A METHOD FOR PRODUCING 1,3-PROPANEDIOL BY FERMENTATION OF A RECOMBINANT MICROORGANISM
20210123079 · 2021-04-29
Inventors
Cpc classification
C12Y102/01075
CHEMISTRY; METALLURGY
C12N9/0008
CHEMISTRY; METALLURGY
C12Y101/01202
CHEMISTRY; METALLURGY
C12Y602/01036
CHEMISTRY; METALLURGY
C12Y402/01116
CHEMISTRY; METALLURGY
C12Y101/01298
CHEMISTRY; METALLURGY
International classification
C12N9/00
CHEMISTRY; METALLURGY
Abstract
Provided is a method for producing 1,3-propanediol by means of fermentation of a recombinant microorganism. First, a recombinant microorganism is provided; the recombinant microorganism can overexpress acetyl-CoA carboxylase genes: accBC and accDA, a malonyl-CoA synthetase gene, mcr, a 3-hydroxypropionyl-CoA synthetase gene: pcs, a 3-hydroxypropionyl-CoA reductase gene: pduP, and a 1,3-propanediol reductase gene: yqhD. The recombinant microorganism is subjected to fermentation culture in a flask or ferment or using glucose ad as raw material to obtain the 1,3-propanediol. The recombinant microorganism can utilize low-cost glucose, sucrose, malasses, xylose and the like as raw material in the fermentation process, without additional expensive vitamin B12. Thus, cost of the production is significantly reduced, and there is a promising prospect in market.
Claims
1. A recombinant microorganism, characterized in that the recombinant microorganism is capable of overexpressing: (1) the acetyl-CoA carboxylase genes accBC and accDA; (2) the malonyl-CoA synthetase gene mcr; (3) the 3 -hydroxypropionyl-CoA synthetase gene pcs; (4) the 3-hydroxypropionyl-CoA reductase gene pduP; and (5) the 1,3-propanediol oxidoreductase gene yqhD.
2. The recombinant microorganism according to claim 1, characterized in that it is E. coli, Corynebacterium glutamicum, Bacillus subtilis, or Saccharomyces cerevisiae.
3. The recombinant microorganism according to claim 1, characterized in that the nucleotide sequences of the accBC and accDA are set forth in SEQ ID NOs: 1-2.
4. The recombinant microorganism according to claim 1, characterized in that the nucleotide sequence of the malonyl-CoA synthetase gene mcr is set forth in SEQ ID NO: 3.
5. The recombinant microorganism according to claim 1, characterized in that the nucleotide sequence of the 3-hydroxypropionyl-CoA synthetase gene pcs is set forth in SEQ ID NO: 4.
6. The recombinant microorganism according to claim 1, characterized in that the nucleotide sequence of the 3-hydroxypropionyl-CoA reductase gene pduP is set forth in SEQ ID NO: 5.
7. The recombinant microorganism according to claim 1, characterized in that the nucleotide sequence of the 1,3-propanediol oxidoreductase gene yqhD is set forth in SEQ ID NO: 6.
8. Use of the recombinant microorganism according to claim 17 in the production of 1,3-propanediol by fermentation with a carbohydrate.
9. A method of producing 1,3-propanediol by using the recombinant microorganism according to claim 1, characterized in that it comprises steps of: (1) constructing a recombinant microorganism capable of overexpressing the acetyl-CoA carboxylase genes accBC and accDA, the malonyl-CoA synthetase gene mcr, the 3-hydroxypropionyl-CoA synthetase gene pcs, the 3-hydroxypropionyl-CoA reductase gene pduP and the 1,3-propanediol oxidoreductase gene yqhD; and (2) conducting an aerobic fermentation by using a raw material comprising a fermentable carbohydrate as substrate, without the need of adding coenzyme vitamin B12.
10. The method according to claim 9, characterized in that the raw material comprising a fermentable carbohydrate in the step (2) is molasses, sucrose, glucose, starch hydrolysate, corn syrup, xylose, mannose or glycerin; and conditions for fermentation are: 28° C. to 37° C., a pH value in a range from 5 to 8, and a dissolved oxygen value greater than 10%.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0036]
DETAILED DESCRIPTION OF THE INVENTION
[0037] The examples below are only used to illustrate the invention, but not intended to limit the scope of the invention. Without deviating the spirit and essence of the invention, any amendment and replacement with respect to the method, step or condition of the invention also fall within the scope of the invention.
