METHODS OF GLYCOENGINEERING PROTEOGLYCANS WITH DISTINCT GLYCAN STRUCTURES
20210115413 · 2021-04-22
Assignee
Inventors
- Michelle Chang (Cambridge, MA, US)
- Leonid A. Gaydukov (Tewksbury, MA, US)
- Giyoung Jung (Cambridge, MA, US)
- Nevin M. Summers (Cambridge, MA, US)
- Timothy Kuan-Ta Lu (Cambridge, MA)
- Ron Weiss (Newton, MA)
- John Scarcelli (Wilmington, MA, US)
- Richard Cornell (Woburn, MA, US)
- Jeffrey Marshall (Weare, NH, US)
- Bruno Figueroa (Andover, MA, US)
- Wen Allen Tseng (Somerville, MA, US)
Cpc classification
C12Y204/01287
CHEMISTRY; METALLURGY
C07K2317/41
CHEMISTRY; METALLURGY
C12N2310/20
CHEMISTRY; METALLURGY
C12Y204/99002
CHEMISTRY; METALLURGY
C12N9/00
CHEMISTRY; METALLURGY
C12Y302/01113
CHEMISTRY; METALLURGY
C12N2800/80
CHEMISTRY; METALLURGY
C07K2317/14
CHEMISTRY; METALLURGY
C12Y204/99003
CHEMISTRY; METALLURGY
C12Y204/99018
CHEMISTRY; METALLURGY
C12Y203/01022
CHEMISTRY; METALLURGY
C07K16/00
CHEMISTRY; METALLURGY
C12Y302/01
CHEMISTRY; METALLURGY
C12Y204/01288
CHEMISTRY; METALLURGY
C12Y204/01068
CHEMISTRY; METALLURGY
C12N9/1029
CHEMISTRY; METALLURGY
C12Y204/99019
CHEMISTRY; METALLURGY
C12Y204/99001
CHEMISTRY; METALLURGY
C12Y203/0102
CHEMISTRY; METALLURGY
International classification
Abstract
Disclosed herein are methods of generating proteoglycans with distinct glycan structures in engineered, non-naturally occurring eukaryotic cells. These methods make accessible a dynamic range of protein glycosylation. Compositions of engineered, non-naturally occurring cells capable of generating these proteoglycans are also disclosed herein.
Claims
1. An engineered, non-naturally occurring eukaryotic cell comprising a modified genome, wherein the modified genome comprises: (a) a knockout of at least one endogenous polynucleic acid sequence encoding a glycan modifying enzyme; and (b) an integration of at least one polynucleic acid sequence comprising a sequence encoding a functional copy of a glycan modifying enzyme knocked out in (a), wherein the sequence encoding the functional copy of a glycan modifying enzyme is operably linked to a tunable control element that controls mRNA and/or protein expression of the glycan modifying enzyme.
2. The engineered, non-naturally occurring eukaryotic cell of claim 1, wherein the tunable control element in (b) is selected from the group consisting of an inducible promoter element, a synthetic promoter panel, a miRNA response element, and an ORF control element.
3. The engineered, non-naturally occurring eukaryotic cell of claim 1, wherein the engineered, non-naturally occurring eukaryotic cell comprises: (b) an integration of at least two polynucleic acid sequences, wherein each polynucleic acid sequence comprises the sequence of a functional copy of a glycan modifying enzyme knocked out in (a), wherein the sequence encoding the functional copy of a glycan modifying enzyme is operably linked to a tunable control element that controls mRNA and/or protein expression of the glycan modifying enzyme.
4. The engineered, non-naturally occurring eukaryotic cell of claim 3, wherein the tunable control element of each of the at least two polynucleic acid sequences in (b) is unique.
5. The engineered, non-naturally occurring eukaryotic cell of claim 3 or claim 4, wherein the tunable control element of at least one of the at least two polynucleic acid sequences in (b) is selected from the group consisting of an inducible promoter element, a synthetic promoter panel, a miRNA response element, and an ORF control element.
6. The engineered, non-naturally occurring eukaryotic cell of claim 2-5, wherein the inducible promotor is a chemically-regulated promoter or a physically-regulated promoter.
7. The engineered, non-naturally occurring eukaryotic cell of claim 6, wherein the chemically-regulated promoter comprises a TRE-Tight promoter sequence or a PhlF-activatable promoter sequence.
8. The engineered, non-naturally occurring eukaryotic cell of any one of claims 1-7, wherein the glycan modifying enzyme in (a) is selected from the group consisting of a fucosyltransferase, a galactosyltransferase, a sialyltransferase, an oligosaccharyltransferase, a glycosidase, a mannosidase, and a monoacylglycerol acetyltransferase.
9. The engineered, non-naturally occurring eukaryotic cell of any one of claims 1-8, wherein the glycan modifying enzyme in (a) is FUT8.
10. The engineered, non-naturally occurring eukaryotic cell of any one of claims 1-8, wherein the glycan modifying enzyme in (a) is β4GALT1.
