GENE DRIVE TARGETING FEMALE DOUBLESEX SPLICING IN ARTHROPODS

Abstract

The invention relates to gene drives, and in particular to genetic sequences and constructs for use in a gene drive. The invention is especially concerned with ultra-conserved and ultra-constrained sequences for use as a gene drive target with the aim of overcoming the development of resistance to the drive. The invention is also concerned with methods of suppressing wild type arthropod populations by use of the gene drive construct described herein.

Claims

1. A gene drive genetic construct capable of disrupting an intron-exon boundary of the female-specific splice form of the doublesex gene in an arthropod, such that when the construct is expressed, the intron-exon boundary is disrupted and at least one exon is spliced out of a doublesex precursor-mRNA transcript, wherein a female arthropod, which is homozygous for the construct, exhibits a suppressed reproductive capacity.

2. The gene drive genetic construct according to claim 1, wherein the arthropod is an insect, optionally wherein the insect is a mosquito, optionally, wherein the mosquito is of the subfamily Anophelinae, and optionally wherein the mosquito is selected from a group consisting of: Anopheles gambiae; Anopheles coluzzi; Anopheles merus; Anopheles arabiensis; Anopheles quadriannulatus; Anopheles stephensi; Anopheles funestus; and Anopheles melas.

3. (canceled)

4. The gene drive genetic construct according to claim 1, wherein the arthropod is Anopheles gambiae.

5. The gene drive genetic construct according to claim 1, wherein the doublesex gene comprises a nucleic acid sequence substantially as set out in SEQ ID NO: 1, or a fragment or variant thereof.

6. The gene drive genetic construct according to claim 1, wherein the intron-exon boundary targeted by the genetic construct is the boundary between intron 4 and exon 5 of the doublesex gene, optionally wherein the genetic construct targets a nucleic acid sequence comprising or consisting of the nucleotide sequence substantially as set out in SEQ ID NO: 2, 3 or 4, or a fragment or variant thereof, or wherein the target sequence includes up to 1, 2, 3, 4, 5, 10 or 15 nucleotides 5′ and/or 3′ of SEQ ID No:2, 3 or 4.

7. The gene drive genetic construct according to claim 1, wherein the gene drive genetic construct is a nuclease-based genetic construct, optionally wherein the nuclease-based genetic construct is selected from a group consisting of: a transcription activator-like effector nuclease (TALEN) genetic construct; Zinc finger nuclease (ZFN) genetic construct; and a CRISPR-based gene drive genetic construct.

8. (canceled)

9. The gene drive genetic construct according to claim 1, wherein the gene drive genetic construct is a nuclease-based genetic construct and wherein the gene drive genetic construct is a CRISPR-based gene drive construct, optionally wherein the genetic construct is a CRISPR-Cpf1-based or a CRISPR-Cas9-based gene drive genetic construct.

10. The gene drive genetic construct according to claim 1, wherein the construct is a nuclease-based genetic construct and is selected from a group consisting of: a transcription activator-like effector nuclease (TALEN) genetic construct; Zinc finger nuclease (ZFN) genetic construct; and a CRISPR-based gene drive genetic construct, wherein the genetic construct comprises a first nucleotide sequence encoding a nucleotide sequence that is capable of hybridising to the intron-exon boundary of the doublesex gene, optionally wherein the first nucleotide sequence that is capable of hybridising to the intron-exon boundary of the doublesex gene is a guide RNA, optionally, wherein the first nucleotide sequence encoding a nucleotide sequence that is capable of hybridising to the intron-exon boundary of the doublesex (dsx) gene comprises a nucleic acid sequence substantially as set out in SEQ ID NO: 5 or 6, or a fragment or variant thereof and optionally, wherein the nucleotide sequence which is encoded by the first nucleotide sequence and which is capable of hybridising to the intron-exon boundary of the doublesex (dsx) gene comprises a nucleic acid sequence substantially as set out in SEQ ID NO: 58 or 48, or a fragment or variant thereof.

11. (canceled)

12. (canceled)

13. The gene drive genetic construct according to claim 1, wherein the construct is a nuclease-based genetic construct and is selected from a group consisting of: a transcription activator-like effector nuclease (TALEN) genetic construct; Zinc finger nuclease (ZFN) genetic construct; and a CRISPR-based gene drive genetic construct, and wherein the gene drive genetic construct further comprises a second nucleotide sequence encoding a CRISPR nuclease, optionally wherein the second nucleotide sequence encodes a Cpf1 or Cas9 nuclease.

14. The gene drive genetic construct according to claim 1, wherein the construct is a nuclease-based genetic construct and is selected from a group consisting of: a transcription activator-like effector nuclease (TALEN) genetic construct; Zinc finger nuclease (ZFN) genetic construct; and a CRISPR-based gene drive genetic construct, and wherein the gene drive genetic construct further comprises at least one promoter sequence, which drives expression of the first and second nucleotide sequence, optionally wherein the gene drive genetic construct comprises a first promoter sequence operably linked to the first nucleotide sequence and a second promoter sequence operably linked to the second nucleotide sequence.

15. (canceled)

16. (canceled)

17. The gene drive genetic construct according to claim 1, wherein the construct is a nuclease-based genetic construct and is selected from a group consisting of: a transcription activator-like effector nuclease (TALEN) genetic construct; Zinc finger nuclease (ZFN) genetic construct; and a CRISPR-based gene drive genetic construct, and wherein the gene drive genetic construct further comprises at least one promoter sequence, which drives expression of the first and second nucleotide sequence, wherein the gene drive genetic construct comprises a first promoter sequence operably linked to the first nucleotide sequence and a second promoter sequence operably linked to the second nucleotide sequence and wherein the second promoter sequence is a promoter sequence that substantially restricts expression of the second nucleotide sequence to germline cells of the arthropod, optionally wherein the second promoter sequence is: (i) zpg, optionally wherein the second promoter sequence comprises or consists of a nucleic acid sequence substantially as set out in SEQ ID No: 7, or a variant or fragment thereof; (ii) nos, optionally wherein the second promoter sequence comprises or consists of a nucleic acid sequence substantially as set out in SEQ ID No: 8, or a variant or fragment thereof; (iii) exu, optionally wherein the second promoter sequence comprises or consists of a nucleic acid sequence substantially as set out in SEQ ID No: 9, or a variant or fragment thereof; or (iv) vasa2, optionally wherein the second promoter sequence comprises or consists of a nucleic acid sequence substantially as set out in SEQ ID No: 10, or a variant or fragment thereof.

18. (canceled)

19. (canceled)

20. The gene drive genetic construct according to claim 1, wherein the third nucleotide sequence comprises or consists of a nucleic acid sequence substantially as set out in SEQ ID No: 11, or a variant or fragment thereof and/or wherein the fourth nucleotide sequence comprises or consists of a nucleic acid sequence substantially as set out in SEQ ID No: 12, or a variant or fragment thereof.

21. The gene drive genetic construct according to claim 1, wherein the gene drive construct comprises or consists of a nucleic acid sequence substantially as set out in SEQ ID NO: 13, or a fragment or variant thereof.

22. The gene drive genetic construct according to claim 1, wherein the construct is capable of targeting (i) a first target site which comprises the intron-exon boundary of the female specific splice form of the doublesex (dsx) gene, and (ii) a second target site disposed in exon 5 of the female specific splice form of the doublesex (dsx) gene, optionally wherein (i) the second target site comprises or consists of a nucleic acid sequence, which is disposed in the sequence substantially as set out in SEQ ID No: 35, 36 (T2), 37 (T3) or 38 (T4) or a variant or fragment thereof, or wherein the second target site includes up to 1, 2, 3, 4, 5, 10 or 15 nucleotides 5′ and/or 3′ of SEQ ID No:35, 36, 37 or 38; or (ii) the second target site comprises or consists of a nucleic acid sequence, which is disposed in the sequence substantially as set out in SEQ ID No: 35, 36 (T2), 37 (T3) or 38 (T4) or a variant or fragment thereof, or wherein the second target site includes up to 1, 2, 3, 4, 5, 10 or 15 nucleotides 5′ and/or 3′ of SEQ ID No:35, 36, 37 or 38.

