresis, the gels were washed in distilled water for 10 minutes to remove residual SDS. One of the two gels was then stained using a Coomassie based commercial protein stain (insert pierce info) for one hour on a table top mixer. Next, the gel was rinsed briefly in distilled water to remove residual stain and then allowed to incubate in distilled water with mixing overnight to destain the gel before visualization. The other gel was used for western blot analysis and was soaked in running buffer (insert tris-glycine buffer) for ten minutes prior to transferring proteins to a nitrocellulose membrane by electrophoresis. The electrophoresis protocol for transferring the proteins from the gel to the membrane consisted of a one hour transfer at 85V. After transfer, the membrane was removed from the gel and allowed to block overnight at 4° C. in a commercial blocking buffer (Pierce). After blocking, the membrane was then incubated with a Ni:HRP conjugate (insert KPL) at a 1/2000 dilution with gentle agitation at 37° C. for one hour. The blot was then rinsed twice in PBS-T at five minutes per wash with gentle agitation before a final rinse in PBS. The membrane was then allowed to develop for approximately three minutes using a metal enhanced DAB substrate (insert pierce info here) before the reaction was stopped by rinsing the blot with distilled water.

(38) ELISA Assay:

(39) Purified M. hyorhinis p37 protein was suspended in carbonate/bicarbonate buffer (Sigma) and 100 μl/well was coated onto the surface of Immulon 2HB plates at a concentration of 100 μg/mL. Plates were allowed to incubate overnight at 4° C. and the coating solution was removed prior to blocking plates. Plates were blocked with 300 μL/well of Neptune block (Immunochemistry Technologies LLC) and allowed to incubate for two hours at 37° C. Plates were then washed one time in PBS-T using a plate washer set to aspirate blocking buffer, add 300 μL/well of wash buffer to the plate, and then aspirate the wash buffer. Next, samples, diluted 1/1000 in Superblock, were added to the plate in duplicate in 100 μL volumes and allowed to incubate for one hour at 37° C. Plates were then washed three times in PBS-T using the same volume setting as the first wash. Conjugate (peroxidase labeled goat anti-swine IgG H&L from KPL) was added to the plate at a 1/5000 dilution and allowed to incubate for one hour at 37° C. After the conjugate incubation, plates were washed four times in PBS-T and developed using TMB chromogen (KPL). The chromogen was added at 100 μL/well and allowed to develop for ten minutes at room temperature. The reaction was stopped by the addition of 1N sulfuric acid added to the plate at 100 μL/well. Plates were then read at a wavelength of 450 nm and absorbance data was exported to Excel. In Excel, the mean absorbance of the two Superblock wells was determined and subtracted from that of every other well on the plate. Next, the mean absorbance of the duplicate samples and controls was determined. Finally, the mean absorbance of every sample and the negative control was divided by that of the positive control sera to obtain sample/positive ratios used to determine positive/negative status of the animals.

Example 2

(40) M. hyosynoviae and M. hyopneumoniae ELISAs:

(41) Optimization ELISA:

(42) Optimal dilutions for coating antigens onto plates and for antisera to be used in the assay were established via a standard checkerboard method. Antisera from trial 1 was then used in the assay to develop positive and negative controls and to establish a positive/negative threshold for use in further testing. Based on the S/P values reported from the vaccinates receiving the undiluted vaccine, and from the non-vaccinated animals, a cut-off of 0.15 S/P was established that reported the minimum number of false positives (1 animal) and no false negatives. A false positive was defined as a non-vaccinate that reacted in the assay with an S/P greater than the cut-off. A false negative was defined as a vaccinate that failed to react in the assay at a level higher than the cut-off. Cut-off values were tested ranging from 1.0 to 0.1 using data from the trial 1 serum set.

Example 3. Animal Trials

(43) Trial 1: M. hyorhinis Study

(44) Twenty-four high health animals were obtained from a commercial supplier and housed in a clean facility until they had reached eight weeks of age. Test animals received two vaccinations of inactivated M. hyorhinis vaccine formulated at different dose levels using as shown in Table 3. Vaccinations were given at days 0 and 21. Vaccine was delivered IM in a 2 cc dose. Serum samples were obtained from animals at day 35 for testing in the ELISA.

