Retargeting of viruses or VLPs
10975359 · 2021-04-13
Assignee
Inventors
- Jens Gruber (Göttingen, DE)
- Stefan SCHNEIDER (Göttingen, DE)
- Ellen Eckermann-Felkl (Duderstadt, DE)
- Alina Mosblech (Göttingen, DE)
- Arnd Steuernagel (Göttingen, DE)
- Dennis Wegener (Schenefeld, DE)
- Julian Plaga (Hamburg, DE)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
A61K31/4188
HUMAN NECESSITIES
C12N2710/22022
CHEMISTRY; METALLURGY
A61K47/6901
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K31/4188
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
A61K47/68
HUMAN NECESSITIES
A61K47/6891
HUMAN NECESSITIES
International classification
C12N7/00
CHEMISTRY; METALLURGY
A61K47/68
HUMAN NECESSITIES
Abstract
The present invention relates to a method of producing a polyomavirus or polyomavirus-derived virus-like particle (vlp) carrying on its surface at least one targeting molecule that binds to a cell of interest. Furthermore, the present invention relates to a composition comprising such a polyomavirus or polyomavirus-derived vlp and to the use of the polyomavirus or polyomavirus-derived vlp of the invention or the composition of the invention for use as a medicament. The present invention further relates to a kit comprising the polyomavirus or polyomavirus-derived vlp or the composition of the invention.
Claims
1. A method of producing a polyomavirus or polyomavirus-derived virus-like particle (VLP) carrying on its surface at least one targeting molecule that binds to a cell of interest, the method comprising the step of contacting the polyomavirus or polyomavirus-derived VLP with (i) the at least one targeting molecule, wherein the at least one targeting molecule is glycosylated with at least one glycosyl residue that is recognised by the polyomavirus or polyomavirus-derived VLP, wherein the at least one glycosyl residue comprises α2,3-, α2,8-, or α2,6-SA; or (ii) a first interaction molecule, wherein the first interaction molecule is glycosylated with at least one glycosyl residue that is recognised by the polyomavirus or polyomavirus-derived VLP; and the at least one targeting molecule, wherein the at least one targeting molecule is conjugated to a second interaction molecule capable of interacting with the first interaction molecule, and wherein the at least one glycosyl residue comprises α2,3-, α2,8-, or α2,6-SA.
2. The method of claim 1, wherein the polyomavirus is the human polyoma JC virus or wherein the VLP is derived from the human polyoma JC virus.
3. The method of claim 1 or 2, wherein the VLP comprises the capsid protein VP1 of the human polyoma JC virus.
4. The method of any one of claims 1 to 3, wherein the glycosyl residue is selected from lactoseries tetrasaccharide c (LSTc), GM1, asialo-GM1, GM2, GD1a, GD1b, GD2, GT1a, GT1b, GM3, GD3, and GQ1b.
5. The method of any one of claims 1 to 4, wherein the at least one targeting molecule is selected from a protein, a peptide, or a carbohydrate.
6. The method of claim 5, wherein the at least one targeting molecule is a protein selected from an antibody, transferrin, epidermal growth factor (EGF) family members, a cytokine, a partial viral glycoprotein, CD9, CD63, var2csa, insulin or a ligand for GABA.
7. The method of claim 5, wherein the at least one targeting molecule is a peptide selected from substance-P, an opioid or cell-penetrating peptides.
8. The method of any one of claims 1 to 7, wherein the first and second interaction molecules are Avidin and Biotin, Streptavidin and Biotin, or NeutrAvidin and Biotin.
9. The method of any one of claims 1 to 8, wherein the virus or VLP further comprises one or more cargo molecule(s) within the virus or VLP.
10. The method of any one of claims 1 to 9, wherein the virus or VLP further comprises additional heterologous molecules on the surface of the virus or VLP.
11. A polyomavirus or polyomavirus-derived virus-like particle (VLP), wherein the virus or VLP carries on its surface at least one targeting molecule that binds to a cell of interest, and wherein the at least one targeting molecule has been bound to the surface of the virus or VLP via: (i) a glycosylation of the at least one targeting molecule with at least one glycosyl residue, wherein said at least one glycosyl residue is recognised and bound by the polyomavirus or polyomavirus-derived VLP, and wherein the at least one glycosyl residue comprises α2,3-, α2,8-, or α2,6-SA; or (ii) the interaction between at least two interaction molecules, wherein a first interaction molecule is glycosylated with at least one glycosyl residue, wherein said at least one glycosyl residue is recognised and bound by the polyomavirus or polyomavirus-derived VLP; and wherein the at least one targeting molecule is conjugated to a second interaction molecule capable of interacting with the first interaction molecule, and wherein the at least one glycosyl residue comprises α2,-3, α2,8-, or α2,6-SA.