23-34. (canceled)

35. A use of a gene drive genetic construct to disrupt an intron-exon boundary of the female specific splice form of the doublesex gene in an arthropod, such that when the construct is expressed, the exon is spliced out of a doublesex precursor-mRNA transcript, wherein the female arthropod's reproductive capacity is suppressed when females are homozygous for the construct.

36. A method for preventing or reducing the inclusion of at least one exon into the female specific splice form of arthropod doublesex mRNA, when said mRNA is produced by splicing from a precursor mRNA transcript, the method comprising contacting one or more cells of an arthropod, optionally one or more cells of an arthropod embryo, in vitro or ex vivo, under conditions conducive to uptake of a gene drive genetic construct that capable of disrupting an intron-exon boundary of the female-specific splice form of the doublesex gene in an arthropod, such that when the construct is expressed, the intron-exon boundary is disrupted and at least one exon is spliced out of a doublesex precursor-mRNA transcript, wherein a female arthropod, which is homozygous for the construct, exhibits a suppressed reproductive capacity by such cell, and allowing splicing to take place, or a method of producing a genetically modified arthropod, the method comprising introducing into an arthropod a gene drive genetic construct capable of disrupting an intron/exon boundary of the female specific splice form of doublesex gene in an arthropod, such that when the gene-drive construct is expressed, an exon is spliced out of a doublesex precursor-mRNA transcript, wherein a female arthropod, which is homozygous for the construct, exhibits a suppressed reproductive capacity.

37. (canceled)

38. The use of claim 35, wherein the intron-exon boundary targeted by the genetic construct is the boundary between intron 4 and exon 5 of the doublesex gene, optionally wherein the genetic construct targets a nucleic acid sequence comprising or consisting of the nucleotide sequence substantially as set out in SEQ ID NO: 2, 3 or 4, or a fragment or variant thereof, or wherein the target sequence includes up to 1, 2, 3, 4, 5, 10 or 15 nucleotides 5′ and/or 2′ of SEQ ID No:2, 2 or 4.

39-47. (canceled)

48. The method according to claim 36, wherein the intron-exon boundary targeted by the genetic construct is the boundary between intron 4 and exon 5 of the doublesex gene, optionally wherein the genetic construct targets a nucleic acid sequence comprising or consisting of the nucleotide sequence substantially as set out in SEQ ID NO: 2, 3 or 4, or a fragment or variant thereof, or wherein the target sequence includes up to 1, 2, 3, 4, 5, 10 or 15 nucleotides 5′ and/or 3′ of SEQ ID No:2, 3 or 4.

Description

[0161] For a better understanding of the invention, and to show how embodiments of the same may be carried into effect, reference will now be made, by way of example, to the accompanying Figures, in which:—

[0162] FIG. 1 shows targeting the female-specific isoform of doublesex. (a) Schematic representation of the male- and female-specific dsx transcripts and the gRNA sequence used to target the gene (shaded in grey). The gRNA spans the Intron4-Exon5 boundary. The proto-spacer adjacent motive (PAM) of the gRNA is highlighted in blue. The scale bar indicates a 200 bp fragment. Introns are not drawn to scale. (b) Sequence alignment of the dsx Intron4-Exon5 boundary in 6 of the species from the Anopheles gambiae complex. The sequence is highly conserved within the complex suggesting tight functional constraint at this region of the dsx gene. The gRNA used to target the gene is underlined and the PAM is highlighted in blue. (c) Schematic representation of the HDR knockout construct specifically recognising exon 5 and the corresponding target locus. (d) Diagnostic PCR using a primer set (blue arrows in panel (c)) to discriminate between the wild type and dsxF allele in homozygous (dsxF.sup.−/−) heterozygous (dsxF.sup.+/−) and wt individuals.

[0163] FIG. 2 shows morphological analysis of homozygous dsxF.sup.−/− mutants. (a) Morphological appearance of genetic males and females heterozygous (dsxF.sup.+/−) or homozygous (dsxF.sup.−/−) for exon 5 null allele. This assay was performed in a strain containing dominant RFP marker linked to the Y chromosome, whose presence permits unambiguous determination of male or female genotype. Anomalies in sexual morphology were observed only in dsxF.sup.−/− genetic female mosquitoes. This group of XX individuals showed male-specific traits including a plumose antenna and claspers (arrows). This group also showed anomalies in the proboscis and accordingly they could not bite and feed on blood. Representative samples of each genotype are shown. (b) Magnification of the external genitalia. All dsxF.sup.−/− females carried claspers, a male-specific characteristic. The claspers were dorsally rotated rather than in the normal ventral position.

[0164] FIG. 3 shows the reproductive phenotype of dsxF mutants. Males and females dsxF.sup.−/− and dsxF.sup.+/− individuals were mated with the corresponding wild type sexes. Females were given access to a blood meal and subsequently allowed to lay individually. Fecundity was investigated by counting the number of larval progeny per lay (n43). Using wild type (wt) as a comparator the inventors saw no significant differences (‘ns’) in any genotype other than dsxF.sup.−/− females, which were unable to feed on blood and therefore failed to produce a single egg (****, p<0.0001; Kruskal-Wallis test). Vertical bars indicate the mean and the s.e.m.

[0165] FIG. 4 shows the transmission rate of the dsxFCRISPRh driving allele and fecundity analysis of heterozygous male and female mosquitoes. Male and female mosquitoes heterozygous for the dsxFCRISPRh allele (a) (dsxFCRISPRh/+) were analysed in crosses with wild type mosquitoes to assess the inheritance bias of the dsxFCRISPRh drive construct (b) and for the effect of the construct on their reproductive phenotype (c). (b) Scattered plot of the transgenic rate observed in the progeny of dsxFCRISPRh/+ female or male mosquitoes (n≥42) crossed to wild type individuals. Each dot represents the progeny derived from single females. Both male and female dsxFCRISPRh/+ showed a high transmission rate of up to 100% of the dsxFCRISPRh allele to the progeny. The transmission rate was determined by visual scoring among offspring of the RFP marker that is linked to the dsxFCRISPRh allele. The dotted line indicates the expected Mendelian inheritance. Mean transmission rate (±s.e.m.) is shown (c) Scattered plot showing the number of larvae produced by single females from crosses of dsxFCRISPRh/+ mosquitoes with wild type individuals after one blood meal. Mean progeny count (±s.e.m.) is shown. (****, p<0.0001; Kruskal-Wallis test).

[0166] FIG. 5 shows the dynamics of the spread of the dsxF.sup.CRISPRh allele and effect on population reproductive capacity. Two cages were set up with a starting population of 300 wild type females, 150 wild type males and 150 dsxF.sup.CRISPRh/+ males, seeding each cage with a dsxF.sup.CRISPRh allele frequency of 12.5%. The frequency of the dsxF.sup.CRISPRh mosquitoes was scored for each generation (a). The drive allele reached 100% prevalence in both cage 2 (grey) and cage 1 (black) at generation 7 and 11 in agreement with a deterministic model (dotted line) that takes into account the parameter values retrieved from the fecundity assays. 20 stochastic simulations were run (light grey lines) assuming a max population size of 650 individuals. (b) Total egg output deriving from each generation of the cage was measured and normalised relative to the output from the starting generation. Suppression of the reproductive output of each cage led the population to collapse completely (black arrows) by generation 8 (cage 2) or generation 12 (cage 1). Parameter estimates included in the model are provided in Table 1.

