Recombinant <i>Dermatophagoides farinae </i>type 1 allergen protein and its preparation method and application
10975128 · 2021-04-13
Assignee
Inventors
Cpc classification
C07K1/34
CHEMISTRY; METALLURGY
C07K1/36
CHEMISTRY; METALLURGY
C07K1/20
CHEMISTRY; METALLURGY
International classification
Abstract
Provided are an optimized proDer f1 gene, a proDer f1 protein encoded thereby, a vector comprising said gene, and a Pichia pastoris strain. Also provided are an expression method and a purification method of the proDer f1 protein.
Claims
1. An isolated DNA sequence encoding a propeptide of Der f1 protein (proDer f1 protein) having a base sequence as shown in SEQ ID NO: 1, wherein the DNA sequence is comprised in a vector.
2. The DNA sequence of claim 1, wherein the DNA sequence is comprised in the vector pAO815, pPIC9, pPIC9K, pPIC3.5, pPIC3.5K, pPICZα A, B, C or pGAPZα A, B, C.
3. The DNA sequence of claim 2, wherein the vector is comprised in the Pichia pastoris strain SMD1168, GS115, KM71, X33 or KM71H.
4. The DNA sequence of claim 3, wherein there is 242 bp interval between the DNA sequence encoding proDer f1 protein and the ATG of AOX1 on Pichia pastoris; and the DNA sequence encoding the proDer f1 protein is preceded by an alpha-factor signal peptide and Kozak sequence GCCACCATGG.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2) The sequence before optimization corresponds to the nucleotide sequence of the natural proDer f1 gene; the sequence after optimization corresponds to the nucleotide sequence of the recombinant proDer f1 gene of the present invention, that is, the codon-optimized sequence.
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10) Lane 1 represents 200 bp DNA ladder; lane 2 represents a PCR product of the recombinant proDer f1 gene containing XhoI and NotI restriction sites at both ends.
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
DETAILED DESCRIPTION OF THE INVENTION
(36) The invention is further illustrated below in conjunction with specific examples. It should be understood that the examples referred to are merely illustrative of the invention and are not intended to limit the scope of the present invention.
Example 1 Codon Optimization of Recombinant ProDer f1
(37) Based on the DNA sequence of proDer f1 disclosed in GenBank (GenBank accession no. AB034946.1), as shown in SEQ ID No: 2, the inventors performed codon optimization of the gene to obtain the proDer f1 gene of the present invention of which the nucleotide sequence is as shown in SEQ ID No: 1 and the amino acid sequence is as shown in SEQ ID No: 3. Comparison of each parameter before and after codon optimization of the proDer f1 is as follows:
(38) 1. Codon Adaptation Index (CAI)
(39) As can be seen from
(40) 2. Optimal Codon Usage Frequency (POP)
(41) As can be seen from
(42) 3. GC Base Content (GC Curve)
(43) The ideal distribution region of GC content is 30%-70%, and any peak outside this region will affect transcription and translation efficiency to varying degrees. As can be seen from the comparison of the average GC base content distribution region plots of the proDer f1 gene in
Example 2: Construction of an Expression Plasmid Containing the ProDer f1 Gene
(44) A sequence of XhoI restriction site was introduced at the 5′ end, and a sequence of NotI restriction site was introduced at the 3′ end of the codon-optimized proDer f1, and then full gene synthesis was performed. The synthesized gene fragment was constructed into the pUC57 plasmid supplied by GenScript (Nanjing) Co., Ltd., thereby obtaining a plasmid for long-term preservation, denoted as pUC57-proDer f1 plasmid.
