COMPOUNDS FOR THE TREATMENT OF ACUTE BRAIN INJURY
20210122700 · 2021-04-29
Inventors
- Anders Bue Klein (Søborg, DK)
- Andrew Neil Clarkson (Dunedin, NZ)
- Joshua Macdonald Houlton (Dunedin, NZ)
- Ulrike Leurs (Copenhagen, DK)
- Rasmus Prætorius Clausen (København S, DK)
- Bente Frølund (Charlottenlund, DK)
- Petrine Wellendorph (Kgs. Lyngby, DK)
Cpc classification
C07C201/00
CHEMISTRY; METALLURGY
C07C69/757
CHEMISTRY; METALLURGY
C07C235/40
CHEMISTRY; METALLURGY
A61K31/167
HUMAN NECESSITIES
C07C2602/32
CHEMISTRY; METALLURGY
C07C59/54
CHEMISTRY; METALLURGY
C07C323/62
CHEMISTRY; METALLURGY
A61K31/235
HUMAN NECESSITIES
A61K31/192
HUMAN NECESSITIES
International classification
C07C69/757
CHEMISTRY; METALLURGY
C07C59/54
CHEMISTRY; METALLURGY
Abstract
The invention relates to a compound according to formula I wherein when R.sub.5 is H, and R.sub.1 and R.sub.2 form a ring system, then said compound is selected from the following compounds of formula II or formula IV or when R.sub.2 is H, and R.sub.1 and R.sub.5 form a ring system, then said compound has formula III
##STR00001##
Claims
1. A compound according to formula I ##STR00063## wherein when R.sub.5 is H, and R.sub.1 and R.sub.2 form a ring system, then said compound is selected from the following compounds of formula II or formula IV ##STR00064## wherein n is 0 or 1; X is selected from O or NH Y is NH, O, S, CH.sub.2 R.sub.3 is selected from H, linear or branched C.sub.1-C.sub.6 including -Me, -Et, —Pr, -iPr, -Bu, -tBu, -iBu, pentyl, neopentyl, hexyl; -benzyl, polyethylenglycolyl (PEG), or a group such as ##STR00065## wherein R.sub.9 and R.sub.10 independently of each other are selected from linear or branched C.sub.1-C.sub.6 including -Me, -Et, —Pr, -iPr, -Bu, -iBu, -tBu, pentyl, neopentyl, hexyl; notably R.sub.10 is selected from H, -Me, -Et, -iPr; R.sub.4 is selected from H, —C(═O)—C.sub.1-C.sub.6-alkyl including —C(═O)-Me, —C(═O)-Et, —C(═O)—Pr, —C(═O)-iPr, —C(═O)—Bu, —C(═O)-tBu; —C(═O)-benzyl, polyethylenglycolyl (PEG), or a groups such as ##STR00066## wherein R.sub.11 and R.sub.12 independently of each other are selected from linear or branched C.sub.1-C.sub.6 including -Me, -Et, —Pr, -iPr, -Bu, -iBu, -tBu, pentyl, neopentyl, hexyl; notably R.sub.12 is selected from H, -Me, -Et, -iPr; R.sub.6, and R.sub.7 are independently from each other selected from H, F, Cl, Br, I, aryl, straight or branched C.sub.1_8 alkyl, —CH.sub.2(CH.sub.2).sub.p-aryl, —CH═CH-aryl, NH.sub.2, NO.sub.2, OH, SH, straight or branched —O—C.sub.1-8 alkyl, straight or branched —S—C.sub.1-8 alkyl, straight or branched —NH—C.sub.1-8 alkyl, —O-aryl, —S-aryl, —NH-aryl, wherein aryl includes aryl having one or more heteroatoms selected from O, N or S, and wherein p is 0 or 1; or when R.sub.2 is H, and R.sub.1 and R.sub.5 form a ring system, then said compound has formula III ##STR00067## wherein n is 0 or 1; X is O or NH m is 0 or 1; R.sub.3 is selected from H, linear or branched C.sub.1-C.sub.6-alkyl including -Me, -Et, —Pr, -iPr, -Bu, -tBu, -iBu, pentyl, isopentyl, hexyl; -benzyl, polyethylenglycolyl (PEG), or a group such as ##STR00068## wherein R.sub.9 and R.sub.10 independently of each other are selected from linear or branched C.sub.1-C.sub.6 including -Me, -Et, —Pr, -iPr, -Bu, -iBu, -tBu, pentyl, neopentyl, hexyl; notably R.sub.10 is selected from H, -Me, -Et, -iPr; R.sub.4 is selected from H, —C(═O)—C.sub.1-C.sub.6-alkyl including —C(═O)-Me, —C(═O)-Et, —C(═O)—Pr, —C(═O)-iPr, —C(═O)—Bu, —C(═O)-tBu; —C(═O)-benzyl, polyethylenglycolyl (PEG), or a groups such as ##STR00069## wherein R.sub.11 and R.sub.12 independently of each other are selected from linear or branched C.sub.1-C.sub.6 including -Me, -Et, —Pr, -iPr, -Bu, -iBu, -tBu, pentyl, neopentyl, hexyl; R.sub.12 is selected from H, -Me, -Et, -iPr; R.sub.13, and R.sub.14 are independently from each other selected from H, F, Cl, Br, I, aryl, straight or branched C.sub.1-8 alkyl, —CH.sub.2(CH.sub.2).sub.p-aryl, —CH═CH-aryl, NH.sub.2, NO.sub.2, OH, SH, straight or branched —O—C.sub.1-8 alkyl, straight or branched —S—C.sub.1-8 alkyl, straight or branched —NH—C.sub.1-8 alkyl, —O-aryl, —S-aryl, —NH-aryl, wherein aryl includes aryl having one or more heteroatoms selected from O, N or S, and wherein p is 0 or 1; or a pharmaceutically acceptable salt thereof; with the proviso that the compound is not one of the following: ##STR00070## wherein R′ is COOH, R″ is H and R″ is OCH.sub.3, or wherein R′ is COOH, R″ is CH.sub.3 and R′″ is OH.
2. A compound according to claim 1 having formula III.
3. A compound according to claim 1 having formula II.
4. A compound according to claim 1 having formula IV.
5. A compound according to claim 1 having formula II or III, and wherein n is 0.
6. A compound according to claim 1 having formula IV, and wherein n is 1
7. A compound according to any of the preceding claims, wherein one of R.sub.3 and R.sub.4 is H.
8. A compound according to any of the preceding claims, wherein both R.sub.3 and R.sub.4 are H.
9. A compound according to any one of claims 1, 2, 5, 7-8 having formula III, wherein one or R.sub.13 and R.sub.14 is H and the other is in position 1 or 2
10. A compound according to any one of claims 1, 2, 5, 7-9 having formula III, wherein one of R.sub.13 and R.sub.14 is H and the other is selected from H, F, Cl, Br, I, aryl, straight or branched C.sub.1-8 alkyl, —CH.sub.2(CH.sub.2).sub.p-aryl, or —CH═CH-aryl.
11. A compound according to any one of claims 1, 2, 5, 7-10 having formula III, wherein one of R.sub.13 and R.sub.14 is H and the other is selected from H, F, Cl, Br, I, Ph, or —CH═CH-aryl.
12. A compound according to any one of claims 1, 2, 5, 7-11 having formula III, wherein one of R.sub.13 and R.sub.14 is H and the other is selected from H, F, Cl, Br, I, Ph, or —CH═CH-phenyl.
13. A compound according to any one of claims 1-7, 9-12, wherein R.sub.3 is selected from ##STR00071## or R.sub.4 is selected from ##STR00072##
14. A compound according to any one of claims 1-7, 9-13, wherein R.sub.3 is ##STR00073##
15. A compound according to any of claims 1, 3, 5, 7, 13-14 having formula II, wherein R.sub.4 is H and R.sub.3 is ##STR00074##
16. A compound according to any one of claims 1, 2, 3, 7 having formula III, wherein n=0, R.sub.3 is H, X is O, R.sub.4 is H and R.sub.13 is selected from H, halogen, phenyl, methyl and R.sub.13 is either in position 1 or in position 2, and R.sub.14 is H.
17. A compound according to any one of claims 1, 2, 3, 7 having formula III, wherein n=0, R.sub.3 is selected from H, -Me, -Et, —Pr, -iPr, -Bu, -tBu and Ph; X is O, R.sub.4 is H and R.sub.13 is selected from H, halogen, phenyl, methyl and R.sub.13 is either in position 1 or in position 2, and R.sub.14 is H.
18. A compound according to any of the preceding claims, wherein X is O.
19. A compound according to any one of claims 1, 3, 5, 7-8, 13-15 having formula II, wherein X is NH.
20. A compound according to claim 1 having one of the following structures: TABLE-US-00003 Compound No. Structure 1
21. A compound according to any of the preceding claims for use in medicine.
22. A compound according to any of the preceding claims for use in the treatment of acute brain injury.
23. A method for treating a subject suffering from acute brain injury, the treatment comprises administering to said subject an effective amount of a compound as defined in any of claims 1-20.
24. A compound for use in the treatment of acute brain injury, wherein the compound has formula I (formula I) wherein when R.sub.5 is H, and R.sub.1 and R.sub.2 form a ring system, then said compound is selected from the following compounds of formula II or formula IV (formula II), or (formula IV) wherein n is 0 or 1; X is selected from 0 or NH Y is NH, O, S, CH.sub.2 R.sub.3 is selected from H, linear or branched C.sub.1-C.sub.6 including -Me, -Et, —Pr, -iPr, -Bu, -tBu, -iBu, pentyl, neopentyl, hexyl; -benzyl, polyethylenglycolyl (PEG), or a group such as or, wherein R.sub.9 and R.sub.10 independently of each other are selected from linear or branched C.sub.1-C.sub.6 including -Me, -Et, —Pr, -iPr, -Bu, -iBu, -tBu, pentyl, neopentyl, hexyl; notably R.sub.10 is selected from H, -Me, -Et, -iPr; R.sub.4 is selected from H, —C(═O)—C.sub.1-C.sub.6-alkyl including —C(═O)-Me, —C(═O)-Et, —C(═O)—Pr, —C(═O)-iPr, —C(═O)—Bu, —C(═O)-tBu; —C(═O)-benzyl, polyethylenglycolyl (PEG), or a groups such as or, wherein R.sub.11 and R.sub.12 independently of each other are selected from linear or branched C.sub.1-C.sub.6 including -Me, -Et, —Pr, -iPr, -Bu, -iBu, -tBu, pentyl, neopentyl, hexyl; notably R.sub.12 is selected from H, -Me, -Et, -iPr; R.sub.6, and R.sub.7 are independently from each other selected from H, F, Cl, Br, I, aryl, straight or branched C.sub.1-8 alkyl, —CH.sub.2(CH.sub.2).sub.p-aryl, —CH═CH-aryl, NH.sub.2, NO.sub.2, OH, SH, straight or branched —O—C.sub.1-8 alkyl, straight or branched —S—C.sub.1-8 alkyl, straight or branched —NH—C.sub.1-8 alkyl, —O-aryl, —S-aryl, —NH-aryl, wherein aryl includes aryl having one or more heteroatoms selected from O, N or S, and wherein p is 0 or 1; or when R.sub.2 is H, and R.sub.1 and R.sub.5 form a ring system, then said compound has formula III (formula III) wherein n is 0 or 1; X is O or NH m is 0 or 1; R.sub.3 is selected from H, linear or branched C.sub.1-C.sub.6-alkyl including -Me, -Et, —Pr, -iPr, -Bu, -tBu, -iBu, pentyl, isopentyl, hexyl; -benzyl, polyethylenglycolyl (PEG), or a group such as or, wherein R.sub.9 and R.sub.10 independently of each other are selected from linear or branched C.sub.1-C.sub.6 including -Me, -Et, —Pr, -iPr, -Bu, -iBu, -tBu, pentyl, neopentyl, hexyl; notably R.sub.10 is selected from H, -Me, -Et, -iPr; R.sub.4 is selected from H, —O(═O)—C.sub.1-C.sub.6-alkyl including —C(═O)-Me, —C(═O)-Et, —C(═O)—Pr, —C(═O)-iPr, —C(═O)—Bu, —C(═O)-tBu; —C(═O)-benzyl, polyethylenglycolyl (PEG), or a groups such as or, wherein R.sub.11 and R.sub.12 independently of each other are selected from linear or branched C.sub.1-C.sub.6 including -Me, -Et, —Pr, -iPr, -Bu, -iBu, -tBu, pentyl, neopentyl, hexyl; R.sub.12 is selected from H, -Me, -Et, -iPr; R.sub.13, and R.sub.14 are independently from each other selected from H, F, Cl, Br, I, aryl, straight or branched C.sub.1-8 alkyl, —CH.sub.2(CH.sub.2).sub.p-aryl, —CH═CH-aryl, NH.sub.2, NO.sub.2, OH, SH, straight or branched —O—C.sub.1-8 alkyl, straight or branched —S—C.sub.1-8 alkyl, straight or branched —NH—C.sub.1-8 alkyl, —O-aryl, —S-aryl, —NH-aryl, wherein aryl includes aryl having one or more heteroatoms selected from O, N or S, and wherein p is 0 or 1; or a pharmaceutically acceptable salt thereof.
25. A compound for use according to claim 24 having formula III.
26. A compound for use according to claim 24 having formula II.
27. A compound for use according to claim 24 having formula IV.
28. A compound for use according to claim 24 having formula II or III, and wherein n is 0.
29. A compound for use according to claim 24 having formula IV, and wherein n is 1
30. A compound for use according to any one of claims 24-29, wherein one of R.sub.3 and R.sub.4 is H.
31. A compound for use according to any one of claims 24-30, wherein both R.sub.3 and R.sub.4 are H.
32. A compound for use according to any one of claims 24-25, 28, 30-31 having formula III, wherein R.sub.13 is H and R.sub.14 is in position 1 or 2.