[0167] FIG. 6 shows molecular confirmation of the correct integration of the HDR-mediated event to generate dsxF−. PCRs were performed to verify the location of the dsx φC31 knock-in integration. Primers (blue arrows) were designed to bind internal of the φC31 construct and outside of the regions used for homology directed repair (HDR) (dotted gray lines) which were included in the Donor plasmid K101. Amplicons of the expected sizes should only be produced in the event of a correct HDR integration. The gel shows PCRs performed on the 5′ (left) and 3′ (right) of 3 individuals for the dsx φC31 knock-in line (dsxF.sup.−) and wild type (wt) as a negative control.

[0168] FIG. 7 shows the morphology of the dsxF.sup.−/− internal reproductive organs. (a) Testis-like gonad from 3-days old female dsxF.sup.−/− individual. There was no layer division between the cells and there was no evidence of sperm. (b) Dissections performed on dsxF.sup.−/− genetic females revealed the presence of organs resembling accessory glands, a typical male internal reproductive organ.

[0169] FIG. 8 shows the development of dsxF.sup.CRISPRh drive construct and its predicted homing process and molecular confirmation of the locus. (a) The drive construct (CRISPRh cassette) contained the transcription unit of a human codon-optimised Cas9 controlled by the germline-restrictive zpg promoter, the RFP gene under the control of the neuronal 3×P3 promoter and the gRNA under the control of the constitutive U6 promoter, all enclosed within two attB sequences. The cassette was inserted at the target locus using recombinase-mediated cassette exchange (RMCE) by injecting embryos with a plasmid containing the cassette and a plasmid containing a $31 recombination transcription unit. During meiosis the Cas9/gRNA complex cleaves the wild type allele at the target locus (DSB) and the construct is copied across to the wild type allele via HDR (homing) disrupting exon 5 in the process. (b) Representative example of molecular confirmation of successful RMCE events. Primers (blue arrows) that bind components of the CRISPRh cassette were combined with primers that bind the genomic region surrounding the construct. PCRs were performed on both sides of the CRISPRh cassette (5′ and 3′) on many individuals as well as wild type controls (wt).

[0170] FIG. 9 shows the maternal or paternal inheritance of the dsxF.sup.CRISPRh driving allele affect fecundity and transmission bias in heterozygotes. Male and female dsxF.sup.CRISPRh heterozygotes (dsxF.sup.CRISPRh/+) that had inherited a maternal or paternal copy of the driving allele were crossed to wild type and assessed for inheritance bias of the construct (a) and reproductive phenotype (b). (a) Progeny from single crosses (n≥15) were screened for the fraction that inherited DsRed marker gene linked to the dsxF.sup.CRISPRh driving allele (e.g. G1♂.fwdarw.G2♀ represents a heterozygous female that received the drive allele from her father). Levels of homing were similarly high in males and females whether the allele had been inherited maternally or paternally. The dotted line indicates the expected Mendelian inheritance. Mean transmission rate (±s.e.m.) is shown. (b) Counts of hatched larvae for the individual crosses revealed a fertility cost in female dsxF.sup.CRISPRh heterozygotes that was stronger when the allele was inherited paternally. Mean progeny count (±s.e.m.) is shown. (***, p<0.001;****, p<0.0001; Kruskal-Wallis test).

[0171] FIGS. 10A-C show resistance plots variants and deletions in sequence. Pooled amplicon sequencing of the target site from 4 generations of the cage experiment (generations 2, 3, 4 and 5) revealed a range of very low frequency indels at the target site (FIG. 10A), none of which showed any sign of positive selection. Insertion, deletion and substitution frequencies per nucleotide position were calculated, as a fraction of all non-drive alleles, from the deep sequencing analysis for both cages. Distribution of insertions and deletions (FIG. 10B) in the amplicon is shown for each cage. Contribution of insertions and deletions arising from different generations is displayed with the frequency in each generation represented by a different colour. Significant change (p<0.01) in the overall indel frequency was observed in the region around the cut-site (dotted area+/−20 bp) for both cages. No significant changes were observed in the substitution frequency (FIG. 10C) around the cut-site (shaded area+/−20 bp) when compared with the rest of the amplicon, confirming that the gene drive did not generate any substitution activity at the target locus and that the laboratory colony is devoid of any standing variation in the form of SNPs within the entire amplicon.

[0172] FIG. 11 shows a sequence comparison of the dsx female-specific exon 5 across members of the Anopheles genus and SNP data obtained from Anopheles gambiae mosquitoes in Africa. (a) Sequence comparison of the dsx Intron4-Exon5 boundary and the dsx female-specific exon 5 within the 16 Anopheline species. The sequence of the Intron4-Exon5 boundary is completely conserved within the six species that form the Anopheles gambiae complex (noted in bold). The gRNA used to target the gene is underlined and the PAM is highlighted in blue. Changes in the DNA sequence are shaded grey and codon silent and missense substitutions are noted in blue and red respectively. (b) SNP frequencies obtained from 765 Anopheles gambiae mosquitoes captured across Africa.sup.17. Across the dsx female-specific Exon 5 there are only 2 SNP variants (noted in yellow) with frequencies of 2.9% (the SNP in the gRNA-complementary sequence) and 0.07%.

[0173] FIG. 12 shows a sequence comparison of the dsx female-specific exon 5 across members of the Anopheles genus and SNP data obtained from Anopheles gambiae mosquitoes in Africa. It shows a further three invariant target sites (referred to as T2, T3 and T4) in addition to the original target site (referred to as T1), which have been identified in exon 5 of the Anopheles gambiae doublesex gene. A sequence alignment in the coding sequence of AgdsxF exon 5 (including part of intron 4, and the 3′ untranslated region (UTR) of exon5) amongst all available mosquito species in which a doublesex homologue could be identified is shown. Species names are shown on the left, and species in bold belong to the Anopheles gambiae species complex. Nucleotides that are variable compared to the Anopheles gambiae sensus stricto reference sequence on the top are shaded in dark grey. Nucleotides are shown in light blue or red, depending on whether a variation causes a synonymous or non-synonymous amino acid change in the exon 5 coding sequence. Asterisks denote the nucleotide positions that remained unchanged in all species. gRNA binding sites are shaded in light grey and underlined in black, the proto-spacer adjacent motives (PAMs) required for Cas9 cleavage are underlined in red. The 3′ splicing acceptor CAGG is shaded in green. In yellow, a single nucleotide polymorphism that has been identified in wild Anopheles gambiae populations, is highlighted.

[0174] FIG. 13 shows one embodiment of a novel multiplexed gene drive at doublesex. This embodiment contains a visible marker (the RFP marker), a germline-expressed Cas9 nuclease and two ubiquitously expressed gRNAs targeting target sites T1 and T3. The CRISPR construct was knocked in between the T1 and T3 cut sites. Homing analysis of the new multi-guide gene drive is shown. Promoter sequences are shown as light grey arrows.

[0175] FIG. 14 shows 1a comparison of the transmission rates and fertility of heterozygous gene drive carriers when the gene drive contained a single target, i.e. T1 (FIG. 14A & C) or two targets, i.e. T1 and T3 (Figures B & D). Female or male gene drive carriers that inherited the drive from a female or male transgenic individual (F->F, F->M, M->F, M->M) were crossed to wild-type mosquitoes. Females were allowed to lay individually. The reproductive output of females was determined by counting eggs and hatched larvae and transmission rates were determined by screening the progeny for RFP fluorescence, indicative of carrying the gene drive. Figures A & B show that the transmission rates correspond to the total number of RFP+ progeny over the total number of screened progeny per female. Mean transmission rates s.e.m. (standard error of mean) are shown. Figures C & D show that the larval output of each class is shown, including a wild-type control, as the standard for comparison (red line). Mean larval outputs s.e.m. are shown. Note that females with zero larval output that showed no evidence of mating were all included in the analysis, since mating competence can be affected by carrying mutations at doublesex. The results from Kyrou et al. (2018) shown on the left were adapted to also include unmated individuals in the analysis.

