Rice planthopper-sensitivity gene BGIOSGA015651 and use thereof

Abstract

The present disclosure provides a rice planthopper-sensitivity gene BGIOSGA015651 and the use thereof. The applicant found a gene BGIOSGA015651 for regulating rice planthopper-resistance by studying on rice varieties BG1222 and TN1. The gene expression level of BGIOSGA015651 in the insect-resistant variety is hundreds of times or more different from that of the insect-susceptible variety. The expression of this gene can be reduced or knocked out by molecular breeding methods or genetic engineering methods, resulting in that the insect-susceptible plant can obtain high insect-resistance. The resistance level of the insect-susceptible rice variety TN1 is of level 9 before knock-out, and the resistance level thereof is significantly increased to level 0-1 after the rice planthopper-sensitivity gene BGIOSGA015651 is knocked out. The gene and the encoded protein thereof can be used for plant genetic improvement, and the obtained rice for breeding can be widely promoted in a wide range of rice growing areas, and has high economic values and outstanding ecological benefits.

Claims

1. A method for improving the insect resistance of a rice plant, comprising: (A) providing a rice plant comprising insect-resistant variety of insect-sensitivity gene BGIOSGA015651, wherein the insect-resistant variety has the sequence of SEQ ID NO: 1 or SEQ ID NO: 3; cross breeding the rice plant comprising SEQ ID NO: 1 or SEQ ID NO: 3 with a rice plant comprising insect-sensitivity gene BGIOSGA015651 of SEQ ID NO: 2 or SEQ ID NO: 4 to produce a progeny rice plant; and Obtaining a progeny rice plant comprising SEQ ID NO: 1 or SEQ ID NO: 3 and that is insect resistant, or (B) Reducing or abolishing the expression of SEQ ID NO: 2 or SEQ ID NO: 4 in a rice plant by producing a non-natural mutation into SEQ ID NO: 2 or SEQ ID NO: 4 by genetic engineering or by breeding.

2. The method according to claim 1, wherein the insect resistance of the rice plant is resistance to planthoppers.

3. The method according to claim 1, wherein the insect resistance is resistance to insects selected from the group consisting of Nilaparvata lugens, Sogatella furcifera, and Laodelphax striatellus.

4. A rice seed, tissue, plant part, or progeny comprising the non-natural mutation of claim 1, wherein the mutation results in reduced or abolished expression of SEQ ID NO: 2 or SEQ ID NO: 4, and/or reduced or abolished level or activity of a protein encoded by insect sensitivity gene BGIOSGA015651 of SEQ ID NO: 2 or SEQ ID NO: 4, wherein the rice seed, tissue, plant part, or progeny has increased resistance to one or more insects as compared to rice seed, tissue, plant part, or progeny that does not comprise the non-natural mutation in SEQ ID NO: 2 or SEQ ID NO: 4.

5. The rice seed, tissue, plant part, or progeny according to claim 4, wherein the non-natural mutation is produced by genetic engineering.

6. The rice seed, tissue, plant part, or progeny according to claim 4, wherein the non-natural mutation is produced by breeding.

7. The rice seed, tissue, plant part, or progeny according to claim 5, wherein the genetic engineering method comprises RNA interference or gene editing.

8. The rice seed, tissue, plant part, or progeny according to claim 4, wherein the insect resistance is resistance to planthoppers.

9. The rice seed, tissue, plant part, or progeny according to claim 4, wherein the insect resistance is resistance to insects selected from the group consisting of Nilaparvata lugens, Sogatella furcifera and Laodelphax striatellus.

10. The rice seed, tissue, plant part, or progeny according to claim 9, wherein the insect resistance is resistance to insects selected from the group consisting of Nilaparvata lugens and Sogatellafircifera.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a graph showing the changes in the expression levels, over time, of BGIOSGA015651 in rice varieties BG1222 and TN1 after being sucked by the brown planthopper.

(2) FIG. 2 is a graph showing, in hybrid F.sub.2 progeny, the relationship between the expression level of BGIOSGA015651 and the insect-resistance score of rice.

DETAIL DESCRIPTION

(3) Nilaparvata lugens is a major pest that is harmful to rice production. In recent years, the brown planthopper damage has become more and more serious due to some reasons such as the variation of the biotypes of the brown planthopper and the development of drug-resistance, and the like. It has been proven by productive practices that the use of resistant varieties is most economical, safe and effective. According to “the standard seed box screening test”, BG1222 was tested for insect-resistance level at the seedling stage for many years. BG1222 was found to have stable and high resistance to Nilaparvata lugens, and therefore has high utilization value in breeding. However, there is no domestic and foreign literature disclosing which key genes are related with the Nilaparvata lugens-resistance of BG1222. TN1 is internationally recognized as an insect-susceptible rice variety with no insect-resistant gene.