12. The polyomavirus or polyomavirus-derived VLP of claim 11, wherein the virus or VLP is obtained or obtainable by the method of any one of claims 1 to 10.
13. A composition comprising the polyomavirus or polyomavirus-derived VLP of claim 11 or 12.
14. The polyomavirus or polyomavirus-derived VLP of claim 11 or 12 or the composition of claim 13 for use as a medicament.
15. A kit comprising the polyomavirus or polyomavirus-derived virus-like particle (VLP) of claim 11 or 12, or the composition of claim 13.
Description
THE FIGURES SHOW
(1)
(2) The VP1 protein dissociates to oligomeric fractions after addition of EGTA and DTT (15 mM each). In the presence of the CAG-GFP expression cassette, EGTA and DTT are removed by dialysis while adding CaCl.sub.2 to the VP1, resulting in capsid formation and incorporation of the DNA. In the schematic at the bottom left, the HER2/neu scFv fragment is crosslinked onto the capsid by a polylinker (NHS-PEG6-Maleimid) via established methods, resulting in a covalent sulfhydryl- and isopeptide-bond. In the schematic at the bottom right, the HER2/neu-Streptavidin scFv is bound via LSTc-Biotin onto the viral capsid.
(3)
(4) a) General setup of SPR-measurements: Assay 1 depicts a setup wherein LSTc-Biotin is immobilized and the VP1-VLP is present in the mobile phase and only becomes immobilized upon binding of the VP1-VLP onto the immobilized LSTc. Assay 2 shows a setup wherein the VP1-VLP is immobilized and Neutravidin::LSTc-Biotin is present in the mobile phase and becomes immobilized upon binding of LSTc onto the immobilized VP1-VLP. b) Injection of Neutravidin::LSTc-Biotin complexes to immobilized VP1; the highest concentration used was 5 μM. The binding pattern obtained is characteristic for an interaction of high avidity. c) Control-experiment of Neutravidin::PEG.Biotin as mobile phase analyte, which shows that no interaction was detected with immobilized VP1.
(5)
(6) a) Neutravidin::LSTc-Biotin matrix-surface with high and low loading density. Binding of siRNA-loaded VLPs was monitored with a concentration of up to 32 nM. Signal pattern and stability show exponential behaviour, underpinning a strong avidity effect. b) Neutravidin::LSTc-Biotin matrix-surface with high and low loading density. Binding of siRNA-loaded VLPs was monitored with a concentration of up to 98 nM. Signal pattern and stability show again an exponential behaviour, underpinning a strong avidity effect.
(7)
(8) The bars show qRT-PCR analysis results obtained for the cell lines used (Hela, SW480 and Skbr3) and depict the relative expression of the 5-HT2 serotonin receptor isoforms a, b, and c as well as the relative expression of HER2/neu.
(9)
(10) a) Phase contrast- and UV-pictures of SKBR3 for GFP-expression after transduction with CAG-GFP expression cassette loaded native VLPs (depicted as “no retargeting” or “unretargeted” on the left), and after transduction with CAG-GFP expression cassette loaded retargeted VLPs. Crosslinking to HER2/neu scFv was performed with NHS-PEG.sub.6-Maleimid, HER2/neu-Streptavidin scFv was bound onto the VLPs by LSTc-Biotin (scale bar: 200 μm, exposure time 1 sec). b) FACS analysis of SKBR3 showed different percentages of GFP-positive populations by usage of unretargeted VLPs and retargeted VLPs (no retargeting: 50%, NHS-PEG.sub.6-Maleimid: 55%, LSTc-Biotin: 55%).
(11)
(12) a) Phase contrast- and UV-pictures of SW480 for GFP-expression after transduction with CAG-GFP expression cassette loaded native VLPs (depicted as “no retargeting” or “unretargeted” on the left), and after transduction with CAG-GFP expression cassette loaded retargeted VLPs. Crosslinking to HER2/neu scFv was performed with NHS-PEG.sub.6-Maleimid, HER2/neu-Streptavidin scFv was bound onto the VLPs by LSTc-Biotin (scale bar: 200 μm, exposure time 1 sec). b) FACS analysis of SW480 showed different percentages of GFP-positive populations by usage of unretargeted VLPs and retargeted VLPs (no retargeting: 20%, NHS-PEG.sub.6-Maleimid: 55%, LSTc-Biotin: 65%).
