System for site-specific modification of ALS gene using CRISPR-Cas9 system for production of herbicide-resistant rice and use of same

10988774 · 2021-04-27

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention discloses a system for site-specific modification of ALS gene by a CRISPR-Cas9 system to produce herbicide-resistant rice, and uses thereof. The system for site-specific modification in a plant genome of the present invention comprises a vector for site-specific modification in a plant genome and a donor DNA; wherein the vector for site-specific modification in a plant genome comprises a Cas9 protein expression cassette, gRNA expression cassettes and a donor DNA; the gRNA expression cassettes encode two gRNAs targeting two target sites of a target DNA of a plant of interest, respectively; the target DNA has a fragment to be site-specifically modified which is positioned between the two target site.

Claims

1. A composition for site-specific modification in a plant genome, comprising a vector for site-specific modification in the plant genome and a donor DNA A; wherein the vector for site-specific modification in the plant genome comprises a Cas9 protein expression cassette, a gRNA expression cassette, and a donor DNA B; wherein the gRNA expression cassette encodes two gRNAs targeting two target sites in a target DNA of a plant of interest; wherein the target DNA of the plant of interest comprises a fragment to be site-specifically modified which is positioned between the two target sites in the target DNA of the plant of interest; wherein of the two target sites, one positioned upstream is an upstream target site, wherein the other one positioned downstream is a downstream target site; wherein the donor DNA B comprises the upstream target site, the downstream target site, and a fragment for site-specific modification positioned between the upstream target site and the downstream target site; wherein the fragment for site-specific modification is a DNA fragment to replace the fragment to be site-specifically modified in the target DNA; wherein the donor DNA A is other than the vector and has a same nucleotide sequence as the donor DNA B, and wherein: the upstream target site consists of nucleotides at positions 7590-7609 from 5′-end of SEQ ID NO: 1; the downstream target site consists of nucleotides at positions 8032-8051 from 5′-end of SEQ ID NO: 1; and the fragment for site-specific modification is set forth by the nucleotides at positions 7716-7979 from 5′-end of SEQ ID NO: 1.

2. The composition according to claim 1, wherein: the plant of interest is a monocotyledonous plant or a dicotyledonous plant.

3. The composition according to claim 2, wherein: the monocotyledonous plant is a gramineous plant.

4. The composition according to claim 1, wherein: the target DNA is a gene encoding acetolactate synthase.

5. The composition according to claim 4, wherein: the acetolactate synthase is a protein with the amino acid sequence as set forth by SEQ ID NO: 2.

6. The composition according to claim 5, wherein: the target DNA is SEQ ID NO: 3.

7. The composition according to claim 4, wherein: the gRNA expression cassette includes a gRNA expression cassette 1 encoding gRNA1, and a gRNA expression cassette 2 encoding gRNA2, wherein the gRNA1 targets the upstream target site, and the gRNA2 targets the downstream target site.

8. The composition according to claim 7, wherein: the gRNA expression cassette 1 is nucleotides at positions 261-747 from 5′-end of SEQ ID NO: 1; and the gRNA expression cassette 2 is nucleotides at positions 8328-8814 from 5′-end of SEQ ID NO: 1.

9. The composition according to claim 8, wherein: the vector for the site-specific modification in the plant genome is SEQ ID NO: 1; and the donor DNA A is nucleotides at positions 7590-8051 from 5′-end of SEQ ID NO: 1.

10. A method for site-specific modification in a plant genome, comprising: introducing into a plant of interest a vector for site-specific modification in the plant genome and a donor DNA A to obtain a plant with the plant genome site-specifically modified; wherein the vector for site-specific modification in the plant genome comprises a Cas9 protein expression cassette, gRNA expression cassettes, and a donor DNA B; wherein the gRNA expression cassettes encode two gRNAs targeting two target sites in a target DNA of a plant of interest, respectively; wherein the target DNA of the plant of interest comprises a fragment to be site-specifically modified positioned between the two target sites in the target DNA of the plant of interest; wherein a first of the two target sites is an upstream target site; wherein a second of the two target sites is a downstream target site; wherein the donor DNA B comprises the upstream target site, the downstream target site, and a fragment for site-specific modification positioned between the upstream target site and the downstream target site; wherein the fragment for site-specific modification is a DNA fragment to replace the fragment to be site-specifically modified in the target DNA; and wherein the donor DNA A has a same nucleotide sequence as the donor DNA B, wherein: the upstream target site consists of nucleotides at positions 7590-7609 from 5′-end of SEQ ID NO: 1; the downstream target site consists of nucleotides at positions 8032-8051 from 5′-end of SEQ ID NO: 1; and the fragment for site-specific modification is set forth by the nucleotides at positions 7716-7979 from 5′-end of SEQ ID NO: 1.