11. The engineered, non-naturally occurring eukaryotic cell of any one of claims 1-8, wherein the genome of the engineered, non-naturally occurring eukaryotic cell comprises a knockout of at least two glycan modifying enzymes, wherein one of the at least two glycan modifying enzymes is FUT8 and one of the at least two glycan modifying enzymes is β4GALT1.
12. The engineered, non-naturally occurring eukaryotic cell of any one of claims 1-11, wherein the engineered, non-naturally occurring eukaryotic cell further comprises an integration of a polynucleic acid sequence comprising the sequence of a protein of interest operably linked to a constitutive or inducible promoter, wherein the protein of interest can be modified by the addition of a glycan.
13. The engineered, non-naturally occurring eukaryotic cell of claim 12, wherein the protein of interest is an immunoglobulin.
14. The engineered, non-naturally occurring eukaryotic cell of claim 13, wherein the immunoglobulin belongs to the IgA, IgD, IgE, IgG, or IgM class.
15. The engineered, non-naturally occurring eukaryotic cell of claim 13 or claim 14, wherein the immunoglobulin is an IgG1, IgG2, IgG3, or IgG4 immunoglobulin.
16. The engineered, non-naturally occurring eukaryotic cell of any one of claims 1-15, wherein the eukaryotic cell is a CHO cell, a COS cell, a NS0 cell, Sp2/0 cell, BHK cell, HEK293 cell, HEK293-EBNA1 cell, HEK293-F cell, HT-1080 cell, HKB-11, CAP cell, HuH-7 cell, or a PER.C6 cell.
17. The engineered, non-naturally occurring eukaryotic cell of any one of claims 1-16, wherein the eukaryotic cell is a CHO cell.
18. The engineered, non-naturally occurring eukaryotic cell of any one of claims 1-17, wherein the integration of the at least one polynucleic acid sequence comprising the sequence of a functional copy of a glycan modifying enzyme and/or the integration of the at least one polynucleic acid sequence comprising the sequence of protein of interest operably linked to a constitutive or inducible promoter is at one or more landing pads.
19. A method of generating a glycoprotein comprising a distinct glycan structure, said method comprising expressing at least one protein of interest and at least one glycan modifying enzyme in an engineered, non-naturally occurring eukaryotic cell comprising a modified genome, wherein the modified genome comprises: (a) a knockout of at least one endogenous polynucleic acid sequence encoding a glycan modifying enzyme; (b) an integration of at least one polynucleic acid sequence comprising a sequence encoding a functional copy of a glycan modifying enzyme knocked out in (a), wherein the sequence encoding the functional copy of a glycan modifying enzyme is operably linked to a tunable control element that controls mRNA and/or protein expression of the glycan modifying enzyme; and (c) an integration of at least one polynucleic acid sequence comprising a sequence encoding a protein of interest operably linked to a constitutive or inducible promoter, wherein each of the at least one protein of interest can, when expressed as a protein, be modified by the addition of a glycan.
20. The method of claim 19, wherein the tunable control element in (b) is selected from the group consisting of an inducible promoter element, a synthetic promoter panel, a miRNA response element, and an ORF control element.
21. The method of claim 20, wherein the engineered, non-naturally occurring eukaryotic cell comprises: (b) an integration of at least two polynucleic acid sequences, wherein each polynucleic acid sequence comprises the sequence of a functional copy of a glycan modifying enzyme knocked out in (a), wherein the sequence encoding the functional copy of a glycan modifying enzyme is operably linked to a tunable control element that controls mRNA and/or protein expression of the glycan modifying enzyme.
22. The method of claim 21, wherein the tunable control element of each of the at least two polynucleic acid sequences in (b) is unique.
23. The method of claim 21 or claim 22, wherein the tunable control element of at least one of the at least two polynucleic acid in (b) is selected from the group consisting of an inducible promoter element, a synthetic promoter panel, a miRNA response element, and an ORF control element.
24. The method of claim 20-23, wherein the inducible promotor is a chemically-regulated promoter or a physically-regulated promoter.
25. The method of claim 24, wherein the chemically-regulated promoter comprises a TRE-Tight promoter sequence or a PhlF-activatable promoter sequence.
26. The method of any one of claims 19-25, wherein at least one of the glycan modifying enzymes in (a) is selected from the group consisting of a fucosyltransferase, a galactosyltransferase, a sialyltransferase, an oligosaccharyltransferase, a glycosidase, a mannosidase, and a monoacylglycerol acetyltransferase.
27. The method of any one of claims 19-26, wherein the glycan modifying enzyme in (a) is FUT8.
28. The method of any one of claims 19-26, wherein the glycan modifying enzyme in (a) is β4GALT1.
29. The method of any one of claims 19-26, wherein the genome of the engineered, non-naturally occurring eukaryotic cell comprises a knockout of at least two glycan modifying enzymes, wherein one of the at least two glycan modifying enzymes is FUT8 and one of the at least two glycan modifying enzymes is β4GALT1.
