OLIGONUCLEOTIDES FOR MODULATING GSK3B EXPRESSION

20210095275 · 2021-04-01

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to antisense oligonucleotides that are capable of reducing expression of GSK3B in a target cell. The antisense oligonucleotides hybridize to GSK3B pre-mRNA. The present invention further relates to conjugates of the antisense oligonucleotide, pharmaceutical salts and pharmaceutical compositions and methods for treatment or alleviation of conditions such as cancer, inflammatory diseases, neurological diseases, neurological injury, neuronal degeneration, psychiatric diseases and Type 2 diabetes.

Claims

1. An antisense oligonucleotide, of 10 to 50 nucleotides in length, which comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length which is at least 90% complementary, such as fully complementary, to a mammalian GSK3B target nucleic acid, wherein the antisense oligonucleotide is capable of reducing the expression of the mammalian GSK3B encoding target nucleic acid in a cell.

2. The antisense oligonucleotide according to claim 1, wherein the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary to a sequence selected from the group consisting of SEQ ID NO: 1, 2, 3, and 4, or a naturally occurring variant thereof.

3. The antisense oligonucleotide according to claim 1, wherein the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary, to an intron region present in the pre-mRNA of mammalian GSK3B target nucleic acid (e.g. SEQ ID NO 1).

4. The antisense oligonucleotide according to claim 1, wherein the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary, to an intron region present in the pre-mRNA of human GSK3B, selected from position 1072-92178 of SEQ ID NO: 1; position 92373-147066 of SEQ ID NO: 1; position 147151-170934 of SEQ ID NO: 1; position 171046-178243 of SEQ ID NO: 1; position 178375-181607 of SEQ ID NO: 1; position 181715-188565 of SEQ ID NO: 1; position 188664-217909 of SEQ ID NO: 1; position 218006-230812 of SEQ ID NO: 1; position 231000-251064 of SEQ ID NO: 1 and position 251164-267562 of SEQ ID NO: 1.

5. The antisense oligonucleotide according to claim 1, wherein the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary, to position 1072-92178 of the human pre-mRNA of mammalian GSK3B target nucleic acid, e.g. SEQ ID NO: 1; or position 181715-188565 of the human pre-mRNA of mammalian GSK3B target nucleic acid, e.g. SEQ ID NO: 1.

6. The antisense oligonucleotide according to claim 1, wherein the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary, to SEQ ID NO 5 or SEQ ID NO: 20.

7. The antisense oligonucleotide according to claim 1, wherein the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary to a target region of SEQ ID NO 1, selected from the group consisting of position 184511-184530, 184587-184606, 184663-184682, 184739-184758, 184815-184834; 184512-184531, 184588-184607, 184664-184683, 184740-184759, 184816-184835; 184512-184529, 184588-184605, 184664-184681, 184740-184757, 184816-184833; 184513-184528, 184589-184604, 184665-184680, 184741-184756, 184817-184832; 184513-184526, 184589-184602, 184665-184678, 184741-184754, 184817-184830; 184518-184531, 184594-184607, 184670-184683, 184746-184759, 184822-184835; 56154-56173, 56154-56171, 56154-56169, and 56154-56167 of SEQ ID NO 1.

8. The antisense oligonucleotide according to claim 1, wherein the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary, to a target region of 10-22, such as 14-20, nucleotides in length of the target nucleic acid of SEQ ID NO: 1, wherein the target region is repeated at least 5 times across the target nucleic acid.

9. The antisense oligonucleotide according to claim 1, wherein the contiguous nucleotide sequence is at least 90% identical, such as is 100% identical to a sequence selected from the group consisting of SEQ ID NO: 10, 11, 12, 13, 14 and 15.

10. The antisense oligonucleotide according to claim 1, wherein the contiguous nucleotide sequence consists or comprises of a sequence selected from the group consisting of SEQ ID NO: 10, 11, 12, 13, 14 and 15.

11. The antisense oligonucleotide of claim 1, wherein the contiguous nucleotide sequence comprises one or more 2′ sugar modified nucleosides.

12. The antisense oligonucleotide of claim 11, wherein the one or more 2′ sugar modified nucleosides are independently selected from the group consisting of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA, 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA and LNA nucleosides.

13. The antisense oligonucleotide of claim 11, wherein the one or more modified nucleosides are LNA nucleosides.

14. The antisense oligonucleotide of claim 11, where the contiguous nucleotide sequence comprises at least one modified internucleoside linkage.

15. The antisense oligonucleotide of claim 14, wherein at least 50% such as at least 75%, such as at least 90%, such as all of the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.

16. The antisense oligonucleotide of claim 1, wherein the oligonucleotide is capable of recruiting RNase H.

17. The antisense oligonucleotide of claim 1, wherein the antisense oligonucleotide or contiguous nucleotide sequence thereof consists or comprises a gapmer of formula 5′-F-G-F′-3′, where region F and F′ independently comprise 1-8 nucleosides, of which 1-4 are 2′ sugar modified and define the 5′ and 3′ end of the F and F′ region, and G is a region between 6 and 16 nucleosides which are capable of recruiting RNaseH, such as a region comprising 6-16 DNA nucleosides.

18. The antisense oligonucleotide of claim 1, wherein the antisense oligonucleotide or contiguous nucleotide sequence thereof is selected from the group consisting of TAatggtctctattcagTTC (Compound ID 10_1); CTAatggtctctattcagTT (Compound ID 11_1); AATGgtctctattcaGTT (Compound ID 12_1); AATggtctctattcAGTT (Compound ID 12_2); ATGgtctctattCAGT (Compound ID 13_1); ATggtctctattCAGT (Compound ID 13_2); GGTctctattcAGT (Compound ID 14_1); CTAAtggtctCTAT (Compound ID 15_1); wherein capital letters represent LNA nucleosides, such as beta-D-oxy LNA, lower case letters represent DNA nucleosides, optionally all LNA C are 5-methyl cytosine, and at least one, preferably all internucleoside linkages are phosphorothioate internucleoside linkages.

19. A conjugate comprising the antisense oligonucleotide according to claim 1, and at least one conjugate moiety covalently attached to said oligonucleotide.

20. A pharmaceutically acceptable salt of the antisense gapmer oligonucleotide according to claim 1.

21. A pharmaceutical composition comprising the antisense oligonucleotide of claim 1 and a pharmaceutically acceptable diluent, solvent, carrier, salt and/or adjuvant.

22. An in vivo or in vitro method for reducing mammalian GSK3B expression in a target cell which is expressing the mammalian GSK3B, said method comprising administering the antisense oligonucleotide of claim 1 in an effective amount to said cell.

23. The antisense oligonucleotide of claim 1 for use in medicine.

24. The oligonucleotide of claim 1 for use in the prevention or alleviation of cancer, inflammatory diseases, neurological diseases, neurological injury, neuronal degeneration, psychiatric diseases and Type 2 diabetes.

25. Use of the antisense oligonucleotide of claim 1, for the preparation of a medicament for treatment or alleviation of cancer, inflammatory diseases, neurological diseases, neurological injury, neuronal degeneration, psychiatric diseases and Type 2 diabetes.

Description

DETAILED DESCRIPTION OF THE INVENTION

The Oligonucleotides of the Invention

[0243] The invention relates to oligonucleotides capable of downregulating the expression of GSK3B. The modulation is achieved by hybridizing to a target nucleic acid encoding GSK3B or which is involved in the regulation of GSK3B. The target nucleic acid may be a part of mammalian GSK3B sequence selected from the group consisting of SEQ ID NO: 1, 2, 3 and 4 or naturally occurring variants thereof.