11. The method according to claim 10, wherein: the vector for site-specific modification in the plant genome and the donor DNA A is introduced into the plant of interest in a molar ratio of 1:(1-40).

12. A method for producing herbicide-resistance in a plant, comprising: introducing into a plant of interest a vector for site-specific modification in the plant genome and a donor DNA A to obtain a plant with the plant genome site-specifically modified; wherein the vector for site-specific modification in the plant genome comprises a Cas9 protein expression cassette, a gRNA expression cassette, and a donor DNA B; wherein the gRNA expression cassette encodes two gRNAs targeting two target sites in a target DNA of a plant of interest, respectively; wherein the target DNA of the plant of interest comprises a fragment to be site-specifically modified positioned between the two target sites in the target DNA of the plant of interest; wherein a first of the two target sites is an upstream target site; wherein a second of the two target sites is a downstream target site; wherein the donor DNA B comprises the upstream target site, the downstream target site, and a fragment for site-specific modification positioned between the upstream target site and the downstream target site; wherein the fragment for site-specific modification is a DNA fragment to replace the fragment to be site-specifically modified in the target DNA; and wherein the donor DNA A has a same nucleotide sequence as the donor DNA B, wherein: the upstream target site consists of nucleotides at positions 7590-7609 from 5′-end of SEQ ID NO: 1; the downstream target site consists of nucleotides at positions 8032-8051 from 5′-end of SEQ ID NO: 1; and the fragment for site-specific modification is set forth by the nucleotides at positions 7716-7979 from 5′-end of SEQ ID NO: 1.

13. The method according to claim 12, wherein the target DNA is a gene encoding acetolactate synthase.

14. The method according to claim 12, wherein the plant of interest is a monocotyledonous plant or a dicotyledonous plant.

Description

DESCRIPTION OF DRAWINGS

(1) This application contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

(2) FIG. 1 shows the identification results from enzyme digestion of PCR products of part of T.sub.0 generation site-specifically modified rice, wherein M is a DL2000 DNA molecular weight marker.

(3) FIG. 2 shows the synonymous mutation results of the nucleotide sequences adjacent to the 548th amino acid and the 627th amino acid of ALS of the plants in Cas9-arm donor group.

(4) FIG. 3 shows the sequencing identification results of the homologous recombinant type of the plants in Cas9-arm donor group; wherein “WT ALS” represents ALS gene of a wild-type rice plant; and “Donor” represents the gene of donor DNA.

(5) FIG. 4 shows the identification for detecting the presence or absence of related sequences in the recombinant vector pCXUN-cas9-gRNA548-gRNA627-arm donor in the plants of the Cas9-arm donor group; wherein A is a schematic diagram indicating the position of the primers used for the detection in the plants of the Cas9-arm donor group; B is an agarose gel electrophoresis pattern for the detection of the presence or absence of the gene of Cas9 protein in the plants of the Cas9-arm donor group by PCR; C is an agarose gel electrophoresis pattern for the detection of the gRNA expression cassettes in the plants of the Cas9-arm donor group by PCR; and D is an agarose gel electrophoresis pattern for the identification of intactness of the exogenous fragment arm donor in the randomly integrated recombinant vector pCXUN-cas9-gRNA548-gRNA627-arm donor in the plants of the Cas9-arm donor group by PCR, wherein “Vector” represents the recombinant vector pCXUN-cas9-gRNA548-gRNA627-arm donor, and “WT” represents the identification results from the enzyme digestion of the PCR products of rice plants of the wild-type group.

(6) FIG. 5 shows the plant growth 36 days after spraying Bispyribac-sodium; wherein “1”, “2” and “3” each represent a plant having successful homologous recombination at two sites, and “4”, “5” and “6” each represent a rice plant of wild-type.