(45) PCR amplification was performed using the pUC57-proDer f1 plasmid as a template, and primers of following sequences:
(46) TABLE-US-00001 upstream primer (SEQ ID No: 5): M13 F: TGT AAA ACG ACG GCC AGT downstream primer (SEQ ID No: 6): M13 R: CAG GAA ACA GCT ATG AC
(47) The total volume of the reaction was 50 μL, in which 2.5 μL of each primer at a concentration of 10 μmol/L was added, 1 μL of dNTP at a concentration of 10 mmol/L was added, and 0.5 μL DNA polymerase being Q5 (#M0491L, purchased from New England BioLabs) at 2 U/pt was added. The reaction conditions were 98° C. for 5 seconds, 55° C. for 45 seconds, and 72° C. for 30 seconds. After 25 cycles, the product was analyzed by 1.0% agarose gel electrophoresis. The results showed that the product size was consistent with the expected size (915 bp) (results as shown in
Example 3: Construction of a Pichia pastoris Host Engineering Strain Containing a Recombinant ProDer f1 Gene
(48) Formulation of YPDS solid medium: the medium was formulated according to the instructions of Easy SelectPichia Expression Kit, Invitrogen, comprising 10 g/L yeast extract, 20 g/L peptone, 20 g/L glucose, 15 g/L agarose, and 182 g/L sorbitol.
(49) 1. Construction of a Host Engineering Strain Containing Codon-Optimized proDer f1
(50) Electrocompetent cells were prepared according to the method of instructions of Easy SelectPichia Expression Kit, Invitrogen. The plasmid pPICZα-proDer f1 obtained in Example 2 was linearized with Sac I restriction endonuclease (#R0156S, purchased from New England Biolabs), and precipitated with ethanol. The linearized vector was electrotransformed into competent cells of Pichia pastoris X33. The cells were plated on YPDS solid media and cultured at 30° C. until the transformants grew.
Example 4: Inducible Expression and Identification of Engineering Strains Containing Codon-Optimized ProDer f1 Gene
(51) Formulation of BMGY medium: the medium was formulated according to the instructions of Easy SelectPichia Expression Kit, Invitrogen, comprising 10 g/L yeast extract, 20 g/L peptone, 3 g/L K.sub.2HPO.sub.4, 11.8 g/L KH.sub.2PO.sub.4, 13.4 g/L YNB, 4×10.sup.−4 g/L biotin, and 10 g/L glycerin.
(52) Formulation of BMMY medium: the medium was formulated according to the instructions of Easy SelectPichia Expression Kit, Invitrogen, comprising 10 g/L yeast extract, 20 g/L peptone, 3 g/L K.sub.2HPO.sub.4, 11.8 g/L KH.sub.2PO.sub.4, 13.4 g/L YNB, 4×10.sup.−4 g/L biotin, and 5 mL/L methanol.
(53) 1. Methanol-Induced Expression of an Engineering Strain of Codon-Optimized proDer f1
(54) The host monoclonal engineering strain obtained in Example 3 was picked into a 5 mL BMGY medium and cultured in a 50 mL sterile centrifuge tube at 30° C. and 220 rpm until OD.sub.600 reaches 1.0-2.0. 1 mL of the culture was stored, and the remaining strain solution was resuspended and transferred to BMMY for induced expression at a small scale, and methanol was supplemented every 24 hours to a final concentration of 1%. One week later, the supernatant of the strain solution was collected by centrifugation, and analyzed by SDS-PAGE gel electrophoresis and Western blotting. Brightness of expressed product bands was observed.
Example 5: Purification of Recombinant ProDer f1 Protein
(55) The Der f1 constructed in this invention is obtained mainly by ion exchange and hydrophobic chromatography purification methods. HiTrap SP FF, HiTrap Q FF, and HiTrap Phenyl HP were selected as the chromatographic packings. The specific steps are as follows:
(56) 1. Pretreatment of the Fermentation Broth by Impurity Removal
(57) The fermentation broth of host engineering strain containing proDer f1 obtained according to Example 4 was centrifuged at a low temperature at 12000 rpm for 15 minutes to collect a supernatant, and the supernatant was dialyzed in a 5 KD dialysis bag against a 25 mM sodium acetate buffer at pH 4.5 for 48 h, and filtered through a 0.45 μm filter membrane to obtain a supernatant of the treated fermentation broth.
(58) 2. Cation Exchange Chromatography
(59) The treated fermentation broth of the previous step was loaded on a SPFF cation exchange chromatographic column, wherein the equilibration buffer was 50 mM NaAc at pH 4.5, the elution buffer was 50 mMNaAc and 1.0 M NaCl at pH 4.5, isocratic elution was performed at 12%, 25% and 100%, and the sample peaks were mainly concentrated at the 25% elution peak.