(4) In addition to Nilaparvata lugens, other common species of planthoppers that are harmful to rice comprise Sogatella furcifera and Laodelphax striatellus. In southern China, it is mainly damaged by Nilaparvata lugens and Sogatella furcifera. In addition to directly sucking juice, Sogatella furcifera also acts as a main media for spreading rice viral diseases. BG1222 also has a certain level of resistance to Sogatella furcifera, which was confirmed by the inventors through the insect-resistance level test performed at seedling stage. This has not been reported in any literature.

(5) The applicant of the present invention found a gene for regulating the planthopper-resistance of rice by studying on a rice variety BG1222 that has stable resistance to Nilaparvata lugens and Sogatella furcifera, and a rice variety TN1 that is susceptible to insects. This gene was named as BGIOSGA015651. It was found that the gene expression level of BGIOSGA015651 in the insect-resistant variety is significantly different from that of the insect-susceptible variety. The expression level of BGIOSGA015651 in the insect-resistant variety BG1222 is hundreds or more of times lower than that of the insect-susceptible rice variety TN1. The expression level of BGIOSGA015651 in BG1222 is much lower than that of TN1, regardless if it is sucked by Nilaparvata lugens. It is demonstrated by hybrid F.sub.2 progeny verification that the expression level of BGIOSGA015651 is negatively related to the insect-resistance of rice (i.e., the lower the expression level, the stronger the insect resistance). In the progeny, the stronger the insect-resistance, the smaller the resistance score (Grade), and correspondingly the lower the expression level of BGIOSGA015651. The gene BGIOSGA015651 is knocked out by gene editing technology, such that the insect-susceptible rice variety TN1 can obtain insect-resistance as high as that of the rice variety BG1222.

(6) Hereinafter the present invention will be further described with reference to specific Examples, but it would be appreciated that the present invention is not limited thereto.

Example 1. The Gene Expression Level of BGIOSGA015651 in the Insect-Resistant Variety is Significant Different from that of the Insect-Susceptible Variety

I. Extraction of Total RNA in Rice

1) Grinding of Rice Samples

(7) The ultra-low temperature frozen rice samples were weighed and quickly transferred to a mortar precooled with liquid nitrogen. The tissue samples were ground with a pestle with continuously adding liquid nitrogen, until the samples were ground into powder. An appropriate amount, which matched the amount of sample homogenate, of RNAiso Plus could be added to the mortar. For fresh tissue samples, RNAiso Plus was added immediately and homogenized well. The homogenate was transferred to a centrifuge tube and allowed to stand at room temperature (15-30° C.) for 5 minutes. It was then centrifuged at 12,000 g for 5 minutes at 4° C. The supernatant was carefully pipetted to a new centrifuge tube.

2) Extraction of Total RNA

(8) Chloroform (⅕ volume of RNAiso Plus) was added to the above homogenate lysate, and the centrifuge tube was tightly closed with a cap. The solution was mixed until it was emulsified to be milky white. Then, it was allowed to stand at room temperature for 5 minutes, followed by centrifuging at 12,000 g for 15 minutes at 4° C. The centrifuge tube was carefully removed from the centrifugal machine. At this moment, the homogenate was divided into three layers, i.e., a colorless supernatant (containing RNA), an intermediate white protein layer (mostly DNA), and a colored lower layer of organic phase. The supernatant was pipetted to a new centrifuge tube (not to pipet the white intermediate layer). A volume of isopropanol, which was 0.5-1 fold of RNAiso Plus, was added to the supernatant. Then, the tube was turned upside down and well mixed, and allowed to stand at room temperature for 10 minutes. It was then centrifuged at 12,000 g for 10 minutes at 4° C. Generally, RNA pellet occurred at the bottom of the tube after the centrifugation.

3) Cleaning of the RNA Pellet

(9) The supernatant was carefully discarded, without affecting the pellet. A small amount of isopropanol could be remained. Then, a certain amount of 75% ethanol, which is equivalent to that of the RNAiso Plus, was added, and the wall of the centrifuge tube was washed by gently turning the tube upside down, followed by centrifuging at 7,500 g for 5 minutes at 4° C. The supernatant was carefully discarded, without affecting the pellet.

4) Dissolution of RNA

(10) The tube cap was opened and the pellet was dried for a few minutes at room temperature. When the pellet was dried, an appropriate amount of RNase-free water was added to dissolve the pellet.