30. The method of claim 29, wherein the protein of interest of (c) is an immunoglobulin.
31. The method of claim 30, wherein the immunoglobulin belongs to the IgA, IgD, IgE, IgG, or IgM class.
32. The method of claim 30 or claim 31, wherein the immunoglobulin is an IgG1, IgG2, IgG3, or IgG4 immunoglobulin.
33. The engineered, non-naturally occurring eukaryotic cell of any one of claims 19-32, wherein the eukaryotic cell is a CHO cell, a COS cell, a NS0 cell, Sp2/0 cell, BHK cell, HEK293 cell, HEK293-EBNA1 cell, HEK293-F cell, HT-1080 cell, HKB-11, CAP cell, HuH-7 cell, or a PER.C6 cell.
34. The method of any one of claims 19-32, wherein the eukaryotic cell is a CHO cell.
35. The method of any one of claims 19-34, wherein the integration of the at least one polynucleic acid sequence comprising the sequence of a functional copy of a glycan modifying enzyme and/or the integration of the at least one polynucleic acid sequence comprising the sequence of protein of interest operably linked to a constitutive or inducible promoter is at one or more landing pads.
36. An immunoglobulin generated by the method of any one of claims 19-35.
37. The immunoglobulin of claim 36, comprising at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% fucosylation.
38. The immunoglobulin of claim 36, comprising at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 85% galactosylation.
39. The immunoglobulin of claim 36, comprising at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% sialylation.
40. The immunoglobulin of claim 36, comprising: (a) at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% fucosylation; and/or (b) at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 85% galactosylation; and/or (c) at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% sialylation.
41. A composition comprising at least one immunoglobulin as claimed in any one of claims 36-40.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0024] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. It is to be understood that the data illustrated in the drawings in no way limit the scope of the disclosure.
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
DETAILED DESCRIPTION
[0044] Therapeutic and engineered proteins that are produced by expression in mammalian cells, such as CHO cells, can have various properties altered by glycosylation, which can be influenced by the type of cell used, culture conditions, etc. One example of this is monoclonal antibodies (mAbs) which, have been utilized for a wide variety of therapeutic applications, including the treatment of several cancers and autoimmune diseases (Weiner L. M., et al., Cell. 2012 Mar. 16; 148(6): 1081-84; Jefferis R., Trends Pharmacol. Sci. 2009 July; 30(7): 356-62; Chiu M. L. and Gilliland G. L., Curr. Opin. Struct. Biol. 2016 June; 38: 163-73). All marketed mAbs belong to the IgG class and consist of two heavy chains and two light chains, with antigen-binding (Fab) and crystallizable (Fc) regions, where the Fc has the potential to bind to Fcγ receptors that regulate immune responses (
[0045] Disclosed herein are novel methods of glycoengineering proteoglycans with distinct glycan structures. The disclosed methods make accessible a dynamic range of protein glycosylation that has never been observed (e.g., 0-95% fucosylation and 0-85% total galactosylation of immunoglobulins). The disclosed methods provide precise, independent control of fucosylation and galactosylation that allows for a large matrix of Fc glycosylated species, which enables the development of new mAbs as well as other types of large molecule therapeutics with tailored in vitro and in vivo effects for use in biotechnology and biomedicine. Also demonstrated herein are the design and control of IgG glycoforms to influence Fc effector function. Importantly, the methods described herein can be applied beyond IgG1s to IgG2, IgG3, and other recombinant glycoproteins where glycans are known to have potential clinical impact such as half-life and effector function.
[0046] In some aspects, the disclosure relates to methods of generating glycoproteins comprising a distinct glycan structure in vivo. In some embodiments, the method comprises expressing at least one protein of interest and at least one glycan modifying enzyme in an engineered, non-naturally occurring eukaryotic cell comprising a modified genome (described below), wherein each of the at least one protein of interest can, when expressed, be modified by the addition of a glycan.
[0047] In other aspects, the disclosure relates to engineered, non-naturally occurring eukaryotic cells comprising a modified genome. As used herein, the term “modified genome” refers to a genome that has been altered so as to render the genome different from that which occurs in nature. In some embodiments, the modified genome comprises: (a) a knockout of at least one endogenous polynucleic acid sequence encoding for a glycan modifying enzyme; and (b) an integration of at least one polynucleic acid sequence comprising the sequence of a functional copy of a glycan modifying enzyme knocked out in (a) and an operably linked tunable control element that controls mRNA and/or protein expression of the glycan modifying enzyme.
[0048] The term “glycan,” as used herein, refers to a polysaccharide or a compound consisting of at least two monosaccharides linked glycosidically or through a glycosidic bond (i.e., a type of covalent bond that joins a saccharide to another group, which may or may not be another saccharide).