(45) TABLE-US-00003 TABLE 3 M. hyorhinis - Trial 1 (results shown in FIG. 2) Group Treatment # animals A 3.715 × 10{circumflex over ( )}8, 10% Trigen 10 B 3.715 × 10{circumflex over ( )}7, 10% Trigen 10 C no treatment 4 isolate 10-1625-1 was used
Trial 2: M. hyosynoviae Study

(46) Fifty high health animals were obtained from a commercial supplier and housed in a clean facility until they had reached ten weeks of age. These animals received two vaccinations of inactivated M. hyosynoviae vaccine formulated at different dose levels using two different adjuvants as shown in Table 4. Vaccinations were given at days 0 and 21. Vaccine was delivered IM in a 2 cc dose. Serum samples were obtained from animals at days 35 for testing in the M. hyorhinis ELISA as well as an M. hyosynoviae ELISA similar to one published by Nielsen et al..sup.28.

(47) TABLE-US-00004 TABLE 4 M. hyosynoviae - Trial 2 (results shown in FIG. 3) Group Treatment # animals # animals tested A 5.012 × 10{circumflex over ( )}8, 10% Trigen 10 8 B 5.012 × 10{circumflex over ( )}8, 66% TS6 10 10 C 5.012 × 10{circumflex over ( )}7, 10% Trigen 10 9 D 5.012 × 10{circumflex over ( )}7, 66% TS6 10 8 E no treatment 10 9
Trial 3: M. hyopneumoniae Study:

(48) A serum set containing 40 sera from animals having received either a PCV2 vaccination or a vaccination against M. hyopneumoniae was used in the assay. Animals were obtained from a high health herd and vaccinated IM at days 0 and 21 using a 2 cc dose. Animals having received the PCV2 vaccine were considered to be non-vaccinates for the purpose of compiling the results. Animals receiving M. hyopneumoniae vaccine were considered to be vaccinates. Serum taken when the animals were 8 weeks of age at day 35 of the study protocol was tested using both a commercially available M. hyopneumoniae ELISA and the M. hyorhinis ELISA.

(49) TABLE-US-00005 TABLE 5 M. hyopneumoniae - Trial 3 (results shown in FIG. 4) Group Treatment # animals A M. hyo commercial vaccine 20 B PCV2 commercial vaccine 19
Trial 4: M. hyorhinis Study 2 (Test Set)

(50) One-hundred nineteen high health animals were obtained from a commercial supplier and housed in a clean facility until they had reached ten weeks of age. These animals received two vaccinations of inactivated M. hyorhinis vaccine formulated at different dose levels using two different adjuvants as shown in Table 6. Vaccinations were given at days 0 and 21. Vaccine was delivered IM in a 2 cc dose. Serum samples were obtained from animals at days 0, 21, and 35 for testing in ELISA.

(51) TABLE-US-00006 TABLE 6 M. hyorhinis - Trial 4 (results shown in FIG. 5) Group Treatment # animals A 3.998 × 10.sup.8, 10% Trigen 10 B 3.998 × 10.sup.7, 10% Trigen 10 C 3.998 × 10.sup.6, 10% Trigen 10 D 3.998 × 10.sup.8, 10% TS6 10 E 3.998 × 10.sup.7, 10% TS6 10 F 3.998 × 10.sup.6, 10% TS6 10 G 3.998 × 10.sup.8, 66% TS6 9 H 3.998 × 10.sup.7, 66% TS6 9 I 3.998 × 10.sup.6, 66% TS6 9 W 1.06 × 10.sup.8 non-concentrated, 10% Trigen 9 X 1.06 × 10.sup.7 non-concentrated, 10% Trigen 9 Y 1.06 × 10.sup.6 non-concentrated, 10% Trigen 9 J Controls 5
Trial 5: Field Prevalence

(52) Two hundred-fifty serum samples that had been submitted to our laboratory for un-related diagnostic testing were used to estimate the sero-prevalence of antibody against the p37 antigen. These samples were obtained from a variety of animals across multiple locations in the United States. Samples were subjected to ELISA testing as described above and the results were compiled in terms of the number of animals testing positive for antibody in the test.

(53) Results

(54) A BLAST search for proteins with homologous to p37 protein used in this study.sup.5 shows that they are highly conserved across M. hyorhinis strains. Among the homologs identified during the BLAST analysis one originated from M. conjunctivae and one from M. ovipneumoniae which have not been previously isolated from swine. However, an M. conjunctiva appears to be genetically related to other Mycoplasma species that infect swine.sup.25. A homologous protein from M. flocculare, a commensal strain commonly found in swine.sup.27 was also found in the search. Due to the common practice of vaccinating pigs against M. hyopneumoniae, interference from vaccination against this pathogen was evaluated in the assay (Table 1).