EXAMPLES

[0176] The invention described herein relies on inserting site-specific nuclease genes into a locus of choice, in formations that both confer some trait of interest on an individual and lead to a biased inheritance of the trait. The approach relies on “homing” leading to suppression. The invention is focused on population suppression, whereby the gene drive construct is designed to insert within a target gene in such a way that the gene product, or a specific isoform thereof, is disrupted. To build the nuclease-based gene drive of the invention, the nuclease gene is inserted within its own recognition sequence in the genome such that a chromosome containing the nuclease gene cannot be cut, but chromosomes lacking it are cut. When an individual contains both a nuclease-carrying chromosome and an unmodified chromosome (i.e. heterozygous for the gene drive), the unmodified chromosome is cut by the nuclease. The broken chromosome is usually repaired using the nuclease-containing chromosome as a template and, by the process of homologous recombination, the nuclease is copied into the targeted chromosome. If this process, called “homing”, is allowed to proceed in the germline, then it results in a biased inheritance of the nuclease gene, and its associated disruption, because sperm or eggs produced in the germline can inherit the gene from either the original nuclease-carrying chromosome, or the newly modified chromosome.

[0177] Due to the negative reproductive load the gene drive imposes, selection can be expected to occur for resistant alleles. The most likely source of such resistance is sequence variation at the target site that prevents the nuclease cutting yet at the same time permits a functional product from the target gene. Such variation can pre-exist in a population or can be created by activity of the nuclease itself—a small proportion of cut chromosomes, rather than using the homologous chromosome as a template, can instead be repaired by end-joining (EJ), which can introduce small insertions or deletions (“indels”) or base substitutions during the repair of the target site. In-frame indels or conservative substitutions might be expected to show selection in the presence of a gene drive. The inventors have previously observed target site resistance in cage experiments (data not shown) and found that end-joining in chromosomes of the early embryo, due to parentally-deposited nuclease, was likely to be the predominant source of the resistant alleles at the target site.

[0178] In mitigating and preventing the emergence of resistant alleles, the strategy being investigated by the inventors involves carefully selecting target sites in regions of the target gene that are so functionally constrained and conserved that most variation is unlikely to restore function to the gene, meaning that the majority of variants will simply not confer any selective advantage. The inventors therefore investigated whether Anopheles gambiae doublesex gene (dsx) is a suitable target for a gene drive approach aimed at suppressing population reproductive capacity to eradicate malaria. To do this, they disrupted the intron 4-exon 5 boundary of dsx (referred to as target site “T1”) with the primary objective to prevent the formation of functional AgdsxF while leaving the AgdsxM transcript unaffected. They also disrupted target sites (referred to as T2, T3 and T4) in addition to the original target site, T1.

Materials and Methods

Population Genetics Model

[0179] To model the results of the cage experiments, the inventors used discrete-generation recursion equations for the genotype frequencies, treating males and females separately. F_ij (t) and M_ij (t) denote the frequency of females (or males) of genotype i/j in the total female (or male) population. The inventors considered three alleles, W (wildtype), D (driver) and R (non-functional resistant), and therefore six genotypes.

Homing

[0180] Adults of genotype W/D produce gametes at meiosis in the ratio W:D:R as follows:

(1−d.sub.f)(1−u.sub.f);d.sub.f:(1−d.sub.f)u.sub.f  in females

(1−d.sub.m)(1−u.sub.m);d.sub.m:(1−d.sub.m)u.sub.m  in males

Here, d_f and d_m are the rates of transmission of the driver allele in the two sexes and u_f and u_m are the fractions of non-drive gametes that are non-functional resistant (R alleles) from meiotic end-joining. In all other genotypes, inheritance is Mendelian. Fitness. Let w_ij≤1 represent the fitness of genotype i/j relative to w_WW=1 for the wild type homozygote. The inventors assume no fitness effects in males. Fitness effects in females are manifested as differences in the relative ability of genotypes to participate in mating and reproduction. The inventors assume the target gene is needed for female fertility, thus D/D, D/R and R/R females are sterile; there is no reduction in fitness in females with only one copy of the target gene (W/D, W/R).

Parental Effects

[0181] The inventors consider that further cleavage of the W allele and repair can occur in the embryo if nuclease is present, due to one or both contributing gametes derived from a parent with one or two driver alleles. The presence of parental nuclease is assumed to affect somatic cells and therefore female fitness but has no effect in germline cells that would alter gene transmission. Previously, embryonic EJ effects (maternal only) were modelled as acting immediately in the zygote [1,2]. Here, the inventors consider that experimental measurements of female individuals of different genotypes and origins show a range of fitnesses, suggesting that individuals may be mosaics with intermediate phenotypes. The inventors therefore model genotypes W/X (X=W, D, R) with parental nuclease as individuals with an intermediate reduced fitness w.sub.WX.sup.10, w.sub.WX.sup.10, or w.sub.WX.sup.11 depending on whether nuclease was derived from a transgenic mother, father, or both. The inventors assume that parental effects are the same whether the parent(s) had one or two drive alleles. For simplicity, a baseline reduced fitness of w.sub.10, w.sub.01, w.sub.11 is assigned to all genotypes W/X (X=W, D, R) with maternal, paternal and maternal/paternal effects, with fitness estimated as the product of mean egg production values and hatching rates relative to wild type in Table 1 in the deterministic model. In the stochastic version of the model, egg production from female individuals with different parentage is sampled with replacement from experimental values.

TABLE-US-00034 TABLE 1 Parameters for stochastic cage model Method of Parameter Estimate estimation Mating 0.85 for heterozygotes; 0 for Estimated probability D/D, D/R and R/R homozygotes from Hammond et al. 2017 Egg production Mean 137.4. Sampling with From assays from wildtype replacement of observed values of mated female (no (10, 61, 96, 98, 111, 111, 113, females parental 127, 128, 129, 132, 132, 134, nuclease) 135, 137, 138, 138, 139, 142, 142, 146, 146, 149, 152, 152, 152, 158, 160, 162, 164, 170, 179, 186, 189, 191) Egg production Mean 118.96. Sampling with From assays from W/D replacement of observed values of mated heterozygote (12, 31, 76, 90, 96, 100, 106, females female (nuclease 106, 107, 113, 117, 118, 119, from ♀) 130, 133, 136, 136, 136, 137, 138, 139, 142, 143, 145, 146, 148, 157, 174) Egg production Mean 59.67. Sampling with From assays from W/D replacement of observed values of mated heterozygote (0, 0, 0, 0, 0, 34, 47, 50, 65, females female (nuclease 105, 113, 115, 115, 125, 126) from ♂) Hatching 0.941 From assays probability, of mated wildtype female females (no parental nuclease) Hatching 0.707 From assays probability, of mated W/D heterozygote females female (nuclease from ♀) Hatching 0.47 From assays probability, of mated W/D heterozygote females female (nuclease from ♂) Probability 0.8708 Average of of emergence observations from pupa over all (survival generations from larva) and both cage experiments Drive in 0.9985 Observed W/D females fraction transgenic from assays Drive in 0.9635 Observed W/D males fraction transgenic from assays Meiotic EJ 0.4685 Estimated parameter from Hammond (fraction et al. 2016 non-drive alleles that are resistant)

Recursion Equations

[0182] The inventors firstly considered the gamete contributions from each genotype, including parental effects on fitness. In addition to W and R gametes that are derived from parents that have no drive allele and therefore have no deposited nuclease, gametes from W/D females and W/D, D/R and D/D males carry nuclease that is transmitted to the zygote, and these are denoted as W{circumflex over ( )}*, D{circumflex over ( )}*, R{circumflex over ( )}*. The proportion of type i alleles in eggs produced by females participating in reproduction are given in terms of male and female genotype frequencies below. Frequencies of mosaic individuals with parental effects (i.e., reduced fitness) due to nuclease from mothers, fathers or both are denoted by superscripts 10, 01 or 11.