DETAILED DESCRIPTION

(7) The present invention will be further described in details in connection with specific embodiments below, and the examples provided is intended merely to illustrate the present invention, but not to limit the scope of the present invention. The experimental methods described below in the examples are conventional methods, unless otherwise specified. The materials, reagents, etc. used in the following examples are commercially available, unless otherwise specified. The quantitative tests described in the following examples are performed in triplicate with the results averaged, unless otherwise specified.

(8) In following examples, Nipponbare rice was used as a plant of interest for the genome site-specific modification, and the acetolactate synthase gene of Nipponbare rice served as a target DNA (as represented by SEQ ID NO: 3 in the sequence listing), to construct a site-specifically modified rice plant having tryptophan (W) (which has a codon of TGG at this position in a wild-type) mutated to leucine (L) (which has a codon of TTG at this position) at position 548, serine (S) (which has a codon of AGT at this position in a wild-type) mutated to isoleucine (I) (which has a codon of ATT at this position) at position 627 in the acetolactate synthase of Nipponbare rice.

(9) The acetolactate synthase gene in Nipponbare rice also contains an EcoR V restriction site sequence, while the restriction site sequence has been site-specifically mutated in donor DNA (arm donor) with the amino acids thereof unchanged.

(10) Nipponbare rice seed is a product from the National Crop Germplasm Resource Conservation Center, Institute of Crop Sciences of Chinese Academy of Agricultural Sciences. Nipponbare rice is also referred to as wild-type rice, abbreviated as WT.

(11) Solid medium R1 (pH5.8): 4.3 g/L MS& Vitamin salts+30 g/L sucrose+0.5 g/L MES+300 mg/L casein amino acids+2.8 g/L L-proline+2 mg/L 2, 4-D+4 g/L plant gel, balanced with water.

(12) Solid medium R4 (pH5.8): 4.3 g/L MS& Vitamin salt+30 g/L sucrose+0.5 g/L MES+2 g/L casein amino acid+30 g/L sorbitol+2 mg/L kinetin+1 mg/L NAA+4 g/L plant gel, balanced with water.

(13) Solid medium R5 (pH5.8): 2.15 g/L MS& Vitamin salt+15 g/L sucrose+0.5 g/L MES+2 g/L plant gel, balanced with water.

(14) The sequences of the primer pairs used in the following examples and purposes thereof are shown in Table 1.

(15) TABLE-US-00001 TABLE 1 Sequences and Purposes of the Primer Pairs Used Name Sequence Purpose 753F SEQ ID NO: 4 Primers for detecting AAGGTGAGGCAATCATCGCT 753R SEQ ID NO: 5 homologous recombination CCATGCCAAGCACATCAAAC Cas9-F SEQ ID NO: 6 Detecting Cas9 TCGACAAGAAGTACTCCATCGGC Cas9-R SEQ ID NO: 7 CAAGAGAGAGGGCGATCAGGTTG U3F SEQ ID NO: 8 Detecting gRNA GTAATTCATCCAGGTCTCCAAG U3R SEQ ID NO: 9 ACGGAGAAATTTCAATGC 365F SEQ ID NO: 10 Detecting cleaved GGAGAACACATGCACACTAAAAA exogenous fragment GA 365R SEQ ID NO: 11 TTGGGTAACGCCAGGGTTTT OFF1F SEQ ID NO: 12 Off-target analysis GAACGCGATGCTGGAAGAAC OFF1R SEQ ID NO: 13 CTGTTGGCGTCGTAGAACCT OFF2F SEQ ID NO: 14 GTACGAGGGGAGTAGTAGTCAGT OFF2R SEQ ID NO: 15 TGAGGTTGAGCTTGTGGAGC OFF3F SEQ ID NO: 16 TTTCTCCCTTGTTCGCATCTG OFF3R SEQ ID NO: 17 GGCAGCTTAATCATGGGCAG OFF4F SEQ ID NO: 18 AACCGCATGCTCGAGAAGAT OFF4R SEQ ID NO: 19 TTGTGCACGGTACACCACTT OFF5F SEQ ID NO: 20 GCACACCTGGCTCCAACC OFF5R SEQ ID NO: 21 TCGGCAAACCAAGAGAACGA

EXAMPLE 1

Construction of Vectors for Site-Specific Mutagenesis of Acetolactate Synthase (ALS) Gene

(16) A double-stranded DNA molecule, as represented by the sequence of positions 7590-8051 from 5′-end of SEQ ID NO. 1 in the sequence listing, was artificially synthesized, designated as arm donor (donor DNA).