(55) The M. hyorhinis isolates analyzed in this study were taken from geographically dispersed locations and over a four year time period indicating that there has been little temporal drift in the p37 sequence and that even over large geographic distances there is very little difference in the protein sequence between strains. The recombinant protein sequence that was used for the ELISA does contain seven differences in the amino acid sequence when compared to the isolate sequences. However, it is apparent from the reactivity in the ELISA that these do not prevent binding of antibody to the antigen.

(56) The SDS-PAGE gel and western blot show the partitioning of the antigen into inclusion bodies during expression in the E. coli host. This was not surprising as p37 is a membrane bound protein and would have been difficult to express in a soluble form. Additionally, purification from the inclusion body phase resulted in a very pure preparation which is important in order to prevent interference in the test from antibodies made against E. coli which is likely to be present in swine, particularly in older animals.

(57) The initial proof of concept study that was done to determine whether the p37 assay could detect antibody against M. hyorhinis successfully demonstrated that we could detect an immune response in vaccinated animals that was not present in the controls. A later study performed using a dose titration of inactivated M. hyorhinis in two different adjuvants demonstrated that we could obtain a more potent response when using a different adjuvant than that used in our initial study. Also, we were able to see the response in the ELISA diminish as the dose of the antigen was decreased, indicating that this assay may have value as a means of semi-quantitatively measuring the immune response as well.

(58) The remaining two trials were performed in order to determine if antibodies made in response to vaccination with other species of Mycoplasma that are known to infect swine might interfere with the test. The results of these two trials demonstrate that animals that had been vaccinated with M. hyosynoviae and M. hyopneumoniae did not react positively in the assay indicating that the assay has sufficient specificity to measure antibody made against M. hyorhinis and will not detect antibody against either M. hyosynoviae or M. hyopneumoniae.

(59) In summary, the p37 antigen can be used as a means to monitor the response to vaccination with inactivated M. hyorhinis. The test exhibits a high degree of selectivity toward antibodies made against this species and the p37 protein is well conserved which should allow us to monitor the response against many, if not all, strains currently circulating in the United States. We were also able to measure the magnitude of the immune response using this assay which resulted in an improvement in our inactivated vaccine through the use of a new adjuvant system.

(60) Sources and Manufacturers

(61) a) Thermo Pierce—3747 N Meridian Rd, Rockford, Ill. 61101 b) Sigma-Aldrich—3050 Spruce St, St. Louis, Mo. 63103 c) T-BONE manufacturer— d) Kirkegaard & Perry Laboratories—910 Clopper Road, Gaithersburg, Md. 20878 e) Immunochemistry Technologies LLC—9401 James Avenue South, Suite 155, Bloomington, Minn. 55431 f) IDEXX—One IDEXX Drive, Westbrook, Me. 04092