II. Removing of the Genome

(11) The reaction solution was formulated by using DNase I of RNase-free according to the following system:

(12) TABLE-US-00001 RNA 60 μl DNase I 20 μl 10 x buffer 20 μl H.sub.2O (RNase free) 100 μl Total volume 200 μl

(13) Digestion was performed at 37° C. for 30 minutes, and inactivated at 65° C. for 10 minutes.

(14) Then the experiment was performed following the steps of:

(15) adding an equal volume of phenol, mixing well by turning upside down, then centrifuging at 10,000 rpm for 5 minutes, and pipetting the supernatant;

(16) adding an equal volume of chloroform, mixing well by turning upside down, then centrifuging at 10,000 rpm for 10 minutes, and pipetting the supernatant;

(17) adding an equal volume of isopropanol, mixing well and gently, and then standing at −20° C. for 15 minutes;

(18) centrifuging at 10,000 g for 10 minutes at 4° C. to collect RNA pellet, and discarding the supernatant;

(19) washing twice with 75% ethanol, and air drying in a super clean bench; and

(20) adding 10 μl DEPC water to dissolve the pellet.

III. Purity Detection and Electrophoresis Detection

(21) Purity detection: 2 μl of RNA sample was taken and diluted 60 times, and OD value thereof was determined on a microspectrophotometer. It was showed that the ratio of OD 260/OD 280 was greater than 1.8, indicating that the resulted RNA was pure and had no protein contamination.

VI. Reverse Transcription

(22) ART reaction solution was formulated according to the following (the formulation of reaction solution was performed on ice).

(23) TABLE-US-00002 RNA* 2 μl 5 x primeScript RT Master Mix (Perfect Real Time) 2 μl RNase-free ddH.sub.2O 6 μl Total volume 10 μl

(24) indicates that the reaction system can be scaled up as required, and 500 ng of Total RNA can be used at most in 10 μl of the reaction system.

(25) The above 10 μl of the reaction solution was reacted on a TaKaRa-TP600 PCR machine: 37° C. 15 minutes; 85° C. 5 seconds; maintained at 4° C., and then stored at −20° C. until use.

(26) V. Quantification

(27) The gene expression level of BGIOSGA015651 was analyzed using the following primer pairs, the base sequences thereof were as follows:

(28) TABLE-US-00003 RE-f: (SEQ ID NO: 7) TCCAGAGCAGGAAACAAGGAC, RE-r: (SEQ ID NO: 8) GCCTACGCCAGCACATGAAA.

(29) Reaction system:

(30) TABLE-US-00004 cDNA template 2 μl Forward primer (RE-f) 1 μl Reverse primer (RE-r) 1 μl SYBR Premix Ex TaqII (Tli RNaseH Plus) (2 X) 12.5 μl dH.sub.2O 8.5 μl Total volume 25 μl

(31) Real Time PCR reactions

(32) Real Time PCR reactions were performed on a CFX96 Real-Time (Bio-Rad) PCR machine: 95° C. 30 seconds; 95° C. 5 seconds, 60° C. 30 seconds, 40 cycles. Analysis of the melting curve: temperature 60° C.-95° C.

(33) The results are shown in FIG. 1.

(34) FIG. 1 shows the changes in the expression levels, over time, of BGIOSGA015651 in rice varieties BG1222 and TN1 after being sucked by Nilaparvata lugens.

(35) It demonstrates by the results as shown in FIG. 1 that the gene expression levels of BGIOSGA015651 in the insect-resistant variety is significantly differently from that of the insect-susceptible variety. The expression levels of BGIOSGA015651 in the insect-resistant variety BG1222 is hundreds of times, or even thousands or more of times lower than that of the insect-susceptible rice variety TN1. The expression levels of BGIOSGA015651 in BG1222 are much lower than that of TN1, regardless if it is sucked by Nilaparvata lugens (sucking for different hours).

Example 2. Cloning of Gene BGIOSGA015651 and Analysis of the Peptide Thereof

(36) The genes BGIOSGA015651 of the insect-resistant variety BG1222 and the insect-susceptible variety TN1 were cloned, sequenced and analyzed, respectively.

(37) The nucleotide sequence of gene BGIOSGA015651 in the insect-resistant variety BG1222 was as shown by SEQ ID NO: 1 (including exons and introns), and the nucleotide sequence of gene BGIOSGA015651 in the insect-susceptible variety TN1 was as shown by SEQ. ID NO: 2 (including exons and introns). There were several different nucleotides between the two nucleotide sequences.