e.sub.W=(F.sub.WW+w.sub.WW.sup.10F.sub.WW.sup.10+w.sub.WW.sup.01F.sub.WW.sup.01+w.sub.WW.sup.1:F.sub.WW.sup.1:+(F.sub.WR+w.sub.WR.sup.10F.sub.WR.sup.10+w.sub.WR.sup.01F.sub.WR.sup.01+w.sub.WR.sup.11F.sub.WR.sup.11)/2)w.sub.f

e.sub.R=½(F.sub.WR+w.sub.WR.sup.10F.sub.WR.sup.10+w.sub.WR.sup.01F.sub.WR.sup.01+w.sub.WR.sup.11F.sub.WR.sup.11)/w.sub.f

e.sub.W*=(1−d.sub.f)(1−u.sub.f)(w.sub.WD.sup.10F.sub.WD.sup.10+w.sub.WD.sup.01F.sub.WD.sup.01+w.sub.WD.sup.11F.sub.WD.sup.11)/w.sub.f

e.sub.D*=d.sub.f(w.sub.WD.sup.10F.sub.WD.sup.10+w.sub.WD.sup.01F.sub.WD.sup.01+w.sub.WD.sup.11F.sub.WD.sup.11)/w.sub.f

e.sub.R*=(1−d.sub.f)u.sub.f(w.sub.WD.sup.10F.sub.WD.sup.10+w.sub.WD.sup.01F.sub.WD.sup.01+w.sub.WD.sup.11F.sub.WD.sup.11)/w.sub.f

[0183] The proportions s.sub.i of type i alleles in sperm are:

s.sub.W=(M.sub.WW+M.sub.WW.sup.10+M.sub.WW.sup.01+M.sub.WW.sup.11+(M.sub.WR+M.sub.WR.sup.10+M.sub.WR.sup.01+M.sub.WR.sup.11)/2)/w.sub.m

s.sub.R=(M.sub.RR+(M.sub.WR+M.sub.WR.sup.10+M.sub.WR.sup.01+M.sub.WR.sup.11)/2)/w.sub.m

s.sub.W*=(1−d.sub.m)(1−u.sub.m)(M.sub.WD.sup.10+M.sub.WD.sup.01+M.sub.WD.sup.11)/w.sub.m

s.sub.D*=(M.sub.DD+M.sub.DR/2+d.sub.m(M.sub.WD.sup.10+M.sub.WD.sup.01+M.sub.WD.sup.11))/w.sub.m

s.sub.R*=(M.sub.DR/2+(1−d.sub.m)u.sub.m(M.sub.WD.sup.01+M.sub.WD.sup.10+M.sub.WD.sup.11))/w.sub.m

[0184] Above, w.sub.f and w.sub.m are the average female and male fitness:

w.sub.f=F.sub.WW+w.sub.WW.sup.10F.sub.WW.sup.10+w.sub.WW.sup.01F.sub.WW.sup.01+w.sub.WW.sup.11F.sub.WW.sup.11+w.sub.WD.sup.10F.sub.WD.sup.10+w.sub.WD.sup.01F.sub.WD.sup.01+w.sub.WD.sup.11F.sub.WD.sup.11+F.sub.WR+F.sub.WR.sup.10w.sub.WR.sup.10+w.sub.WR.sup.01F.sub.WR.sup.01+w.sub.WR.sup.11F.sub.WR.sup.11

w.sub.m=M.sub.WW+M.sub.WW.sup.10+M.sub.WW.sup.31+M.sub.WW.sup.11+M.sub.WD.sup.10+M.sub.WD.sup.01+M.sub.WD.sup.11+M.sub.WR+M.sub.WR.sup.10+M.sub.WR.sup.01+M.sub.WR.sup.11+M.sub.DD+M.sub.DR+M.sub.RE=1

[0185] To model cage experiments, the inventors started with an equal number of males and females, with an initial frequency of wildtype females in the female population of F_WW=1, wildtype males in the male population of M.sub.WW=½, and M.sub.WD.sup.01=½ heterozygote drive males that inherited the drive from their fathers. Assuming a 50:50 ratio of males and females in progeny, after the starting generation, genotype frequencies of type i/j in the next generation (t+1) are the same in males and females, F.sub.ij (t+1)=M.sub.ij (t+1). Both are given by G.sub.ij (t+1) in the following set of equations in terms of the gamete proportions in the previous generation, assuming random mating:

G.sub.WW(t+1)=e.sub.Ws.sub.W

G.sub.WW.sup.10(t+1)=e.sub.W*s.sub.W

G.sub.WW.sup.01(t+1)=e.sub.Ws.sub.W*

G.sub.WW.sup.11(t+1)=e.sub.W*s.sub.W*

G.sub.WD.sup.10(t+1)=e.sub.D*s.sub.W

G.sub.WD.sup.01(t+1)=e.sub.Ws.sub.D*

G.sub.WD.sup.11(t+1)=e.sub.W*s.sub.D*+e.sub.D*s.sub.W*

G.sub.WR(t+1)=e.sub.Ws.sub.R+e.sub.Rs.sub.W

G.sub.WR.sup.10(t+1)=e.sub.W*s.sub.R+e.sub.R*s.sub.W

G.sub.WR.sup.01(t+1)=e.sub.Ws.sub.R*+e.sub.Rs.sub.W*

G.sub.WR.sup.11(t+1)=e.sub.W*s.sub.R*+e.sub.R*s.sub.W*

G.sub.DD(t+1)=e.sub.n*s.sub.n*

G.sub.DR(t+1)=(e.sub.R+e.sub.R*)s.sub.D*+e.sub.D*(s.sub.R+s.sub.R*)

G.sub.RR=(e.sub.R+e.sub.R*)(s.sub.R+s.sub.R*)

[0186] The frequency of transgenic individuals can be compared with experiment (fraction of RFP+ individuals):

f.sub.RFP+=F.sub.WD.sup.10+F.sub.WD.sup.01+F.sub.WD.sup.11+F.sub.DD+F.sub.DR+M.sub.WD.sup.10+M.sub.WD.sup.01+M.sub.WD.sup.11+M.sub.DD+M.sub.DR

[0187] All calculations were carried out using Wolfram Mathematica.sup.23.

PCR

[0188] The PCR reactions were performed using Phusion High Fidelity Master Mix. Initial denaturation was performed in 98° C. for 30 seconds. Primer annealing was performed at a temperature range of 60-72° C. form 30 seconds and elongation was performed at a temperature of 72° C. for 30 seconds per kb.