[0244] The oligonucleotide of the invention is an antisense oligonucleotide, which targets GSK3B. In some embodiments the antisense oligonucleotide of the invention is capable of modulating the expression of the target by inhibiting or reducing target expression. Preferably, an inhibition of expression of at least 20% compared to the normal expression level of the target, more preferably at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% or 95% inhibition compared to the normal expression level of the target. In some embodiments oligonucleotides of the invention may be capable of inhibiting expression levels of GSK3B mRNA by at least 60% or 70% in vitro using HeLa cells. In some embodiments compounds of the invention may be capable of inhibiting expression levels of GSK3B protein by at least 50% in vitro using HeLa cells. Suitably, the examples provide assays which may be used to measure GSK3B RNA or protein inhibition (e.g. example 1). The target modulation is triggered by the hybridization between a contiguous nucleotide sequence of the oligonucleotide and the target nucleic acid. In some embodiments the oligonucleotide of the invention comprises mismatches between the oligonucleotide and the target nucleic acid. Despite mismatches hybridization to the target nucleic acid may still be sufficient to show a desired modulation of GSK3B expression. Reduced binding affinity resulting from mismatches may advantageously be compensated by increased number of nucleotides in the oligonucleotide and/or an increased number of modified nucleosides capable of increasing the binding affinity to the target, such as 2′ sugar modified nucleosides, including LNA, present within the oligonucleotide sequence.

[0245] An aspect of the present invention relates to a antisense oligonucleotide of 10 to 50, such as 10-30, nucleotides in length, which comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementarity, such as full complementarity, to a mammalian GSK3B target nucleic acid, wherein the antisense oligonucleotide is capable of reducing the expression of the mammalian GSK3B target nucleic acid in a cell.

[0246] An aspect of the present invention relates to an antisense oligonucleotide of 10 to 30 nucleotides in length, which comprises a contiguous nucleotide sequence of 10 to 22 nucleotides in length with at least 90% complementarity, such as full complementarity, to a mammalian GSK3B target nucleic acid, wherein the antisense oligonucleotide is capable of reducing the expression of the mammalian GSK3B target nucleic acid in a cell.

[0247] In some embodiments, the antisense oligonucleotide gapmer comprises a contiguous sequence which is at least 90% complementary, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, or 100% complementary with the target nucleic acid or the target sequence.

[0248] In a preferred embodiment the antisense gapmer oligonucleotide of the invention, or contiguous nucleotide sequence thereof is fully complementary (100% complementary) to the target nucleic acid or the target sequence, or in some embodiments may comprise one or two mismatches between the oligonucleotide and the target nucleic acid.

[0249] Another aspect of the present invention relates to the antisense oligonucleotide, wherein the contiguous nucleotide sequence is at least 90% complementary to a sequence selected from the group consisting of SEQ ID NO: 1, 2, 3 or 4, or a naturally occurring variant thereof.

[0250] In some embodiments the oligonucleotide sequence or contiguous nucleotide sequence is at least 90% complementary or at least 95% complementary such as fully complementary to a corresponding target sequence present in SEQ ID NO: 1 and SEQ ID NO: 4. In some embodiments the contiguous sequence of the antisense oligonucleotide is fully complementary to the mammalian GSK3B target nucleic acid.

[0251] In a preferred embodiment the oligonucleotide sequence or contiguous nucleotide sequence is 100% complementary to a corresponding target sequence present in SEQ ID NO: 1 and SEQ ID NO: 4.

[0252] Another aspect of the present invention relates to the antisense oligonucleotide, wherein the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary, to an intron region present in the pre-mRNA of mammalian target nucleic acid (e.g. SEQ ID NO 1).

[0253] It shall be understood that intron positions on SEQ ID NO: 1 may vary depending on different splicing of GSK3B pre-mRNA. In the context of the present invention any nucleotide sequence in the gene sequence or pre-mRNA that is removed from the pre-mRNA by RNA splicing during maturation of the final RNA product (mature mRNA) are introns irrespectively on their position on SEQ ID NO: 1. Table 1 provides the most common intron regions in SEQ ID NO: 1.

[0254] In some embodiments the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary, to an intron region present in the pre-mRNA of human GSK3B, selected from position 1072-92178 of SEQ ID NO 1; position 92373-147066 of SEQ ID NO 1; position 147151-170934 of SEQ ID NO 1; position 171046-178243 of SEQ ID NO 1; position 178375-181607 of SEQ ID NO 1; position 181715-188565 of SEQ ID NO 1; position 188664-217909 of SEQ ID NO 1; position 218006-230812 of SEQ ID NO 1; position 231000-251064 of SEQ ID NO 1 and position 251164-267562 of SEQ ID NO 1.

[0255] In some embodiments the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary, to position 181715-188565 of SEQ ID NO: 1 or to position 184509 to 184845 of SEQ ID NO: 1.

[0256] In some embodiments the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary, to position 1072-92178 of SEQ ID NO: 1 or to position 56154 to 56173 of SEQ ID NO: 1.

[0257] In some embodiments the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary, to SEQ ID NO: 5.

[0258] In some embodiments the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary, to SEQ ID NO: 20.

[0259] In some embodiments, the oligonucleotide or contiguous nucleotide sequence is complementary to a region of the target nucleic acid, wherein the target nucleic acid region is selected from the group consisting of position 184511-184530, 184587-184606, 184663-184682, 184739-184758, 184815-184834; 184512-184531, 184588-184607, 184664-184683, 184740-184759, 184816-184835; 184512-184529, 184588-184605, 184664-184681, 184740-184757, 184816-184833; 184513-184528, 184589-184604, 184665-184680, 184741-184756, 184817-184832; 184513-184526, 184589-184602, 184665-184678, 184741-184754, 184817-184830; 184518-184531, 184594-184607, 184670-184683, 184746-184759, 184822-184835; 56154-56173, 56154-56171, 56154-56169, 56154-56167, 267802-267821, 267802-267815, 267804-26821, or 267806-267821 of SEQ ID NO 1.

[0260] According to one aspect of the invention, the target sequence is repeated within the target nucleic acid, i.e. at least two identical target nucleotide sequences (target regions) of at least 10 nucleotides in length occur in the target nucleic acid at different positions. A repeated target region is generally between 10 and 50 nucleotides, such as between 11 and 30 nucleotides, such as between 12 and 25 nucleotides, such as between 13 and 22 nucleotides, such as between 14 and 20 nucleotides, such as between 15 and 19 nucleotides, such as between 16 and 18 nucleotides. In a preferred embodiment the repeated target region is between 14 and 20 nucleotides.

[0261] In one aspect the invention provides antisense oligonucleotides wherein the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary, to a target region that is repeated at least 2 times across the target nucleic acid of SEQ ID NO: 1. The effect of this is that several oligonucleotide compounds (with the same sequence) can hybridize to one or more target regions on the same target nucleic acid (at the same time), which may result in multiple cleavage events of the target nucleic acid when the oligonucleotide is administered to a cell or an animal or a human.

[0262] In some embodiments the oligonucleotide or the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary to a target region that is repeated at least 3 times, such as at least 4, 5, 6, 7, 8, 9 or 10 times, or that is repeated more than 10 times. In one embodiment the target region is repeated between 2 and 5 times within intron 6.

[0263] In a further embodiment the antisense oligonucleotide comprises a contiguous nucleotide sequence that is at least 90% complementary, such as fully complementary, to a target region of 10-22, such as 14-20, nucleotides in length of the target nucleic acid of SEQ ID NO: 1, wherein the target region is repeated at least 5 or more times across the introns of the target nucleic acid.

[0264] In some embodiments, the antisense oligonucleotide of the invention or the contiguous nucleotide sequence thereof is complementary to at least 5 repeated target regions in SEQ ID NO: 20.

[0265] In some embodiments, the oligonucleotide of the invention comprises or consists of 10 to 35 nucleotides in length, such as from 10 to 30, such as 11 to 22, such as from 12 to 20, such as from 14 to 18 or 14 to 16 contiguous nucleotides in length. Advantageously, the oligonucleotide comprises or consists of 14 to 20 nucleotides in length.

[0266] It is to be understood that any range given herein includes the range endpoints.

[0267] In some embodiments, the oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 22 or less nucleotides, such as 20 or less nucleotides, such as less than 18, such as 14, 15, 16 or 17 nucleotides.

[0268] In some embodiments, the contiguous nucleotide sequence comprises or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous nucleotides in length. In a preferred embodiment, the oligonucleotide comprises or consists of 14 to 20 nucleotides in length.