(13) The following examples illustrate the invention:
EXAMPLE 1: MATERIAL AND METHODS
(14) GFP-Expression Cassette Generation
(15) The CAG-GFP expression construct was amplified from the pAAV-CAG-GFP plasmid (Addgene #28014) (for 5″-3″ GATCGTACCATTGACGTCAATAATG (SEQ ID NO: 19), rev 5′-3′ TCTCCCCCTGAACCTGAAAC (SEQ ID NO: 20)). The amplicon was transferred via TA-cloning into the pGEM®-T Easy vector (Promega). The woodchuck hepatitis virus posttranslational regulatory element (WPRE) sequence was removed by PCR-amplification of the plasmid, followed by self-ligation (for 5″-3″p-TCGATACCGTCGACCCG (SEQ ID NO: 21), rev 5″-3″ p-TTATCGATAAGCTTGATATCGAATTC (SEQ ID NO: 22)). The linear expression cassette was generated by SacI/SphI digestion, giving rise to the 1946 bp construct. Linear DNA was purified with QIAquick® gel extraction kit (Qiagen) according to the manufacturer's protocol.
(16) VLP Production and Loading
(17) JC polyomavirus-like particles were generated as described elsewhere [57]. For transduction the desired amount of VLPs was incubated in disassembly buffer (10 mM HEPES [pH 7.4], containing 150 mM NaCl and 15 mM EGTA and DTT each) at room temperature (RT) for 30 min. Per 25 μg of VLPs, 500 ng in total of the linearized GFP-expression construct were added and incubated for another 30 min at RT. VLPs were reassembled by dialyzing against 5 L of reassembly buffer (10 mM HEPES [pH 7.4], containing 150 mM NaCl and 1 mM CaCl.sub.2) at 4° C. under constant stirring over night.
(18) ScFv Production and Cross-Linking
(19) HER2/neu ScFv DNA was ordered from Geneart based on the sequence published elsewhere [58, 59] as a codon-optimized construct for expression in Pichia pastoris and transferred as XbaI/XhoI amplicon into the pPICZαA-vector (Invitrogen). Streptavidin was fused by overlap extension PCR from the pTSA-c plasmid (Addgene #17329) to the c-terminus of the scFv. The linearized plasmids were transformed into the humanized P. pastoris SuperMan.sub.5 strain (his.sup.+) and grown under standard conditions. In brief, expression of the construct was performed in BMMH full medium at 28° C. and 160 rpm with feeding of methanol to a final concentration of 1% every 24 h. After 3 days, the supernatant was harvested by centrifugation (30 min, 10000×g, RT) and filtered through a 0.45 μm filter. HER2/neu scFV and HER2/neu-Streptavidin scFv were enriched from the supernatant by immobilized metal ion affinity chromatography (IMAC). ScFv-containing eluate fractions were dialyzed over night against reassembly buffer at 4° C. under constant stirring and subsequently concentrated by usage of a Vivaspin column (MWCO 5 kDa) at 4° C. to the desired concentration of 0.5-1 mg/mL.
(20) For cross-linking with HER2/neu scFv, the desired amount of HER2/neu ScFv was incubated for 1 h at RT with DTT to a final concentration of 5 mM to reduce its N-terminal cysteine for cross-linking. Excess DTT was removed by gel filtration (PD10 desalting column) and HER2/neu ScFv was concentrated by a Vivaspin column (MWCO 5 kDa).
(21) The desired amount of CAG-GFP loaded VLPs were incubated with NHS-PEG.sub.6-Maleimide (Invitrogen, Dreieich, Germany) according to the manufacturer's protocol. After 1 h of incubation at RT, the remaining NHS-PEG.sub.6-Maleimide was removed by gelfiltration (PD10 desalting column equilibrated with reassembly buffer) and the coated VLPs were concentrated by usage of a Vivaspin column (MWCO 30 kDa).
(22) The coated VLPs were then incubated with the reduced HER2/neu ScFv with a final ratio of 1:5 (10 μg VLPs/50 μg scFv) for 1 h at RT before they were used for transduction.
(23) For cross-linking of HER2/neu-Streptavidin via the method of the invention, 300 μg of HER2/neu scFv (0.5 mg/mL) were incubated for 1 h at RT with lactoseries tetrasaccharide c (LSTc)-Biotin with a final concentration of 160 μM. Excess LSTc-Biotin was removed by gelfiltration (PD10 desalting column) and the LSTc-Biotin-conjugated HER2/neu-Streptavidin scFv was concentrated by a Vivaspin column (MWCO 5 kDa). The VLPs were incubated with this LSTc-Biotin-conjugated HER2/neu-Streptavidin scFv with a final ratio of 1:2 (10 μg VLPs/20 μg scFv) for 1 h at RT before they were used for transduction.