(60) 3. Anion Exchange Chromatography
(61) The Der f1 protein peak purified in the previous step was collected, and the sample was ultrafiltrated with a 20 mM NaH.sub.2PO.sub.4 solution at pH 6.0, and loaded on a HiTrap Q FF chromatography packing. The equilibration buffer was 20 mM NaH.sub.2PO.sub.4 at pH 6.0, and the elution buffer was 20 mM NaH.sub.2PO.sub.4 and 1.0 M NaCl at pH 6.0. The flow-through peak of Der f1 was collected. The flow-through peak of Der f1 protein was as shown in
(62) 4. Hydrophobic Chromatography
(63) The flow-through peak of Der f1 from the anion chromatography was collected, and ammonium sulfate was added to a final concentration of 1.5 M. The fermentation broth supernatant treated as above was loaded on a Phenyl HP chromatographic column. The equilibration buffer was 20 mM NaH.sub.2PO.sub.4 and 1.5 M (NH.sub.4).sub.2SO.sub.4 at pH 6.0; the elution buffer was 20 mM NaH.sub.2PO.sub.4 at pH 6.0, isocratic elution was performed at 25%, 50%, 70%, and 100%, and the Der f1 protein is mainly concentrated at the 75% elution peak.
Example 6: Analysis of Der f1 Protein Activity
(64) The purified Der f1 protein was dialyzed against a PBS buffer at pH 7.4, and the protein concentration was determined by a Pierce BCA protein concentration assay kit (Cat No: 23225, purchased from Pierce), and fold-diluted to 250 ng, 125 ng, 62.5 ng, 31.25 ng, and 15.625 ng. The obtained solution was detected for the reactivity with sera of patients allergic to Dermatophagoides farinae by comparing with natural Der f1.
Example 7: Determination of Gene Copy Number of Recombinant ProDer f1 Engineering Strain
(65) 1. Inoculation in X33 strain: the strains were cultured in YPD media for 24 h, the X33 genome was extracted by a genomic extraction kit (purchased from Tiangen Biotech (Beijing) Co., Ltd.), and GAP gene was amplified using the X33 genome as a template, and GAP-1 and GAP-2 as primers of which the sequences are as follows:
(66) TABLE-US-00002 upstream primer (SEQ ID No: 7) GAP-1: GGTATTAACGGTTTCGGACGTATTG downstream primer (SEQ ID No: 8) GAP-2: GATGTTGACAGGGTCTCTCTCTTGG
(67) The total volume of the reaction was 50 μL, in which 2.5 μL of each primer at a concentration of 10 μmol/L was added, 1 μL of dNTP at a concentration of 10 mmol/L was added, and 0.5 μL DNA polymerase being Taq DNA Polymerase (M0267S, purchased from New England BioLabs) at 2 U/μL was added. The reaction conditions were 94° C. for 10 minutes, 94° C. for 30 seconds, 55° C. for 30 seconds, 68° C. for 60 seconds, and 68° C. for 5 minutes. After 30 cycles, the product was analyzed by 1.0% agarose gel electrophoresis. The results showed that the product size was consistent with the expected size (400 bp) (results as shown in
(68) 2. The proDer f1 gene was amplified using the pPICZα-proDer f1 plasmid of Example 2 as a template, and 5′ AOX and 3′ AOX as primers with the following sequences:
(69) TABLE-US-00003 upstream primer (SEQ ID No: 9): 5′ AOX: GACTGGTTCCAATTGACAAGC downstream primer (SEQ ID No: 10): 3′ AOX: GGCAAATGGCATTCTGACAT
(70) The total volume of the reaction was 50 in which 2.5 μL of each primer at a concentration of 10 μmol/L was added, 1 μL of dNTP at a concentration of 10 mmol/L was added, and 0.5 μL DNA polymerase being Taq DNA Polymerase (# M0267S, purchased from New England BioLabs) at 2 U/μL was added. The reaction conditions were 94° C. for 10 minutes, 94° C. for 30 seconds, 49° C. for 30 seconds, and 68° C. for 60 seconds, and 68° C. for 5 minutes. After 30 cycles, the product was analyzed by 1.0% agarose gel electrophoresis. The results showed that the product size was consistent with the expected size (1500 bp) (results as shown in
(71) 3. Calculation of Gene Copy Number:
(72) The concentration (ng/μL) of the standard plasmid was determined by a nucleic acid microanalyzer (Nanodrop2000, ThermoFisher). Copy numbers of GAP and proDer f1 were calculated according to the following formula:
Copies/u=(6.02×10.sup.23)×(ng/μl×10.sup.−9)/(DNA length×660)
4. Processing Samples to be Tested
(73) The pPICZα-proDer f1-X33 engineering strain was inoculated in YPD liquid media at 30° C. overnight; and the genome was extracted the next day, and its concentration (ng/μL) and purity were determined by a nucleic acid quantitative microanalyzer.