[0269] In some embodiments the antisense oligonucleotide or contiguous nucleotide sequence of the invention is at least 90% identical, such as 100% identical to a sequence selected from the group consisting of SEQ ID NO: 6, 7, 8 and 9, In some embodiments the antisense oligonucleotide or contiguous nucleotide sequence of the invention is at least 90% identical, such as 100% identical to a sequence selected from the group consisting of SEQ ID NO: 10, 11, 12, 13, 14 and 15, In some embodiments the antisense oligonucleotide or contiguous nucleotide sequence thereof consists or comprises of 10 to 30 contiguous nucleotides in length with at least 90% identity, preferably 100% identity to a sequence selected from SEQ ID NO 6, 7, 8 or 9.

[0270] In some embodiments the antisense oligonucleotide or contiguous nucleotide sequence thereof consists or comprises of 10 to 30 contiguous nucleotides in length with at least 90% identity, preferably 100% identity to a sequence selected from SEQ ID NO 10, 11, 12, 13, 14 or 15.

[0271] In some embodiments the antisense oligonucleotide or contiguous nucleotide sequence thereof consists or comprises of 12 to 20 contiguous nucleotides in length with at least 90% identity, preferably 100% identity to a sequence selected from SEQ ID NO 6, 7, 8, or 9.

[0272] In some embodiments the antisense oligonucleotide or contiguous nucleotide sequence thereof consists or comprises of 12 to 20 contiguous nucleotides in length with at least 90% identity, preferably 100% identity to a sequence selected from SEQ ID NO 10, 11, 12, 13, 14 or 15.

[0273] In some embodiments the antisense oligonucleotide or contiguous nucleotide sequence thereof consists or comprises of 14 to 20 contiguous nucleotides in length with at least 90% identity, preferably 100% identity to a sequence selected from SEQ ID NO 6, 7, 8 and 9.

[0274] In some embodiments the antisense oligonucleotide or contiguous nucleotide sequence thereof consists or comprises of 14 to 20 contiguous nucleotides in length with at least 90% identity, preferably 100% identity to a sequence selected from SEQ ID NO 10, 11, 12, 13, 14 or 15.

[0275] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof comprises a sequence selected from SEQ ID NO: 6, 7, 8 or 9.

[0276] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof comprises a sequence selected from SEQ ID NO: 10, 11, 12, 13, 14 or 15.

[0277] Another aspect of the present invention relates to the antisense oligonucleotide, wherein the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary, to an exon in the pre-mRNA of mammalian GSK3B target nucleic acid (e.g. SEQ ID NO 1).

[0278] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence targets exon 11 of a mammalian GSK3B target nucleic acid, such as position 267563 to 273095 of SEQ ID NO: 1.

[0279] In some embodiments, the antisense oligonucleotide or the contiguous nucleotide sequence is fully complementary to position 267802-267821 of SEQ ID NO: 1.

[0280] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence of the invention is at least 90% identical, such as 100% identical to a sequence selected from the group consisting of 16, 17, 18 and 19.

[0281] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof consists or comprises of 10 to 30 contiguous nucleotides in length with at least 90% identity, preferably 100% identity to a sequence selected from SEQ ID NO: 16, 17, 18 or 19.

[0282] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof consists or comprises of 12 to 20 contiguous nucleotides in length with at least 90% identity, preferably 100% identity to a sequence selected from SEQ ID NO: 16, 17, 18 or 19.

[0283] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof consists or comprises of 14 to 20 contiguous nucleotides in length with at least 90% identity, preferably 100% identity to a sequence selected from SEQ ID NO: 16, 17, 18 or 19.

[0284] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof comprises a sequence selected from SEQ ID NO: 16, 17, 18 or 19.

[0285] Oligonucleotide compounds represent specific designs of a motif sequence. Capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine, and 5-methyl DNA cytosines are presented by “e”, all internucleoside linkages are, preferably, phosphorothioate internucleoside linkages.

[0286] It is understood that the contiguous nucleobase sequences (motif sequence) can be modified to for example increase nuclease resistance and/or binding affinity to the target nucleic acid.

[0287] Modifications are described in the definitions and in the following paragraphs. Table 4 lists preferred designs of each motif sequence.

[0288] The pattern in which the modified nucleosides (such as high affinity modified nucleosides) are incorporated into the oligonucleotide sequence is generally termed oligonucleotide design.

[0289] The oligonucleotides of the invention are designed with modified nucleosides and DNA nucleosides. Advantageously, high affinity modified nucleosides are used.

[0290] In an embodiment, the oligonucleotide comprises at least 1 modified nucleoside, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15 or at least 16 modified nucleosides. In an embodiment the oligonucleotide comprises from 1 to 10 modified nucleosides, such as from 2 to 9 modified nucleosides, such as from 3 to 8 modified nucleosides, such as from 4 to 7 modified nucleosides, such as 6 or 7 modified nucleosides. Suitable modifications are described in the “Definitions” section under “modified nucleoside”, “high affinity modified nucleosides”, “sugar modifications”, “2′ sugar modifications” and Locked nucleic acids (LNA)″.

[0291] In an embodiment, the oligonucleotide comprises one or more sugar modified nucleosides, such as 2′ sugar modified nucleosides. Preferably the oligonucleotide of the invention comprise one or more 2′ sugar modified nucleoside independently selected from the group consisting of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA, 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA and LNA nucleosides. It is advantageous if one or more of the modified nucleoside(s) is a locked nucleic acid (LNA).

[0292] In a further embodiment the oligonucleotide comprises at least one modified internucleoside linkage. Suitable internucleoside modifications are described in the “Definitions” section under “Modified internucleoside linkage”. It is advantageous if at least 75%, such as all, the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioateinternucleoside linkages. In some embodiments all the internucleotide linkages in the contiguous sequence of the oligonucleotide are phosphorothioate linkages.

[0293] In some embodiments, the oligonucleotide of the invention comprises at least one LNA nucleoside, such as 1, 2, 3, 4, 5, 6, 7, or 8 LNA nucleosides, such as from 2 to 6 LNA nucleosides, such as from 3 to 7 LNA nucleosides, 4 to 8 LNA nucleosides or 3, 4, 5, 6, 7 or 8 LNA nucleosides. In some embodiments, at least 75% of the modified nucleosides in the oligonucleotide are LNA nucleosides, such as 80%, such as 85%, such as 90% of the modified nucleosides are LNA nucleosides. In a still further embodiment all the modified nucleosides in the oligonucleotide are LNA nucleosides. In a further embodiment, the oligonucleotide may comprise both beta-D-oxy-LNA, and one or more of the following LNA nucleosides: thio-LNA, amino-LNA, oxy-LNA, ScET and/or ENA in either the beta-D or alpha-L configurations or combinations thereof. In a further embodiment, all LNA cytosine units are 5-methyl-cytosine. It is advantageous for the nuclease stability of the oligonucleotide or contiguous nucleotide sequence to have at least 1 LNA nucleoside at the 5′ end and at least 2 LNA nucleosides at the 3′ end of the nucleotide sequence.

[0294] In an embodiment of the invention the oligonucleotide of the invention is capable of recruiting RNase H.

[0295] In the current invention an advantageous structural design is a gapmer design as described in the “Definitions” section under for example “Gapmer”, “LNA Gapmer”, “MOE gapmer” and “Mixed Wing Gapmer” “Alternating Flank Gapmer”. The gapmer design includes gapmers with uniform flanks, mixed wing flanks, alternating flanks, and gapbreaker designs. In the present invention it is advantageous if the oligonucleotide of the invention is a gapmer with an F-G-F′ design. In some embodiments the gapmer is an LNA gapmer with uniform flanks.

[0296] In some embodiments of the invention the LNA gapmer is selected from the following uniform flank designs In preferred embodiments the F-G-F′ design is selected from 2-15-3; 3-15-2; 4-11-3; 3-11-4; 3-9-4, 2-10-4; 3-8-3; 4-6-4.

Exemplary Compounds of the Invention

[0297] In the exemplified oligonucleotide compounds, capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine, and 5-methyl DNA cytosines are presented by “e” or .sup.mc, all internucleoside linkages are phosphorothioate internucleoside linkages.

[0298] For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP-ID-NO: 10_1; 11_1, 12_1, 12_2, 13_1, 13_2, 14_1 or 15_1.