33. A compound for use according to any one of claims 24-25, 28, 30-32 having formula III, wherein one of R.sub.13 and R.sub.14 is H and the other is selected from H, F, Cl, Br, I, aryl, straight or branched C.sub.1-8 alkyl, —CH.sub.2(CH.sub.2).sub.p-aryl, or —CH═CH-aryl.
34. A compound for use according to any one of claims 24-25, 28, 30-33 having formula III, wherein one of R.sub.13 and R.sub.14 is H and the other is selected from H, F, Cl, Br, I, Ph, or —CH═CH-aryl.
35. A compound for use according to any one of claims 24-25, 28, 30-34 having formula III, wherein one of R.sub.13 and R.sub.14 is H and the other is selected from H, F, Cl, Br, I, Ph, or —CH═CH-phenyl.
36. A compound for use according to any one of claims 24-30, 32-35, wherein R.sub.3 is selected from ##STR00089## or R.sub.4 is selected from ##STR00090##
37. A compound for use according to any one of claims 24-30, 32-36, wherein R.sub.3 is ##STR00091##
38. A compound for use according to any of claims 24, 26, 28, 30, 36-37 having formula II, wherein R.sub.4 is H and R.sub.3 is ##STR00092##
39. A compound for use according to any one of claims 24-26, 30 having formula III, wherein n=0, R.sub.3 is H, X is O, R.sub.4 is H and R.sub.13 is selected from H, halogen, phenyl, methyl and R.sub.13 is either in position 1 or in position 2, and R.sub.14 is H.
40. A compound for use according to any one of claims 24-26, 30 having formula III, wherein n=0, R.sub.3 is selected from H, -Me, -Et, —Pr, -iPr, -Bu, -tBu and Ph; X is O, R.sub.4 is H and R.sub.13 is selected from H, halogen, phenyl, methyl and R.sub.13 is either in position 1 or in position 2, and R.sub.14 is H.
41. A compound for use according to any of the preceding claims, wherein X is O.
19. A compound for use according to any one of claims 24, 26, 28-30, 36-38 having formula II, wherein X is NH.
20. A compound for use according to claim 24, wherein the compound has one of the following structures: TABLE-US-00004 Compound No. Structure 1
Description
FIGURE LEGENDS
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
EXAMPLES
[0107] Materials and Methods
[0108] Rat Brain Membrane Binding Assays
[0109] Compounds were evaluated in the .sup.3H-A, .sup.3H-B, or .sup.3H-GABA binding assays (for GABA.sub.B) according to previously published protocols using crude synaptic membranes prepared from rat cortex (Wellendorph et al., 2005 and Klein et al., 2016). For .sup.3H-A and .sup.3H-B binding, membranes were incubated with increasing concentrations of test compound or 1-10 mM GHB for non-specific binding in a 50 mM potassium phosphate buffer (pH 6.0 or pH 7.4) for 1 hr at 0-4° C. in 96-well ligand plates. Following incubation by rapid filtration through GF/C unifilters (PerkinElmer, Boston, Mass., USA), using a 96-well Packard cell-harvester (PerkinElmer) and three fast washes with ice-cold binding buffer, microscint scintillation fluid (PerkinElmer) was added to the dried filters, and the amount of filter-bound radioactivity was quantified in a Packard TopCount microplate scintillation counter (PerkinElmer). For GABA.sub.B receptor binding assays, membranes were incubated with increasing concentrations of test compound or 100 μM baclofen (Sigma) for non-specific binding in a 50 mM Tris-HCl buffer (pH 7.4) containing 2.5 mM CaCl.sub.2) and 40 μM isoguvacine (Sigma) for 1 hr at room temperature in 48-well setup. The binding reactions were terminated by rapid filtration through GF/C filters (Whatman), soaked in 0.1% polyethylene imine, using a Brandell 48-well harvester and rapid washing with ice-cold binding buffer. The dried filters were added Optifluor scintillation liquid (PerkinElmer) and counts determined on a Tricarb 4910 TR Scintillation counter (PerkinElmer). Data are presented as % specific binding (of control), and IC.sub.50 or K.sub.i values calculated by means of non-linear regression curve-fitting and the Cheng-Prusoff equation, respectively.
[0110] Temperature Recording
[0111] Mice were pre-treated with saline injections (0.9% saline) i.p. for 4 days prior to the experiment to minimize stress on the day of the experiment. Experiments were conducted in a quiet room, in which mice were left undisturbed for at least two hrs prior to the experiment. After the i.p. injections, mice were left in their home cages for two hrs, had core body temperature recorded, and were then euthanized. The core body temperature was measured rectally by a thermometer (model DM 852; ELLAB Instruments; Copenhagen, Denmark) via a lubricated thermistor probe (model PRA-22002-A, 2.2 mm diameter; ELLAB Instruments). Mice were held at the base of the tail and measured until a stable temperature measurement was obtained.
[0112] Glucose Metabolism Studies
[0113] Regional cerebral metabolism rate of glucose (rCMRglc) was measured in conscious free-moving GABA.sub.B(1) receptor knock-out mice (Kaupmann et al., 2003) using a semiquantitative index of rCMRglc (irCMRglc) which avoids the need to perform blood sampling throughout the experiment. 10 min following GBL (200 mg/kg) or saline i.p. injections, mice were injected i.p. with 5 μCi of .sup.14C-2-deoxyglucose (specific activity 54.1 mCi/mmol, Sigma, UK) dissolved in 0.4 ml saline. After 45 min, mice were euthanized by cervical dislocation and brains were snap-frozen and stored at −80° C. until sectioning. Coronal sections of 20 μm were collected at 2.68, 1.34, 0.74, -1.7, -3.08 and -5.68 mm corresponding to bregma, and were thaw-mounted onto glass slides (Fischer Scientific, Denmark). Autoradiographic images were produced by exposing sections to a .sup.14C-sensitive plate (Science Imaging Scandinavia AB, Nacka, Sweden) in cassettes for five days with .sup.14C-microscales (Amersham, UK). Finally, the imaging plate was scanned on a BAS-2500 scanner (Fujifilm Europe GmbH, Dusseldorf, Germany). Specific and non-specific binding in frontal cortex and hippocampus were calculated by measuring pixel density using ImageJ and converted to nCi using the calibration scale.
[0114] The photothrombotic mouse model of focal ischemia
[0115] All procedures were performed in accordance with the guidelines on the care and use of laboratory animals set out by the University of Otago, Animal Research Committee and the Guide for Care and Use of Laboratory Animals (NIH Publication No. 85-23, 1996). All in vivo studies were approved by the University of Otago Animal Ethics Committee and are reported according to the ARRIVE (Animal Research: Reporting In Vivo Experiments) guidelines. The photochemical cortical lesion model resembles situations of acute brain injury related clinically to stroke and traumatic brain injury (TBI). Focal ischemia was induced by photothrombosis in male C57BL/6J mice (8-10 weeks) weighing ˜23-30 g as previously described (Clarkson et al., 2010). Under anesthesia with isoflurane (2% to 2.5% in O.sub.2) mice were placed in a stereotactic apparatus, the skull exposed through a midline incision, cleared of connective tissue and dried. A cold light source (KL1500 LCD, Zeiss, Auckland, New Zealand) attached to a 40× objective providing a 2-mm diameter illumination was positioned 1.5 mm lateral from bregma. Then, 0.2 ml of Rose Bengal (Sigma-Aldrich, Auckland, New Zealand; 10 mg/ml in normal saline) was administered i.p. After 5 min, the brain was illuminated through the exposed intact skull for 15 min, while keeping body temperature at 37.0±0.3° C. degrees using a heating pad (Harvard apparatus, Holliston, Mass., USA). The skin was glued and animals left in a cage placed on a heating pad during the wake-up phase. Mice were housed under a 12-hr light/dark cycle with ad libitum access to food and water. Further, the mice were monitored and weighed on a daily basis.
[0116] Compound Sources and Preparation of Compounds for In Vivo Studies
[0117] The sodium salt of A was synthesized in-house as described previously (Vogensen et al., 2013). The sodium salt of GHB, the GHB prodrug γ-butyrolactone (GBL), NCS-382 (B), diclofenac and 4′-hydroxydiclofenac were purchased from Sigma-Aldrich, whereas C was obtained from Carbosynth or SantaCruz (Berkshire, UK). The CN21 peptide was obtained from Genscript.
[0118] For in vivo studies, all compounds were dissolved in a mixture of sterile saline and H.sub.2O to obtain isotonicity (0.9%) and administered as 10 mg/ml and 10 μl of solution per gram mouse body weight. The injection of compound (i.p.) was performed 30 min, 3, 6 or 12 hrs after induction of the photothrombotic stroke. The vehicle groups received a corresponding volume of saline (0.9%) at the same time points (30 min, 3, 6 or 12 hrs).
[0119] Behavioural assessment in the photothrombotic model of focal ischemia Forelimb motor performance was determined using the cylinder and grid-walking tasks as previously described (Clarkson et al., 2010). All animals were tested both in a pre- and post-testing session, 1 week before and 3 days or 7 days after the ischemic insult, respectively. Observers who scored the behaviour were blinded to the treatment groups.
[0120] The Permanent Middle Cerebral Artery Occlusion (pMCAO) Model of Focal Ischemia
[0121] The pMCAO study was performed using age-matched, young adult (7-8 weeks), male C57BL/6J mice (Taconic). Mice were housed in separate cages under diurnal lighting and given free access to food (1314 Altromin) and water. Mice were acclimatized for seven days prior to surgery in accordance with guidelines approved by the Danish Animal Ethical Committee.
[0122] Focal cerebral ischemia was made by permanent occlusion of the distal part of the left middle cerebral artery (MCA). Mice were anesthetized by injection of a mixture of Hypnorm (fentanyl citrate 0.315 mg/ml and fluanisone 10 mg/ml; Jansen-Cilag), Stesolid (5 mg/ml Diazepamum; Dumex) and distilled water (1:1:2; 0.20 ml/10 g body weight, s.c.). The mouse was placed on a 37±0.5° C. warm heating pad and a skin incision was made from eye to ear. The parotid gland and the upper part of the temporal muscle were pushed aside and a small hole was drilled over the distal part of the MCA. The MCA was occluded by electro-coagulation and the open incision was stitched with a 4.0 nylon-suture. After surgery, the mice were injected with 1 ml isotonic saline and their eyes were coated with ointment. The mice recovered from the surgery in a recovery room at 28° C. For treatment of post-surgical pain, mice were supplied s.c. with 0.15 ml Temgesic diluted 1:30 (stock: 0.3 mg/ml Buprenorphinum; Reckitt & Colman, UK) three times with an 8 hr interval starting immediately after surgery.
[0123] Behavioural Assessment in the pMCAO Model
[0124] To assess sensory-motor impairment, animals were tested in the rotarod, grip strength and Hargreaves tests 2-3 days post-stroke.
[0125] The rotarod (LE 8200, Panlab) measures motor performance in rodents by assessing the time during which the animal remains on a rotating rod. The rod rotation accelerates from 0 to 40 rounds per min (rpm) over a time period of 5 min 48 hrs post-stroke, mice were tested in four repeating trials with a 20 min interval (resting time). Prior to surgery, mice were pretrained to stay on the rod for 30 s at 4 rpm. The grip strength meter (BIO-GT-3, BIOSEB) allowed the study of neuromuscular functions in mice by determining the maximum force that is required to make the mouse release its grip. The mouse is allowed to grasp a metal grid and then pulled backwards in the horizontal plane. The force applied to the grid is recorded as the peak tension. Individual (right and left) and total (both) front paw grip strength was measured before (baseline) and 3 days after pMCAO. Each mouse was tested in five sequential trials and the highest grip strength was recorded as the score. Thermal hyperalgesia (hind paw withdrawal from a normally innocuous heat source) was tested with a Hargreaves test setup. The latency times of five stimuli per hindlimb with at least 2 min break in between were recorded. The lowest and highest reflex latency scores were discarded and the average for left and right was calculated and plotted.
[0126] Statistical Analyses for In Vivo Studies
[0127] All analyses were performed in GraphPad 6.0 (San Diego, Calif., USA). All data are presented as means+/−SEM. When comparing two groups, an unpaired t-test was used, and while comparing more than two groups, a one-way ANOVA with Holm-Sidak as post hoc test was performed. For the behavioural analyses, either two-way ANOVA with Bonferroni as post hoc test (photothrombotic ischemia data) or repeated-measures two-way ANOVA was used (pMCAO data).
[0128] Histological Assessment
[0129] For quantification of the infarcted area, animals were perfused with saline and then with 4% paraformaldehyde (PFA) and the brain dissected out and submerged in 4% PFA for post-fixing overnight. Then the brains were moved to 30% sucrose solution and kept at 4° C. until processing. Brains were cut in 30 μm sections, free-floating in anti-freeze media. Sections were mounted, stained for cresyl violet and the infarct volumes determined by measuring every 6th section through the entire infarct as described in Lie et al (2017). All analyses were performed by an observer blinded to the treatment groups. Brains from the pMCAO studies were flash-frozen in CO.sub.2 (gas) and processed into six parallel series of sections (30 μm). Separate series were collected on glass slides and used for infarct size analysis or in Eppendorf tubes and used for qPCR. The glass slides were stored at −80° C. until further processing, and then Cresyl-Violet stained and quantified as described for the photothrombotic photochemical method.