[0049] The term “glycan modifying enzyme” as used herein, refers to a protein that catalyzes the formation of or the removal of a glycosidic bond. Examples of glycan modifying enzymes are known to those having skill in the art and include, but are not limited to, oligosaccharyltransferases, glycosidases, mannosidases, monoacylglycerol acetyltransferases, fucosyltransferases (e.g., FUT1, FUT2, FUT3, FUT4, FUT5, FUT6, FUT7, FUT8, FUT9, FUT10, and FUT11), galactosyltransferases (e.g., β3GALNT1, β3GALNT2, β3GALT1, β3GALT2, β3GALT4, β3GALT5, β3GALT6, β3GNT2, β3GNT3, β3GNT4, β3GNT5, β3GNT6, β3GNT7, β3GNT8, β4GALNT1, β4GALNT2, β4GALNT3, βGALNT4, β4GALT1, β4GALT2, β4GALT3, β4GALT4, β4GALT5, β4GALT6, β4GALT7, GALNT1, GALNT2, GALNT3, GALNT4, GALNT5, GALNT6, GALNT7, GALNT8, GALNT9, GALNT10, GALNT11, GALNT12, GALNT13, GALNT14, GALNTL1, GALNTL2, GALNTL4, GALNTL5, and GALNTL6), and sialyltransferases (e.g., SIAT4C, SIAT9, ST3GAL1, ST3GAL2, ST3GAL3, ST3GAL4, ST3GAL5, ST3GAL6, ST3GalIII, ST6GAL1, ST6GAL2, ST6Gal, ST8SIA1, ST8SIA2, ST8SIA3, ST8SIA4, ST8SIA5, ST8SIA6, and ST8Sia).
[0050] As used herein, the term “knockout” refers to a disruption of an endogenous gene, such that the endogenous gene is rendered inactive. In some embodiments, a knockout is rendered through excision or removal of at least a portion of an endogenous polynucleic acid sequence encoding for a gene (i.e., at least a portion of a gene-coding region). As used herein the term “at least a portion of” may refer to a single nucleotide or to a stretch of contiguous nucleic acids comprising at least 0.5%, at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the gene coding polynucleic acid sequence. In some embodiments, a knockout is rendered through integration or introduction of an exogenous piece of DNA. As used herein, the term “integration” refers to the insertion or knockin of an exogenous sequence of DNA into the genome of a cell. Methods of performing gene knockout and knockin are known to those having skill in the art and include, but are not limited to, the use of homologous recombination and site-specific nucleases (e.g., recombinases, zinc-finger nucleases, TALENs, and CRISPR/Cas).
[0051] In some embodiments, the one or more polynucleic acid sequences integrated into the cell are integrated at one or more “landing pads” (LPs), which are defined sites in the genome of the cell. As described elsewhere herein, a landing pad can contain a recombination site(s) for site-specific integration of one or more polynucleic acid sequences using a recombinase that recognizes the recombination site(s) and effects recombination. In addition, the landing pad can contain a selectable marker. In “multi-LP” cell lines, multiple landing pads are used, and preferably in such cases the landing pads are orthogonal.
[0052] In some embodiments, the modified genome comprises a knockout of more than one endogenous polynucleic acid sequence encoding for a glycan modifying enzyme. In some embodiments, the number of integrated polynucleic acid sequences that comprise the sequence of a functional copy of a knocked out glycan modifying enzyme and an operably linked tunable control element is less than the number of knocked out glycan modifying enzymes (e.g., a knockout of FUT8 and β4GALT1 and an integration of a functional copy of FUT8, and not β4GALT1, or vice versa).
[0053] The term “functional copy,” as used herein, relates to the degree of identity between a polynucleic acid encoding for a native protein (i.e., the sequence found in a native cell) and an in vitro created polynucleic acid encoding for an engineered protein (i.e., the functional copy). In some embodiments, the polynucleic acid sequence of the native protein and the polynucleic acid sequence encoding for the functional copy are identical. In other embodiments, the sequences differ. For example in some embodiments, the polynucleic acid sequence encoding for the native protein and the polynucleic acid sequence encoding for the functional copy share 5-10%, 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, 95-99%, or 99-100% identity. In some embodiments, the polynucleic acid sequence encoding for the functional copy is longer or shorter than the polynucleic acid sequence of the native protein by at least 5, at least 10, at least 20, at least 50, at least 100, at least 200, at least 300, at least 500, at least 1000, or greater than 1000 nucleotides. Indeed, in some embodiments, the polynucleic acid sequence of the functional copy may encode for protein functional properties that are not shared with the native protein (e.g., the protein encoded by the functional property can perform at least one function that is not shared with the native protein). In other embodiments, the polynucleic acid sequence of the functional copy of the glycan modifying enzyme may not encode for at least one function of the native protein (e.g., the native protein can perform at least one function that is not shared with the functional copy). Nonetheless, to be considered a “functional copy,” the polynucleic acid encoding for the engineered protein must maintain enough identity with that of the native protein such that the engineered protein can perform the targeted function of the native protein to at least some degree, such as at least 1%, at least 2%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of the activity of the native protein. In some embodiments, the targeted function is the ability to catalyze the formation of or the removal of a glycosidic bond. For example, if the native protein is a glycan modifying enzyme, a functional copy of the glycan modifying enzyme (e.g., fucosyltransferase functional copy) will have enough identity with the native glycan modifying enzyme (e.g., native fucosyltransferase) such that the functional copy can catalyze the formation of or the removal of a glycosidic bond (e.g., transfer L-fucose from a GDP-fucose donor substrate to an acceptor substrate) at least 1%, at least 2%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% as efficiently as the native glycan modifying enzyme. In some embodiments, the engineered protein encoded by the functional copy can perform the targeted function more efficiently than the native protein (e.g., at least 110%, at least 120%, at least 150%, at least 200%, at least 300%, or greater than 500% of the activity of the native protein).