(24) Transduction Experiments
(25) For VLP transduction experiments, the cell lines SKBR3 and SW480 were seeded in DMEM medium containing FCS (10%) and Pen/Strep (1%) at a density of 25.000 cells/well in a 24-well plate and grown over night under standard culture conditions. Prior to transduction, the medium was changed to FCS-free DMEM containing Pen/Strep (1%). Per well, 25 μg of wt, NHS-PEG.sub.6-Maleimid HER2/neu scFv, or LSTc-Biotin HER2/neu-Streptavidin scFv coated VLPs, packaged with 500 ng CAG-GFP expression cassette, were added and incubated for 24 h. Afterwards, the medium was removed and FCS-containing DMEM was added and the cells were incubated for another 48 h. 3 day post transduction, cells were analysed for GFP-expression by microscopy and FACS.
(26) Quantitative PCR Analysis
(27) Total RNA was isolated via Phenol/Chloroform extraction according to manufacture protocol (Trizol, Thermo Fisher Scientific, Waltham Mass., USA). RNA was measured by synergy system (Biotek, Winooski Vt., USA), 1000 ng of total RNA was reverse transcribed using Sensifast cDNA Synthesis Kit (Bioline, London, UK) and 1 μL of the obtained cDNA was used for quantitative analysis on ABI StepOnePlus system (Applied biosystems, Waltham Mass., USA). Relative expression of 5-HT2.sub.a, 5-HT2.sub.b and 5-HT2.sub.c was calculated via ΔΔC.sub.T-method using β2M as housekeeping gene. For analysis of the 5-HT2.sub.a isoform, HeLa cells were used for normalization due to the low expression of this isoform in SKBR3- and SW480-cells.
(28) TABLE-US-00001 Primer sequence fwd sequence rev Reference b2m TGTGCTCGCGCTACT CGGATGGATGAAACC — CTCTCT CAGACA (SEQ ID NO: 23) (SEQ ID NO: 24) Ht2a AACTCCAGAACTAAG CTTAAAGACCTTCGA [60] GCATTT ATCGTC (SEQ ID NO: 25) (SEQ ID NO: 26) Ht2b CACGGGCTACAGCAT CCAAAACGTTCCTTT — TCATCA GTCAGC (SEQ ID NO: 27) (SEQ ID NO: 28) Ht2c CCGAGTCCGTTTCTC GATGGCGTCAGTTGG — GTCTAG CCTATG (SEQ ID NO: 29) (SEQ ID NO: 30) Her2/ CCTCTGACGTCCATC CGGATCTTCTGCTGC [61] neu GTCTC CGTCG (SEQ ID NO: 31) (SEQ ID NO: 32)
Row Cytometry
(29) Cells were trypsinized and fixated for 20 min at 4° C. with 2% PFA in PBS. Flow cytometry was performed using BD LSR II instrument (BD Biosciences), filters employed for GFP were (505LP-BP530/30) using a 488 nm laser. Data analysis was performed using flowing software, the flow Core Bioconductor package and GraphPad software (GraphPad Prism version 7.00 for Windows, GraphPad Software, La Jolla Calif. USA). For histograms gated and binned data were extracted from the flowing software, normalized by % max (bin value/max value from all binned data) and plotted using GraphPad.
EXAMPLE 2: RETARGETING OF VLPS
(30) The recombinantly expressed VP1 of human JC polyomavirus was purified to homogeneity as described elsewhere. Upon purification, the VLPs were subjected to an in vitro DNA packaging process. VLPs are known to dissociate into smaller mono- and oligomers (
(31) To alter the tropism of the VLPs, the retargeting approach of the present invention was employed, which is based on the VLPs ability to bind LSTc. By fusion of LSTc to Biotin, it was possible to attach an scFv-Streptavidin fusion construct onto the VLP.
(32) In a comparative experiment, an scFv was covalently link onto the surface of the particles. For this approach, two lysine-residues (K60 and K164), located in the flexible loops of the outer surface of the VLPs, were utilized. Moreover the scFv carried a c-terminal cystein, which enabled the use of a polylinker with two different functional groups at each end (SM-PEG.sub.6-Maleimide) to connect the lysine-residues with the scFv.
(33) The thus retargeted VLPs were then used for transducing HER2/neu positive mammalian breast- and colorectal-cancer cell lines (SKBR3 and SW480).