[0130] qPCR
[0131] Tissue from the peri-infarct area was collected and snap-frozen 12-72 hrs post stroke and RNA was extracted using a RNA mini kit (Qiagen) following the instructions from the manufacturer. Extracted RNA was treated with DNAse using Turbo DNA-free kit (Ambion), all according to the manufacturer's protocol. The reverse transcription was performed using gScript™ cDNA SuperMix (Quanta Biosciences, Gaithersburg, Md., USA) on a standard PCR machine (25° C. for 5 min, 42° C. for 30 min, 85° C. for 5 min) and cDNA stored at −20° C. until further processing.
[0132] qPCR was performed in 96-well plates (Agilent Technologies, Santa Clara, Calif., USA) mixing PerfeCTa SYBR Green FastMix (Quanta Biosciences), nuclease free water (Qiagen, West Sussex, UK), and primers (TAG Copenhagen A/S (Copenhagen, Denmark). The PCR was performed with an initial denaturation step of 95° C. for 30 s, followed by 40 cycles of 5 s at 95° C., 60° C. for 15 s and 72° C. for 10 s. To assure single-product amplification, a dissociation curve analysis was performed consisting of 60 s at 95° C., 30 s at 55° C. and 30 s at 95° C. The qPCR was performed using the Agilent Mx3005P qPCR system (Agilent Technologies), and the corresponding MxPro software was used to determine the Ct values. The ΔCt values were calculated using 2 (Reference Ct−Target Ct).
TABLE-US-00002 Primer sequences SEQ ID NO 1 CD14 (F) AATCTACCGACCATGGAGC SEQ ID NO 2 CD14 (R) ACTTTCCTCGTCTAGCTCG SEQ ID NO 3 IL-6 (F) CTCTGGGAAATCGTGGAAAT SEQ ID NO 4 IL-6 (R) CCAGTTTGGTAGCATCCATC SEQ ID NO 5 MMP9 (F) CAGCCGACTTTTGTGGTCTTC SEQ ID NO 6 MMP9 (R) CGGCCGTAGAGACTGCTTCTI SEQ ID NO 7 GFAP (F) GGAGATGCGGGATGGTGAG SEQ ID NO 8 GFAP (R) ACCACGTCCTTGTGCTCCTG SEQ ID NO 9 Rpl13a (F) GGAGGGGCAGGTTCTGGTAT SEQ ID NO 10 Rpl13a (R) TGTTGATGCCTTCACAGCGT SEQ ID NO 11 SDHA (F) GCCCATGCCAGGGAAGATTA SEQ ID NO 12 SDHA (R) TGTTCCCCAAACGGCTTCTT
[0133] Quantification of Cytokines in Plasma
[0134] Detection of MCP-1 (monocyte chemotactant protein-1), IL-6 (interleukin-6) and IL-1a (interleukin-1a) was performed using a LEGENDplex assay kit according to the manufacturers' instructions (BioPlex, BioLegend, San Diego, Calif., USA).
[0135] Photoaffinity Labelling and Enrichment of the GHB High-Affinity Binding Site from Rat Brain
[0136] Crude synaptic membranes were incubated at a concentration of 0.125 mg/ml with 600 nM 4-(4-((3-azido-5-(azidomethyl)benzyl)oxy)phenyl)-4-hydroxybutanoic acid (SBV3) for 60 min at 4° C. in the dark. For the competition experiments, 0.1 nM-10 μM compound C was added. Membranes were then transferred on to non-tissue culture treated polystyrene plates and irradiated for 4 min at room temperature using a UVP Benchtop transilluminator set to high intensity (302 nm, 8 W, M-20V). Excess SBV3 was subsequently washed away with 1×PBS and centrifugation. For Staudinger Bertozzi ligation, the membranes were resuspended to a concentration of 0.5 mg/ml in 1×PBS and solubilized with 0.1% SDS and 1 mM EDTA for 15 min at 37° C. EZ-Link™ Phosphine-PEG.sub.3-Biotin (ThermoFisher Scientific) was added to a final concentration of 200 μM and the reaction was shaken for 60 min at 37° C. Prior to streptavidin affinity enrichment, excess EZ-Link™ Phosphine-PEG3-Biotin was removed using PD MiniTrap G25 spin columns (GE Healthcare, Pittsburgh, Pa., USA).
[0137] Biotinylated proteins were enriched using Pierce™ High Capacity Streptavidin Agarose (ThermoFisher Scientific). The solubilized membranes were diluted to a final concentration of 0.01% SDS and incubated with the resin under rotation for 30 min at room temperature. Enrichment was followed by a rigorous washing procedure (3×1 min with 10 CV 1×PBS, 0.01% Tween and 3×10 min with 10 CV 1×PBS, 0.01% Tween). Biotinylated proteins were eluted by boiling in 1×NuPAGE™ LDS sample buffer (ThermoFisher Scientific) supplemented with 100 μM DTT at 100° C. for 10 min under vigorous shaking. Eluates were loaded onto NuPAGE™ 4-12% Bis-Tris gels (ThermoFisher Scientific) and run for 50 min at 175 V. Gels were stained with GelCode™ Blue Stain (ThermoFisher Scientific) according to the manufacturer's instructions. Gel sections between the 70 kDa and 25 kDa marker (PageRuler™ Prestained Protein Ladder, 10 to 180 kDa, ThermoFisher Scientific) were cut out and diced into 1×1 mm cubes. In-gel digestions were carried out using 70 ng/band endoproteinase Lys-C(Sigma-Aldrich) over night at 37° C. and 175 ng/band trypsin (Sigma-Aldrich) for 8 h at 37° C. Peptide extracts were loaded onto in-house packed C18 STAGE Tips and eluted into a 96-well microtiter plate with 2×20 μl 40% acetonitrile, 0.5% acetic acid in water, followed by removal of organic solvents in a vacuum centrifuge and reconstitution of peptides in 2% acetonitrile, 0.5% acetic acid, 0.1% TFA in water.
[0138] Mass Spectrometry
[0139] All samples were analyzed on an Easy-nLC 1000 coupled to a Q-Exactive HF instrument (ThermoFisher Scientific) equipped with a nanoelectrospray source. Peptides were separated on a 15 cm analytical column (75 μm inner diameter) in-house packed with 1.9 μm C18 beads (Dr. Maisch, Germany). The column temperature was maintained at 40° C. using an integrated column oven (PRSO-V1, Sonation GmbH, Biberach, Germany). Peptides were separated by a linear gradient of increasing acetonitrile in 0.5% acetic acid for 35 min with a flow rate of 250 nl/min. The Q-Exactive HF mass spectrometer was operated in data-dependent acquisition mode. Spray voltage was set to 2 kV, S-lens RF level at 50, and heated capillary temperature at 275° C. All experiments were performed in the data-dependent acquisition mode to automatically isolate and fragment Top10 multiply-charged precursors according to their intensities. Former target ions were dynamically for 40 s excluded and all experiments were acquired using positive polarity mode. Full scan resolution was set to 60.000 at m/z 200 and the mass range was set to m/z 350-1400. Full scan ion target value was 3E6 allowing a maximum fill time of 100 ms. Higher-energy collisional dissociation (HCD) fragment scans was acquired with optimal setting for parallel acquisition using 1.3 m/z isolation width and normalized collision energy of 28. Target value for HCD fragment scans was set to 1e5 with a maximum fill time of 45 ms and analyzed with 60.000 resolution.
[0140] Raw LC-MS/MS data was processed using the MaxQuant software (v. 1.5.5.1) and searched against the rat and mouse UniProt databases (downloaded 13 Mar. 2017). In addition, the default contaminant protein database was included and any hits to this were excluded from further analysis. Carbamidomethylation of cysteine was specified as a fixed modification; phosphorylation of serine, threonine and tyrosine residues, oxidation of methionine, pyro-glutamate formation from glutamine and protein N-terminal acetylation were set as variable modifications.
[0141] Further data analysis was performed using Perseus (v. 1.5.6.0, Max-Planck Institute of Biochemistry, Department of Proteomics and Signal Transduction, Munich), Microsoft Office Exel and GraphPad Prism (v. 7.0). After database searching using MaxQuant, the proteingroups.txt file was processed using Perseus: Hits only identified by site or from the reverse database were excluded. Data were then exported to GraphPad Prism and non-linear regression was performed for all proteins using the “One site-Fit log IC.sub.50” function. Best-fit values for Top and the R.sup.2 values were plotted against each other to identify proteins with competitive dose-dependence behaviour.
[0142] .sup.3H-A Binding to Recombinant CAMK2 Expressed in HEK293T Cells
[0143] HEK293T were cultured using standard conditions, using Dulbecco's modified Eagle Medium with GlutaMax, 10% fetal bovine serum and 1% penicillin-streptomycin, and incubated at 37° C. in a humidified atmosphere of 95% O.sub.2 and 5% CO.sub.2. Cells were transfected with rat CAMK2A (Origene construct RR201121) or rat CAMK2B (Origene construct RR200520) using PolyFect (Qiagen, West Sussex, UK) according to the manufacturer's protocol. Whole cell homogenates were prepared 48 hr post-transfection by washing the cells with ice-cold 1×PBS and harvesting by scraping. Cells were collected and centrifuged for 10 min at 1000×g. Cell pellets were resuspended in ice-cold 1×PBS and homogenized using 2×1 mm zirkonium beads in a bullet blender for 20 s at max speed (NextAdvance, N.Y., USA). Homogenates were cleared by centrifugation (10 min, 4° C., 14.000×g). Protein concentration was determined using the Bradford protein assay. 150-200 μg protein was incubated with 5 nM .sup.3H-A and test compound in 1 ml total volume for 1 hr at 0-4° C. Nonspecific binding was determined with 1-10 mM GHB. Proteins were then precipitated by addition of ice-cold acetone (4× of the assay volume), vortexing and incubation at −20° C. for 1 hr. Proteins were filtrated rapidly through GF/C unifilters (Whatman) and washed. The dried filters were added scintillation liquid and radioactivity measured on a Tricarb 2100 Scintillation counter (Packard).
[0144] MCT-Mediated Uptake of GHB Analogues in tsA201 Cells
[0145] Uptake was measured using the cell-permeable pH-sensitive dye 2′,7′-Bis(2-carboxyethyl)-5(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) (Molecular Probes), utilizing the endogenous expression of MCTs in tsA201 cells. The day before the assay, cells were plated (50,000 cells/well) in black poly-D-lysin-coated 96-well plates with clear bottom (VWR, Radnor, Pa., USA). On the day of assay, media was removed and cells loaded by addition of 50 μl BCECF AM/well (1.6 μM) in buffer (HBSS supplemented with 20 mM HEPES, 1 mM CaCl.sub.2, 1 mM MgCl.sub.2, and 1.8 mM probenecid, pH 7.4) and incubated for 45 min at 37° C., shielded from light. Cells were then washed twice with 100 μl buffer and the cell plate assayed at 37° C. in a FlexStation 3 reader (Molecular Devices). After ligand addition, the emitted fluorescence was recorded for 2 min at 538 nm after excitation of 485/444 nm. The fluorescence 485/444 nm was converted to intracellular pH by a nigericin calibration curve.
[0146] pThr286 Autophosphorylation in Dissected Mouse Tissues
[0147] Along with the standard protocol for photothrombotic focal ischemia, mice were treated with either saline or 175 mg/kg A (i.p.) 30 min after the injury. Three hours after the injury, mice were sacrificed, brains were dissected out and immediately submerged in ice-cold PBS supplemented with 1% phosphatase and protease inhibitors (Phosphatase inhibitor cocktail 3 #P0044 (Sigma), Phosphatase inhibitor cocktail 2 #P5726 (Sigma) and complete EDTA protease inhibitors (Roche) for 5 min. Cortex tissue from the infarct core region (i.e. 1.5 mm right of bregma including the primary motor cortex with a diameter of 2 mm) was dissected and snap-frozen on dry ice. Tissue homogenization was performed using 1×RIPA buffer supplemented with phosphatase and protease inhibitors and a Bullet Blender. Autophosphorylation was assessed by Western blot analysis, comparing the total level of CAMK2A (quantified using anti-CAMK2A, #NB100-1983, Novus Biologicals) to the level of phosphorylated CAMK2A (pThr286: #12716S, Cell Signalling Technology; goat anti-rabbit HRP: #PI-1000 X0126, Vector). Levels of pThr286 CAMK2A and CaMK2A were normalized to signals of a reference protein (anti-GAPDH, #NB300-221, Novus Biologicals). Subsequently, the ratio of the normalized signal of pThr286 CAMK2A and total CAMK2A expression was taken to detect changes in autophosphorylation. Digital images of bands were obtained with a cooled CCD-camera (FluorChem HD2 system, ProteinSimple) and densiometric analysis was performed with ImageStudioLite (LI-COR Biosciences).
[0148] Chemical Synthesis
[0149] Unless otherwise indicated, all reagents used in the examples below are obtained from commercial sources.
[0150] General Chemistry Methods
[0151] The compounds of the general formula IIIa may be prepared as given below from the appropriate substituted 6,7,8,9-tetrahydro-5H-benzo[7]annulen-5-on according to the procedures in Examples 1-3.
##STR00034##
[0152] The compounds of the general formula IVa may be prepared as given below from ethyl 2-(2-iodo-5-methoxyphenyl)acetate and an appropriate substituted aniline, phenol or thiophenol (X=N, O or S) catalyzed by copper in the presence of an inorganic base.