[0054] As used herein, the term “tunable control element” refers to a polynucleic acid sequence that can be modified to increase or decrease a particular output. In some embodiments, the tunable control element functions to regulate mRNA expression (i.e., the output is mRNA levels). For example, in some embodiments, the tunable control element comprises an inducible promoter (see e.g., Materials and Methods, Design, Example 3 and Example 4), a synthetic promoter panel (see e.g., Design—“Transcriptional regulation of FUT8 by synthetic promoter library”), and/or a miRNA response element (see e.g., Design—“microRNA control of synthetic genes expression”). In some embodiments, the tunable control element functions to regulate protein expression (i.e., the output is protein level). For example, in some embodiments, a tunable control element comprises an open reading frame (ORF) control element (see e.g., Design—“Upstream ORF control of synthetic gene expression”). In some embodiments, the tunable control element functions to regulate protein function (i.e., the output is protein function). For example, in some embodiments, the tunable control element comprises a polynucleic acid sequence that encodes for a protein that increases or decreases the activity of the protein generating the output.
[0055] In some embodiments, the engineered, non-naturally occurring eukaryotic cell comprises an integration of at least two polynucleic acid sequences, wherein each comprises the sequence of a functional copy of a glycan modifying protein and an operably linked tunable control element that controls mRNA and/or protein expression of the glycan modifying enzyme. In some embodiments, the tunable control element of each of the at least two polynucleic acid sequences—each comprising the sequence of a functional copy of a glycan modifying enzyme and an operably linked tunable control element—is unique, i.e., different than all other tunable control elements that control mRNA and/or protein expression of glycan modifying enzymes in the engineered, non-naturally occurring eukaryotic cell.
[0056] A tunable control element controls expression or transcription of the polynucleic acid sequence to which it is operably linked, such as a polynucleic acid sequence encoding a functional copy of a knocked out glycan modifying enzyme. A tunable control element is considered to be “operably linked” when it is in a correct functional location and orientation in relation to the polynucleic acid sequence it regulates, thereby resulting in the ability of the tunable control element to control transcription initiation or expression of that polynucleic acid sequence.
[0057] In some embodiments, the tunable control element comprises an inducible promoter. In some embodiments, the inducible promotor is a chemically-regulated promoter or a physically-regulated promoter. Examples of chemically-regulated promoters are known to those having skill in the art and include, but are not limited to, alcohol-regulated promoters, tetracycline-regulated promoters, steroid-regulated promoters, metal-regulated promoters, and pathogenesis-related promoters. As such, chemically regulated promoters may be responsive to the presence of small molecule inducers (e.g., ABA, Dox, cumate, and gibberellic acid). In some embodiments, the chemically-regulated promoter comprises the polynucleic acid sequence of a TRE-Tight promoter or a PhlF-activatable promoter. Examples of physically-regulated promoters are also known to those having skill in the art and include, but are not limited to, temperature-regulated promoters and light-regulated promoters.
[0058] In some embodiments, at least one of the glycan modifying enzymes that is knocked out in the engineered, non-naturally occurring eukaryotic cell is selected from the group consisting of an oligosaccharyltransferase, a glycosidase, a mannosidase, a monoacylglycerol acetyltransferase, a fucosyltransferase, a galactosyltransferase, and a sialyltransferase.
[0059] In some embodiments, at least one of the glycan modifying enzymes that is knocked out in the engineered, non-naturally occurring eukaryotic cell is a fucosyltransferase selected from the group consisting of FUT1, FUT2, FUT3, FUT4, FUT5, FUT6, FUT7, FUT8, FUT9, FUT10, FUT11, and orthologs thereof. In some embodiments at least one of the glycan modifying enzymes is FUT8.
[0060] In some embodiments, at least one of the glycan modifying enzymes that is knocked out in the engineered, non-naturally occurring eukaryotic cell is a galactosyltransferase selected from the group consisting of β3GALNT1, β3GALNT2, β3GALT1, β3GALT2, β3GALT4, β3GALT5, β3GALT6, β3GNT2, β3GNT3, β3GNT4, β3GNT5, β3GNT6, β3GNT7, β3GNT8, β4GALNT1, β4GALNT2, β4GALNT3, β8GALNT4, B4GALT1, β4GALT2, β4GALT3, β4GALT4, β4GALT5, β4GALT6, β4GALT7, GALNT1, GALNT2, GALNT3, GALNT4, GALNT5, GALNT6, GALNT7, GALNT8, GALNT9, GALNT10, GALNT11, GALNT12, GALNT13, GALNT14, GALNTL1, GALNTL2, GALNTL4, GALNTL5, GALNTL6, and orthologs thereof). In some embodiments, at least one of the glycan modifying enzymes is β4GALT1.