EXAMPLE 3: ANALYSIS OF 5-HT2 SEROTONIN RECEPTOR EXPRESSION AND HER2/NEU EXPRESSION
(34) Because uncoated VLPs require the 5-HT2 serotonin receptor to transduce cells, the expression of the three 5-HT2 isoforms a, b and c in the cells SKBR3 and SW480 used herein was initially analyzed (
(35) Analysis of the expression of Her2/neu in SW480 and SKBR3 cells additionally confirmed the presence of this receptor on the cells employed herein. Both SKBR3 and SW480 show high expression of the receptor, whereas SKBR3 showed a two-fold higher expression rate.
EXAMPLE 4: TRANSDUCTION OF THE HER2/NEU POSITIVE CELL LINES SKBR3 AND SW480 WITH VLPS
(36) Using VLPs that were not retargeted (i.e. “unretargeteted VLPs”) but were loaded with the CAG-GFP expression cassette, it was possible to transduce SKBR3 and SW480 cells (
(37) To more efficiently transduce HER2/neu positive cell lines, the serotonergic tropism of the JCV derived VLPs was altered. Using the VLPs retargeted as described in Example 2, it was possible to transduce SW480 and SKBR3 cells with the used CAG-GFP expression cassette with both retargeting approaches (
(38) Because SKBR3 cells express not only Her2/neu, but also the native JCV receptor, both unretargeteted and retargeted VLPs of JCV can transduce these cells. However, SW480 cells only express Her2/neu and, consequently, a significant increase in transduction efficiency was observed in the above described experiments. Moreover, the retargeting approach of the present invention not only represents a less cumbersome and less time consuming method of retargeting, it also resulted in a further increase in efficiency (i.e. an increase from 20% to 65% in SW480 cells).
REFERENCES
(39) [1] Y. P. Liu, J. T. Westerink, O. ter Brake, B. Berkhout, RNAi-inducing lentiviral vectors for anti-HIV-1 gene therapy, Methods in molecular biology, 721 (2011) 293-311. [2] S. Weinstein, I. A. Toker, R. Emmanuel, S. Ramishetti, I. Hazan-Halevy, D. Rosenblum, M. Goldsmith, A. Abraham, O. Benjamini, O. Bairey, P. Raanani, A. Nagler, J. Lieberman, D. Peer, Harnessing RNAi-based nanomedicines for therapeutic gene silencing in B-cell malignancies, Proceedings of the National Academy of Sciences of the United States of America, 113 (2016) E16-22. [3] J. L. Gori, P. D. Hsu, M. L. Maeder, S. Shen, G. G. Welstead, D. Bumcrot, Delivery and Specificity of CRISPR-Cas9 Genome Editing Technologies for Human Gene Therapy, Human gene therapy, 26 (2015) 443-451. [4] L. Naldini, Gene therapy returns to centre stage, Nature, 526 (2015) 351-360. [5] R. Sharma, X. M. Anguela, Y. Doyon, T. Wechsler, R. C. DeKelver, S. Sproul, D. E. Paschon, J. C. Miller, R. J. Davidson, D. Shivak, S. Zhou, J. Rieders, P. D. Gregory, M. C. Holmes, E. J. Rebar, K. A. High, In vivo genome editing of the albumin locus as a platform for protein replacement therapy, Blood, 126 (2015) 1777-1784, [6] R. Waehler, S. J. Russell, D. T. Curiel, Engineering targeted viral vectors for gene therapy, Nature reviews. Genetics, 8 (2007) 573-587. [7] E. Blanco, H. Shen, M. Ferrari, Principles of nanoparticle design for overcoming biological barriers to drug delivery, Nature biotechnology, 33 (2015) 941-951. [8] B. Assetta, M. S. Maginnis, I. Gracia Ahufinger, S. A. Haley, G. V. Gee, C. D. Nelson, B. A. O'Hara, S. A. Allen Ramdial, W. J. Atwood, 5-HT2 receptors facilitate JC polyomavirus entry, Journal of virology, 87 (2013) 13490-13498. [9] G. F. Elphick, W. Querbes, J. A. Jordan, G. V. Gee, S. Eash, K. Manley, A. Dugan, M. Stanifer, A. Bhatnagar, W. K. Kroeze, B. L. Roth, W. J. Atwood, The human polyomavirus, JCV, uses serotonin receptors to infect cells, Science, 306 (2004) 1380-1383. [10] U. Neu, M. S. Maginnis, A. S. Palma, L. J. Stroh, C. D. Nelson, T. Feizi, W. J. Atwood, T. Stehle, Structure-function