[0153] The X=CH.sub.2 may be prepared from ethyl 2-(2-iodo-5-methoxyphenyl)acetate using an appropriate substituted benzylhalide by a palladium catalyzed cross-coupling reaction. The protection groups may be cleaved by BBr.sub.3.
##STR00035##
Example 1
Synthesis of (E)-2-(2-bromo-5-hydroxy-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (1)
[0154] Step 1: To a solution of NaOH (368 mg, 9.1 mmol) in H.sub.2O (4.6 ml) and ethanol (10 ml) was added a mixture of 2-bromo-6,7,8,9-tetrahydro-5H-benzo[7]annulen-5-one (Murineddu et al., 2005) (400 mg, 1.6 mmol) and glyoxylic acid monohydrate (495 mg, 6.6 mmol) in water (10 ml) at room temperature. The mixture was stirred at room temperature until dissolution and then heated at reflux for 4 hr. After cooling, EtOH was removed in vacuo and the residual aqueous solution was washed with Et.sub.2O (2×15 ml) and the pH was adjusted to 1 with HCl and extracted with EtOAc (2×20 ml). The combined organic phases were dried over MgSO.sub.4, filtered and evaporated. The residue was purified by column chromatography (DCM/MeOH 9.5:0.5+1% of AcOH) to give 369 mg, (75%) of (E)-2-(2-bromo-5-oxo-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid as a brown solid.
[0155] Step 2: Under a nitrogen atmosphere, CeCl.sub.3 7H.sub.2O (231 mg, 0.6 mmol) and (E)-2-(2-bromo-5-oxo-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (183 mg, 0.6 mmol) were dissolved in MeOH (30 ml). NaBH.sub.4 (351 mg, 9.3 mmol) was slowly added to the solution at 0° C. The reaction was stirred at room temperature for 4 hr and then solvent was evaporated in vacuo. H.sub.2O (50 ml) was added to the residue and the pH was adjusted to 1 with HCl. The aqueous phase was extracted with DCM (3×30 ml), the combined organic phases were dried over MgSO.sub.4, filtered and evaporated in vacuo. Purification by column chromatography (DCM+1% of AcOH) afforded (E)-2-(2-bromo-5-hydroxy-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (120 mg, 65%) as a white solid. .sup.1H NMR (600 MHz, Methanol-d.sub.4), δ: 7.39-7.36 (d, J=8.2 Hz, 1H), 7.35-7.32 (dd, J=8.2, 2.1 Hz, 1H), 7.26-7.25 (d, J=2.0 Hz, 1H), 6.00 (s, 1H), 5.25 (s, 1H), 3.50-3.45 (ddd, J=11.9, 6.9, 4.3 Hz, 1H), 3.07-3.00 (m, J=14.2, 9.1, 2.6 Hz, 1H), 2.81-2.71 (m, J=27.5, 13.1, 9.2, 3.5 Hz, 2H), 1.86-1.79 (m, J=13.7, 9.3, 7.0, 4.5, 2.5 Hz, 1H), 1.74-1.66 (m, J=13.6, 9.3, 4.4, 2.7 Hz, 1H). .sup.13[C] NMR (151 MHz, Methanol-d.sub.4), δ: 168.8, 162.4, 142.3, 140.3, 131.8, 129.0, 127.4, 120.5, 114.2, 76.3, 29.5, 29.3, 27.5.
Example 2
Synthesis of (E)-2-(5-hydroxy-2-phenyl-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (2)
[0156] Step 1: Phenylboronic acid (101 mg, 0.8 mmol) and K.sub.2CO.sub.3 (173 mg, 1.2 mmol) were added to a solution of 2-bromo-6,7,8,9-tetrahydro-5H-benzo[7]annulen-5-one (Murineddu et al., 2005) (100 mg, 0.4 mmol) in DMF (16 ml) and H.sub.2O (8 ml). The solution was stirred under nitrogen atmosphere for 10 min, then tetrakis(triphenylphosphine)palladium (96 mg, 0.08 mmol) was added and the mixture was stirred under nitrogen atmosphere for additional 10 min. The reaction was heated at reflux for 24 hours. DMF was evaporated in vacuo before H.sub.2O (160 ml) was added and the aqueous phase was extracted with Et.sub.2O (80 ml). The organic phase was washed with H.sub.2O (160 ml) and brine (2×80 ml), dried over MgSO.sub.4, filtered and evaporated in vacuo. Purification by column chromatography (Heptane/EtOAc 9:1) afforded 2-phenyl-6,7,8,9-tetrahydro-5H-benzo[7]annulen-5-one (65 mg, 68.8%) as a yellow oil.
[0157] Step 2: Performed as describe in example 1 (step 1) using NaOH (59 mg, 1.4 mmol) in H.sub.2O (0.7 ml) and ethanol (10 ml), 2-phenyl-6,7,8,9-tetrahydro-5H-benzo[7]annulen-5-one (65 mg, 0.2 mmol) and glyoxylic acid monohydrate (79 mg, 1.0 mmol) in H.sub.2O (5 ml). Purification by column chromatography (DCM/MeOH 9.5:0.5+1% of AcOH) afforded (E)-2-(5-oxo-2-phenyl-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (47 mg, 59%) as a yellow solid.
[0158] Step 3: Performed as described in example 1 (step 2) using CeCl.sub.3, 7H.sub.2O (145 mg, 0.3 mmol), (E)-2-(5-oxo-2-phenyl-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (116 mg, 0.3 mmol), MeOH (20 ml) and NaBH.sub.4 (145 mg, 5.9 mmol). Purification by column chromatography (DCM+1% of AcOH) afforded (E)-2-(5-hydroxy-2-phenyl-5,7,8,9-tetrahydro-6H benzo[7]annulen-6-ylidene)acetic acid (92 mg, 80%) as a white solid. .sup.1H NMR (600 MHz, Methanol-d.sub.4), δ: 7.61-7.56 (d, J=7.4 Hz, 2H), 7.53-7.50 (d, J=7.9 Hz, 1H), 7.47-7.42 (dd, J=7.9, 2.0 Hz, 2H), 7.42-7.37 (t, J=7.7 Hz, 1H), 7.35-7.33 (d, J=2.0 Hz, 1H), 7.32-7.27 (t, J=7.4 Hz, 1H), 6.03 (s, 1H), 5.33 (s, 1H), 3.55-3.39 (m, 1H), 3.24-3.04 (m, 1H), 2.96-2.73 (m, 2H), 1.91-1.67 (m, 2H). .sup.13[C] NMR (151 MHz, Methanol-d.sub.4), δ: 170.4, 164.1, 142.1, 141.8, 141.7, 141.2, 129.7, 129.3, 128.2, 127.9, 127.8, 126.1, 115.4, 78.5, 35.4, 30.8, 29.3.
Example 3
Synthesis of sodium (E)-2-(5-hydroxy-2-phenyl-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetate (Sodium Salt of 2)
[0159] The sodium salt of 2 was prepared by dissolving 2 (85.4 mg, 0.290 mmol) in ethanol (2 ml) and NaOH (aq) (282 μl, 0.296 mmol, 0.5M Tritisol) was added. The solvent was removed in vacuo to give the product (90 mg, 99%) as white solid.
Example 4
Synthesis of (E)-2-(5-hydroxy-2-((E)-styryl)-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (3)
[0160] Step 1: Styrene (8.4 ml, 6.0 mmol, 2 eq) and triethylamine (5.5 ml, 39.7 mmol, 19 eq) were added to a solution of 2-bromo-6,7,8,9-tetrahydro-5H-benzo[7]annulen-5-one (Murineddu et al., 2005) in CH.sub.3CN (15 ml). The solution was stirred under nitrogen atmosphere for 5 min, then tetrakis(triphenylphosphine)palladium (725 mg, 0.4 mmol) was added and the mixture was stirred under nitrogen atmosphere for an additional 5 min. The reaction was heated at reflux for 22 hrs sat. aq. NH.sub.4Cl (10 ml) was added, followed by extraction with EtOAc (2×20 ml). The combined organic phases were washed with H.sub.2O and brine, dried over MgSO.sub.4 and evaporated in vacuo. Purification by column chromatography (Heptane/EtOAc 9.8:0.2) afforded (E)-2-styryl-6,7,8,9-tetrahydro-5H-benzo[7]annulen-5-one (229 mg, 52%) as a yellowish sticky oil.
[0161] Step 2: Performed as described in example 1 (step 1) using NaOH (152 mg, 10 mmol) in H.sub.2O (1.9 ml) and ethanol (7 ml), (E)-2-styryl-6,7,8,9-tetrahydro-5H-benzo[7]annulen-5-one (100 mg, 0.3 mmol) and glyoxylic acid monohydrate (140 mg, 5 mmol) in H.sub.2O (5 ml). Purification by column chromatography (DCM/MeOH 9.5:0.5+1% of AcOH) afforded (E)-2-(5-oxo-2-((E)-styryl)-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (121 mg, 50%) as a yellow solid.
[0162] Step 3: Performed as described in example 1 (step 2) using CeCl.sub.3, 7H.sub.2O (70 mg, 0.1 mmol), (E)-2-(5-oxo-2-((E)-styryl)-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (63 mg, 0.1 mmol), MeOH (20 ml) and NaBH.sub.4 (74 mg, 1.9 mmol). Purification by column chromatography (DCM+1% of AcOH) afforded (E)-2-(5-hydroxy-2-((E)-styryl)-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (30 mg, 49%) as a white solid. .sup.1H NMR (600 MHz, Methanol-d.sub.4), δ: 7.55-7.50 (d, J=6.9 Hz, 2H), 7.45-7.37 (m, 2H), 7.36-7.30 (m, J=7.0 Hz, 2H), 7.30-7.27 (d, J=5.2 Hz, 1H), 7.25-7.19 (m, J=7.3, 6.8 Hz, 2H), 6.01 (s, 1H), 5.29 (s, 1H), 3.50-3.40 (m, 1H), 3.18-3.01 (m, J=14.1, 7.7, 3.4 Hz, 1H), 2.97-2.71 (m, 2H), 1.91-1.68 (m, 2H). .sup.13[C] NMR (151 MHz, Methanol-d.sub.4), δ: 170.6, 164.3, 141.6, 141.5, 138.8, 138.1, 129.6, 129.5, 129.3, 128.8, 127.7, 127.4, 125.7, 115.4, 78.6, 35.3, 30.7, 29.3.
Example 5
Synthesis of (E)-2-(2-chloro-5-hydroxy-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (4)
[0163] ##STR00036##
[0164] Step 1: Performed as describe in example 1 (step 1) using NaOH (1.48 g, 37.1 mmol) in H.sub.2O (18 mL) and EtOH (40 mL), 2-chloro-6,7,8,9-tetrahydro-5H-benzo[7]annulen-5-one (Murineddu et al., 2005) (1.20 g, 6.18 mmol) and glyoxylic acid monohydrate (2.28 g, 24.7 mmol) in H.sub.2O (40 mL). Purification by column chromatography (DCM/MeOH 9.5:0.5+1% of AcOH) afforded (E)-2-(5-oxo-2-chloro-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (764 mg, 49%) as a white solid.
[0165] Step 3: Performed as described in example 1 (step 2) using CeCl.sub.3, 7H.sub.2O (735 mg, 3.0 mmol), (E)-2-(5-oxo-2-chloro-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (740 mg, 3.0 mmol), MeOH (150 mL) and NaBH.sub.4 (1.1 g, 30 mmol). Purification by column chromatography (DCM+1% of AcOH) afforded (E)-2-(5-hydroxy-2-chloro-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (402 mg, 52%) as a white solid. .sup.1H NMR (400 MHz, Methanol-d.sub.4), δ: 7.44-7.43 (d, J=8.25 Hz, 1H), 7.20-1.18 (dd, J=2.29, 8.25 Hz, 2H), 7.11-7.10 (d, J=2.29 Hz, 1H), 6.00 (s, 1H), 5.27 (s, 1H), 3.49-3.45 (m, 1H), 3.07-3.02 (m, 1H), 2.81-2.73 (m, 2H), 1.86-1.80 (m, 1H), 1.74-1.68 (m, 1H). .sup.13[C] NMR (151 MHz, Methanol-d.sub.4), δ: 170.3, 164.0, 143.5, 141.2, 133.9, 130.3, 128.7, 127.4, 115.6, 77.8, 35.0, 30.9, 29.0
Example 6
Synthesis of (E)-2-(2-iodo-5-hydroxy-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (5)
[0166] ##STR00037##
[0167] Step 1: A mixture of 2-bromo-6,7,8,9-tetrahydro-5H-benzo[7]annulen-5-one (Murineddu et al., 2005) (826 mg, 3.5 mmol), bis(tributyltin) (4.0 g, 6.9 mmol) and tetrakis(triphenylphosphine)palladium (0) (400 mg, 0.3 mmol) in dry toluene (35 mL) was heated at reflux under argon atmosphere for 3 hours. The solvent was evaporated in vacuo to dryness. The crude product was carried on to step 2.
[0168] Step 2: A solution of 2-(tributylstannyl)-6,7,8,9-tetrahydro-5H-benzo[7]annulen-5-one (1068 g, 2.4 mmol) in THF (50 mL) was cooled to 0° C. and a solution of iodine (905 g, 3.6 mmol) in THF (35 mL) was drop wise added. After 1 hour at 0° C. the reaction was quenched by addition of saturated aqueous Na.sub.2S.sub.2O.sub.3. Neutralized with a solution of saturated aqueous NaHCO.sub.3 and extracted with EtOAc. The combined organic layers were dried over Na.sub.2SO.sub.4, filtered and evaporated in vacuo. Purification by column chromatography (heptane/EtOAc 4:1) afforded the product (272 mg, 27%) as a colorless oil. .sup.1H NMR (400 MHz, CDCl.sub.3), δ: 7.66 (dd, J=8.2, 1.7 Hz, 1H), 7.61 (d, J=1.7 Hz, 1H), 7.43 (d, J=8.1 Hz, 1H), 2.90-2.84 (t, J=7.2, 5.3 Hz, 2H), 2.75-2.68 (m, 2H), 1.93-1.75 (m, 4H). .sup.13C NMR (100.6 MHz, CDCl.sub.3), δ: 205.3, 143.2, 138.7, 138.3, 136.1, 130.3, 99.9, 40.9, 32.3, 25.2, 20.9.