TABLE-US-00035 TABLE 2 Primers used in this study for Example 1 dsxgRNA-F TGCTGTTTAACACAGGTCAAGCGG-SEQ ID No: 14 dsxgRNA-R AAACCCGCTTGACCTGTGTTAAAC-SEQ ID No: 15 dsx031L-F GCTCGAATTAACCATTGTGGACCGGTCTTGTGTTTAGCAG GCAGGGGA-SEQ ID No: 16 dsx031L-R TCCACCTCACCCATGGGACCCACGCGTGGTGCGGGTCACC GAGATGTTC-SEQ ID No: 17 dsx031R-F CACCAAGACAGTTAACGTATCCGTTACCTTGACCTGTGTTA AACATAAAT-SEQ ID No: 18 dsx031R-R GGTGGTAGTGCCACACAGAGAGCTTCGCGGTGGTCAACG AATACTCACG-SEQ ID No: 19 zpgprCRISPR-F GCTCGAATTAACCATTGTGGACCGGTCAGCGCTGGCGGTG GGGA-SEQ ID No: 20 zpgprCRISPR-R TCGTGGTCCTTATAGTCCATCTCGAGCTCGATGCTGTATTT GTTGT-SEQ ID No: 21 zpgteCRISPR-F AGGCAAAAAAGAAAAAGTAATTAATTAAGAGGACGGCGA GAAGTAATCAT-SEQ ID No: 22 zpgteCRISPR-R TTCAAGCGCACGCATACAAAGGCGCGCCTCGCATAATGAA CGAACCAAAGG-SEQ ID No: 23 dsxin3-F GGCCCTTCAACCCGAAGAAT-SEQ ID No: 24 dsxex6-R CTTTTTGTACAGCGGTACAC-SEQ ID No: 25 GFP-F GCCCTGAGCAAAGACCCCAA-SEQ ID No: 26 dsxex4-F GCACACCAGCGGATCGACGAAG-SEQ ID No: 27 dsxex5-R CCCACATACAAAGATACGGACAG-SEQ ID No: 28 dsxex6-R GAATTTGGTGTCAAGGTTCAGG-SEQ ID No: 29 3xP3 TATACTCCGGCGGTCGAGGGTT-SEQ ID No: 30 hCas9-F CCAAGAGAGTGATCCTGGCCGA-SEQ ID No: 31 dsxex5-R1 CTTATCGGCATCAGTTGCGCAC-SEQ ID No: 32 dsxin4-F GGTGTTATGCCACGTTCACTGA-SEQ ID No: 33 RFP-R CAAGTGGGAGCGCGTGATGAAC-SEQ ID No: 34

TABLE-US-00036 TABLE 6 Primers used in this study for Example 2 multidsxΦ31L-F gctcgaattaaccattgtggaccggtCTTGTGTTTAGCAGGCAGGGGA-SEQ ID No: 52 multidsxΦ31L-R tgaacgattggggtaccggtCTTGACCTGTGTTAAACATAAATG-SEQ ID No: 53 multidsxΦ31R-F agatataatcctgaacgcgtGAGTGGATGATAAACTTTCCGCAC-SEQ ID No: 54 multidsxΦ31R-R tccacctcacccatgggacccacgcgtGGTGCGGGTCACCGAGATGTTC- SEQ ID No: 55 4050-2U6-T1-F gagggtctcaTGCTGTTTAACACAGGTCAAGCGGgttttagagctagaaatagca agt-SEQ ID No: 56 4050-2U6-T3-R gagggtctcaAAACCTCTGACGGGTGGTATTGCagcagagagcaactccatttca t-SEQ ID No: 57

Example 1

[0189] To investigate whether dsx represented a suitable target for a gene drive approach aimed at suppressing population reproductive capacity, the inventors disrupted the intron 4-exon 5 boundary of dsx with the objective to prevent the formation of functional AgdsxF while leaving the AgdsxM transcript unaffected. The inventors injected A. gambiae embryos with a source of Cas9 and gRNA designed to selectively cleave the intron 4-exon 5 boundary in combination with a template for homology directed repair (HDR) to insert an eGFP transcription unit (FIG. 1c). Transformed individuals were intercrossed to generate homozygous and heterozygous mutants among the progeny.

Results

[0190] HDR-mediated integration was confirmed by diagnostic PCR using primers that spanned the insertion site, producing a larger amplicon of the expected size for the HDR event and a smaller amplicon for the wild type allele, and thus allowing easy confirmation of genotypes (FIG. 1d).

[0191] The knock-in of the eGFP construct resulted in the complete disruption of the exon 5 (dsxF−) coding sequence and was confirmed by PCR and genomic sequencing of the chromosomal integration (FIG. 6 and data not shown). Crosses of heterozygote individuals produced, wild type, heterozygous and homozygous individuals for the dsxF− allele at the expected Mendelian ratio 1:2:1, indicating that there was no obvious lethality associated with the mutation during development (Table 3).

TABLE-US-00037 TABLE 3 Ratio of larvae recovered by intercrossing heterozygous dsx ΦC31-knock-in mosquitoes GFP strong (dsxF.sup.−/−) GFP weak (dsxF.sup.−/+) no GFP (+/+) Total 262 (24.9%) 523 (49.7%) 268 (25.5%) 1053

[0192] Larvae heterozygous for the exon 5 disruption developed into adult male and female mosquitoes with a sex ratio close to 1:1. On the contrary half of dsxF−/− individuals developed into normal males whereas the other half showed the presence of both male and female morphological features as well as a number of developmental anomalies in the internal and external reproductive organs (intersex).

[0193] To establish the sex genotype of these dsxF.sup.−/− intersex, the inventors introgressed the mutation into a line containing a Y-linked visible marker (RFP) and used the presence of this marker to unambiguously assign sex genotype among individuals heterozygous and homozygous for the null mutation. This approach revealed that the intersex phenotype was observed only in genotypic females that were homozygous for the null mutation. The inventors saw no effect in heterozygous mutants, suggesting that the female-specific isoform of dsx is haplosufficient.

[0194] Examination of external sexually dimorphic structures in dsxF.sup.−/− genotypic females showed several phenotypic abnormalities including: the development of dorsally rotated male claspers (and absent female cerci), longer flagellomeres associated with male-like plumose antennae (FIG. 2). The analysis of the internal reproductive organs of these individuals failed to reveal the presence of fully developed ovaries and spermathecae; instead they were replaced by male-accessory glands (MAGs) and in some cases (˜20%) by rudimentary pear-shaped organs resembling unstructured testes (FIG. 7).

[0195] Males carrying the dsxF− null mutation in heterozygosity or homozygosity showed wild type levels of fertility as measured by clutch size and larval hatching per mated female, as did heterozygous dsxF− female mosquitoes. On the contrary, intersex XX dsxF-female mosquitoes, though attracted to anaesthetised mice were unable to take a bloodmeal and failed to produce any eggs (FIG. 3).

[0196] The surprisingly drastic phenotype of dsxF− in females is proof of key functional role of exon 5 of dsx in the poorly understood sex differentiation pathway of A. gambiae mosquitoes and suggested that its sequence could represent a suitable target for gene drive approaches aimed at population suppression.

[0197] The inventors employed recombinase-mediated cassette exchange (RMCE) to replace the 3×P3::GFP transcription unit with a dsxF.sup.CRISPRh gene drive construct that consists of an RFP marker gene, a transcription unit to express the gRNA targeting dsxF, and the Cas9 gene under the control of the germline promoter of zero population growth (zpg) and its terminator sequence (FIG. 8). The zpg promoter has shown improved germline restriction of expression and specificity over the vasa promoter used in previous gene drive constructs (Hammond and Crisanti unpublished). Successful RMCE events that incorporated the dsxF.sup.CRISPRh into its target locus were confirmed in those individuals that had swapped the GFP for the RFP marker. During meiosis the Cas9/gRNA complex cleaves the wild type allele at the target sequence and the dsxF.sup.CRISPRh cassette is copied into wt locus via HDR (‘homing’), disrupting exon 5 in the process.

[0198] The ability of the dsxF.sup.CRISPRh construct to home and bypass Mendelian inheritance was analysed by scoring the rates of RFP inheritance in the progeny of heterozygous parents (referred to as dsxF.sup.CRISPRh/+ hereafter) crossed to wild type mosquitoes. Surprisingly, high dsxF.sup.CRISPRh transmission rates of up to 100% were observed in the progeny of both heterozygous dsxF.sup.CRISPRh/+ male and female mosquitoes (FIG. 4a). The fertility of the dsxF.sup.CRISPRh line was also assessed to unravel potential negative effects due to ectopic expression of the nuclease in somatic cells and/or parental deposition of the nuclease into the newly fertilised embryos (FIG. 4b). These experiments showed that while heterozygous dsxF.sup.CRISPRh/+ males showed a fecundity rate (assessed as larval progeny per fertilised female) that did not differ from wild type males, heterozygous dsxF.sup.CRISPRh/+ female showed reduced fecundity overall (mean fecundity 49.8%+/−6.3% S.E., p<0.0001).