[0061] In some embodiments, at least one of the glycan modifying enzymes that is knocked out in the engineered, non-naturally occurring eukaryotic cell is a sialyltransferase selected from the group consisting of SIAT4C, SIAT9, ST3GAL1, ST3GAL2, ST3GAL3, ST3GAL4, ST3GAL5, ST3GAL6, ST3GalIII, ST6GAL1, ST6GAL2, ST6Gal, ST8SIA1, ST8SIA2, ST8SIA3, ST8SIA4, ST8SIA5, ST8SIA6, ST8Sia, and orthologs thereof.
[0062] In some embodiments, the genome of the engineered, non-naturally occurring eukaryotic cell comprises a knockout of at least two glycan modifying enzymes, wherein one of the at least two glycan modifying enzymes is FUT8 and one of the at least two glycan modifying enzymes is β4GALT1.
[0063] In some embodiments, the engineered, non-naturally occurring eukaryotic cell further comprises an integration of at least one polynucleic acid sequence comprising a sequence encoding a protein of interest operably linked to a constitutive or inducible promoter, wherein the protein of interest can be modified by the addition of a glycan. In some embodiments, a polynucleic acid sequence encoding for a protein of interest operably linked to a constitutive or inducible promoter is integrated as multiple copies, potentially at multiple genomic locations. In some embodiments, the constitutive or inducible promoter of the multiple copies is identical. In other embodiments, the constitutive or inducible promoter of at least one copy is unique.
[0064] In some embodiments, at least one protein of interest is an immunoglobulin (see e.g., Materials and Methods, Design, and Examples 2-6). In some embodiments, the immunoglobulin belongs to the IgA, IgD, IgE, IgG, or IgM class. In some embodiments, the immunoglobulin is an IgG1, IgG2, IgG3, or IgG4 immunoglobulin.
[0065] Various eukaryotic cells have been used to generate glycan-modified proteins. See e.g., Lalonde M. E. and Duocher Y., J. Biotechnol. 2017 Jun. 10; 251: 128-140, the entirety of which is incorporated herein). In some embodiments, the engineered, non-naturally occurring eukaryotic cell is derived from a CHO cell, a COS cell, a NS0 cell, Sp2/0 cell, BHK cell, HEK293 cell, HEK293-EBNA1 cell, HEK293-F cell, HT-1080 cell, HKB-11, CAP cell, HuH-7 cell, or a PER.C6 cell. In some embodiments, the engineered, non-naturally occurring eukaryotic cell is derived from a CHO cell.
[0066] In other aspects, the disclosure relates to proteoglycans generated as described above. In some embodiments, the proteoglycan is an immunoglobulin. In some embodiments, the immunoglobulin comprises at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% fucosylation. Methods of determining the percentage of fucosylation are known to those having skill in the art (see e.g., Materials and Methods). In some embodiments, the immunoglobulin comprises at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 85% galactosylation. Methods of determining the percentage of galactosylation are known to those having skill in the art (see e.g., Materials and Methods). In some embodiments, the immunoglobulin comprises at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% sialylation. Methods of determining the percentage of sialylation are known to those having skill in the art (see e.g., Materials and Methods).
[0067] In some embodiments, the immunoglobulin comprises: (a) at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% fucosylation; (b) at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 85% galactosylation; and/or (c) at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% sialylation.
[0068] In some aspects, the disclosure relates to compositions comprising at least one proteoglycan. In some embodiments, the proteoglycan is an immunoglobulin. In some embodiments, the composition is a pharmaceutical composition, which may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, adjuvants, pharmaceutically acceptable excipients, and optionally other therapeutic ingredients. The nature of the pharmaceutical carrier, excipient, and other components of the pharmaceutical composition will depend on the mode of administration. The pharmaceutical compositions of the disclosure may be administered by any means and route known to the skilled artisan.
EXAMPLES
Example 1. Methods and Materials for Examples 2-8
[0069] CHO cell culture and transfections: Serum-free, suspension adapted CHO-K1 cells were grown in CD-CHO media, supplemented with 8 mM L-glutamine, at 37° C. and 7% CO.sub.2 in flasks with shaking at 130 rpm. Seeding density was 3×10.sup.5 cells/mL, and cultures were split every 3 or 4 days. Transfections were always carried out using Neon electroporation (1600 V, 10 ms, 3 pulses) with 3×10.sup.5 cells per 10 ul transfection.
[0070] Generation of knockout cell lines and genomic PCR diagnostic test: Transfection of 250 ng U6-gRNA pairs and 250 ng pSP-Cas9(BB)-2A-GFP into dLP cells with JUG-444 integrated into LP2. Three days post transfection, GFP-positive single cells were FACS sorted and genomic DNA was assayed for exon excision.