[0169] Step 3: Performed as describe in example 1 (step 1) using NaOH (215.0 mg, 5.2 mmol) in H.sub.2O (3 mL) and EtOH (6 mL) and 2-iodo-6,7,8,9-tetrahydro-5H-benzo[7]annulen-5-one (272 mg, 0.95 mmol) and glyoxylic acid monohydrate (354 mg, 3.8 mmol) in H.sub.2O (7 mL). Purification by column chromatography (DCM/MeOH 9.5:0.5+1% of AcOH) afforded (E)-2-(5-oxo-2-iodo-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (151 mg, 46%) as a yellow solid. .sup.1H NMR (400 MHz, Methanol-d.sub.4), δ: 7.77 (dd, J=8.1, 1.7 Hz, 1H), 7.72 (d, J=1.7 Hz, 1H), 7.47 (d, J=8.1 Hz, 1H), 6.68 (s, 1H), 2.82-2.76 (dt, J=6.8, 4.8 Hz, 4H), 2.07-1.98 (p, 2H). .sup.13C NMR (100.6 MHz, Methanol-d.sub.4), δ: 198.2, 169.3, 153.3, 143.7, 139.6, 137.6, 137.5, 131.7, 126.5, 102.0, 31.8, 26.2, 24.2.
[0170] Step 4: Performed as described in example 1 (step 2) using CeCl.sub.3, 7H.sub.2O (158 mg, 0.4 mmol), (E)-2-(5-oxo-2-iodo-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (145 mg, 0.4 mmol), MeOH (20 mL) and NaBH.sub.4 (160 mg, 4.2 mmol). Purification by column chromatography (DCM+1% of AcOH) afforded (E)-2-(2-iodo-5-hydroxy-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (113 mg, 77%) as a white solid. .sup.1H NMR (600 MHz, Methanol-d.sub.4) δ: 7.55 (dd, J=8.1, 1.9 Hz, 1H), 7.46 (d, J=1.9 Hz, 1H), 7.23 (d, J=8.1 Hz, 1H), 5.99 (s, 1H), 5.24 (s, 1H), 3.50-3.45 (ddd, J=11.8, 6.9, 4.3 Hz, 1H), 3.04-2.98 (ddd, J=14.2, 9.1, 2.6 Hz, 1H), 2.80-2.71 (m, 2H), 1.86-1.79 (m, J=13.6, 6.9, 4.5, 2.5 Hz, 1H), 1.73-1.65 (m, J=13.5, 9.3, 4.3, 2.7 Hz, 1H). .sup.13C NMR (151 MHz, Methanol-d.sub.4), δ: 170.3, 163.8, 143.8, 142.4, 139.3, 136.8, 129.0, 115.7, 93.4, 77.8, 34.9, 30.9, 29.0. HPLC (254 nm): 100%.
Example 7
Synthesis of (E)-2-(2-fluoro-5-hydroxy-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (6)
[0171] ##STR00038##
[0172] Step 1: To 2-(tributylstannyl)-6,7,8,9-tetrahydro-5H-benzo[7]annulen-5-one (1017 mg, 2.3 mmol) in acetone (35 mL) at room temperature were added Ag.sub.2O (31 mg, 0.1 mmol), NaHCO.sub.3 (397 mg, 4.5 mmol) and F-TEDA-BF.sub.4 (1204 mg, 3.4 mmol). The reaction mixture was stirred at reflux for 6 hours. After cooling to room temperature, the reaction mixture was filtered on a short pad of celite and evaporated in vacuo. The crude product was carried on to the next step.
[0173] Step 2: Performed as describe in example 1 (step 1) using NaOH (221 mg, 5.5 mmol) in H.sub.2O (8 mL) and EtOH (16 mL) and 2-fluoro-6,7,8,9-tetrahydro-5H-benzo[7]annulen-5-one (179 mg, 1.0 mmol) and glyoxylic acid monohydrate (370 mg, 4.0 mmol) in H.sub.2O (16 mL). Purification by column chromatography (DCM/MeOH 9.5:0.5+1% of AcOH) afforded (E)-2-(5-oxo-2-fluoro-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid. The crude product was carried on to the next step. MS (m/z) for C.sub.13H.sub.11FO.sub.3 (M-1).sup.− calcd.: 234.1, found: (M)H.sup.− 233.0.
[0174] Step 3: Performed as described in example 1 (step 2) using CeCl.sub.3, 7H.sub.2O (235.7 mg, 0.6 mmol), (E)-2-(5-oxo-2-fluoro-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (135 mg, 0.6 mmol), MeOH (30 mL) and NaBH.sub.4 (218 mg, 5.6 mmol). The crude product was purified by preparative HPLC to afford (E)-2-(2-fluor-5-hydroxy-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (23.2 mg, 17%) as a white solid. .sup.1H NMR (400 MHz, CD.sub.3OD), δ: 7.44 (dd, J=8.5, 5.9 Hz, 1H), 6.89 (td, J=8.5, 2.7 Hz, 1H), 6.84 (dd, J=9.6, 2.7 Hz, 1H), 5.98 (s, 1H), 5.26 (s, 1H), 3.46-3.38 (ddd, J=12.1, 6.9, 4.7 Hz, 1H), 3.13-3.04 (ddd, J=14.2, 8.8, 3.4 Hz, 1H), 2.85-2.73 (m, 2H), 1.86-1.70 (m, 2H). .sup.13C NMR (100.6 MHz, Methanol-d.sub.4), δ: 170.4, 164.6, 164.1, 162.2, 144.1, 144.0, 138.3, 129.3, 129.2, 117.3, 117.1, 115.7, 113.7, 113.5, 78.1, 35.1, 30.6, 29.1. .sup.19F NMR (376.4 MHz, Methanol-d.sub.4), δ: −118.3 (s, 1F). MS (m/z) for C.sub.13H.sub.13FO.sub.3 (M-1).sup.− calcd.: 236.2, found: 235.0 (M)H.sup.−. HPLC (254 nm): 95.5%.
Example 8
Synthesis of (E)-2-(2-methyl-5-hydroxy-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (7)
[0175] ##STR00039##
[0176] Step 1: Performed as describe in example 1 (step 1) using NaOH (6.71 g, 167.7 mmol) in H.sub.2O (80 mL) and EtOH (40 mL), 2-methyl-6,7,8,9-tetrahydro-5H-benzo[7]annulen-5-one (Murineddu et al., 2005) (4.84 g, 27.8 mmol) and glyoxylic acid monohydrate (10.28 g, 111.7 mmol) in H.sub.2O (40 mL). Purification by column chromatography (DCM/MeOH 9.5:0.5+1% of AcOH) afforded (E)-2-(2-methyl-5-oxo-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (5.42 g, 85%) as a yellow solid. Step 2: Performed as described in example 1 (step 2) using CeCl.sub.3, 7H.sub.2O (6.35 g, 17.0 mmol), (E)-2-(2-methyl-5-oxo-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (3.56 g, 15.5 mmol), MeOH (150 mL) and NaBH.sub.4 (8.79 g, 232.3 mmol). Recrystallization from EtOAc after purification by column chromatography (DCM/MeOH 30:1+1% of AcOH) afforded (E)-2-(5-hydroxy-2-methyl-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (1.56 g, 43%) as a white solid. .sup.1H NMR (400 MHz, Methanol-d.sub.4), δ: 7.29 (d, J=7.7 Hz, 1H), 7.00 (dd, J=7.8, 1.9 Hz, 1H), 6.90 (s, 1H), 5.96 (s, 1H), 5.22 (s, 1H), 3.40-3.33 (m, 1H), 3.09-3.03 (m, 1H), 2.85-2.80 (m, 1H), 2.76-2.69 (m, 1H), 2.27 (s, 3H), 1.82-1.72 (m, 2H). .sup.13C NMR (101 MHz, Methanol-d.sub.4) δ 170.4, 164.8, 141.2, 139.1, 138.4, 131.5, 128.1, 127.6, 115.3, 79.0, 35.2, 30.5, 29.4, 21.0. HPLC (254 nm): 100%. UPLC-MS: m/z=231.4 [M-H].sup.−
Example 9
Synthesis of (E)-2-(1-bromo-5-hydroxy-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (8)
[0177] ##STR00040##
[0178] Step 1: Performed as describe in example 1 (step 1) using NaOH (194 mg, 4.8 mmol) in H.sub.2O (3 mL) and EtOH (7 mL), 1-bromo-6,7,8,9-tetrahydro-5H-benzo[7]annulen-5-one (Gruber et al. 1983) (192 mg, 0.8 mmol) and glyoxylic acid monohydrate (299 mg, 3.2 mmol) in H.sub.2O (7 mL). Rough purification by column chromatography (DCM/MeOH 9.5:0.5+1% of AcOH) afforded crude (E)-2-(1-bromo-5-oxo-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (172 mg, 73%) as a yellow solid.
[0179] Step 2: Performed as described in example 1 (step 2) using CeCl.sub.3, 7H.sub.2O (236 mg, 0.6 mmol), (E)-2-(1-bromo-5-oxo-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (166 mg, 0.6 mmol), MeOH (8 mL) and NaBH.sub.4 (214 mg, 5.6 mmol). Purification by preparative HPLC (gradient 30-55% B, eluent A (H.sub.2O/TFA, 100:0.1) and eluent B (MeCN/H.sub.2O/TFA, 90:10:0.1) at a flow rate of 20 mL min.sup.−1, over 9 min) furnished (E)-2-(1-bromo-5-hydroxy-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (92 mg, 55%) as white solid. .sup.1H NMR (400 MHz, Methanol-d.sub.4) δ: 7.48 (d, J=8.7 Hz, 2H), 7.09 (t, J=7.8 Hz, 1H), 6.04 (s, 1H), 5.37 (s, 1H), 3.52-3.35 (m, 2H), 3.07-3.00 (m, 1H), 2.69-2.62 (m, 1H), 1.87-1.78 (m, 1H), 1.69-1.57 (m, 1H). .sup.13C NMR (101 MHz, Methanol-d.sub.4) δ: 170.3, 163.8, 145.0, 139.9, 132.9, 129.0, 126.5, 125.5, 115.8, 77.5, 32.5, 30.8, 27.5. HPLC (254 nm): 98%. ESI-MS: m/z=295.0, 297.0 [M-H].sup.−
Example 10
Synthesis of (E)-2-(1-phenyl-5-hydroxy-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (9)
[0180] ##STR00041##
[0181] Step 1: Performed as describe in example 2 (step 1) using phenylboronic acid (255 mg, 2.1 mmol), K.sub.2CO.sub.3 (436 mg, 3.1 mmol), 1-bromo-6,7,8,9-tetrahydro-5H-benzo[7]annulen-5-one (Gruber et al. 1983) ((247 mg, 1.0 mmol), tetrakis(triphenylphosphine)palladium (239 mg, 0.2 mmol) in DMF (24 mL) and H.sub.2O (16 mL). Rough purification by column chromatography (heptane/EtOAc 9:1) afforded crude 1-phenyl-6,7,8,9-tetrahydro-5H-benzo[7]annulen-5-one (220 mg, 90%) as a yellow oil.
[0182] Step 2: Performed as describe in example 1 (step 1) using NaOH (214 mg, 5.3 mmol) in H.sub.2O (3 mL) and EtOH (8 mL), 1-phenyl-6,7,8,9-tetrahydro-5H-benzo[7]annulen-5-one (210 mg, 0.9 mmol) and glyoxylic acid monohydrate (329 mg, 3.6 mmol) in H.sub.2O (5 mL). The crude (E)-2-(5-oxo-1-phenyl-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid was used for next step without any purification.
[0183] Step 3: Performed as described in example 1 (step 2) using CeCl.sub.3, 7H.sub.2O (362 mg, 1.0 mmol), (E)-2-(5-oxo-1-phenyl-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (258 mg, 0.9 mmol), MeOH (14 mL) and NaBH.sub.4 (338 mg, 8.9 mmol). Purification by preparative HPLC (gradient 30-72% B, eluent A (H.sub.2O/TFA, 100:0.1) and eluent B (MeCN/H.sub.2O/TFA, 90:10:0.1) at a flow rate of 20 mL min.sup.−1, over 10 min) furnished (E)-2-(5-hydroxy-1-phenyl-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (106 mg, 40% (overall yield in 2 steps)) as a white solid. .sup.1H NMR (600 MHz, Methanol-d.sub.4) δ: 7.50 (dd, J=7.7, 1.4 Hz, 1H), 7.42-7.36 (m, 2H), 7.36-7.30 (m, 1H), 7.25-7.19 (m, 3H), 7.09 (dd, J=7.6, 1.4 Hz, 1H), 6.07 (s, 1H), 5.40 (s, 1H), 3.47 (ddd, J=12.5, 6.4, 4.6 Hz, 1H), 3.00 (ddd, J=14.5, 9.1, 2.7 Hz, 1H), 2.69 (tdd, J=11.6, 9.3, 3.7 Hz, 2H), 1.77-1.71 (m, 1H), 1.65-1.58 (m, 1H). .sup.13C NMR (151 MHz, Methanol-d.sub.4) δ: 170.6, 164.5, 143.6, 143.4, 143.0, 138.3, 130.4, 130.3, 129.1, 127.9, 127.0, 126.3, 115.3, 78.1, 30.9, 29.6, 28.9. HPLC (254 nm): 100%. UPLC-MS: m/z=293.0 [M-H].sup.−
Example 11
Synthesis of (E)-2-(3-bromo-5-hydroxy-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (10)
[0184] ##STR00042##
[0185] Step 1: Performed as describe in example 1 (step 1) using NaOH (246 mg, 6.0 mmol) in H.sub.2O (3 mL) and EtOH (7 mL), 3-bromo-6,7,8,9-tetrahydro-5H-benzo[7]annulen-5-one (Gruber et al. 1983) (237 mg, 1.0 mmol) and glyoxylic acid monohydrate (366 mg, 4.0 mmol) in H.sub.2O (7 mL). Purification by column chromatography (DCM/MeOH 9.5:0.5+1% of AcOH) afforded (E)-2-(3-bromo-5-oxo-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (259 mg, 89%) as a yellow solid.