(38) The cDNA sequence of gene BGIOSGA015651 in the insect-resistant variety BG1222 was as shown by SEQ ID NO: 3, while the cDNA sequence of gene BGIOSGA015651 in the insect-susceptible variety TN1 was as shown by SEQ. ID NO: 4.

(39) The protein encoded by gene BGIOSGA015651 in the insect-resistant variety BG1222 was as shown by SEQ ID NO: 5, while the protein encoded by gene BGIOSGA015651 in the insect-susceptible variety TN1 was as shown by SEQ. ID NO: 6. There were 16 different amino acids between the two proteins.

Example 3. Hybrid F.SUB.2 .Progeny Between the Insect-Resistant Variety and the Insect-Susceptible Variety

(40) A population of F.sub.2 progeny was established by hybridizing BG1222 with TN1. The samples of F.sub.2 progeny population was 512 (i.e. n=512), from which sixty plants with different resistance scores were selected for detection. The expression levels of BGIOSGA015651 were detected for the F.sub.2 progeny plants having phenotypes of different resistance-levels, so as to determine the correlation between the expression level of BGIOSGA015651 and the insect-resistant phenotype of rice.

(41) The results are shown in FIG. 2.

(42) FIG. 2 is a graph showing, in the hybrid F.sub.2 progeny, the relationship between the expression level of BGIOSGA015651 and the insect-resistance score of rice.

(43) The bar graph of FIG. 2 shows the relationship between the expression level of BGIOSGA015651 and the insect-resistance scores of plants representing hybrid F2 progeny plants. The horizontal axis shows the insect-resistance scores (i.e. 0, 1, 3, 5, 7 and 9), and the vertical axis shows the expression level (in log10) of BGIOSGA015651, wherein a shorter bar on the graph of FIG. 2 indicates a lower expression level of BGIOSGA015651. According to FIG. 2, it can be seen that, with the decrease of the expression level of BGIOSGA015651, the insect-resistance score is also gradually reduced (i.e. from right to left), and the shortest bar has the lowest insect-resistance score (0) and the lowest expression level of BGIOSGA015651. The letters (i.e. “a”, “b”, “c”, “cd”, and “d”) above the bars indicate the statistically relationship between the data represented by each bar.

(44) It demonstrates by the results as shown in FIG. 2 that, in the hybrid F.sub.2 progeny, the expression level of gene BGIOSGA015651 is negatively related to the insect-resistance of rice (the lower the expression level, the stronger the insect-resistance). It shows that the stronger the insect-resistance in the progeny, the smaller the resistance score (Grade), and correspondingly the lower the expression level of BGIOSGA015651.

Example 4. Gene Knockout Experiment

(45) Gene BGIOSGA015651 was knocked out by gene editing technology in the gene knockout experiment, such that the insect-susceptible rice variety TN1 can obtain insect resistance as high as that of the rice variety BG1222.

I. Construction of a Gene-Knockout Vector in Rice

(46) A fragment located at the front end of the cDNA sequence of gene BGIOSGA015651 was selected as a target sequence, and a gRNA (guide RNA) sequence was designed and synthesized (the sequences was shown as follows, but the target sequence and the corresponding gRNA sequence were not limited to them). The gRNA sequence was recombined into apBWA(V)H vector (Wuhan BioRun Co., Ltd.) containing a hygromycin-resistance tag. The vector system was engineered by using the CRISPR/Cas9 genome, and one base in the target sequence was mutated (i.e., deleting or adding one base in the target sequence). The cDNA sequence of gene BGIOSGA015651 was subjected to frame shift mutation, such that the expressed protein thereof was not the same as the original amino acid product, thereby achieving the purpose of knocking out gene BGIOSGA015651.

(47) TABLE-US-00005 gRNA sequence: (SEQ ID NO: 9) 5′-CATCTCTCAGTGCACGGCT-3′; Target sequence: (SEQ ID NO: 10) 5′-ACATCTCTCAGTGCACGGCTGGG-3′.

II. Obtaining Rice Seedlings with Gene Knockout by Genetic Transformation

(48) Inducing callus from a mature embryo of the insect-susceptible rice TN1: Cultured Agrobacterium (EHA105) solution was placed in a centrifuge tube and centrifuged. The supernatant was pipetted to prepare Agrobacterium suspension. A callus having a certain size was picked out and placed in the Agrobacterium suspension for infection. Then the callus was placed on the co-culture medium.