(17) A recombinant vector, pCXUN-cas9-gRNA548-gRNA627-arm donor (a circular plasmid) was artificially synthesized. The recombinant vector pCXUN-cas9-gRNA548-gRNA627-arm donor is represented by SEQ ID NO. 1 in the sequence listing. In the SEQ ID NO. 1, the nucleotides at positions 900-7570 constitute a Cas9 protein expression cassette (the nucleotides at positions 5580-7570 constitute a Ubiquitin promoter, the nucleotides at positions 1446-5576 constitute a Cas9 gene, and the nucleotides at positions 900-1152 constitute a NOS terminator), the nucleotides at positions 261-747 constitute a gRNA expression cassette 1 (the nucleotides at positions 367-747 constitute a OsU3 promoter, the nucleotides at positions 271-366 constitute a gRNA1 encoding gene , and the nucleotides at positions 261-270 constitute a Poly-A terminator), the nucleotides at positions 8328-8814 constitute a gRNA expression cassette 2 (the nucleotides at positions 8328-8708 constitute a OsU3 promoter, the nucleotides at positions 8709-8804 constitute a gRNA2 encoding gene, and the nucleotides at positions 8805-8814 constitute a Poly-T terminator), and the nucleotides at positions 7590-8051 constitute an arm donor (the nucleotides at positions 7590-7609 constitute a upstream target site, the nucleotides at positions 7616-7715 constitute a upstream homologous arm, the nucleotides at positions 7716-7979 constitute a fragment for site-specific modification, the nucleotides at positions 7980-8025 constitute a downstream homologous arm, and the nucleotides at positions 8032-8051 constitute a downstream target site). The Cas9 protein expression cassette was used for expression of a Cas9 protein. The gRNA expression cassette 1, designated as expression cassette gRNAW548L, was used for expression of gRNAW548L. The gRNA expression cassette 2, designated as expression cassette gRNAS627I, was used for expression of gRNAS627I.

EXAMPLE 2

Production and Confirmation of Rice with ALS Having Both Amino Acids at Positions 548 and 627 Site-Specifically Modified

(18) I. Production of site-specifically modified rice 1. Plump seeds of Nipponbare rice were selected and dehulled. After sterilization and washing, the seeds were uniformly dibbled into solid medium R1, and exposed to continuous illumination at 28° C. for 2-3 weeks to induce the formation of calli. 2. Following step 1, the induced calli were treated with solid medium R1 containing 0.3M mannitol and 0.3M sorbitol for 4-6 h, to obtain treated calli. 3. The recombinant vector pCXUN-cas9-gRNA548-gRNA627-arm donor and the arm-donor were mixed in a molar ratio of 1:20, and the mixture was used to bombard the treated calli obtained in step 2 by means of a biolistic (using gold powder of 0.6 μm, at a bombardment pressure of 900 psi), to obtain transformed calli. 4. After step 3 was completed, the transformed calli were cultured on solid medium R1 containing 0.3M mannitol and 0.3M sorbitol for 16 h, and then transferred onto solid medium R1 containing 50 mg/L hygromycin for culture under light condition at 28° C. for 2 weeks, followed by transferring to solid medium R1 contianing 0.4 μM bispyribac-sodium and culturing at 28° C. under light condition for 2 weeks. 5. After step 4 was completed, well grown, bright yellow, positive calli were selected and transferred into solid medium R4 containing 0.4 μM bispyribac-sodium with sterile tweezers, and subjected to light incubation at 28° C. until differentiated seedlings were grown to 2-5 mm. 6. After step 5 was completed, the seedlings were transferred into solid medium R5 and subjected to light incubation at 28° C. for 2-3 weeks, and then transplanted into soil, and placed in a greenhouse for cultivation (at a temperature of 28-30° C., 16 h illumination/8 h darkness). A total of 116 plants of T.sub.0 site-specifically modified rice were obtained, designated as Cas9-arm donor group. 7. The treated calli obtained in step 2 were cultured on solid medium R1 containing 0.3M mannitol and 0.3M sorbitol for 16 h, and then transferred to solid medium R1 and subjected to light incubation at 28° C. for 2 weeks, followed by transfer to solid medium R1 and 2-week 28° C. light incubation. 8. After step 7 was completed, well grown, bright yellow calli was selected and transferred into solid medium R4 with sterile tweezers for 28° C. light incubation, until differentiated seedlings were grown to 2-5 mm. 9. After step 8 was completed, the seedlings were transferred to solid medium R5, and incubated under light at 28° C. for 2-3 weeks, and then transplanted into soil and placed in a greenhouse for cultivation (at a temperature of 28-30° C., 16 h illumination/8 h darkness) to obtain T.sub.0 non-site-specifically modified rice, designated as wild-type group.