REFERENCES

(62) 1. Urbanek C, Goodison S, Chang M, et al.: 2011, Detection of antibodies directed at M. hyorhinis p37 in the serum of men with newly diagnosed prostate cancer. BMC Cancer 11:233-238. 2. Hansen M S, Pors S E, Jensen H E, et al.: 2010, An investigation of the pathology and pathogens associated with porcine respiratory disease complex in Denmark. J Comp Pathol 143:120-131. 3. Palzer A, Ritzmann M, Wolf G, Heinritzi K: 2008, Associations between pathogens in healthy pigs and pigs with pneumonia. Vet Rec 162:267-271. 4. Kim B, Lee K, Han K, et al.: 2010, Development of in situ hybridization for the detection of Mycoplasma hyorhinis in formalin-fixed paraffin-embedded tissues from naturally infected pigs with polyserositis. J Vet Med Sci 72:1225-1227. 5. Dudler R, Schmidhauser C, Parish R W, et al.: 1988, A mycoplasma high-affinity transport system and the in vitro invasiveness of mouse sarcoma cells. EMBO J 7:3963-3970. 6. Razin S, Hayflick L: 2010, Highlights of mycoplasma research—An historical perspective. Biologicals 38:183-190. 7. Minion F C: 2002, Molecular pathogenesis of mycoplasma animal respiratory pathogens. Front Biosci 7:1410-1422. 8. Kobisch M, Friis N F: 1996, Swine mycoplasmoses. Rev Sci Tech 15: 1569-1605. 9. Hagedorn-Olsen T, Nielsen N C, Friis N F, Nielsen J: 1999, Progression of Mycoplasma hyosynoviae infection in three pig herds. Development of tonsillar carrier state, arthritis, and antibodies in serum and synovial fluid in pigs from birth to slaughter. Zentralbl Veterinarmed A 46: 555-564. 10. Friis N F, Ahrens P, Larsen H: 1991, Mycoplasma hyosynoviae isolation from the upper respiratory tract and tonsils of pigs. Acta Vet Scand 32:425-429. 11. Yang H, Qu L, Chen L, et al.: 2010, Mycoplasma hyorhinis infection in gastric carcinoma and its effects on the malignant phenotypes of gastric cancer cells. BMC Gastroenterol 10:132-139. 12. Namiki K, Goodison S, Porvasnik S, et al: 2009, Persistent exposure to Mycoplasma induces malignant transformation of human prostate cells. PLoS One 4:e6872. 13. Gois M, Kuksa F: 1974, Intranasal infection of gnotobiotic piglets with Mycoplasma hyorhinis: Differences in virulence of the strains and influence of age on the development of infection. Zentralbl Veterinarmed B 21:352-361. 14. Gomes Neto J C, Gauger P C, Strait E L, et al.: 2012, Mycoplasma-associated arthritis: Critical points for diagnosis. J Swine Health Prod 20:82-86. 15. Sippel K H, Robbins A H, Reutzel R, et al.: 2009, Structural insights into the extracytoplasmic thiamine-binding lipoprotein p37 of Mycoplasma hyorhinis. J Bacteriol 191:2585-2592. 16. Yogev D, Rosengarten R, Watson-McKown R, Wise K S: 1991, Molecular basis of Mycoplasma surface antigenic variation: a novel set of divergent genes undergo spontaneous mutation of periodic coding regions and 5′ regulatory sequences. EMBO J 10:4069-4079. 17. Rosengarten R, Wise K S: 1990, Phenotypic switching in mycoplasmas: phase variation of diverse surface lipoproteins. Science 247:315-318. 18. Rosengarten R, Wise K S: 1991, The VLP system of Mycoplasma hyorhinis: Combinatorial expression of distinct size variant lipoproteins generating high-frequency surface antigenic variation. J Bacteriol 173:4782-4793. 19. Citti C, Kim M F, Wise K S: 1997, Elongated versions of VLP surface lipoproteins protect Mycoplasma hyorhinis escape variants from growth-inhibiting host antibodies. Infect Immun 65:1773-1785. 20. Gong M, Meng L, Beihai J, et al.: 2008, p37 from Mycoplasma hyorhinis promotes cancer cell invasiveness and metastasis through activation of MMP-2 and followed by phosphorylation of EGFR. Mol Cancer Ther 7:530-537. 21. Teh H S, Ho M, Williams L D: 1988, Suppression of cytotoxic responses by a supernatant factor derived from Mycoplasma hyorhinis-infected mammalian cell lines. Infect Immun 56:197-203. 22. Zinocker S, Wang M-Y, Gaustad P, et al.: 2011, Mycoplasma contamination revisited: Mesenchymal stromal cells harboring Mycoplasma hyorhinis potently inhibit lymphocyte proliferation In Vitro. PLoS ONE 6:e16005. 23. Sippel K H, Robbins A H, Reutzel R, et al.: 2009, Structural insights into the extracytoplasmic thiamine-binding lipoprotein p37 of Mycoplasma hyorhinis. J Bacteriol 191:2585-2592. 24. Ketcham C M, Anai S, Reutzel R, et al.: 2005, p37 induces tumor invasiveness. Mol Cancer Ther 4:1031-1038. 25. Liu W, Fang L, Li M, et al.: 2012, Comparative genomics of Mycoplasma: Analysis of conserved essential genes and diversity of the pan-genome. PLoS ONE 7:e35698. 26. Stephen F, Altschul T L, Madden A A, et al.: 1997, Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25: 3389-3402. 27. Armstrong C H, Sands-Freeman L, Freeman M J: 1987, Serological, pathological, and cultural evaluations of swine infected experimentally with Mycoplasma flocculare. Can J Vet Res 51:185-188. 28. Nielsen E O, Lauritsen K T, Friis N F, et al.: 2005, Use of a novel serum ELISA method and the tonsil-carrier state for evaluation of Mycoplasma hyosynoviae distributions in pig herds with or without clinical arthritis. Vet Microbiol 111:41-5