(49) 2) Screening: The callus was removed and dried. The dried callus was transferred to screening medium for a first screening. An initial callus comprising resistant callus was transferred to new medium for a second screening.

(50) 3) Induced differentiation and rooting of the resistant callus: The resistant callus was picked out, transferred to a culture dish containing differentiation medium. Then, the culture dish was sealed with sealing film, and placed in a constant temperature culture chamber to make the resistant callus to differentiate into seedlings. When the size of the seedlings was about 1 cm, the seedlings were transferred to rooting medium for culturing strong seedlings.

(51) 4) PCR detection of hygromycin (Hyg) resistant gene: A conventional PCR amplification method was used to determine whether the rice seedling comprised this gene by using hygromycin resistant gene-specific primers. If the rice seedling comprised this gene, it would be a transformation positive seedling.

(52) Resistant gene specific primers:

(53) TABLE-US-00006 Hyg-f: (SEQ ID NO: 11) 5′-ACGGTGTCGTCCATCACAGTTTGCC-3′; Hyg-r: (SEQ ID NO: 12) 5′-TTCCGGAAGTGCTTGACATTGGGA-3′.

(54) 5) Gene knockout detection of positive seedlings: PCR reaction was performed by using the detection primers designed in the vicinity of the target. The PCR product was then sequenced to detect gene knockout (whether or not a knockout homozygous seedling was obtained). Homozygous seedlings, in which gene BGIOSGA015651 of the insect-susceptible rice TN1 were successfully knocked out, were obtained.

III. Identification of Insect-Resistance of Rice Seedlings with Gene Knockout

(55) Homozygous seedlings, in which gene BGIOSGA015651 of the insect-susceptible rice TN1was successfully knocked out, were identified for insect resistance at seedling stage.

(56) The identified results were as follows: the mortality rate of the insect-susceptible receptor variety TN1 was 100%; the mortality rate of homozygous seedlings, in which gene BGIOSGA015651 was knocked out, was 0% and the resistance level thereof was 0-1 (i.e., high resistance level).

(57) It is verified that the expression level of gene BGIOSGA015651 is negatively related to the insect resistance of rice (the lower the expression level, the stronger the insect resistance). Thus, gene BGIOSGA015651 is an important gene related to rice planthopper resistance.

Example 5. Comparison Between Insect-Resistance Effect of Gene BGIOSGA015651 and that of Existing Nilaparvata lugens-Resistant Genes

(58) In the present invention, after gene BGIOSGA015651 was knocked out from the insect-susceptible rice variety TN1 (having an original resistance level of 9), the resistance level thereof was significantly increased to level 0-1, which was equivalent to or better than that of insect-resistant variety BG1222 (having a resistance level of 1.07).

(59) The applicants found that the varieties, which previously have insect-resistance, had a substantial loss of insect resistance through rice seedling identification. At present, Mudgo (comprising Bph1) has an average resistance level of 5.4, ASD7 (comprising Bph2) has an average resistance level of 8.89, Rathu Heenati (comprising Bph3) has an average resistance level of 4.61, Babavee (comprising Bph4) has an average resistance level of 8.14, while the insect resistant variety BG1222 has an average resistance level of 1.07.

(60) By comparison, it can be found that the rice planthopper sensitivity gene BGIOSGA015651 of the present invention has a great prospect in rice breeding. With molecular breeding methods or genetic engineering methods, it can change an insect-susceptible plant to one having high insect-resistance by reducing or knocking out the expression of the protein-encoding gene, thereby obtaining highly planthopper resistant (e.g. Nilaparvata lugens resistant and Sogatella furcifera resistant) rice varieties.

Example 6. Resistance Against Sogatella furcifera of BGIOSGA015651

(61) In the present invention, after gene BGIOSGA015651 was knocked out from the insect-susceptible rice variety TN1 (having an original resistance level of level 9), the resistance level thereof against Sogatella furcifera was identified at the seedling stage.

(62) The results were as follows: the mortality rate of the insect-susceptible receptor variety TN1 was 100%; the mortality rate of homozygous seedlings, in which gene BGIOSGA015651 was knocked out, was 0% and the resistance level thereof was 0-1 (i.e., high resistance level).

(63) Therefore, the rice planthopper-sensitivity gene BGIOSGA015651 of the present invention is also effective for breeding of seedlings having resistance against Sogatella furcifera.

(64) The above examples are preferred embodiments of the present invention, and the embodiments of the present invention are not limited to these examples. Any other alterations, modifications, substitutions, combinations, and simplification can be made without departing from the spirit and principle of the present invention, and all belong to equivalent alternations and fall in the protection scope of the present invention.