(19) II. Identification of Homologous Recombinant Plant 10. 1. Identification of homologous recombination plant by PCR and enzyme digestion

(20) 52 rice plants from the Cas9-arm donor group and 10 rice plants from the wild-type group obtained in step I were randomly taken for following identification.

(21) Leaves of the rice were collected, from which genomic DNA was extracted using a plant genomic DNA extraction kit (Tiangen Biotech (Beijing) Co., Ltd.). With the genomic DNA as a template, acetolactate synthase (ALS) gene was subjected to PCR amplification using a primer pair consisting of 753F and 753R, followed by identification by enzyme cleavage with a restriction enzyme EcoRV. PCR reaction system (25 μL): 10×PCR Buffer 2.5 μL, dNTP 2 μL, 753F 0.5 μL, 753R 0.5 μL, genomic DNA 1 μL, rTaq 0.2 μL, ddH.sub.2O 18.3 μL. PCR reaction conditions: pre-denaturation at 94° C. for 4 min; 35 cycles of denaturation at 94° C. for 40 s, annealing at 58° C. for 40 s, extension at 72° C. for 1 min; finally extension at 72° C. for 10 min.

(22) In view of high homology between arm-Donor and native ALS gene segment of rice, 753F and 753R were positioned upstream and downstream of segment in rice genome corresponding to that in the arm-Donor, respectively so as to eliminate the interference of arm-Donor with the identification of a homologous recombinant plant, since the rice native ALS gene itself contains restriction enzyme EcoRV restriction site (gatatc). Accordingly, a site-specific mutation was introduced into the arm-Donor, so that the PCR amplified products with arm-Donor as a template could be not cleaved by restriction enzyme EcoRV. With the genomic DNA of a plant to be tested as a template, if the PCR amplified product cannot be cleaved by restriction enzyme EcoRV (the PCR amplified product remains 753 bp due to non-cleavage occurred after digestion with restriction enzyme EcoRV), the plant to be tested is a plant that is successfully recombined. With the genomic DNA of a plant to be tested as a template, if the PCR amplified product may be cleaved by restriction enzyme EcoRV (becoming 488 bp and 265 bp), the plant to be tested is a plant that is not successfully recombined.

(23) Agarose gel electrophoresis patterns of a portion of the cleaved products are shown in FIG. 1. Of the 52 rice plants of the Cas9-arm donor group, 48 plants were not cleaved by restriction enzyme EcoRV, and 4 plant were cleaved by restriction enzyme EcoRV. All of the rice plants of the wild-type group were cleaved by restriction enzyme EcoRV.

(24) 2. Sequencing

(25) Genomic DNAs were extracted from the 52 rice plants of the Cas9-arm donor group randomly selected in step 1, and subjected to PCR amplification using a primer pair consisting of 753F and 753R, followed by sequencing the PCR amplified products.

(26) Among them, 48 plants which could not be cleaved by restriction enzyme EcoR V were successful homologous recombinant plants (including B98-1, B98-3, B98-4, B98-5, B99-5, B99-6, B99-7, B99-13, and B99-23), and homozygous lines. As compared with wild-type, the successful homologous recombinant plants of the Cas9-arm donor group each had an ALS gene with tryptophan (W) (which has a codon of TGG at this position in wild-type) mutated to leucine (L) (which has a codon of TTG at this position) at position 548, serine (S) (which has a codon of AGT at this position in wild-type) mutated to isoleucine (I) (which has a codon of ATT at this position) at position 627, and other amino acids unchanged, except for synonymous mutation of the nucleotides near these two sites.

(27) The sequencing results suggest that, the 4 rice plants of the Cas9-arm donor group that could be cleaved by restriction enzyme EcoRV (B99-9, B99-10, B99-11 and B99-12) had one strand where homologous recombination occurred at the codon of the 548th amino acid of ALS, but not at the codon of the 627th amino acid of ALS, and the other strand where non-homologous recombination occurred at both the codons of the 548th amino acid and of the 627th amino acid of ALS.