[0186] Step 2: Performed as described in example 1 (step 2) using CeCl.sub.3, 7H.sub.2O (356 mg, 1.0 mmol), (E)-2-(3-bromo-5-oxo-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (256 mg, 0.9 mmol), MeOH (10 mL) and NaBH.sub.4 (332 mg, 8.7 mmol). Purification by preparative HPLC (gradient 30-55% B, eluent A (H.sub.2O/TFA, 100:0.1) and eluent B (MeCN/H.sub.2O/TFA, 90:10:0.1) at a flow rate of 20 mL min.sup.−1, over 9 min) furnished (E)-2-(3-bromo-5-hydroxy-5,7,8,9-tetrahydro-6H-benzo[7]annulen-6-ylidene)acetic acid (139 mg, 54%) as white solid. .sup.1H NMR (600 MHz, Methanol-d.sub.4) δ: 7.64 (d, J=2.2 Hz, 1H), 7.28 (dd, J=8.0, 2.2 Hz, 1H), 7.00 (d, J=8.0 Hz, 1H), 6.01 (s, 1H), 5.28 (s, 1H), 3.57 (ddd, J=12.6, 6.5, 4.2 Hz, 1H), 2.99 (ddd, J=14.3, 8.6, 2.6 Hz, 1H), 2.80 (ddd, J=14.3, 9.8, 2.5 Hz, 1H), 2.66 (ddd, J=12.5, 9.9, 4.5 Hz, 1H), 1.90-1.84 (m, 1H), 1.65-1.59 (m, 1H). .sup.13C NMR (151 MHz, Methanol-d.sub.4) δ: 170.3, 163.8, 145.0, 140.3, 132.4, 131.2, 129.3, 121.2, 115.6, 77.0, 34.9, 31.5, 29.0. HPLC (254 nm): 99%. ESI-MS: m/z=295.0, 297.0 [M-H].sup.−
Example 12
Synthesis of acetoxymethyl 3-hydroxycyclopent-1-ene-1-carboxylate (11)
[0187] ##STR00043##
[0188] A mixture of 3-hydroxycyclopent-1-ene-1-carboxylic acid (A) (Vogensen et al., 2013) (207.4 mg, 1.62 mmol), K.sub.2CO.sub.3 (114.9 mg, 0.83 mmol) and KI (138.4 mg, 0.83 mmol) in dry DMF (5 ml) was stirred at room temperature for 30 min. To the reaction mixture, a solution of chloromethyl acetate (218.9 mg, 2.03 mmol) was added dropwise, and then stirred at 70° C. for 2 hrs before it was cooled to room temperature. Water (15 ml) was added, and aqueous phase was extracted with EtOAc (3×20 ml). The combined organic phase was dried over MgSO.sub.4, filtered, and evaporated in vacuo. Purification by column chromatography (EtOAc/Heptane 1:1) furnished the product (202.5 g, 63%) as a transparent oil. .sup.1H NMR (600 MHz, Methanol-d.sub.4) δ: 6.74 (q, J=2.1 Hz, 1H), 5.81 (s, 2H), 4.91-4.88 (m, 1H), 2.72-2.65 (m, 1H), 2.50-2.43 (m, 1H), 2.38-2.33 (m, 1H), 2.08 (s, 3H), 1.79-1.73 (m, 1H). .sup.13C NMR (151 MHz, Methanol-d.sub.4) δ: 171.1, 164.9, 146.7, 138.3, 80.6, 77.5, 34.0, 30.6, 20.5. HPLC (254 nm): 96%.
Example 13
Synthesis of 3-(2-acetoxyacetoxy)cyclopent-1-ene-1-carboxylic acid (12)
[0189] ##STR00044##
[0190] A mixture of acetoxyacetyl chloride (0.4 mL, 3.8 mmol) and acetoxyacetic acid (457 mg, 3.9 mmol) in THF (3 mL) was cooled to 0° C. N,N-Diisopropylethylamine (1.8 mL, 10.4 mmol) was added at less than 5° C. The resulting solution was warmed to room temperature and stirred for 30 min. 3-Hydroxycyclopent-1-ene-1-carboxylic acid (HOCPCA) (Vogensen et al., 2013) (222 mg, 1.7 mmol) and 4-dimethylaminopyridine (22 mg, 0.2 mmol) were dissolved in THF (1.5 mL). The solution was added to the reaction mixture in one portion and was stirred for 3h at room temperature. Water (3 mL) was added and the reaction was stirred for 90 minutes at room temperature. The mixture was extracted with EtOAc. The combined organic phase was dried over Na.sub.2SO.sub.4, filtered, and evaporated in vacuo. Purification by column chromatography (EtOAc/heptane 1:1+1% of AcOH) furnished 3-(2-acetoxyacetoxy)cyclopent-1-ene-1-carboxylic acid (35 mg, 9%) as a off-white solid. .sup.1H NMR (600 MHz, Methanol-d.sub.4) δ: 6.62 (q, J=2.1 Hz, 1H), 5.85-5.82 (m, 1H), 4.62 (s, 2H), 2.73-2.67 (m, 1H), 2.57-2.51 (m, 1H), 2.48-2.42 (m, 1H), 2.12 (s, 3H), 1.98-1.92 (m, 1H). .sup.13C NMR (151 MHz, Methanol-d.sub.4) δ 172.1, 169.3, 167.7, 143.7, 139.0, 81.9, 61.9, 31.0, 31.0, 20.3. HPLC (254 nm): 95%.
Example 14
Synthesis of Neopentyl 3-hydroxycyclopent-1-ene-1-carboxylate (13)
[0191] ##STR00045##
[0192] Step 1: To a solution of 3-oxocyclopent-1-ene-1-carboxylic acid 4 (126 mg, 1.0 mmol), 4-dimethylaminopyridine (24 mg, 0.2 mmol) and 2,2-dimethylpropan-1-ol (124 mg, 1.4 mmol) in DCM (9 mL) at 0° C. was added N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (260 mg, 1.4 mmol) dissolved in DCM (4 mL). The mixture was then allowed to warm to room temperature and stirred for overnight. A solution of saturated NH.sub.4Cl was added to the mixture, which then, was washed with DCM. The combined organic phase was dried over Na.sub.2SO.sub.4, filtered, and evaporated in vacuo. Rough purification by column chromatography (Heptane/EtOAc 4:1) furnished impure neopentyl 3-oxocyclopent-1-ene-1-carboxylate (75 mg, 43%) as a yellow oil.
[0193] Step 2: Performed as described in example 1 (step 2) using CeCl.sub.3, 7H.sub.2O (309 mg, 0.8 mmol), neopentyl 3-oxocyclopent-1-ene-1-carboxylate (131 mg, 0.7 mmol), MeOH (7 mL) and NaBH.sub.4 (127 mg, 3.4 mmol). Purification by column chromatography (heptane/EtOAc 3:1) furnished neopentyl 3-hydroxycyclopent-1-ene-1-carboxylate (57 mg, 43%) as a transparent oil. .sup.1H NMR (600 MHz, Chloroform-d) δ: 6.71 (q, J=2.1 Hz, 1H), 5.01-4.97 (m, 1H), 3.85 (s, 2H), 2.79-2.73 (m, 1H), 2.54-2.49 (m, 1H), 2.45-2.39 (m, 1H), 1.83-1.78 (m, 1H), 0.97 (s, 9H). .sup.13C NMR (151 MHz, Chloroform-d) δ: 165.3, 142.7, 139.4, 77.4, 74.0, 33.8, 31.6, 30.1, 26.6. HPLC (254 nm): 99%.
Example 15
Synthesis of tert-Butyl 3-hydroxycyclopent-1-ene-1-carboxylate (14) (Aye et al, 2008)
[0194] ##STR00046##
[0195] Step 1: To a solution of 3-oxocyclopent-1-ene-1-carboxylic acid 4 (209 mg, 1.7 mmol) in DMF (5 mL), tert-butyl 2,2,2-trichloroacetimidate (3.0 mL, 16.7 mmol) and boron trifluoride diethyl etherate (0.1 mL, 0.9 mmol) were added. The mixture was stirred overnight at 50° C. A solution of saturated NaHCO.sub.3 was added and then aqueous phase was extracted with EtOAc. The combined organic phase was dried over anhydrous Na.sub.2SO.sub.4, filtered, and evaporated in vacuo to dryness. Rough purification by column chromatography (Heptane/EtOAc 3:1) furnished tert-butyl 3-oxocyclopent-1-ene-1-carboxylate (138 mg, 46%) as a yellow oil.
[0196] Step 2: Performed as described in example 1 (step 2) using CeCl.sub.3, 7H.sub.2O (499 mg, 1.3 mmol), tert-butyl 3-oxocyclopent-1-ene-1-carboxylate (203 mg, 1.1 mmol), MeOH (11 mL) and NaBH.sub.4 (213 mg, 5.6 mmol). Purification by column chromatography (heptane/EtOAc 2:1) furnished tert-butyl 3-hydroxycyclopent-1-ene-1-carboxylate (Aye et al, 2008) (25 mg, 12%) as an off-white oil.
Example 16
Synthesis of Lithium(I) (2S)-2-amino-3-(3-(3-hydroxycyclopent-1-ene-1-carboxamido)phenyl)propanoate (15)
[0197] ##STR00047##
[0198] Step 1: 3-Hydroxycyclopent-1-ene-1-carboxylic acid (HOCPCA) (Vogensen et al., 2013) (355 mg, 2.8 mmol), 4-dimethylaminopyridine (35 mg, 0.3 mmol) were dissolved in THF (15 mL), and cooled to 0° C. under argon. Acetic anhydride (0.4 mL, 4.2 mmol) was added dropwise, and stirred overnight at room temperature. Water was added and the mixture was extracted with EtOAc. The combined organic phase was dried over Na.sub.2SO.sub.4, filtered, and evaporated in vacuo. Purification by column chromatography (heptane/EtOAc 1:3+1% of AcOH) furnished 3-acetoxycyclopent-1-ene-1-carboxylic acid (434 mg, 92%) as a white solid.
[0199] Step 2: 3-Acetoxycyclopent-1-ene-1-carboxylic acid (137 mg, 0.8 mmol), N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (152 mg, 0.8 mmol), hydroxybenzotriazole (108 mg, 0.8 mmol), triethylamine (0.22 mL, 1.6 mmol) were dissolved in THF (3 mL) and stirred for 10 minutes under argon. Methyl (S)-3-(3-aminophenyl)-2-((tertbutoxycarbonyl)amino)propanoate (281 mg, 1.0 mmol) in THF (3 mL) was added, and the mixture was stirred overnight at room temperature. A solution of saturated NH.sub.4Cl was added to the mixture, which then, was washed with EtOAc. The combined organic phase was dried over Na.sub.2SO.sub.4, filtered, and evaporated in vacuo. Purification by column chromatography (Heptane/EtOAc 1:1) afforded methyl (2S)-3-(3-(3-acetoxycyclopent-1-ene-1-carboxamido)phenyl)-2-((tert-butoxycarbonyl)-amino)propanoate (320 mg, 90%) as a yellow solid Step 3: To a solution of methyl (2S)-3-(3-(3-acetoxycyclopent-1-ene-1-carboxamido)phenyl)-2-((tert-butoxycarbonyl)amino)propanoate (139 mg, 0.3 mmol) in dioxane (1.2 mL) was added dropwise with 4M HCl/dioxane (1.2 mL, 4.7 mmol) at 0° C. The mixture was allowed to stir for 1h at room temperature. A solution of saturated NaHCO.sub.3 was added and then aqueous phase was extracted with EtOAc. The combined organic phase was dried over anhydrous Na.sub.2SO.sub.4, filtered, and evaporated in vacuo to dryness. Rough purification by column chromatography (EtOAc/MeOH 5:1) furnished corresponding intermediate as a yellow oil. LiOH (4 mg, 0.2 mmol) in water (0.5 mL) was added to a solution of intermediate in MeOH (0.5 mL). The mixture was stirred at room temperature until full conversion. The mixture was evaporated in vacuo to dryness to afford lithium(I) (2S)-2-amino-3-(3-(3-hydroxycyclopent-1-ene-1-carboxamido)phenyl)propanoate (30 mg, 34%) as an off-white solid. .sup.1H NMR (400 MHz, Methanol-d.sub.4) δ: 7.62 (ddd, J=8.1, 2.2, 1.0 Hz, 1H), 7.33 (t, J=1.9 Hz, 1H), 7.25 (t, J=7.9 Hz, 1H), 7.05 (dt, J=7.6, 1.4 Hz, 1H), 6.61 (q, J=2.1 Hz, 1H), 4.94 (tdd, J=5.2, 2.6, 1.6 Hz, 1H), 3.47 (dd, J=8.1, 4.7 Hz, 1H), 3.10 (dd, J=13.5, 4.7 Hz, 1H), 2.86-2.73 (m, 2H), 2.65-2.50 (m, 1H), 2.43-2.35 (m, 1H), 1.85-1.76 (m, 1H). .sup.13C NMR (151 MHz, Methanol-d.sub.4) δ: 181.4, 166.3, 143.0, 140.9, 139.9, 139.4, 129.8, 126.8, 123.1, 120.4, 77.9, 58.9, 42.7, 34.1, 31.1. HPLC (254 nm): 99%.