analysis of the human JC polyomavirus establishes the LSTc pentasaccharide as a functional receptor motif, Cell host & microbe, 8 (2010) 309-319. [11] L. J. Stroh, M. S. Maginnis, B. S. Blaum, C. D. Nelson, U. Neu, G. V. Gee, B. A. O'Hara, N. Motamedi, D. DiMaio, W. J. Atwood, T. Stehle, The Greater Affinity of JC Polyomavirus Capsid for alpha2,6-Linked Lactoseries Tetrasaccharide c than for Other Sialylated Glycans Is a Major Determinant of Infectivity, Journal of virology, 89 (2015) 6364-6375. [12] B. Tsai, J. M. Gilbert, T. Stehle, W. Lencer, T. L. Benjamin, T. A. Rapoport, Gangliosides are receptors for murine polyoma virus and SV40, The EMBO journal, 22 (2003) 4346-4355. [13] U. Neu, S. A. Allen, B. S. Blaum, Y. Liu, M. Frank, A. S. Palma, L. J. Stroh, T. Feizi, T. Peters, W. J. Atwood, T. Stehle, A structure-guided mutation in the major capsid protein retargets BK polyomavirus, PLoS pathogens, 9 (2013) e1003688. [14] S. Eash, K. Manley, M. Gasparovic, W. Querbes, W. J. Atwood, The human polyomaviruses, Cellular and molecular life sciences: CMLS, 63 (2006) 865-876. [15] S. Gleiter, H. Lilie, Coupling of antibodies via protein Z on modified polyoma virus-like particles, Protein science: a publication of the Protein Society, 10 (2001) 434-444. [16] S. Gleiter, H. Lilie, Cell-type specific targeting and gene expression using a variant of polyoma VP1 virus-like particles, Biological chemistry, 384 (2003) 247-255. [17] Y. Kitai, H. Fukuda, T. Enomoto, Y. Asakawa, T. Suzuki, S. Inouye, H. Handa, Cell selective targeting of a simian virus 40 virus-like particle conjugated to epidermal growth factor, Journal of biotechnology, 155 (2011) 251-256. [18] S. Thrane, C. M. Janitzek, M. O. Agerbaek, S. B. Ditlev, M. Resende, M. A. Nielsen, T. G. Theander, A. Salanti, A. F. Sander, A Novel Virus-Like Particle Based Vaccine Platform Displaying the Placental Malaria Antigen VAR2CSA, PloS one, 10 (2015) e0143071. [19] S. Gleiter, K. Stubenrauch, H. Lilie, Changing the surface of a virus shell fusion of an enzyme to polyoma VP1, Protein science: a publication of the Protein Society, 8 (1999) 2562-2569. [20] U. Schmidt, R. Rudolph, G. Bohm, Binding of external ligands onto an engineered virus capsid, Protein engineering, 14 (2001) 769-774. [21] K. Tegerstedt, A. V. Franzen, K. Andreasson, J. Joneberg, S. Heidari, T. Ramqvist, T. Dalianis, Murine polyomavirus virus-like particles (VLPs) as vectors for gene and immune therapy and vaccines against viral infections and cancer, Anticancer research, 25 (2005) 2601-2608. [22] D. Chang, C. Y. Fung, W. C. Ou, P. C. Chao, S. Y. Li, M. Wang, Y. L. Huang, T. Y. Tzeng, R. T. Tsai, Self-assembly of the JC virus major capsid protein, VP1, expressed in insect cells, The Journal of general virology, 78 (Pt 6) (1997) 1435-1439. [23] C. Goldmann, H. Petry, S. Frye, O. Ast, S. Ebitsch, K. D. Jentsch, F. J. Kaup, F. Weber, C. Trebst, T. Nisslein, G. Hunsmann, T. Weber, W. Luke, Molecular cloning and expression of major structural protein VP1 of the human polyomavirus JC virus: formation of virus-like particles useful for immunological and therapeutic studies, Journal of virology, 73 (1999) 4465-4469. [24] M. A. Kawano, T. Inoue, H. Tsukamoto, T. Takaya, T. Enomoto, R. U. Takahashi, N. Yokoyama, N. Yamamoto, A. Nakanishi, T. Imai, T. Wada, K. Kataoka, H. Handa, The VP2/VP3 minor capsid protein of simian virus 40 promotes the in vitro assembly of the major capsid protein VP1 into particles, The Journal of biological chemistry, 281 (2006) 10164-10173. [25] L. Gorelik, C. Reid, M. Testa, M. Brickelmaier, S. Bossolasco, A. Pazzi, A. Bestetti, P. Carmillo, E. Wilson, M. McAuliffe, C. Tonkin, J. P. Carulli, A. Lugovskoy, A. Lazzarin, S. Sunyaev, K. Simon, P. Cinque, Progressive