(28) The statistic results of the recombination of the plants of Cas9-arm donor group are shown in Table 2.

(29) TABLE-US-00002 TABLE 2 Statistic results of recombination Number Donor of Zygosity DNA plant of T.sub.0 in Cas gRN No. tested Line No. Genotype plants vector 9 A B97 2 1, 2 HR548 & HR6 Ho deletion 2+ 2+ 27-1 B98 24 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, HR548 & HR6 Ho deletion 24+ 24+ 12, 13, 14, 15, 16, 17, 18, 27-3 19, 20, 21, 22, 23, 24 B99 24 1, 2, 3, 4, 13, 14 HR548 & HR6 Ho deletion 6+ 6+ 27-1 5, 6, 7, 8, 17 HR548 & HR6 Ho deletion 5+ 5+ 27-2 15, 16, 18, 19, 20, 21, 22, HR548 & HR6 Ho deletion 10+ 10+ 23, 24 27-3 9 HR548/NHEJ Com-He deletion & 0 1+ NHEJ 10, 11, 12 HR548/NHEJ Com-He deletion 0 3+ B100 2 1, 2 HR548 & HR6 Ho deletion 2+ 2+ 27-1

(30) Note that: Ho represents a homozygous line, Com-He represents a compound heterozygous line, “+” represents positive result. The sequencing results and corresponding nucleotide sequences of HR548, HR627-1, HR627-2, and HR627-3 are shown in FIG. 2.

(31) Of part of the plants of the Cas9-arm donor group, the nucleotide sequence adjacent to the 548th amino acid and the nucleotide sequence adjacent to the 627th amino acid are shown in FIG. 3 (B99-12 is a heterozygous type, B99-12-39 and B99-12-17 represent the sequencing results of associated segments of two chromosomes thereof, respectively).

(32) 3. Identification of the Presence or Absence of Related Sequence of Recombinant Vector pCXUN-cas9-gRNA548-gRNA627-Arm Donor in Homologous Recombinant Plants

(33) According to the sequence of the recombinant vector pCXUN-cas9-gRNA548-gRNA627-arm donor, primer pairs were designed as below, respectively: a primer pair (Cas9-F/Cas9-R) for detecting Cas9 protein gene, with which an amplified fragment of a length of 738 bp can be obtained from a plant containing the Cas9 protein gene; a primer pair (U3F/U3R) for detecting a gRNA expression cassette, with which an amplified fragment of a length of 614 bp can be obtained from a plant containing the gRNA expression cassette; a primer pair (365F/365R) for identifying the intactness of arm donor as an exogenous fragment of randomly integrated recombinant vector pCXUN-cas9-gRNA548-gRNA627-arm donor in a plant, with which an amplified fragments all of a length of 365 bp can be obtained when the arm donors all have been edited in the plant, or an amplified fragments of a length of 841 bp when the arm donors are not edited in the plant, or an amplified fragments of both 365 bp and 841 bp when part of arm donors are edited in the plant.

(34) Genomic DNAs were extracted from the 52 rice plants of the Cas9-arm donor group randomly selected in step 1, and subjected to PCR assay using the primer pair for identifying Cas9 protein gene. The results indicate that all the plants contained Cas9 protein gene, i.e., amplified fragments of which have a length of 738 bp in the PCR amplification products, except for plants B99-9, B99-10, B99-11 and B99-12. All the plants containing Cas9 protein gene exhibited successful homologous recombination, and belonged to homozygous lines, so that the gRNA could not recognize site-specifically modified ALS gene, with no occurrence of chimera. The 4 plants, B99-9, B99-10, B99-11 and B99-12, although having unedited position 627 of ALS, could not be re-edited due to the absence of the intact sequence of Cas9 protein gene (FIG. 4, B).

(35) Genomic DNAs were extracted from the 52 rice plants of the Cas9-arm donor group randomly selected in step 1, and subjected to PCR assay using the primer pairs for identifying gRNA expression cassettes. The identification results indicate that all the plants contained the gRNA expression cassette (FIG. 4, C), and all the PCR amplification products contained the amplified fragment of a 614 bp length.