Example 17
GHB-Related Analogues Bind with High Affinity to Specific GHB Sites in Rat Brain Synaptic Membranes at Both pH Values of 6.0 and 7.4 (FIG. 1)
[0200] Novel analogues were tested in established binding assays and compared to reference compounds. At pH 6, compounds 1-10 were found to inhibit A).sup.3H-B binding (respective K.sub.i values of 50, 92, 30, 52, 53, 108, 325, 225, 382, 9687 nM) compared to compound B with a K.sub.i value of 440 nM. B) Compounds 1, 2 and 3 also inhibited .sup.3H-A binding in a concentration-dependent manner with similar affinities (respective K.sub.i values of 56 nM, 144 nM and 50 nM) compared to GHB itself with a K.sub.i value of 2.75 μM. C) At pH 7.4, lower affinities were obtained in the .sup.3H-A binding assay, yielding K.sub.i values for compounds 1, 2 and 3 of ˜267, 604 and 87 nM, respectively. The known CAMK2A inhibitor CN21 failed to displace .sup.3H-A binding at concentrations up to 30 μM (˜300-fold its reported IC.sub.50 value). D) Competition of compounds C, diclofenac and 4′-hydroxydiclofenac in the .sup.3H-A binding assay showed superior affinity of compound C relative to 4′-hydroxydiclofenac and diclofenac (K.sub.i values of 22 nM vs. 16 μM and 4.7 μM).
Example 18
Lack of Noticeable GABA.SUB.B .Receptor Binding of GHB Analogues (FIG. 2)
[0201] GHB, compounds A and C were tested for affinity for the GABA.sub.B receptor in an established binding assay. Whereas GHB at both 0.1 mM and 1 mM could inhibit .sup.3H-GABA.sub.B binding, compound A displayed no ability to compete up to concentrations of 1 mM and compound C showed limited inhibition at a concentration of 1 mM.
Example 19
Compound a does not Produce Hypothermia in Mice, but GBL does (FIG. 3)
[0202] To confirm the inability of compound A to functionally activate the GABA.sub.B receptor, the known GABA.sub.B effect of hypothermia was studied in mice by comparing administration of the GHB prodrug GBL (750 mg/kg) and compound A (500 mg/kg) in wild-type and GABA.sub.B receptor knock-out mice (Kaupmann et al., 2003). As expected, GBL was able to promote a strong decreased in body temperature. By contrast, compound A had no effect on hypothermia in either wild-type or knock-out mice.
Example 20
GBL Induces a Reduction in the Cerebral Metabolic Rate of Glucose not Mediated by GABA.SUB.B .Receptors (FIG. 4)
[0203] To confirm that the GHB prodrug GBL alters glucose metabolism via a non-GABA.sub.B receptor-dependent mechanism, either saline (black bars) or GBL (200 mg/kg) (white bars) were administered (i.p.) to GABA.sub.B1 receptor knock-out mice. Ten min later, .sup.14C-deoxyglucose was administered (i.p.) to all mice to estimate brain glucose consumption. This showed a significant GHB-induced lowering of the cerebral metabolic rate of glucose in frontal cortex and hippocampus after 45 min (10.46 vs. 6.78 nCi/ROI/min for frontal cortex and 9.74 vs. 6.45 for hippocampus, *P<0.05, error bars depicted as SD).
Example 21
Compound A Reduces Infarct Size when Administered 30 Min after Photothrombotic Focal Ischemia (FIG. 5)
[0204] A) Compound A in two different doses was administered to mice 30 min after induction of a focal stroke to the cerebral cortex and compared to saline-treated animals. Three days after the induced stroke, an infarct was visible in the left motor cortex. B) Quantification of infarct volumes revealed a 30% reduction when comparing saline with compound A (175 mg/kg) (9.38 vs. 6.56 mm.sup.3, ***P<0.0005). The group of mice receiving the low dose (17.5 mg/kg) did not show a significant reduction in infarct volume compared to saline (9.38 vs. 8.95 mm.sup.3).
Example 22
Compound A Improves Motor Performance in Affected Limbs when Administered 30 Min after Photothrombotic Focal Ischemia (FIG. 6)
[0205] To evaluate improvement of motor function following administration of compound A after focal ischemia, the cylinder task and the grid-walking task were used as specific measures for left forelimb motor recovery. Asymmetry was observed between left and right forelimb in the cylinder and grid-walking tasks 3 days after focal ischemia. A) In the grid-walking task, the group of mice that received the high dose (175 mg/kg), demonstrated an improvement of 26% compared to the saline-treated group (**P<0.01), while a non-significant reduction (10%) was observed for the 17.5 mg/kg group. B) The asymmetry measured with the cylinder task was significantly reduced when administering compound A for both the 17.5 and the 175 mg/kg dose groups with effects of 40% and 42%, respectively.
Example 23
Compound A Reduces Infarct Size when Administered 3, 6 or 12 Hrs after Photothrombotic Focal Ischemia (FIG. 7)
[0206] To evaluate later treatment efficacy, compound A was given 3, 6 or 12 hrs after induction of the infarct at two different doses. A) Administration of compound A (175 mg/kg) 3, 6 or 12 hrs after the stroke significantly decreased infarct sizes (5.51 mm.sup.3 vs. 3.12, 3.68 and 3.58 mm.sup.3, respectively) (P<0.01-0.05), amounting to a 33-43% decrease. For comparison, GHB (275 mg/kg) at the 3 hr time point did not result in a significant decrease in infarct size (not shown) B) Administration of a lower dose of compound A (90 mg/kg) 3 hrs after the stroke significantly decreased infarct size by 51% (5.55 mm.sup.3 vs. 2.68 mm.sup.3, **P<0.01).
Example 24
Compound A Improves Motor Performance in Affected Limbs when Administered 3, 6 or 12 Hrs after Photothrombotic Focal Ischemia (FIG. 8)
[0207] To assess motor skills in the treatment group receiving a 175 mg/kg dose of A at the later time points of administration after the induction of the infarct, asymmetry was measured between left and right forelimb in the grid-walking and cylinder tasks 7 days after the focal ischemia. A) The asymmetry measured with the grid-walking task was highly significantly reduced for both 3, 6 and 12 hr treatment points (effects of 31, 22 and 21%, respectively (***P<0.001). B) In the cylinder task an improvement of 16% and 20% compared to the saline-treated group was observed for the 3 hr (*P<0.05) and 6 hr (**P<0.001) time points, respectively, whereas the 12 hr point was non-significant.
Example 25
Compound 2 Reduces Infarct Size and Improves Motor Performance in Affected Limbs when Administered 3 or 6 Hrs after Photothrombotic Focal Ischemia (FIG. 9)
[0208] The novel compound 2 was given (i.p.) 3 or 6 hrs after induction of the infarct at doses of 175 mg/kg (A-C) or 50 mg/kg (D-F). A) Administration of 2 (175 mg/kg), 3 or 6 hrs after the injury significantly decreased infarct sizes (5.55 mm.sup.3 vs. 3.44 and 2.98 mm.sup.3, respectively, P<0.01-0.05), amounting to a 38-46% decrease. Compound 2 administration significantly reduced B) number of foot faults (*P<0.05) for the 6 hr group, and C) time spent on affected paw for both 3 and 6 hrs (P<0.01-0.001) compared to the saline-treated mice. D) Administration of 2 (50 mg/kg) promoted similar protection 3 hrs after the injury significantly decreased infarct size by 39% (5.55 mm.sup.3 vs. 3.4 mm.sup.3, **P<0.01). Similarly, mice treated with the lower dose displayed E-F) significantly improved motor performance in both asymmetry tests.
Example 26
Compound A Treatment Reduces the Expression of Selected Molecular Markers Related to Photothrombotic Focal Ischemia (FIG. 10)
[0209] To investigate the protective mechanisms against brain damage following a focal ischemic insult, mRNA expression levels of the markers GFAP, CD14 and MMP9 were measured in the brain tissue surrounding the ischemic core 3 days post-stroke. A) GFAP levels were markedly increased in the stroked animals, but the levels were not different between the two treatment groups. B) C) By contrast, the mRNA levels of CD14 and MMP9 were markedly lowered in animals that received compound A (175 mg/kg) 30 min following the focal ischemic event. Already at the low dose of A (17.5 mg/kg), MMP9 mRNA levels were significantly lower than in animals receiving saline. D) Similar results were found after 12 hrs.
Example 27
Compound A Treatment Reduces Plasma Levels of Selected Pro-Inflammatory Cytokines in Photothrombotic Focal Ischemia (FIG. 11)
[0210] To evaluate the inflammatory response at early time points, blood samples were collected 4 hrs after induction of a focal ischemic event. A) The formation of the infarct significantly increased the levels of MCP-1, IL-6 and IL-1a. MCP-1 levels showed a tendency towards a decrease in plasma in the compound A-treated animals after 4 hrs. B) Treatment with compound A significantly lowered the plasma levels of IL-6 compared to saline-treated mice. C) Treatment with A did not significantly affect IL-1a levels compared to saline-treated mice.
Example 28
Compound A Reduces Infarct Size in the Permanent Middle Cerebral Artery Occlusion (pMCAO) Model of Focal Ischemia (FIG. 12)
[0211] Compound A (175 mg/kg) was administered to mice 30 min after induction of a focal stroke via a permanent occlusion of the middle cerebral artery and compared to saline-treated animals. Three days after the induced stroke, an infarct was visible in the left motor cortex. Quantification of infarcts revealed a significant reduction in infarct volume when comparing saline with A (175 mg/kg) after 30 min (16.6 vs. 12.3 mm.sup.3, *P<0.05).
Example 29
Compound A Improves Functional Recovery when Administered 30 Min after a pMCAO Focal Lesion (FIG. 13)
[0212] Compound A (175 mg/kg) was administered to mice 30 min after induction of a focal stroke via a permanent occlusion of the middle cerebral artery and compared to saline-treated animals and both motor- and sensory impairment was investigated using rotarod, grip strength and Hargreaves tests.
[0213] In the rotarod test, the mice were exposed to 4 trials (T1-T4) 48 hrs post-stroke. A) Saline-treated mice in the rotarod learned significantly from T2 to T3). B) In comparison, the mice receiving treatment with A had a steeper learning curve (T1 to T2), although time spent on the rotarod in T4 did not differ between groups. C) Three days following stroke, saline-treated mice demonstrated a significant deficit in grip strength in the affected fore limb, while the Compound A-treated mice did not demonstrate any deficit in this test. D) Similarly, for the evaluation of sensory deficits in the affected fore limb, the saline-treated mice showed an increased response time in the Hargreaves test for the affected forelimb, while this was not evident for the mice treated with A.
Example 30
Ex Vivo .SUP.3.H-A Radioligand Binding in Coronal Brain Sections from Mouse Brain (FIG. 14)
[0214] .sup.3H-A was used to perform ex vivo binding to C57BL/6J mice. Thus, in a design with 5 mice per group, .sup.3H-A (5 MBq per mouse) was injected i.p. After 30 min, the brains were dissected and autoradiography performed. Significant specific binding levels were observed in the hippocampus and cortex compared to the cerebellum, used for normalization.
Example 31
Identification of CAMK2A as the GHB High-Affinity Binding Site (FIG. 15)
[0215] A) Principle of photoaffinity labelling workflow. Crude synaptic membranes from rat hippocampus were incubated with the photoaffinity ligand SBV3 and UV-irradiated (wavelength 302 nm) to covalently link the photoaffinity ligand to the GHB binding protein. After introduction of biotin through a Staudinger-Bertozzi ligation to EZ-Link™ Phosphine-PEG.sub.3-Biotin (ThermoFisher Scientific), the biotin-labelled proteins were affinity-purified and subjected to LC-MS/MS analysis. B) The anti-biotin western blot shows the specifically labelled band at ˜55 kDa in the presence (first lane) and absence (second lane) of photoligand. C).sup.3H-A binding to cortical membranes from CAMK2A and CAMK2B knock-out mouse brains. D).sup.3H-A binding to whole cell homogenate from HEK293T cells transfected with rat CAMK2A displayed significantly higher total binding compared to non-specific levels (87% specific binding) whereas no specific binding was seen at CAMK2B (black bars=specific binding, white bars=non-specific binding; 1 mM GHB).