TABLE-US-00001 TABLE 1 Sequences used in this study. SEQ ID Name NO Sequence Notes gRNA (PAM) sequences - GeneArt CRISPR String DNA (Thermo) Fut8-gRNA2 1 TTATTTGCTTGACATACACA (GGG) Fut8-gRNA3 2 GTAATCCTAGTGCTATAGTG (GGG) B4GalT1- 3 ATTGCAACAGAAATGTGCCG (GGG) gRNA2 B4GalT1- 4 TAGTGAGTCAGACCAAGACG (GGG) gRNA4 PCR primers for gDNA PCR diagnostic test #1 Fut8- 5 5′-GAAAGATGGATTGACAGGGAGAG 5726 bp gRNA2-Fwd3 GTTAAG-3′ amplicon Fut8- 6 5′-CAGGTGATGGGAGGGTTTTGATG if no gRNA3-Rev4 ATTTTC-3′ excision. 499 bp amplicon if excision. B4GalT1- 7 5′-CTGGAAATGGATTGTTGACTCAG 2428 bp gRNA2-Fwd3 AGGG-3′ amplicon if no B4GalT1- 8 5′-GAGAACCATCACATAAACTAAGG excision. gRNA4-Rev2 AAAACACC-3′ 636 bp amplicon if excision. PCR primers for gDNA PCR diagnostic test #2 Fut8- 9 5′-CTTCCCTTTGACTCCACTTCTAT 499 bp gRNA3-Fwd3 GAAATTG-3′ amplicon Fut8- 10 5′-CAGGTGATGGGAGGGTTTTGATG if no gRNA3-Rev4 ATTTTC-3′ excision. No ampli- con if excision. B4GalT1- 11 5′-GTTTGTACTCTGACCCTTCTTAT 924 bp gRNA3-Fwd3 TCCTCTC-3′ amplicon B4GalT1- 12 5′-GAGAACCATCACATAAACTAAGG if no gRNA4-Rev2 AAAACACC-3′ excision. No ampli- con if excision. RT-qPCR primers fut8-ex7- 13 5′-ACTGGAGGATGGGAGACTGTGT- fwd2 3′ fut8-ex8- 14 5′-TCAGGAGTCGATCTGCAAGGTC rev2 T-3′ b4galt1- 15 5′-TCTGTTGCAATGGACAAGTTTG ex2-fwd4 G-3′ b4galt1- 16 5′-CCTCCCCAGCCCCAATAATTAT ex3-rev3 T-3′
[0071] Construction and integration of genetic circuits: A synthetic FUT8 gene (cDNA sequence comprising 11 exons) and a synthetic β4GALT1 gene (cDNA sequence comprising 5 exons) were acquired as a gBlock from IDT. Modular Gateway/Gibson assembly was used in the construction of all genetic circuits (Duportet X., et al., Nucleic Acids Res. 2014 Dec. 1; 42(21): 13440-51). Circuit integration requires transfection of 500 ng pEXPR-BxB1 and at least 500 ng of each circuit. Three days post transfection, mKate signal was assayed by FACS analysis. Selection may be carried out for 7 days. Ten days post transfection, cells were sorted by FACS to obtain mKate-positive and EYFP-negative cells (circuit integration into Rosa locus) or for mKate-positive and EBFP-negative cells (circuit integration into C5 locus).
[0072] Fed-batch culture and glycan analysis: 7-day fed batch cultures were used to generate mAb for glycan analysis. Fed batch cultures (25 mL in 125 mL shake flasks) were seeded at 1.5×10.sup.6 cells/mL. Starting on day 3, cultures were titrated to pH 7.2 twice a day and supplemented with Cell Boost 5, 20% D-glucose, and L-glutamine once a day. When required to induce synthetic circuits, Dox was added every 48 hours or ABA was added every 24 hours to the fed batch culture starting on day 0. Cultures were harvested on day 7 and clarified media was saved for titer measurement by Octet and for JUG-444 purification on ProA resin. Glycans were enzymatically cleaved off of purified JUG-444, derivatized with 2-aminobenzamide labeling agent, and analyzed by HILIC (Shang T. Q., et al., J. Pharm. Sci. 2014 July; 103(7): 1967-78).
FcγRIIIa Binding SPR Analysis:
[0073] Equipment and software: Biacore™ T200 instrument (GE Healthcare) with Control Software version 2.0.1 and Evaluation software version 3.0 was used for interaction analysis.
[0074] Sensor chips, reagents and buffers: Amine coupling reagents, N-(3-dimethylaminopropyl)-N-ethylcarbodiimide (EDC) and N-hydroxysuccinimide (NHS), ethanolamine-HCl, Series S Sensor Chip CMS, including 10 mM Glycine pH 1.5 regeneration solution, 10 mM Sodium Acetate pH 4.5, 50 mM Sodium Hydroxide, Biacore Normalizing Solution (70% Glycerol), 0.5% (w/v) sodium dodecyl sulphate, 50 mM Glycine pH 9.5 and HBS-EP+ Buffer 10× (0.1 M HEPES buffer with 30 mM EDTA, 1.5 M NaCl and 0.5% Surfactant P20 (Tween 20)) were purchased from GE Healthcare. Recombinant human FcγRIIIa-158V (ligand) expressed in Human Embyronic Kidney 293 (HEK293) cells was from Syngene and anti-PENTA Histidine antibody was from Qiagen. The JUG-444 mAbs used in this study were fully human mAbs expressed with IgG1. All JUG-444 mAbs were purified in-house and were later dialyzed into PBS. Finally, all the purified mAbs were aliquoted and stored at 10° C. until used for kinetic assay.