(36) Genomic DNAs were extracted from the 52 rice plants of the Cas9-arm donor group randomly selected in step 1, and subjected to PCR assay using the primer pair for identifying the intactness of the exogenous fragment arm donor in the recombinant vector pCXUN-cas9-gRNA548-gRNA627-arm donor randomly integrated in the detected plant. The identification results indicate that 51 out of the 52 plants were big fragment deficient type. That is, all the exogenous fragment, arm donor, had been edited by the designed recombinant vector pCXUN-cas9-gRNA548-gRNA627-arm donor, wherein the presence of gRNA548 and gRNA627 allowed the exogenous fragment, arm donor, to be cleaved and used for site-specifically modifying the native ALS gene of the rice, resulting in a large fragment deficient type. And, plant B99-9 was the only one with PCR amplification products of 841 bp long fragment (FIG. 4, D). The sequencing results indicate that this plant had non-homologous recombination occurring at the codons of both the 548th and 627th amino acids of ALS.

(37) 4. Off-Target Analysis of Recombinant Vector pCXUN-cas9-gRNA548-gRNA627-Arm Donor

(38) By means of an online prediction software, off-target sites that might exist in gRNA548 and gRNA627 were pedicted, respectively, primer pairs were designed depending on the sequences flanking the off-target sites that might exist: the primer pairs for gRNAW548L expression cassette were OFF1F/OFF1R and OFF2F/OFF2R, and the primer pairs for gRNAS627I expression cassette were OFF3F/OFF3R, OFF4F/OFF4R and OFF5F/OFF5R.

(39) Genomic DNAs were extracted from the 52 rice plants of the Cas9-arm donor group randomly selected in step 1, and subjected to PCR identification using each of the primer pair described above, respectively. The primer pairs OFF1F/OFF1R, OFF2F/OFF2R, OFF3F/OFF3R, OFF4F/OFF4R and OFF5F/OFF5R resulted in amplified fragment lengths of 492 bp, 606 bp, 597 bp, 388 bp and 382 bp for off-target plants.

(40) 30 plants were PCR amplified with primer pairs OFF1F/R, OFF2F/R, OFF3F/R, OFF4F/R and OFF5F/R, and the PCR amplification products were cloned and sequenced. The detection results indicated that the designed recombinant vector pCXUN-cas9-gRNA548-gRNA627-arm donor led to gRNA expression, and the expressed gRNA did not have off-target (Table 3).

(41) TABLE-US-00003 TABLE 3 Off-target analysis of target spot Number Number Number of off- Name of mis- of target Target of Position Sequence matched plants plants spot target of target of target bases tested detected gRNA OFF1 chr04: SEQ ID NO: 22 2 30 0 W548L 19170867- GGGCATGGTGGTGCA 19170889 GTGGGAGG OFF2 chr03: SEQ ID NO: 23 2 30 0 1562250- GGGTGTGGTGCTGCA 1562272 TTGGGTGG gRNAS OFF3 chr09: SEQ ID NO: 24 3 30 0 627I 15887010- G_GCCACCACTGGG 15887031 GATCATTGG OFF4 chr01: SEQ ID NO: 25 4 30 0 36565231- CCGGTGCTCCCAGGT 36565253 GGGAGCGC OFF5 chr10: SEQ ID NO: 26 4 30 0 17913749- GAGCCCCCACGTGGG 17913771 AGCAACGG

(42) 4. Identification of Resistance of Plant with Successful Homologous Recombination to Herbicide Bispyribac-Sodium (BS)

(43) The wild-type rice, and the T.sub.0 site-specifically modified rice of the Cas9-arm donor group with successful homologous recombination at the codons of both the 548th and 627th amino acids of ALS as obtained in step I were sprayed with Bispyribac-sodium in a concentration of 100 μM, and 30-50 days thereafter, the growth states of the plants were observed.

(44) The results were shown in FIG. 5. 36 days after the spray of the Bispyribac-sodium in the concentration of 100 μM, the wild-type rice plants were withered, while the T.sub.0 site-specifically modified, successfully homologous recombinant plants of the Cas9-arm donor group showed normal growth.

INDUSTRIAL APPLICATION

(45) The present invention develops a technical system for producing an herbicide-resistant rice by site-specifically modifying acetolactate synthase (ALS) gene using a CRISPR/Cas9 system, and provides a basis for gene site-specific modification, replacement, and exogenous gene site-specific integration in rice and other crops using the CRISPR/Cas9 system, and a support for improving agronomic traits of other important crops.