multifocal leukoencephalopathy (PML) development is associated with mutations in JC virus capsid protein VP1 that change its receptor specificity, The Journal of infectious diseases, 204 (2011) 103-114. [26] R. Komagome, H. Sawa, T. Suzuki, Y. Suzuki, S. Tanaka, W. J. Atwood, K. Nagashima, Oligosaccharides as receptors for JC virus, Journal of virology, 76 (2002) 12992-13000. [27] A. Ashok, W. J. Atwood, Virus receptors and tropism, Advances in experimental medicine and biology, 577 (2006) 60-72. [28] M. Ahmad, M. Hirz, H. Pichler, H. Schwab, Protein expression in Pichia pastoris: recent achievements and perspectives for heterologous protein production, Applied microbiology and biotechnology, 98 (2014) 5301-5317. [29] C. L. Young, Z. T. Britton, A. S. Robinson, Recombinant protein expression and purification: a comprehensive review of affinity tags and microbial applications, Biotechnology journal, 7 (2012) 620-634. [30] S. Maschauer, J. Einsiedel, R. Haubner, C. Hocke, M. Ocker, H. Hubner, T. Kuwert, P. Gmeiner, O. Prante, Labeling and glycosylation of peptides using click chemistry: a general approach to (18)F-glycopeptides as effective imaging probes for positron emission tomography, Angewandte Chemie, 49 (2010) 976-979. [31] S. S. Shekhawat, I. Ghosh, Split-protein systems: beyond binary protein-protein interactions, Current opinion in chemical biology, 15 (2011) 789-797. [32] D. Russell, N. J. Oldham, B. G. Davis, Site-selective chemical protein glycosylation protects from autolysis and proteolytic degradation, Carbohydrate research, 344 (2009) 1508-1514. [33] A. Dondoni, A. Massi, P. Nanni, A. Roda, A new ligation strategy for peptide and protein glycosylation: photoinduced thiol-ene coupling, Chemistry, 15 (2009) 11444-11449. [34] D. Crich, Mechanism of a chemical glycosylation reaction, Accounts of chemical research, 43 (2010) 1144-1153. [35] L. Bohe, D. Crich, A propos of glycosyl cations and the mechanism of chemical glycosylation; the current state of the art, Carbohydrate research, 403 (2015) 48-59. [36] Z. L. Wu, X. Huang, A. J. Burton, K. A. Swift, Glycoprotein labeling with click chemistry (GLCC) and carbohydrate detection, Carbohydrate research, 412 (2015) 1-6. [37] W. J. Lin, W. Y. Hsu, Pegylation effect of chitosan based polyplex on DNA transfection, Carbohydrate polymers, 120 (2015) 7-14. [38] S. N. Wang, Y. H. Deng, H. Xu, H. B. Wu, Y. K. Qiu, D. W. Chen, Synthesis of a novel galactosylated lipid and its application to the hepatocyte-selective targeting of liposomal doxorubicin, European journal of pharmaceutics and biopharmaceutics: official journal of Arbeitsgemeinschaft fur Pharmazeutische Verfahrenstechnik e.V, 62 (2006) 32-38. [39] H. Zhang, Y. Xiao, S. Cui, Y. Zhou, K. Zeng, M. Yan, C. Zhao, Novel Galactosylated Poly(ethylene glycol)-Cholesterol for Liposomes as a Drug Carrier for Hepatocyte-Targeting, Journal of nanoscience and nanotechnology, 15 (2015) 4058-4069. [40] A. Pagani, M. Vieillevoye, A. Nai, M. Rausa, M. Ladli, C. Lacombe, P. Mayeux, F. Verdier, C. Camaschella, L. Silvestri, Regulation of cell surface transferrin receptor-2 by iron-dependent cleavage and release of a soluble form, Haematologica, 100 (2015) 458-465. [41] B. Frolund, B. Ebert, U. Kristiansen, T. Liljefors, P. Krogsgaard-Larsen, GABA(A) receptor ligands and their therapeutic potentials, Current topics in medicinal chemistry, 2 (2002) 817-832. [42] X. Y. Chen, G. Q. Ru, Y. Y. Ma, J. Xie, W. Y. Chen, H. J. Wang, S. B. Wang, L. Li, K. T. Jin, X. L. He, X. Z. Mou, High expression of substance P and its receptor neurokinin-1 receptor in colorectal cancer is associated with tumor progression and prognosis, OncoTargets and therapy, 9 (2016) 3595-3602. [43] S. S. Rizk, A. Misiura, M. Paduch, A. A. Kossiakoff, Substance