[0299] For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP-ID-NO: 122, 13_1, 13_2 or 14_1.

[0300] For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP-ID-NO: 6_1, 7_1, 8_1 or 9_1.

[0301] For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP-ID-NO: 16_1, 17_1, 18_1 or 19_1.

Method of Manufacture

[0302] In a further aspect, the invention provides methods for manufacturing the oligonucleotides of the invention comprising reacting nucleotide units and thereby forming covalently linked contiguous nucleotide units comprised in the oligonucleotide. Preferably, the method uses phophoramidite chemistry (see for example Caruthers et al, 1987, Methods in Enzymology vol. 154, pages 287-313). In a further embodiment the method further comprises reacting the contiguous nucleotide sequence with a conjugating moiety (ligand). In a further aspect a method is provided for manufacturing the composition of the invention, comprising mixing the oligonucleotide or conjugated oligonucleotide of the invention with a pharmaceutically acceptable diluent, solvent, carrier, salt and/or adjuvant.

Pharmaceutical Salt

[0303] In a further aspect the invention provides a pharmaceutically acceptable salt of the antisense oligonucleotide or a conjugate thereof. In a preferred embodiment, the pharmaceutically acceptable salt is a sodium or a potassium salt.

Pharmaceutical Composition

[0304] In a further aspect, the invention provides pharmaceutical compositions comprising any of the aforementioned oligonucleotides and/or oligonucleotide conjugates or salts thereof and a pharmaceutically acceptable diluent, carrier, salt and/or adjuvant. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS) and pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In some embodiments the pharmaceutically acceptable diluent is sterile phosphate buffered saline. In some embodiments the oligonucleotide is used in the pharmaceutically acceptable diluent at a concentration of 50-300 μM solution.

[0305] Suitable formulations for use in the present invention are found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, Pa., 17th ed., 1985. For a brief review of methods for drug delivery, see, e.g., Langer (Science 249:1527-1533, 1990). WO 2007/031091 provides further suitable and preferred examples of pharmaceutically acceptable diluents, carriers and adjuvants (hereby incorporated by reference). Suitable dosages, formulations, administration routes, compositions, dosage forms, combinations with other therapeutic agents, pro-drug formulations are also provided in WO2007/031091.

[0306] Oligonucleotides or oligonucleotide conjugates of the invention may be mixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

[0307] These compositions may be sterilized by conventional sterilization techniques, or may be sterile filtered. The resulting aqueous solutions may be packaged for use as is, or lyophilized, the lyophilized preparation being combined with a sterile aqueous carrier prior to administration. The pH of the preparations typically will be between 3 and 11, more preferably between 5 and 9 or between 6 and 8, and most preferably between 7 and 8, such as 7 to 7.5. The resulting compositions in solid form may be packaged in multiple single dose units, each containing a fixed amount of the above-mentioned agent or agents, such as in a sealed package of tablets or capsules. The composition in solid form can also be packaged in a container for a flexible quantity, such as in a squeezable tube designed for a topically applicable cream or ointment.

[0308] In some embodiments, the oligonucleotide or oligonucleotide conjugate of the invention is a prodrug. In particular with respect to oligonucleotide conjugates the conjugate moiety is cleaved of the oligonucleotide once the prodrug is delivered to the site of action, e.g. the target cell.

Applications

[0309] The oligonucleotides of the invention may be utilized as research reagents for, for example, diagnostics, therapeutics and prophylaxis.

[0310] In research, such oligonucleotides may be used to specifically modulate the synthesis of GSK3B protein in cells (e.g. in vitro cell cultures) and experimental animals thereby facilitating functional analysis of the target or an appraisal of its usefulness as a target for therapeutic intervention. Typically the target modulation is achieved by degrading or inhibiting the pre-mRNA or mRNA producing the protein, thereby prevent protein formation or by degrading or inhibiting a modulator of the gene or mRNA producing the protein. Further advantages may be achieved by targeting pre-mRNA thereby preventing formation of the mature mRNA.

[0311] If employing the oligonucleotide of the invention in research or diagnostics the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA.

[0312] The present invention provides an in vivo or in vitro method for modulating GSK3B expression in a target cell, which is expressing GSK3B, said method comprising administering an oligonucleotide of the invention in an effective amount to said cell.

[0313] In some embodiments, the target cell, is a mammalian cell in particular a human cell. The target cell may be an in vitro cell culture or an in vivo cell forming part of a tissue in a mammal. In preferred embodiments the target cell is present in a tumor, in the liver, in adipose tissue, in peripheral nerves or in the CNS. In particular, target cells in the brain, in neurons, such as peripheral neurons, axon cells or ganglion, such as dorsal root ganglia or basal ganglia or neve fibers are of interest.

[0314] In diagnostics the oligonucleotides may be used to detect and quantitate GSK3B expression in cell and tissues by northern blotting, in-situ hybridisation or similar techniques.

[0315] For therapeutics, an animal or a human, suspected of having a disease or disorder, which can be treated by modulating the expression of GSK3B.

[0316] The invention provides methods for treating or preventing a disease, comprising administering a therapeutically or prophylactically effective amount of an oligonucleotide, an oligonucleotide conjugate or a pharmaceutical composition of the invention to a subject suffering from or susceptible to the disease.

[0317] The invention also relates to an oligonucleotide, a composition or a conjugate as defined herein for use as a medicament.

[0318] The oligonucleotide, oligonucleotide conjugate or a pharmaceutical composition according to the invention is typically administered in an effective amount.

[0319] The invention also provides for the use of the oligonucleotide or oligonucleotide conjugate of the invention as described for the manufacture of a medicament for the treatment of a disorder as referred to herein, or for a method of the treatment of as a disorder as referred to herein.

[0320] The disease or disorder, as referred to herein, is associated with expression of GSK3B.

[0321] The methods of the invention are preferably employed for treatment or prophylaxis against diseases caused by abnormal levels and/or activity of GSK3B.

[0322] The invention further relates to use of an oligonucleotide, oligonucleotide conjugate or a pharmaceutical composition as defined herein for the manufacture of a medicament for the treatment of abnormal levels and/or activity of GSK3B.

[0323] In one embodiment, the invention relates to oligonucleotides, oligonucleotide conjugates or pharmaceutical compositions for use in the treatment or alleviation of diseases or disorders selected from of cancer, inflammatory disease, neurological diseases, neurological injury, neuronal degeneration, psychiatric diseases and Type 2 diabetes.

[0324] Cancers where GSK3B downregulation may be beneficial, can be selected from the group consisting of hepatocellular carcinoma (HHC), breast cancer, ovarian cancer, prostate cancer, colon cancer, renal cancer, thyroid cancer, pancreatic cancer and leukemia. The oligonucleotides, oligonucleotide conjugates or pharmaceutical compositions of the present invention may be advantageous in the treatment of hepatocellular carcinoma (HHC), in particular if associated with Type 2 diabetes.

[0325] Type 2 diabetes patients also benefit from treatment with oligonucleotides, oligonucleotide conjugates or pharmaceutical compositions of the present invention, by stimulating insulin-dependent removal of sugar from the blood.

[0326] Inflammatory disease where GSK3B downregulation may be beneficial can be selected from the group consisting of asthma, arthritis, colitis, and peritonitis.

[0327] Neurological diseases, and neuronal degeneration where GSK3B downregulation may be beneficial encompasses diseases such as Alzheimer's disease, Down syndrome, fragile X syndrome, Huntington's disease Parkinson's disease, spinocerebellar ataxia type 1 as well as neurological disorders resulting from traumatic brain injury, stroke, and related conditions that involve axonal disconnection. In particular, the cognitive functions in patients with these diseases may be improved following treatment with oligonucleotides, oligonucleotide conjugates or pharmaceutical compositions of the present invention.

[0328] Neurological injury where GSK3B downregulation may be beneficial is for example traumatic injury to the peripheral nervous system, where axon and peripheral nerve growth may be stimulated to improve or restore peripheral nerve function.

[0329] Psychiatric disease where GSK3B downregulation may be beneficial may be selected from bipolar disorder, depression, anxiety or schizophrenia.