[0199] Surprisingly, the inventors noticed a more severe reduction in the fertility of heterozygous females when the drive allele was inherited from their father (mean fecundity 21.7%+/−8.6%) rather than their mother (64.9%+/−6.9%) (FIG. 9). Without wishing to be bound to any particular theory, the inventors believe that this could be explained assuming a paternal deposition of active Cas9 nuclease into the newly fertilized zygote that stochastically induces conversion to of dsx to dsxF.sup.−, either through end-joining or HDR, in a significant number of cells resulting in a reduced fertility in females. Consistent with this hypothesis, some heterozygous females receiving a paternal dsxF.sup.CRISPRh allele showed a somatic mosaic phenotype that included, with varying penetrance, the absence of spermatheca and/or the formation of an incomplete clasper set. A mathematical model built considering the inheritance bias of the construct, the fecundity of heterozygous individuals, the phenotype of intersex as well as the paternal deposition of the nuclease on female fertility, indicated that the dsxF.sup.CRISPRh had the potential to reach 100% frequency in caged population in a span of 9-13 generations depending on starting frequency and stochasticity (FIG. 5a).

[0200] To test this hypothesis, caged wild type mosquito populations were mixed with individuals carrying the dsxF.sup.CRISPRh allele and subsequently monitored at each generation to assess the spread of the drive and quantify its effect on reproductive output. To mimic a hypothetical release scenario, the inventors started the experiment in two replicate cages putting together 300 wild type female mosquitoes with 150 wt male mosquitoes and 150 dsxF.sup.CRISPRh/+ male individuals and allowed them to mate. Eggs produced from the whole cage were counted and 650 eggs were randomly selected to seed the next generations. The larvae that hatched from the eggs were screened for the presence of the RFP marker to score the number of the progeny containing the dsxF.sup.CRISPRh allele in each generation. During the first three generations, the inventors observed in both caged populations an increase of the drive allele from 25% up to ˜69% and thereafter they diverged. In cage 2 the drive reached 100% frequency by generation 7; in the following generation no eggs were produced and the population collapsed. In cage 1 the drive allele reached 100% frequency at generation 11 after drifting around 65% for two generations. This cage population also failed to produce eggs in the next generation. Though the two cages showed some apparent differences in the dynamics of spreading both curves fall within the prediction of the model (FIG. 5b). A summary of the cage trials is shown in table 5.

[0201] The inventors also monitored at different generations the occurrence of mutations at the target site to identify the occurrence of nuclease resistant functional variants. Amplicon sequencing of the target sequence from pooled population samples collected at generation 2, 3, 4 and 5 revealed the presence of several low frequency indels generated at the cleavage site, none of which appeared to encode for a functional AgdsxF transcript (FIGS. 10A-C). Accordingly, none of the variants identified showed any signs of positive selection as the drive progressively increased in frequency over generations, thus indicating that the selected target sequence has rigid functional and structural constraints. This notion is supported by the high degree of conservation of exon 5 in A. gambiae mosquitoes.sup.16,17 and the presence of highly regulated splice site critical for the mosquito reproductive biology.

[0202] Heterozygous and homozygous individuals for the dsxF allele were separated based on the intensity of fluorescence afforded by the GFP transcription unit within the knockout allele. Homozygous mutants were distinguishable as recovered in the expected Mendelian ratio of 1:2:1 suggesting that the disruption of the female-specific isoform of Agdsx is not lethal at the Li larval stage.

TABLE-US-00038 TABLE 4 Genetic females homozygous for the insertion carry male-specific characteristics Genetic Males Genetic Females Characteristic dsxF.sup.+/+ dsxF.sup.+/− dsxF.sup.−/− dsxF.sup.+/+ dsxF.sup.+/− dsxF.sup.−/− Pupal genital male male male female female male lobe Claspers ✓ ✓ ✓ X X ✓ Cercus X X X ✓ ✓ X Spermatheca X X X ✓ ✓ X MAGs ✓ ✓ ✓ X X ✓ Feed on blood X X X ✓ ✓ X Can lay eggs X X X ✓ ✓ X Plumose ✓ ✓ ✓ X X ✓ antennae Pilose X X X ✓ ✓ X antennae

[0203] The inventors assume that parental effects on fitness (egg production and hatching rates) for non-drive (W/W, W/R) females with nuclease from one or both parents are the same as observed values for drive heterozygote (W/D) females with parental effects. For combined maternal and paternal effects (nuclease from both parents), the minimum of the observed values for maternal and paternal effect is assumed.

TABLE-US-00039 TABLE 5 Summary of values obtained from the cage trials Cage Trial 1 Cage Trial 2 Genera- Transgenic Hatching Egg Output Repr. Transgenic Hatching Egg Output Repr. tion Rate (%) Rate (%) (N) Load (%) Rate (%) Rate (%) (N) Load (%) G0 25   — 27462 — 25   — 26895 — (150/600) (150/600) G1 49.65 88.62 17405 36.62 50   86.15 16578 38.36 (268/576) (576/650) (280/560) (560/650) G2 62.01 74.92 14957 45.54 61.79 80.92 15565 42.13 (302/487) (487/650) (325/526) (526/650) G3 68.94 76.77 11249 59.04 68.05 74.15 9376 65.14 (344/499) (499/650) (328/482) (482/650) G4 67.67 71.85 9170 66.61 85.41 71.69 6514 75.78 (316/467) (467/650) (398/466) (466/650) G5 58.67 69.23 11364 58.62 86.5 61.54 4805 81.13 (264/450) (450/650) (346/400) (400/650) G6 63.3  70   7727 71.86 90.09 52.77 4210 84.35 (288/455) (455/650) (309/343) (343/650) G7 69.47 78.62 7785 71.65 100    55.85 1668 93.8 (355/511) (511/650) (363/363) (363/650) G8 70.07 70.92 6293 77.08 100    42.77 0 100 (323/461) (461/650) (278/278) (278/650) G9 75.58 66.15 4107 85.04 — — — — (325/430) (430/650) G10 95.71 57.38 4146 84.90 (357/373) (373/650) G11 100    57.54 2645 90.37 (374/374) (374/650) G12 100    38.92 0 100 (253/253) (253/650)

[0204] Transgenic rate, hatching rate, egg output and reproductive load at each generation during the cage experiment. The reproductive load indicates the suppression of egg production at each generation compared to the first generation.

CONCLUSIONS

[0205] In the human malaria vector, Anopheles gambiae, the gene doublesex (Agdsx) encodes two alternatively spliced transcripts dsx-female (AgdsxF) and dsx-male (AgdsxM) that, in turn, regulate the activation of distinct subordinate genes responsible for the differentiation of the two sexes. The female transcript, unlike AgdsxM, contains an exon (exon 5) whose coding sequence is highly conserved in all Anopheles mosquitoes so far analysed. CRISPR-Cas9 targeted disruption of the intron 4-exon 5 sequence boundary aimed at blocking the formation of functional AgdsxF did not affect male development or fertility, whereas females homozygous for the disrupted allele showed an intersex phenotype characterised by the presence of male internal and external reproductive organs and complete sterility, as summarised in table 4. A CRISPR-Cas9 gene drive construct targeting this same sequence was able to spread rapidly in caged mosquito populations reaching 100% prevalence within a span of 8-12 generations while progressively reducing the egg production to the point of total population collapse. Notably, this drive solution did not induce resistance. A variety of non-functional Cas9 resistant variants were generated in each generation at the target site, they all failed to block the spread of the drive.