(74) 5. Establishment of a Standard Curve
(75) The standard plasmids of T-GAP and T-proDer f1 with known copy numbers were gradiently diluted to 10.sup.8, 10.sup.7, 10.sup.6, 10.sup.5, 10.sup.4, and 10.sup.3 copies/μl, respectively. The fluorescent quantitative PCR were performed using GAP-1 and GAP-2, 5′ AOX and 3′ AOX as primers, respectively.
(76) 6. Determination of Copy Number of ProDer f1 Gene in Recombinant Strains
(77) The genome sample of extracted pPICZα-proDer f1-X33 was serially 10-fold-diluted to obtain four gradients of stock solution, 10.sup.−1, 10.sup.−2, and 10.sup.−3. Fluorescent quantitative PCR was performed using GAP-1 and GAP-2, 5′ AOX and 3′ AOX as primers, and each gradient was assayed three times.
(78) TABLE-US-00004 TABLE 1 Results of copy number of proDer f1 in the genome detected by real-time fluorescent quantitative PCR Average Ct value gene copy number (10.sup.N)Copy number of proDer f1 gene in Pichia pastoris genome Copy number of the proDer f1 gene/copy DNA GAP proDer f1 GAP proDer f1 number of the concentration gene gene gene gene GAP gene Stock 18.802 23.000 6.84 5.96 6.02 solution 10.sup.−1 19.939 24.382 6.29 5.57 5.46 10.sup.−2 23.650 24.704 5.17 5.29 5.07 10.sup.−3 27.966 24.876 3.62 5.19 4.85
Example 8: Analysis of the Acting Elements in the ProDer f1 Genome
(79) There is no stable additional plasmid in Pichia pastoris, the expression vector is homologously recombined with the host chromosome, and the exogenous gene expression framework is fully integrated into the chromosome to realize the expression of the exogenous gene; the typical Pichia pastoris expression vector contains a regulatory sequence of alcohol oxidase gene, and contains the main structures comprising AOX promoter, multiple cloning site, transcription termination and polyA formation gene sequence (TT), screening markers and the like. The promoter is a cis-element for gene expression regulation and an important element for the genetically engineered expression vector. The important role of the promoter at the transcriptional level determines the gene expression level.
(80) The proDer f1 genome was extracted according to the method of Example 7, and the proDer f1 gene was amplified from the genome using 5′ AOX and 3′ AOX as primers. The obtained samples were sent to GenScript (Nanjing) Co., Ltd. to detect the acting element before and after the proDer f1 gene which was inserted into the genome. The results of genome sequencing indicated that the proDer f1 gene expression framework was integrated into the chromosome of Pichia pastoris by a single cross-insertion, which enabled the proDer f1 gene to express the gene using the AOX promoter on the yeast chromosome, and thus the expression level was higher.
(81) Generally, the closer the first ATG of the exogenous coding sequence to the ATG of AOX1, the better the expression effect. In the gene construction, the inventors chose an enzyme cleavage site closest to the ATG of AOX1, and found that the proDer f1 gene was away from ATG of AOX1 only by 242 bp. In addition, the alpha-factor signal peptide and Kozak sequence GCCACCATGG were added in front of proDer f1 gene, and the signal peptide and the sequence can greatly improve transcription and translation efficiency and increase expression efficiency of proDer f1 gene in eukaryotes.