Administration

[0330] The oligonucleotides or pharmaceutical compositions of the present invention may be administered enteral (such as, orally or through the gastrointestinal tract) or parenteral (such as, intravenous, subcutaneous, intra-muscular, intracerebral, intracerebroventricular or intrathecal).

[0331] In a non-limiting embodiment the antisense oligonucleotide, a conjugate, a pharmaceutical salt or pharmaceutical compositions of the present invention are administered by a parenteral route including intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion.

[0332] In one embodiment the active oligonucleotide or oligonucleotide conjugate or pharmaceutical composition is administered intravenously.

[0333] In another embodiment the active oligonucleotide or oligonucleotide conjugate or pharmaceutical composition is administered subcutaneously.

[0334] Alternatively, the oligonucleotides can be administered locally, e.g. via injection into the affected neurons such as peripheral neurons or injection into ganglion, such as dorsal root ganglia or basal ganglia or injection in the area surrounding the affected neurons or neve fibers or injection into a joint with neuronal damage.

[0335] The oligonucleotides can also be administered locally into the central nervous system (CNS) for example via intracranial, e.g. intracerebral or intraventricular, intravitreal administration or via the cerebrospinal fluid (CSF) using intrathecal administration or lumbar puncture. In one embodiment the active oligonucleotide or oligonucleotide conjugate is administered locally. In another embodiment the active oligonucleotide or oligonucleotide conjugate is administered to the CNS.

[0336] In some embodiments, the antisense oligonucleotide, oligonucleotide conjugate or pharmaceutical composition of the invention is administered at a dose of 0.1-15 mg/kg, such as from 0.2-10 mg/kg, such as from 0.25-5 mg/kg. The administration can be once a week, every 2.sup.nd week, every third week or even once a month.

[0337] The invention also provides for the use of the antisense oligonucleotide or oligonucleotide conjugate of the invention as described for the manufacture of a medicament wherein the medicament is in a dosage form for subcutaneous administration. The invention also provides for the use of the oligonucleotide or oligonucleotide conjugate of the invention as described for the manufacture of a medicament wherein the medicament is in a dosage form for intravenous administration. The invention also provides for the use of the oligonucleotide or oligonucleotide conjugate of the invention as described for the manufacture of a medicament wherein the medicament is in a dosage form for local administration. The invention also provides for the use of the oligonucleotide or oligonucleotide conjugate of the invention as described for the manufacture of a medicament wherein the medicament is in a dosage form for CNS or CSF administration. The invention also provides for the use of the oligonucleotide or oligonucleotide conjugate of the invention as described for the manufacture of a medicament wherein the medicament is in a dosage form for intrathecal administration.

Embodiments

[0338] The following embodiments of the present invention may be used in combination with any other embodiments described herein.