[0206] Hence, these data all together provide important functional insights on the role of dsx in A. gambiae sex determination while demonstrating substantial progress towards the development of effective gene drive vector control measures aimed at population suppression. Without wishing to be bound to any particular theory, the intersex phenotype of dsxF−/− genetic females demonstrates that exon 5 is critical for the production of a functional female transcript. Furthermore, the observation that heterozygous dsxFCRISPRh/+ females are fertile and produce nearly 100% transformed progeny would indicate that the majority of the germ cells in these females are homozygous and, unlike somatic cells, do not undergo autonomous dsx-mediated sex commitment.sup.18. The development of a gene drive solutions capable of collapsing a human malaria vector population is a long sought scientific and technical achievement.sup.19. The gene drive dsxFCRISPRh targeting exon 5 of dsx showed a number of desired efficacy features for field applications, in term of inheritance bias, fertility of heterozygous individuals, phenotype of homozygous females and apparent lack of nuclease-resistant functional variants at the target site.

Example 2

[0207] A promising approach to mitigate resistance to gene drive is to target multiple sites at the same time in a strategy analogous to combinational drug therapy. For resistance to get selected against the gene drive, resistant mutations would have to be simultaneously present at all target sites, and co-operatively restore the targeted gene's original function. Note that homing will also serve to remove resistant mutations generated if at least one of the targeted sites is still cleavable.

[0208] Exon 5 of doublesex that was targeted with a gene drive as described in Example 1 contains a total of four invariant target sites that are amenable to multiplexing (FIG. 12). Accordingly, the inventors then generated a novel multiplexed gene drive targeting the original target site at doublesex (T1) and a new target site (T3) present at the 3′ end of the exon 5 coding sequence. The transgenic line that was obtained contains a CRISPR construct bearing a 3×P3::RFP marker, Cas9 expressed under the zpg promoter and two multiplexed U6::gRNA expression cassettes as shown in FIG. 13.

[0209] The inheritance bias of the gene drive, and fertility of gene drive carriers was assessed through phenotype assays. Gene drive heterozygotes of both sexes that had inherited the drive from either males or females were crossed to wild-type individuals and females of each cross were allowed to lay eggs individually. The same was done with a wild-type cage, as a control. Egg and larval output of each female was counted, as soon as they laid and hatched respectively. Larvae were then screened for RFP fluorescence indicative of gene drive presence. The mating status of females that did not give offspring was determined by dissecting their spermathecae and examining it under an EVOS cell imaging microscope for the presence of spermatozoa. Females that showed no evidence of mating were all included in the analysis as having given 0 progeny, since mating competence can be affected by carrying the doublesex gene drive. The results from Kyrou et al. (2018) were adapted to also include unmated individuals in the analysis.

[0210] The results revealed that the novel multiplexed gene drive can successfully bias its inheritance to the next generation with transmission rates comparable to the single-guide gene drive we previously developed (p>0.05) or higher (p=0.04), when the gene drive was transmitted by a male carrier who inherited it maternally (F->M class) (FIGS. 14A and 14B). As with the original doublesex gene drive, the fertility of gene drive carrier females descended from transgenic males (M->F class) was decreased compared to all other classes (FIGS. 14C and 14D). The total and relative number of average larval progeny of females that inherited the gene drive from males (M->F class), is surprisingly higher for the multiplexed gene drive (FIGS. 14C and 14D).

REFERENCES

[0211] 1. Gantz, V. M. et al. Highly efficient Cas9-mediated gene drive for population modification of the malaria vector mosquito Anopheles stephensi. Proc Natl Acad Sci USA 112, E6736-6743 (2015). [0212] 2. Hammond, A. et al. A CRISPR-Cas9 gene drive system targeting female reproduction in the malaria mosquito vector Anopheles gambiae. Nat Biotechnol 34, 78-83 (2016). [0213] 3. Burt, A. Site-specific selfish genes as tools for the control and genetic engineering of natural populations. Proc Biol Sci 270, 921-928 (2003). [0214] 4. Deredec, A., Godfray, H. C. & Burt, A. Requirements for effective malaria control with homing endonuclease genes. Proc Natl Acad Sci USA 108, E874-880 (2011). [0215] 5. Hamilton, W. D. Extraordinary sex ratios. A sex-ratio theory for sex linkage and inbreeding has new implications in cytogenetics and entomology. Science 156, 477-488 (1967). [0216] 6. Galizi, R. et al. A synthetic sex ratio distortion system for the control of the human malaria mosquito. Nat Commun 5, 3977 (2014). [0217] 7. Magnusson, K. et al. Demasculinization of the Anopheles gambiae X chromosome. BMC Evol Biol 12, 69 (2012). [0218] 8. Champer, J. et al. Novel CRISPR/Cas9 gene drive constructs reveal insights into mechanisms of resistance allele formation and drive efficiency in genetically diverse populations. PLoS Genet 13, e1006796 (2017). [0219] 9. Hammond, A. M. et al. The creation and selection of mutations resistant to a gene drive over multiple generations in the malaria mosquito. PLoS Genet 13, e1007039 (2017). [0220] 10. Marshall, J. M., Buchman, A., Sanchez, C. H. & Akbari, O. S. Overcoming evolved resistance to population-suppressing homing-based gene drives. Sci Rep 7, 3776 (2017). [0221] 11. Unckless, R. L., Clark, A. G. & Messer, P. W. Evolution of Resistance Against CRISPR/Cas9 Gene Drive. Genetics 205, 827-841 (2017). [0222] 12. Burtis, K. C. & Baker, B. S. Drosophila doublesex gene controls somatic sexual differentiation by producing alternatively spliced mRNAs encoding related sex-specific polypeptides. Cell 56, 997-1010 (1989). [0223] 13. Graham, P., Penn, J. K. & Schedl, P. Masters change, slaves remain. Bioessays 25, 1-4 (2003). [0224] 14. Krzywinska, E., Dennison, N.J., Lycett, G. J. & Krzywinski, J. A maleness gene in the malaria mosquito Anopheles gambiae. Science 353, 67-69 (2016). [0225] 15. Scali, C., Catteruccia, F., Li, Q. & Crisanti, A. Identification of sex-specific transcripts of the Anopheles gambiae doublesex gene. J Exp Biol 208, 3701-3709 (2005). [0226] 16. Neafsey, D. E. et al. Mosquito genomics. Highly evolvable malaria vectors: the genomes of 16 Anopheles mosquitoes. Science 347, 1258522 (2015). [0227] 17. Anopheles gambiae Genomes, C. et al. Genetic diversity of the African malaria vector Anopheles gambiae. Nature 552, 96-100 (2017). [0228] 18. Murray, S. M., Yang, S. Y. & Van Doren, M. Germ cell sex determination: a collaboration between soma and germline. Curr Opin Cell Biol 22, 722-729 (2010). [0229] 19. Curtis, C. F. Possible use of translocations to fix desirable genes in insect pest populations. Nature 218, 368-369 (1968). [0230] 20. National Academies of Sciences, E. & Medicine Gene Drives on the Horizon: Advancing Science, Navigating Uncertainty, and Aligning Research with Public Values. (The National Academies Press, Washington, D.C.; 2016). [0231] 21. Papathanos, P. A., Windbichler, N., Menichelli, M., Burt, A. and Crisanti, A. The vasa regulatory region mediates germline expression and maternal transmission of proteins in the malaria mosquito Anopheles gambiae: a versatile tool for genetic control strategies. BMC Mol Biol 10, 65, (2009). [0232] 22 Hammond, A. M. et al. The creation and selection of mutations resistant to a gene drive over multiple generations in the malaria mosquito. PLoS Genet 13, e1007039 (2017). [0233] 23. Wolfram Research, Inc., 2017 Mathematica 11.2, Champaign, Ill.