P derivatives as versatile tools for specific delivery of various types of biomolecular cargo, Bioconjugate chemistry, 23 (2012) 42-46. [44] J. F. Peppin, R. B. Raffa, Delta opioid agonists: a concise update on potential therapeutic applications, Journal of clinical pharmacy and therapeutics, 40 (2015) 155-166. [45] I. S. Zagon, Y. Wu, P. J. McLaughlin, Opioid growth factor and organ development in rat and human embryos, Brain research, 839 (1999) 313-322. [46] P. J. McLaughlin, I. S. Zagon, J. Skitzki, Human neuroblastoma cell growth in tissue culture is regulated by opioid growth factor, International journal of oncology, 14 (1999) 373-380. [47] S. W. Jones, R. Christison, K. Bundell, C. J. Voyce, S. M. Brockbank, P. Newham, M. A. Lindsay, Characterisation of cell-penetrating peptide-mediated peptide delivery, British journal of pharmacology, 145 (2005) 1093-1102. [48] C. M. Dundas, D. Demonte, S. Park, Streptavidin-biotin technology: improvements and innovations in chemical and biological applications, Applied microbiology and biotechnology, 97 (2013) 9343-9353. [49] E. A. Teunissen, M. de Raad, E. Mastrobattista, Production and biomedical applications of virus-like particles derived from polyomaviruses, Journal of controlled release: official journal of the Controlled Release Society, 172 (2013) 305-321. [50] A. Abbing, U. K. Blaschke, S. Grein, M. Kretschmar, C. M. Stark, M. J. Thies, J. Walter, M. Weigand, D. C. Woith, J. Hess, C. O. Reiser, Efficient intracellular delivery of a protein and a low molecular weight substance via recombinant polyomavirus-like particles, The Journal of biological chemistry, 279 (2004) 27410-27421. [51] L. Chen, D. B. Flies, Molecular mechanisms of T cell co-stimulation and co-inhibition, Nature reviews. Immunology, 13 (2013) 227-242. [52] P. B. Davis, M. J. Cooper, Vectors for airway gene delivery, The AAPS journal, 9 (2007) E11-17. [53] S. Li, Z. Ma, Nonviral gene therapy, Current gene therapy, 1 (2001) 201-226. [54] H. Yin, R. L. Kanasty, A. A. Eltoukhy, A. J. Vegas, J. R. Dorkin, D. G. Anderson, Non-viral vectors for gene-based therapy, Nature reviews. Genetics, 15 (2014) 541-555. [55] D. Fioretti, S. Iurescia, V. M. Fazio, M. Rinaldi, DNA vaccines: developing new strategies against cancer, Journal of biomedicine & biotechnology, 2010 (2010) 174378. [56] B. Volz, M. Schmidt, K. Heinrich, K. Kapp, M. Schroff, B. Wittig, Design and characterization of the tumor vaccine MGN1601, allogeneic fourfold gene-modified vaccine cells combined with a TLR-9 agonist, Molecular therapy oncolytics, 3 (2016) 15023. [57] D. B. Hoffmann, K. O. Boker, S. Schneider, E. Eckermann-Felkl, A. Schuder, M. Komrakova, S. Sehmisch, J. Gruber, In Vivo siRNA Delivery Using JC Virus-like Particles Decreases the Expression of RANKL in Rats, Molecular therapy. Nucleic acids, 5 (2016) e298. [58] X. Li, P. Stuckert, I. Bosch, J. D. Marks, W. A. Marasco, Single-chain antibody-mediated gene delivery into ErbB2-positive human breast cancer cells, Cancer gene therapy, 8 (2001) 555-565. [59] E. Song, P. Zhu, S. K. Lee, D. Chowdhury, S. Kussman, D. M. Dykxhoorn, Y. Feng, D. Palliser, D. B. Weiner, P. Shankar, W. A. Marasco, J. Lieberman, Antibody mediated in vivo delivery of small interfering RNAs via cell-surface receptors, Nature biotechnology, 23 (2005) 709-717. [60] F. Nau, Jr., B. Yu, D. Martin, C. D. Nichols, Serotonin 5-HT2A receptor activation blocks TNF-alpha mediated inflammation in vivo, PloS one, 8 (2013) e75426. [61] A. Millson, A. Suli, L. Hartung, S. Kunitake, A. Bennett, M. G. Nordberg, W. Hanna, C. T. Wittwer, A. Seth, E. Lyon, Comparison of two quantitative polymerase chain reaction methods for detecting HER2/neu amplification, The Journal of molecular diagnostics: JMD, 5 (2003) 184-190.