1. An antisense oligonucleotide of 10 to 50 nucleotides in length, which comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementarity, such as fully complementary, to a mammalian GSK3B target nucleic acid, wherein the antisense oligonucleotide is capable of reducing the expression of the mammalian GSK3B target nucleic acid, in a cell.
2. The antisense oligonucleotide according to embodiment 1, wherein the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary to a sequence selected from the group consisting of SEQ ID NO: 1, 2, 3, and 4, or a naturally occurring variant thereof.
3. The antisense oligonucleotide of embodiments 1 or 2, wherein the contiguous nucleotide sequence is fully complementary to the mammalian GSK3B target sequence.
4. The antisense oligonucleotide of any of embodiments 1 to 3, wherein the wherein the contiguous nucleotide sequence targets exon 11 of a mammalian GSK3B target nucleic acid, such as position 267563 to 273095 of SEQ ID NO: 1.
5. The antisense oligonucleotide of any of embodiments 1 to 4, wherein the contiguous nucleotide sequence is fully complementary to position 267802-267821 of SEQ ID NO: 1.
6. The antisense oligonucleotide of any of embodiments 1 to 3, wherein the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary, to an intron region present in the pre-mRNA of mammalian GSK3B target nucleic acid (e.g. SEQ ID NO 1).
7. The antisense oligonucleotide according to any of embodiments 1 to 3 or 6, wherein the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary, to an intron region present in the pre-mRNA of human GSK3B, selected from intron 1 (1072-92178 of SEQ ID NO: 1); intron 2 (92373-147066 of SEQ ID NO: 1); intron 3 (147151-170934 of SEQ ID NO 1); intron 4 (171046-178243 of SEQ ID NO: 1); intron 5 (171046-178243 of SEQ ID NO: 1); intron 6 (181715-188565 of SEQ ID NO: 1); intron 7 (188664-217909 of SEQ ID NO: 1); intron 8 (218006-230812 of SEQ ID NO: 1); intron 9 (231000-251064 of SEQ ID NO: 1) and intron 10 (251164-267562 of SEQ ID NO: 1).
8. The antisense oligonucleotide according to any one of embodiments 1 to 3 or 6 or 7, wherein the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary, to position 181715-188565 of SEQ ID NO: 1 or to position 184509 to 184845 of SEQ ID NO: 1.
9. The antisense oligonucleotide according to any of embodiments 1 to 3, 6 or 7, wherein the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary, to position 1072-92178 of SEQ ID NO: 1 or to position 56154 to 56173 of SEQ ID NO: 1.
10. The antisense oligonucleotide according to any of embodiments 1 to 3, 6 or 7, wherein the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary, to SEQ ID NO: 5 or SEQ ID NO: 20.
11. The antisense oligonucleotide of any one of embodiments 1 to 3, 6 to 8 or 10, wherein the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary, to a target region of SEQ ID NO 1, selected from the group consisting of position 184511-184530, 184587-184606, 184663-184682, 184739-184758, 184815-184834; 184512-184531, 184588-184607, 184664-184683, 184740-184759, 184816-184835; 184512-184529, 184588-184605, 184664-184681, 184740-184757, 184816-184833; 184513-184528, 184589-184604, 184665-184680, 184741-184756, 184817-184832; 184513-184526, 184589-184602, 184665-184678, 184741-184754, 184817-184830; 184518-184531, 184594-184607, 184670-184683, 184746-184759, and 184822-184835 of SEQ ID NO 1.
12. The antisense oligonucleotide according to any of embodiments 1 to 3, 6 to 8, 10 or 11, wherein the contiguous nucleotide sequence is at least 90% complementary, such as fully complementary, to a target sequence of 10-22, such as 14-20 nucleotides in length of the target nucleic acid of SEQ ID NO: 1, wherein the target sequence is repeated at least 5 or more times across the target nucleic acid.
13. The antisense oligonucleotide of any one of embodiments 1 to 12, wherein the oligonucleotide is capable of hybridizing to a target nucleic acid selected from the group consisting of SEQ ID NO: 1, 2 and 3 with a ΔG° below −10 kcal.
14. The antisense oligonucleotide of embodiments 1 to 13, wherein the target nucleic acid is RNA.
15. The antisense oligonucleotide of embodiment 14, wherein the mRNA is pre-mRNA or mature mRNA.
16. The antisense oligonucleotide of any of embodiments 1 to 15, wherein the contiguous nucleotide sequence comprises or consists of at least 10 contiguous nucleotides, particularly 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29 contiguous nucleotides.
17. The antisense oligonucleotide of embodiments 1 to 16, wherein the contiguous nucleotide sequence comprises or consists of from 12 to 22 nucleotides.
18. The antisense oligonucleotide of any one of embodiments 1 to 17, wherein the contiguous nucleotide sequence comprises or consists of from 14 to 20 nucleotides.
19. The antisense oligonucleotide of any one of embodiments 1 to 16, wherein the antisense oligonucleotide comprises or consists of 12 to 35 nucleotides in length.
20. The antisense oligonucleotide of any one of embodiments 1 to 16, wherein the antisense oligonucleotide comprises or consists of 14 to 25 nucleotides in length.
21. The antisense oligonucleotide of any one of embodiments 1 to 20, wherein the oligonucleotide or contiguous nucleotide sequence is single stranded.
22. The antisense oligonucleotide of any one of embodiments 1 to 21, wherein the oligonucleotide is neither siRNA nor self-complementary.
23. The antisense oligonucleotide of any one of embodiments 1 to 3, 6 to 8 or 10 to 22 excluding dependency on embodiments 4, 5 or 9, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from SEQ ID NO: 10, 11, 12, 13, 14 or 15.
24. The antisense oligonucleotide of any one of embodiments 1 to 5, or 13 to 22 (excluding dependency on embodiment 6 to 12), wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from SEQ ID NO: 6, 7, 8 or 9.
25. The antisense oligonucleotide of any one of embodiments 1 to 3, 6, 7, 9, or 13 to 22 (excluding dependency on embodiment 4, 5, 8 and 10 to 12), wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from SEQ ID NO: 16, 17, 18 or 19.
26. The antisense oligonucleotide of any one of embodiments 1 to 23, wherein the contiguous nucleotide sequence has zero to three mismatches compared to the target nucleic acid it is complementary to.
27. The antisense oligonucleotide of embodiment 26, wherein the contiguous nucleotide sequence has one mismatch compared to the target nucleic acid.
28. The antisense oligonucleotide of embodiment 26, wherein the contiguous nucleotide sequence has two mismatches compared to the target nucleic acid.
29. The antisense oligonucleotide of any one of embodiments 1 to 28, comprising one or more modified nucleosides.
30. The antisense oligonucleotide of embodiment 29, wherein the one or more modified nucleoside is a high-affinity modified nucleosides.
31. The antisense oligonucleotide of any one of embodiments 29 or 30, wherein the one or more modified nucleoside is a 2′ sugar modified nucleoside.
32. The antisense oligonucleotide of embodiment 31, wherein the one or more 2′ sugar modified nucleoside is independently selected from the group consisting of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA, 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA and LNA nucleosides.
33. The antisense oligonucleotide of any one of embodiments 31 or 32, wherein the antisense oligonucleotide comprises 3 to 6 2′ sugar modified nucleosides.
34. The antisense oligonucleotide of any one of embodiments 1 to 33, wherein the oligonucleotide comprises at least one modified internucleoside linkage.
35. The antisense oligonucleotide of embodiment 34, wherein the modified internucleoside linkage is nuclease resistant.
36. The antisense oligonucleotide of any one of embodiments 34 or 35, wherein at least 50% of the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages internucleoside linkages.
37. The antisense oligonucleotide of any one of embodiments 34 to 36, wherein all the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.
38. The antisense oligonucleotide of any one of embodiments 1 to 37, wherein the oligonucleotide is capable of recruiting RNase H.
39. The antisense oligonucleotide of embodiment 38, wherein the oligonucleotide is a gapmer.
40. The antisense oligonucleotide of any one of embodiments 1 to 39, wherein the antisense oligonucleotide or contiguous nucleotide sequence thereof consists of or comprises a gapmer of formula 5′-F-G-F′-3′, where region F and F′ independently comprise or consist of 1-8 nucleosides, of which 1-4 are 2′ sugar modified and defines the 5′ and 3′ end of the F and F′ region, and G is a region between 6 and 16 nucleosides which are capable of recruiting RNaseH.
41. The oligonucleotide of embodiment 40, wherein the 2′ sugar modified nucleoside independently is selected from the group consisting of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA, 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA and LNA nucleosides.
42. The antisense oligonucleotide of any one of embodiments 40 or 41, wherein one or more of the modified nucleosides in region F and F′ is a LNA nucleoside.
43. The antisense oligonucleotide of embodiment 42, wherein all the modified nucleosides in region F and F′ are LNA nucleosides.
44. The antisense oligonucleotide of embodiment 43, wherein region F and F′ consist of LNA nucleosides.
45. The antisense oligonucleotide of any one of embodiments 45 to 47, wherein all the modified nucleosides in region F and F′ are oxy-LNA nucleosides.
46. The antisense oligonucleotide of any one of embodiments 42-45, wherein the LNA nucleoside is selected from beta-D-oxy-LNA, alpha-L-oxy-LNA, beta-D-amino-LNA, alpha-L-amino-LNA, beta-D-thio-LNA, alpha-L-thio-LNA, (S)cET, (R)cET beta-D-ENA and alpha-L-ENA.
47. The antisense oligonucleotide of any one of embodiment 42-45, wherein the LNA nucleoside is oxy-LNA.
48. The antisense oligonucleotide of any one of embodiments 42-45, wherein the LNA nucleoside is beta-D-oxy-LNA.
49. The antisense oligonucleotide of any one of embodiments 42-45, wherein the LNA nucleoside is thio-LNA.
50. The antisense oligonucleotide of any one of embodiments 42-45, wherein the LNA nucleoside is amino-LNA.
51. The antisense oligonucleotide of embodiment any one of embodiments 42-45, wherein the LNA nucleoside is cET.
52. The antisense oligonucleotide of any one embodiment of 42-45, wherein the LNA nucleoside is ENA.
53. The antisense oligonucleotide of embodiment 42, wherein at least one of region F or F′ further comprises at least one 2′ sugar substituted nucleoside independently selected from the group consisting of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA, 2′-amino-DNA and 2′-fluoro-DNA.
54. The antisense oligonucleotide of any one of embodiments 40 to 53, wherein the RNaseH recruiting nucleosides in region G are independently selected from DNA, alpha-L-LNA, C4′ alkylated DNA, ANA and 2′F-ANA and UNA.
55. The antisense oligonucleotide of embodiment 54, wherein the nucleosides in region G is DNA and/or alpha-L-LNA nucleosides.
56. The antisense oligonucleotide of embodiment 54 or 55, wherein region G consists of at least 75% DNA nucleosides.
57. The antisense oligonucleotide of any one of embodiments 54 to 56, wherein all the nucleosides in region G are DNA nucleosides.
58. The antisense oligonucleotide according to any one of embodiments 1 to 3, 6 to 8, 10 to 23 (excluding dependency on embodiments 4, 5 or 9), 26 to 58 (excluding dependency on embodiments 4, 5, 9, 24 and 25), wherein the antisense oligonucleotide or contiguous nucleotide sequence thereof is selected from the group consisting of TAatggtctctattcagTTC (Compound ID 10_1); CTAatggtctctattcagTT (Compound ID 11_1); AATGgtctctattcaGTT (Compound ID 12_1); AATggtctctattcAGTT (Compound ID 12_2); ATGgtctctattCAGT (Compound ID 13_1); ATggtctctattCAGT (Compound ID 13_2); GGTctctattcAGT (Compound ID 14_1); and CTAAtggtctCTAT (Compound ID 15_1), wherein capital letters represent LNA nucleosides, such as beta-D-oxy LNA, lower case letters represent DNA nucleosides, optionally all LNA C are 5-methyl cytosine, and at least one, preferably all internucleoside linkages are phosphorothioate internucleoside linkages.
59. The oligonucleotide of embodiment 58, wherein the oligonucleotide is selected from CMP ID NO:10_1; 11_1; 12_1; 12_2; 13_1; 13_2; 14_1 or 15_1.
60. The antisense oligonucleotide according to any one of embodiments 1 to 3, 6, 7, 9, 13 to 22 (excluding dependency on embodiment 4, 5, 8 10 to 12), 24, or 26 to 58 (excluding dependency on embodiments 4, 5, 8, 10 to 12, 23 and 25), wherein the antisense oligonucleotide or contiguous nucleotide sequence thereof is selected from the group consisting of TTAgttatcataattcacCC (Compound ID 6_1); AGTTatcataattcacCC (Compound ID 7_1); TTATcataattcACCC (Compound ID 8_1); and ATCAtaattcACCC (Compound ID 9_1), wherein capital letters represent LNA nucleosides, such as beta-D-oxy LNA, lower case letters represent DNA nucleosides, optionally all LNA C are 5-methyl cytosine, and at least one, preferably all internucleoside linkages are phosphorothioate internucleoside linkages.
61. The oligonucleotide of embodiment 60, wherein the oligonucleotide is selected from CMP ID NO: 6_1; 7_1; 8_1; or 9_1.
62. The antisense oligonucleotide according to any one of embodiments 1 to 5, 13 to 22 (excluding dependency on embodiment 6 to 12), 25 or 26 to 58 (excluding dependency on embodiments on embodiment 6 to 12, 23 and 24), wherein the antisense oligonucleotide or contiguous nucleotide sequence thereof is selected from the group consisting of ATGAaattggtttgtaTTTA (Compound ID 16_1); TTGGtttgtaTTTA (Compound ID 17_1), ATGAaattggtttgTATT (Compound ID 18_1), and ATGAaattggttTGTA (Compound ID 19_1), wherein capital letters represent LNA nucleosides, such as beta-D-oxy LNA, lower case letters represent DNA nucleosides, optionally all LNA C are 5-methyl cytosine, and at least one, preferably all internucleoside linkages are phosphorothioate internucleoside linkages.
63. The oligonucleotide of embodiment 62, wherein the oligonucleotide is selected from CMP ID NO: 16_1; 17_1; 18_1; and 19_1.
64. A conjugate comprising the antisense oligonucleotide according to any one of embodiments 1 to 63, and at least one conjugate moiety covalently attached to said antisense oligonucleotide.
65. The antisense oligonucleotide conjugate of embodiment 64, wherein the conjugate moiety is selected from carbohydrates, cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins, peptides, toxins, vitamins, viral proteins or combinations thereof.
66. The antisense oligonucleotide conjugate of embodiment 64 or 65, wherein the conjugate moiety is capable of binding to the asialoglycoprotein receptor.
67. The antisense oligonucleotide conjugate of any one of embodiments 64 to 66, comprising a linker which is positioned between the antisense oligonucleotide and the conjugate moiety.
68. The antisense oligonucleotide conjugate of embodiment 67, wherein the linker is a physiologically labile linker.
69. The antisense oligonucleotide conjugate of embodiment 68, wherein the physiologically labile linker is nuclease susceptible linker.
70. The antisense oligonucleotide conjugate of embodiments 64 to 69, wherein the oligonucleotide has the formula D′—F-G-F′ or F-G-F′-D″, wherein F, F′ and G are as defined in embodiments 40 to 57 and D′ or D″ comprises 1, 2 or 3 DNA nucleosides with phosphorothioate internucleoside linkages.
71. A pharmaceutically acceptable salt of the antisense oligonucleotide according to any one of embodiments 1 to 63 or the conjugate according to any of embodiments 64 to 70.
72. A pharmaceutical composition comprising the antisense oligonucleotide of any one of embodiments 1 to 63 or the conjugate according to any of embodiments 64 to 70, or the pharmaceutically acceptable salt of embodiment 71 and a pharmaceutically acceptable diluent, carrier, salt and/or adjuvant.
73. A method for manufacturing the antisense oligonucleotide of any one of embodiments 1 to 63, comprising reacting nucleotide units thereby forming covalently linked contiguous nucleotide units comprised in the oligonucleotide.
74. The method of embodiment 73, further comprising reacting the contiguous nucleotide sequence with a non-nucleotide conjugation moiety.
75. A method for manufacturing the composition of embodiment 72, comprising mixing the oligonucleotide with a pharmaceutically acceptable diluent, carrier, salt and/or adjuvant.
76. An in vivo or in vitro method for reducing GSK3B expression in a target cell which is expressing the mammalian GSK3B, said method comprising administering the antisense oligonucleotide of any one of embodiments 1 to 63 or the conjugate according to any of embodiments 64 to 70 or the pharmaceutical salt of embodiment 71 or the pharmaceutical composition of embodiment 72 in an effective amount to said cell.
77. A method for treating, alleviating or preventing a disease comprising administering a therapeutically or prophylactically effective amount of the antisense oligonucleotide of any one of embodiments 1 to 63 or the conjugate according to any of embodiments 64 to 70 or the pharmaceutical salt of embodiment 71 or the pharmaceutical composition of embodiment 72 to a subject suffering from or susceptible to the disease.
78. The antisense oligonucleotide of anyone of embodiments 1 to 63 or the conjugate according to any of embodiments 64 to 70 or the pharmaceutical salt of embodiment 71 or the pharmaceutical composition of embodiment 72, for use as a medicament for treatment alleviation or prevention of a disease in a subject.
79. Use of the oligonucleotide of antisense oligonucleotide of any one of embodiment 1 to 63 or the conjugate according to any of embodiments 64 to 70 for the preparation of a medicament for treatment or prevention of a disease in a subject.
80. The method, the antisense oligonucleotide or the use of any one of embodiments 76 to 79, wherein the disease is associated with in vivo activity of GSK3B.
81. The method, the antisense oligonucleotide or the use of any one of embodiments 76 to 80, wherein the disease is associated with overexpression of GSK3B gene and/or abnormal levels of GSK3B protein.
82. The method, the antisense oligonucleotide or the use of embodiment 81, wherein the GSK3B is reduced by at least 30%, or at least or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95% compared to the expression without the antisense oligonucleotide of embodiment 1 to 59 or the conjugate according to any of embodiments 64 to 70 or the pharmaceutical salt of embodiment 71 or the pharmaceutical composition of embodiment 72.
83. The method, the antisense oligonucleotide or the use of any one of embodiments 76 to 80, wherein the disease is cancer, such as hepatocellular carcinoma (HCC), breast cancer, ovarian cancer, prostate cancer, colon cancer, renal cancer, thyroid cancer, pancreatic cancer or leukemia.
84. The method, the antisense oligonucleotide or the use of any one of embodiments 76 to 80, wherein the disease is an inflammatory disease, such as asthma, arthritis, colitis, and peritonitis
85. The method, the antisense oligonucleotide or the use of any one of embodiments 76 to 80, wherein the disease is a neurological disorder such as Alzheimer's disease, Down syndrome, fragile X syndrome, Huntington's disease Parkinson's disease, spinocerebellar ataxia type 1, stroke or traumatic brain injury.
86. The method, the antisense oligonucleotide or the use of any one of embodiments 76 to 80, wherein the disease is neurological injury, such as traumatic injury to the peripheral nervous system.
87. The method, the antisense oligonucleotide or the use of any one of embodiments 76 to 80, wherein the disease is neuronal degeneration, such as multiple sclerosis.
88. The method, the antisense oligonucleotide or the use of any one of embodiments 76 to 80, wherein the disease is a psychiatric disease, such as bipolar disorder, depression, anxiety or schizophrenia.
89. The method, the antisense oligonucleotide or the use of any one of embodiments 76 to 80, wherein the disease is Type 2 diabetes.
90. The method, the antisense oligonucleotide or the use of any one of embodiments 76 to 89, wherein the subject is a mammal.
91. The method, the antisense oligonucleotide or the use of embodiment 90, wherein the mammal is a human.