[0038] Unless indicated otherwise, chemical reagents used in the examples are conventional commercially available, and techniques used in the examples are conventional to a person skilled in the art.
EXAMPLE 1
[0039] Construction of a recombinant plasmid for overexpressing the acetyl-CoA carboxylase genes accBC and accDA.
[0040] The gene accBC (the nucleotide sequence of which is set forth in SEQ ID NO: 1) of about 1.8 Kb was obtained by PCR amplification using the genome of Corynebacterium glutamicum ATCC 13032 as a template, with the primers accBC-F (tagcgcagtaaAAGGAGATATACCatgt cagtcgagactaggaaga) and accBC-R (CTGCAGGCGCGCCGAGCTCGttacttgatctcgaggagaaca acgcc) and purified.
[0041] The gene accDA (the nucleotide sequence of which is set forth in SEQ ID NO: 2) of about 1.5 kb was obtained by PCR amplification using the genome of Corynebacterium glutamicum ATCC 13032 as a template, with the primers accDA-F (GTTTAACTTTAATAAGGAGATA TACatggtgtggggcatggaac) and accDA-R (TATATCTCCTTttactgcgctaaacgctcaaatcg) and purified. The plasmid pACYCDuet (Novagen) was cleaved with Ncol and EcoRI; and the purified accBC and accDA fragments were one-step linked into the pACYCDuet by using the Gibson Assembly Kit (NEB), to obtain a recombinant plasmid designated as pACYC-accDABC.
EXAMPLE 2
[0042] Construction of a recombinant plasmid for overexpressing the malonyl-CoA synthetase gene mcr.
[0043] Based on the amino acid sequence of the malonyl-CoA synthetase from Chloroflexus aurantiacus, an optimized nucleic acid sequence of the gene was artificially designed (the gene sequence is set forth in SEQ ID NO: 3) and synthesized by the Qinglan Biotech. Inc. A mcr fragment of about 3.7kb was obtained by PCR using the gene fragment as a template with the primers mcr-F (GCGATCGCTGACGTCGGTACAAGGAGATATACATATGTCGGGC ACTG) and mcr-R (TTTACCAGACTCGAGGGTACTTAAACGGTGATTGCGCGTCC), and purified. The plasmid pACYC-accDABC prepared in the example 1 was cleaved with Kpnl, the mcr fragment was one-step linked to the pACYC-accDABC using the Gibson Assembly Kit (NEB), to obtain the recombinant plasmid pACYC-accDABC-mcr. After transforming the pACYC-accDABC-mcr into E. coli BL21 (DE3) by thermal transformation, a recombinant microorganism was selected in a LB plate containing chloramphenicol of 25 mg/L, which was designated as E. coli/pACYC-accDABC-mcr.
EXAMPLE 3
[0044] Construction of a recombinant plasmid for overexpressing the 3-hydroxypropionyl-CoA synthetase gene pcs, the 3-hydroxypropionyl-CoA reductase gene pduP, and the 1,3-propanediol oxidoreductase gene yqhD.