Example 32
GHB and the GHB-Related Analogues A, B, C, 1 and 2 Bind Directly to Recombinant CAMK2A (FIG. 16)
[0216] Human/rat CAMK2A expressed in HEK cells was assayed in an in-house established .sup.3H-A filtration binding assay performed on whole cell lysates of CAMK2A-transfected HEK293T cells. As seen for binding to synaptic membranes from rat brain cortex, compounds GHB, A, B, C, 1 and 2 were able to concentration-dependently inhibit radioligand binding. Obtained K values were 50.4, 1.95, 3.71, 0.81, 0.72 and 1.09 μM, respectively, compounds 1 and 2 displaying up 50-70 times better affinity than GHB in competition with the .sup.3H-A radioligand, which is similar to the binding potency shift observed in the .sup.3H-A binding assay (
Example 33
Compounds A and 2 Rapidly Cross tsA201 Cell Membranes Through their Substrate Activity at Proton-Coupled Transporters (FIG. 17)
[0217] To monitor the ability of compounds to enter into cells and reach the target (CAMK2A), a fluorescence-based assay with the pH-sensitive dye BCECF was employed. Cells (tsA201; related to HEK293-T) known to express MCTs were grown in 96-well plates and exposed to compounds and pH-decreased measured for 2 min. A) As expected for A, a known MCT1 substrate, a concentration-dependent decrease in pH was observed (EC.sub.50 value of 8.2 mM). B) Compound 2, representative of several of the analogues, similarly produced a concentration-dependent decrease in pH (EC.sub.50 value of 1.6 mM), supporting compound delivery into the cell cytosol.
Example 34
Compound a Prevents pThr286 CAMK2A Autophosphorylation in Mice Subjected to Photothrombotic Focal Ischemia (FIG. 18)
[0218] To assess functional activity of A, the well-described pThr286 assay (Kool et al., 2016) was used on cortical tissue isolated from mice subjected to photothrombotic injury with and without treatment with A.
[0219] To this end, sham mice or mice were treated with either saline or 175 mg/kg A (i.p.) 3 hrs after the injury. Thirty (30) min after the injury, mice were sacrificed and cortex tissue processed. Autophosphorylation was assessed by Western blot analysis and levels of pThr286 CAMK2A normalized to total CAMK2A to detect changes in autophosphorylation. In accordance with other reports on ischemia (Ahmed et al., 2017), focal ischemia induced by photothrombosis significantly increased autophosphorylation (#P<0.05). This response was significantly inhibited by compound A (*P<0.05) amounting to a 73% decrease in autophosphorylation compared to the sham condition.
REFERENCES
[0220] Ahmed, M. E., Dong, Y., Lu, Y., Tucker, D., Wang, R., Zhang, Q., 2017. Beneficial effects of a CaMKIIa inhibitor TatCN21 peptide in global cerebral ischemia. J Mol Neurosci 61, 42-51. [0221] Aye, Y.; Davies, S. G., Garnaer, A. C., Roberts, P. M., Smith, A. D.; Thomson, J. E., 2008 [0222] Parallel kinetic resolution of citertci-butyl (RS)-3-oxy-substituted cyclopent-1-ene-carboxylates for the asymmetric synthesis of 3-oxy-substituted cispentacin and transpentacin derivaties. Organic Biomol Chem 6, 2195-2203. [0223] Clarkson, A. N., Huang, B. S., Macisaac, S. E., Mody, I., Carmichael, S. T., 2010. Reducing excessive GABA-mediated tonic inhibition promotes functional recovery after stroke. Nature 468, 305-309. [0224] Coultrap, S. J., Ashpole, N. M., Hudmon, A., Bayer, K. U., 2011. CaMKII in cerebral ischemia. Acta Pharmacol Sin 32, 861-872. [0225] Gruber, R; Cagniant, D., Cagniant, P., 1983. Hydrocarbures arylaliphatiques. Partie VII. Orientation dans la reaction de bromation de benzocyclenes bi-et tricycliques superieurs. Bulletin de la Societe Chimique de France, 2, 96-104. [0226] Kaupmann, K., Cryan, J. F., Wellendorph, P., Mombereau, C., Sansig, G., Klebs, K., Schmutz, M., Froestl, W., van der Putten, H., Mosbacher, J., Brauner-Osborne, H., Waldmeier, P., Bettler, B., 2003. Specific γ-hydroxybutyrate-binding sites but loss of pharmacological effects of γ-hydroxybutyrate in GABA.sub.B1-deficient mice. Eur J Neurosci 18, 2722-2730. [0227] Klein, A. B., Bay, T., Villumsen, I. S., Falk-Petersen, C. B., Marek, A., Frølund, B., Clausen, R. P., Hansen, H. D., Knudsen, G. M., Wellendorph, P., 2016. Autoradiographic imaging and quantification of the high-affinity GHB binding sites in rodent brain using .sup.3H-HOCPCA. Neurochem Int 100, 138-145. [0228] Kool, M. J., Van De Bree, J. E., Bodde, H. E., Elgersma, Y., Van Woerden, G. M., 2016. The molecular, temporal and region-specific requirements of the beta isoform of Calcium/Calmodulin-dependent protein kinase type 2 (CAMK2B) in mouse locomotion. Sci Rep 6:26989, 1-12. [0229] Kuschinsky, W., Suda, S., Sokoloff, L., 1985. Influence of gamma-hydroxybutyrate on the relationship between local cerebral glucose utilization and local cerebral blood flow in the rat brain. J Cereb Blood Flow Metab 5, 58-64. [0230] Lie, M. E. K., Johansen, N. B., Gowing E. K., Dalby, N. O., Thiesen, L., Wellendorph, P., Clarkson, A. N., In Press. The GAT3 selective substrate L-isoserine upregulates GAT3 expression and increases functional recovery after a focal ischemic stroke in mice. J Cereb Blood Flow Metab doi: 10.1177/0271678X17744123. [0231] Murineddu, G., Ruiu, S., Loriga, G., Manca, I., Lazzari, P., Reali, R., Pani, L.; Toma, L., Pinna, G. A., 2005. Tricyclic pyrazoles. 3. Synthesis, biological evaluation, and molecular modeling of analogues of the cannabinoid antagonist 8-chloro-1-(2′,4′-dichlorophenyl)-N-piperidin-1-yl-1,4,5,6-tetrahydrobenzo[6,7]cyclohepta[1,2-c]pyrazole-3-carboxamide. J Med Chem 48, 7351-7362. [0232] Thiesen, L., Kehler, J., Clausen, R. P., Frolund, B., Bundgaard, C., Wellendorph, P., 2015. In vitro and in vivo evidence for active brain uptake of the GHB analog HOCPCA by the monocarboxylate transporter subtype 1. J Pharmacol Exp Ther 354, 166-174. [0233] Vest, R. S., Davies, K. D., O'Leary, H., Port, J. D., Bayer, K. U., 2007. Dual mechanism of a natural CaMKII inhibitor. Mol Cell Biol 18, 5024-5033. [0234] Vogensen, S. B., Marek, A., Bay, T., Wellendorph, P., Kehler, J., Bundgaard, C., Frolund, B., Pedersen, M. H., Clausen, R. P., 2013. New synthesis and tritium labeling of a selective ligand for studying high-affinity γ-hydroxybutyrate (GHB) binding sites. J Med Chem. 56, 8201-8205. [0235] Waxham, M. N., Grotta, J. C., Silva, A. J., Strong, R., Aronowski, J., 1996. Ischemia-induced neuronal damage: a role for calcium/calmodulin-dependent protein kinase II. J Cereb Blood Flow Metab 16, 1-6. [0236] Wellendorph, P., Hog, S., Greenwood, J. R., de Lichtenberg, A., Nielsen, B., Frolund, B., Brehm, L., Clausen, R. P., Bräuner-Osborne, H., 2005. Novel cyclic γ-hydroxybutyrate (GHB) analogs with high affinity and stereoselectivity of binding to GHB sites in rat brain. J Pharmacol Exp Ther 315, 346-351.
[0237] Items
[0238] 1. A compound according to formula I
##STR00048##
[0239] wherein R.sub.1 and R.sub.2 form a ring system to obtain a compound selected from
##STR00049##
[0240] wherein n is 0 or 1;
[0241] R.sub.3 is selected from H, -Me, -Et, —Pr, -iPr, -Bu, -tBu, -benzyl, polyethylenglycolyl (PEG), or a group such as
##STR00050##
[0242] wherein R.sub.9 is selected from -Me, -Et, —Pr, -iPr, -Bu, -iBu, or -tBu, and wherein R.sub.10 is selected from H, -Me, -Et, -iPr;
[0243] R.sub.4 is selected from H, —C(═O)-Me, —C(═O)-Et, —C(═O)—Pr, —C(═O)-iPr, —C(═O)—Bu, —C(═O)-tBu, —C(═O)-benzyl, polyethylenglycolyl (PEG), or a groups such as
##STR00051##
[0244] wherein R.sub.11 is selected from -Me, -Et, —Pr, -iPr, -Bu, iBu, or -tBu, and wherein R.sub.12 is selected from H, -Me, -Et, -iPr;
[0245] R.sub.5, R.sub.6, R.sub.7, and R.sub.8 are independently from each other selected from H, F, Cl, Br, I, aryl, straight or branched C.sub.1-8 alkyl, —CH.sub.2(CH.sub.2).sub.p-aryl, —CH═CH-aryl, NH.sub.2, NO.sub.2, OH, SH, straight or branched —O—C.sub.1-8 alkyl, straight or branched —S—C.sub.1-8 alkyl, straight or branched —NH—C.sub.1-8 alkyl, —O-aryl, —S-aryl, —NH-aryl, wherein aryl includes aryl having one or more heteroatoms selected from O, N or S, and wherein p is 0 or 1;
[0246] m is 0 or 1; and
[0247] X is N, O, S, CH.sub.2
[0248] or a pharmaceutically acceptable salt thereof;
[0249] with the proviso that the compound is not one of the following:
##STR00052##
[0250] 2. A compound according to item 1 having formula II or III, and wherein n is 0.
[0251] 3. A compound according to item 1 having formula IV, and wherein n is 1
[0252] 4. A compound according to any of the preceding items, wherein one of R.sub.3 and R.sub.4 is H.
[0253] 5. A compound according to any of the preceding item, wherein both R.sub.3 and R.sub.4 are H.
[0254] 6. A compound according to any of the preceding items having formula III, wherein R.sub.5 is H and R.sub.6 is in the 2 position.
[0255] 7. A compound according to any of the preceding items having formula III, wherein R.sub.5 is H and R.sub.6 is selected from H, F, Cl, Br, I, aryl, straight or branched C.sub.1-8 alkyl, —CH.sub.2(CH.sub.2).sub.p-aryl, or —CH═CH-aryl.
[0256] 8. A compound according to any of the preceding items having formula III, wherein R.sub.5 is H and R.sub.6 is selected from H, F, Cl, Br, I, Ph, or —CH═CH-aryl.
[0257] 9. A compound according to any of the preceding items having formula III, wherein R.sub.5 is H and R.sub.6 is selected from H, F, Cl, Br, I, Ph, or —CH═CH-phenyl.
[0258] 10. A compound according to any of items 1-4, 5-9, wherein R.sub.3 is selected from
##STR00053##
[0259] or R.sub.4 is selected from
##STR00054##
[0260] 11. A compound according to items 1-4, 5-10, wherein R.sub.3 is
##STR00055##
[0261] 12. A compound according to any of items 1-4, 10 having formula II, wherein R.sub.4 is H and R.sub.3 is
##STR00056##
[0262] 13. A compound according to any of the preceding items having one of the following structures
##STR00057##
[0263] 14. A compound according to any of the preceding items for use in medicine.
[0264] 15. A compound according to any of the preceding items for use in the treatment of acute brain injury as defined herein.
[0265] 16. Use of a compound according to any of claim 1-13 for the manufacture of a medicament for the treatment of acute brain injury as defined herein.
[0266] 17. A method for treating a subject suffering from acute brain injury, the treatment comprises administering to said subject an effective amount of a compound as defined in any of items 1-13.
[0267] 18. A compound according to formula I
##STR00058##
[0268] wherein R.sub.1 and R.sub.2 form a ring system to obtain a compound selected from
##STR00059##
[0269] wherein n is 0 or 1;
[0270] R.sub.3 is selected from H, -Me, -Et, —Pr, -iPr, -Bu, -tBu, -benzyl, polyethylenglycolyl (PEG), or a group such as
##STR00060##
[0271] wherein R.sub.9 is selected from -Me, -Et, —Pr, -iPr, -Bu or -tBu, and wherein R.sub.10 is selected from H, -Me, -Et, -iPr;
[0272] R.sub.4 is selected from H, —C(═O)-Me, —C(═O)-Et, —C(═O)—Pr, —C(═O)-iPr, —C(═O)—Bu, —C(═O)-tBu, —C(═O)-benzyl, polyethylenglycolyl (PEG), or a groups such as
##STR00061##
[0273] wherein R.sub.11 is selected from -Me, -Et, —Pr, -iPr, -Bu or -tBu, and wherein R.sub.12 is selected from H, -Me, -Et, -iPr;
[0274] R.sub.5, R.sub.6, R.sub.7, and R.sub.8 are independently from each other selected from H, F, Cl, Br, I, aryl, straight or branched C.sub.1-8 alkyl, —CH.sub.2(CH.sub.2).sub.p-aryl, —CH═CH-aryl, NH.sub.2, NO.sub.2, OH, SH, straight or branched —O—C.sub.1-8 alkyl, straight or branched —S—C.sub.1-8 alkyl, straight or branched —NH—C.sub.1-8 alkyl, —O-aryl, —S-aryl, —NH-aryl, wherein aryl includes aryl having one or more heteroatoms selected from O, N or S, and wherein p is 0 or 1;
[0275] m is 0 or 1; and
[0276] X is N, O, S, CH.sub.2
[0277] or a pharmaceutically acceptable salt thereof
[0278] for use in the treatment of acute brain injury.
[0279] 19. A compound for use according to item 18, wherein the compound is selected from
##STR00062##