Examples

Materials and Methods

[0339]

TABLE-US-00005 TABLE 4 list of oligonucleotide motif sequences (indicated by SEQ ID NO),  designs of these, as well as specific oligonucleotide compounds  (indicated by CMP ID NO) designed based on the motif sequence. SEQ CMP ID Oligonucleotide ID Start position  NO Motif sequence Design Compound NO  on SEQ ID NO: 1  6 TTAGTTATCATAATTCACCC 3-15-2 TTAgttatcataattcacCC  6_1 56154  7 AGTTATCATAATTCACCC 4-12-2 AGTTatcataattcacCC  7_1 56154  8 TTATCATAATTCACCC 4-8-4 TTATcataattcACCC  8_1 56154  9 ATCATAATTCACCC 4-6-4 ATCAtaattcACCC  9_1 56154 10 TAATGGTCTCTATTCAGTTC 2-15-3 TAatggtctctattcagTTC 10_1 184511, 184587, 184663, 184739, 184815 11 CTAATGGTCTCTATTCAGTT 3-15-2 CTAatggtctctattcagTT 11_1 184512, 184588, 184664, 184740, 184816 12 AATGGTCTCTATTCAGTT 4-11-3 AATGgtctctattcaGTT 12_1 184512, 184588, 184664, 184740, 184816 12 AATGGTCTCTATTCAGTT 3-11-4 AATggtctctattcAGTT 12_2 184512, 184588, 184664, 184740, 184816 13 ATGGTCTCTATTCAGT 3-9-4 ATGgtctctattCAGT 13_1 184513, 184589, 184665, 184741, 184817 13 ATGGTCTCTATTCAGT 2-10-4 ATggtctctattCAGT 13_2 184513, 184589, 184665, 184741, 184817 14 GGTCTCTATTCAGT 3-8-3 GGTctctattcAGT 14_1 184513, 184589, 184665, 184741, 184817 15 CTAATGGTCTCTAT 4-6-4 CTAAtggtctCTAT 15_1 184518, 184594, 184670, 184746, 184822 16 ATGAAATTGGTTTGTATTTA 4-12-4 ATGAaattggtttgtaTTTA 16_1 267802 17 TTGGTTTGTATTTA 4-6-4 TTGGtttgtaTTTA 17_1 267802 18 ATGAAATTGGTTTGTATT 4-10-4 ATGAaattggtttgTATT 18_1 267804 19 ATGAAATTGGTTTGTA 4-8-4 ATGAaattggttTGTA 19_1 267806 Motif sequences represent the contiguous sequence of nucleobases present in the oligonucleotide. Designs refer to the gapmer design, F-G-F′, where each number represents the number of consecutive modified nucleosides, e.g2′ modified nucleosides (first number = 5′ flank), followed by the number of DNA nucleosides (second number = gap region), followed by the number of modified nucleosides, e.g2′ modified nucleosides (third number = 3′ flank), optionally preceded by or followed by further repeated regions of DNA and LNA, which are not necessarily part of the contiguous sequence that is complementary to the target nucleic acid.