[0045] Based on the amino acid sequence of the 3-hydroxypropionyl-CoA synthetase from Metallosphaera sedula, an optimized nucleic acid sequence of the gene was artificially designed (the gene sequence is set forth in SEQ ID NO: 4) and synthesized by the Qinglan Biotech. Inc. A pcs fragment of about 2.0 kb was obtained by PCR using the gene fragment as a template, with the primers pcs-F (CTTTAAGAAGGAGATATACCaggaggaaacagaaccATG TTTATGCGC) and pcs-R (acgttaatggTTAGGAAGTCTTTAATTCCTTCTTCAGTTCTTCC AC) and purified. A pduP gene of about 1.5 kb (the nucleotide sequence of which is set forth in SEQ ID NO: 5) was obtained by PCR using the genome of Klebsiella pneumoniae DSM2026 as a template, with the primers pduP-F (GACTTCCTAAccattaacgtgagaa ctcatcaatgaatacag) and pduP-R (atATGTATATCTCCTTCTTAAAGTTttagcgaatggaaaaaccgtt ggt), and purified. A yqhD gene of about 1.2 kb (the nucleotide sequence of which is set forth in SEQ ID NO: 6) was obtained by PCR using the genome of E. coli W3110 as a template , with the primers yqhD-F (TAAGAAGGAGATATACATatgAACAACTTTAATCTGCACACC) and yqhD-R (CAAGCTTGTCGACGGAGCTCGCGGGCGGCTTCGTATATACG), and purified. The plasmid pET32a (Novagen) was cleaved with Ncol and EcoRI, and the pcs fragment, the pduP fragment and the yqhD fragment were one-step linked into the pET28a to obtain a recombinant plasmid designated as pET-pcs-pduP-yqhD. After transforming the pET-pcs-pduP-yqhD into the E coli/pACYC-accDABC-mcr obtained in the example 2 by thermal transformation, a recombinant microorganism was selected in a LB plate with Kanamycin at 25 mg/L and chloramphenicol at 25 mg/L, designated as E. coli/pACYC-accDABC-mcr/pET-pcs-pduP-yqhD.
EXAMPLE 4
[0046] Production of 1,3-propanediol by fermentation with the recombinant E. coli
[0047] After culturing the E. coli/pACYC-accDABC-mcr/pET-pcs-pduP-yqhD obtained in the example 3 in a LB plate with Kanamycin (25 mg/L) and chloramphenicol (25 mg/L) overnight, a single colony from this fresh plate was inoculated to a 250 ml flask with baffle containing 30 ml seed culture medium, and incubated for 16 h at 30° C. and 200 rpm.
[0048] The composition of the seed culture medium comprises (g/L): glucose of 20, yeast extract of 5.0, peptone of 10, NaCl of 5.0, chloramphenicol of 0.025, and kanamycin of 0.025.
[0049] The seed broth was inoculated to a 1000 ml flask with baffle containing 100 ml fermentation culture medium at an inoculation amount of 10%, and incubated at 30° C. and 200 rpm. IPTG (0.5 mM) was added 6 hours after fermentation for induction and the fermentation were conducted for another 48 h.
[0050] The composition of the fermentation culture medium comprises (g/L): glucose of 20, Na.sub.2HPO.sub.4.7H.sub.2O of 12.8, K.sub.2HPO.sub.4 of 3.0, MgSO.sub.4 of 0.5, NaCl of 0.5, NH.sub.4Cl of 0.5, yeast extract of 10, biotin of 0.001, thiamine hydrochloride of 0.001, chloramphenicol of 0.025, and Kanamycin of 0.025.
[0051] The E. coli/pACYC-accDABC-mcr/pET-pcs-pduP-yqhD obtained in the example 3 was detected at 24h after fermentation for the enzyme activities of the acetyl-CoA carboxylase, malonyl-CoA synthetase, 3 -hydroxypropionyl-CoA synthetase, 3 -hydroxypropionyl-CoA reductase and 1,3-propanediol oxidoreductase, which were 0.24 U/mg, 0.12 U/mg, 0.38 U/mg, 0.97 U/mg and 1.72 U/mg, respectively, indicating that each of the recombinant enzymes was expressed normally. Substantially no corresponding enzyme activities were detected in the control wildtype E coli BL21 (DE3).
[0052] At 48 h after the fermentation, the E coli/pACYC-accDABC-mcr/pET-pcs-pduP-yqhD obtained in the example 3 could produce 1,3-propanediol at 2.1 g/L, with a mass conversion rate of 0.105 g/g of glucose, showing that the constructed recombinant strain can convert glucose to 1,3-propanediol directly, without addition of the coenzyme B12. In the control experiment under the same conditions, both the wildtype E. coli BL21 (DE3) and the E. coli/pACYC-accDABC-mcr obtained in the example 2 could not produce 1,3-propanediol.
[0053] Although the general description and the embodiments above have described the invention in detail, it is apparent for a person skilled in the art to make modification or alteration to them based on the disclosure of the invention. Thus, such modification and alteration without departure of the spirit of the invention fall within the scope of the invention.