[0340] Oligonucleotide compounds represent specific designs of a motif sequence. Capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine, and 5-methyl DNA cytosines are presented by “e”, all internucleoside linkages are phosphorothioate internucleoside linkages.

Oligonucleotide Synthesis

[0341] Oligonucleotide synthesis is generally known in the art. Below is a protocol which may be applied. The oligonucleotides of the present invention may have been produced by slightly varying methods in terms of apparatus, support and concentrations used.

[0342] Oligonucleotides are synthesized on uridine universal supports using the phosphoramidite approach on an Oligomaker 48 at 1 μmol scale. At the end of the synthesis, the oligonucleotides are cleaved from the solid support using aqueous ammonia for 5-16 hours at 60° C. The oligonucleotides are purified by reverse phase HPLC (RP-HPLC) or by solid phase extractions and characterized by UPLC, and the molecular mass is further confirmed by ESI-MS.

Elongation of the Oligonucleotide:

[0343] The coupling of β-cyanoethyl-phosphoramidites (DNA-A(Bz), DNA-G(ibu), DNA-C(Bz), DNA-T, LNA-5-methyl-C(Bz), LNA-A(Bz), LNA-G(dmf), or LNA-T) is performed by using a solution of 0.1 M of the 5′-O-DMT-protected amidite in acetonitrile and DCI (4,5-dicyanoimidazole) in acetonitrile (0.25 M) as activator. For the final cycle a phosphoramidite with desired modifications can be used, e.g. a C6 linker for attaching a conjugate group or a conjugate group as such. Thiolation for introduction of phosphorthioate linkages is carried out by using xanthane hydride (0.01 M in acetonitrile/pyridine 9:1). Phosphordiester linkages can be introduced using 0.02 M iodine in TH/Pyridine/water 7:2:1. The rest of the reagents are the ones typically used for oligonucleotide synthesis.

[0344] For post solid phase synthesis conjugation a commercially available C6 aminolinker phorphoramidite can be used in the last cycle of the solid phase synthesis and after deprotection and cleavage from the solid support the aminolinked deprotected oligonucleotide is isolated. The conjugates are introduced via activation of the functional group using standard synthesis methods.

Purification by RP-HPLC:

[0345] The crude compounds are purified by preparative RP-HPLC on a Phenomenex Jupiter C18 10p 150×10 mm column. 0.1 M ammonium acetate pH 8 and acetonitrile is used as buffers at a flow rate of 5 mL/min. The collected fractions are lyophilized to give the purified compound typically as a white solid.

Abbreviations

[0346] DCI: 4,5-Dicyanoimidazole [0347] DCM: Dichloromethane [0348] DMF: Dimethylformamide [0349] DMT: 4,4′-Dimethoxytrityl [0350] THF: Tetrahydrofurane [0351] Bz: Benzoyl [0352] Ibu: Isobutyryl [0353] RP-HPLC: Reverse phase high performance liquid chromatography

T.SUB.m .Assay:

[0354] Oligonucleotide and RNA target (phosphate linked, PO) duplexes are diluted to 3 mM in 500 ml RNase-free water and mixed with 500 ml 2×T.sub.m-buffer (200 mM NaCl, 0.2 mM EDTA, 20 mM Naphosphate, pH 7.0). The solution is heated to 95° C. for 3 min and then allowed to anneal in room temperature for 30 min. The duplex melting temperatures (T.sub.m) is measured on a Lambda 40 UV/VIS Spectrophotometer equipped with a Peltier temperature programmer PTP6 using PE Templab software (Perkin Elmer). The temperature is ramped up from 20° C. to 95° C. and then down to 25° C., recording absorption at 260 nm. First derivative and the local maximums of both the melting and annealing are used to assess the duplex T.sub.m.

Example 1: Testing In Vitro Efficacy and Potency

[0355] Oligonucleotides targeting one region as well as oligonucleotides targeting at least three independent regions on GSK3B were tested in an in vitro experiment in HeLa cells. EC50 (potency) and max kd (efficacy) was assessed for the oligonucleotides.

Cell Lines

[0356] The HeLa cell line was purchased from European Collection of Authenticated Cell Cultures (ECACC) and maintained as recommended by the supplier in a humidified incubator at 37° C. with 5% CO.sub.2. For assays, 2,500 cells/well were seeded in a 96 multi well plate in Eagle's Minimum Essential Medium (Sigma, M4655) with 10% fetal bovine serum (FBS) as recommended by the supplier.

Oligonucleotide Potency and Efficacy

[0357] Cells were incubated for 24 hours before addition of oligonucleotides. The oligonucleotides were dissolved in PBS and added to the cells at final concentrations of oligonucleotides was of 0.01, 0.031, 0.1, 0.31, 1, 3.21, 10, and 32.1 μM, the final culture volume was 100 μl/well. The cells were harvested 3 days after addition of oligonucleotide compounds and total RNA was extracted using the PureLink Pro 96 RNA Purification kit (Thermo Fisher Scientific), according to the manufacturer's instructions. Target transcript levels were quantified using FAM labeled TaqMan assays from Thermo Fisher Scientific in a multiplex reaction with a VIC labelled GAPDH control probe in a technical duplex and biological triplex set up. TaqMan primer assays for the target transcript of interest GSK3B (Hs01047718_ml) and a house keeping gene GAPDH (4326317E VIC®/MGB probe). EC50 and efficacy of the oligonucleotides are shown in Table 5 as % of control sample.

[0358] EC50 calculations were performed in GraphPad Prism6. The maximum GSK31B knock down level is shown in Table 5 as % of control.

TABLE-US-00006 TABLE 5 EC50 and maximal knock down (Max Kd) % of control CMP Start position(s) ID NO EC50 Std Max kd std on SEQ ID NO: 1  6_1 4.12 1.89 49.93 7.73 56154  7_1 3.88 3.88 6.34 5.52 56154  8_1 9.20 9.20 52.76 4.28 56154  9_1 9.47 9.47 89.90 5.23 56154 10_1 1.68 1.68 6.92 6.32 184511, 184587, 184663, 184739, 184815 11_1 4.88 4.88 00 16.28 184512, 184588, 184664, 184740, 184816 12_1 1.77 1.77 9.28 2.77 184512, 184588, 184664, 184740, 184816 12_2 0.69 0.69 2.80 0.96 184512, 184588, 184664, 184740, 184816 13_1 4.68 4.68 30.34 16.64 184513, 184589, 184665, 184741, 184817 13_2 1.42 1.42 0.00 8.74 184513, 184589, 184665, 184741, 184817 14_1 1.03 1.03 0.00 4.53 184513, 184589, 184665, 184741, 184817 15_1 10.14 10.14 0.00 12.39 184518, 184594, 184670, 184746, 184822 16_1 1.84 1.84 58.98 3.89 267802 17_1 71.15 71.15 0.00 129.72 267802 18_1 1.34 1.34 56.72 1.83 267804 19_1 4.65 4.65 58.44 12.45 267806