[0075] Immobilization of anti-PENTA Histidine mAb on Biacore T200: Anti-PENTA Histidine mAb diluted in 10 mM sodium acetate (pH 4.5) at 10 μg/ml was directly immobilized across a Series S CMS biosensor chip using a standard amine coupling kit according to manufacturer's instructions and procedures. Un-reacted moieties on the biosensor surface were blocked with ethanolamine. Anti-PENTA Histidine mAb immobilization procedure yielded approximately 1500 RU surface density. Modified carboxymethyl dextran surface containing captured Fcγ receptor via immobilized anti-PENTA Histidine Mab across flow cells 2 and 4 were used as a reaction surface. A similar modified carboxymethyl dextran surface without Fcγ receptors across flow cells 1 and 3 were used as a reference surface.
[0076] FcγRIIIa-158V capture assay procedure: The sample compartment of the Biacore T200 system was set to 10° C., the analysis temperature to 25° C. and the data collection rate to 1 Hz. HBS-EP+ was used as running buffer. In each cycle FcγRIIIa-158V (ligand) at 1 μg/ml in HBS-EP+ was injected for 60 seconds at a flow rate of 50 μl/min, to reach minimum capture levels of around 30-60 RU. JUG-444 antibody, 4.7 to 150.4 μg/ml in HBS-EP+, was injected for 180 seconds followed by a dissociation phase of 300 s for all six antigen concentrations and the surface was regenerated with 10 mM Glycine pH 1.5 solution per kit instructions (300 s contact). The association and dissociation rate constants, k.sub.a (unit M.sup.−1s.sup.−1) and k.sub.d (unit s.sup.−1) were determined under a continuous flow rate of 50 μl/min.
[0077] Data processing and analysis: The binding data were initially processed using the Evaluation version 3.0 software. The double reference subtracted data generated using FcγRIIIa-158V capture assay was globally fitted to a 1:1 Langmuir binding model. Rate constants for the JUG-444 mAb-FcγRIIIa-158V interactions were derived by making kinetic binding measurements at six different analyte concentrations ranging from 31.25-1000 nM. Association and dissociation rate constants were extracted from binding data using global fit analysis (allowing identical values for each curve in the data set). The R.sub.max parameter setting was floated fit locally. The equilibrium dissociation constant (unit M) of the reaction between Fcγ receptor and JUG-444 mAbs was then calculated from the kinetic rate constants by the following formula: K.sub.D=k.sub.d/k.sub.a.
Example 2. Design
[0078] Overview: CHO-K1 cells adapted for serum-free and suspension culture were used to construct new cell lines with knockouts of FUT8 and/or β4GALT1 genes, and with multiple landing pads for specific integration of JUG-444 and synthetic gene circuits. First, a landing pad (LP) containing a recombination site and a selectable marker was integrated into the genome. Then, a matching recombinase was used to insert a DNA payload specifically into that locus, allowing for reproducible integration at well-defined sites in the genome. By utilizing landing pads for both the mAb and the gene circuits, the cells were normalized for both copy number and loci, allowing for consistent and reproducible expression levels (Duportet X., et al., Nucleic Acids Res. 2014 Dec. 1; 42(21): 13440-51; Gaidukov L., et al., Nucleic Acids Res. 2018 May 4; 46(8): 4072-86). JUG-444 is an antibody of the IgG1 subclass, and the glycosylation of JUG-444 served as the functional readout for the modulation of Fut8 and β4GalT1 enzymatic activity. Synthetic circuits integrated into landing pads reintroduced FUT8 and β4GALT1 genes under constitutive or inducible promoters. Upon addition of small molecule inducers, varied levels of Fut8 and β4GalT1 enzymes were expressed corresponding to levels of small molecules added. This in turn led to varied levels of JUG-444 glycosylation that reflect the expressed enzyme levels. While JUG-444 was used as a test mAb, this system is compatible with all types of mAbs, including antibody-drug conjugates and bispecific monoclonal antibodies. In fact, it is relevant to any bio-manufactured genetically expressed therapeutic protein where precision in glycosylation is required for desired biological effect.
[0079] Generation of CHO cell lines with orthogonal landing pads: A landing pad (LP) containing a recombination site and a selectable marker was integrated using a CRISPR/Cas9 genome editing approach at loci demonstrated to have stable gene expression (Duportet X., et al., Nucleic Acids Res. 2014 Dec. 1; 42(21): 13440-51; Gaidukov L., et al., Nucleic Acids Res. 2018 May 4; 46(8): 4072-86) (
[0080] Integration of mAb into landing pad: A double copy of JUG-444 light and heavy chain genes was integrated into the first landing pad (LP2). BxB1-mediated recombination occurred between LP2's attP site and the payload's attB site (
[0081] Design of FUT8 and β4GALT1 knockouts: The CHO cell line with LP2 expressing JUG-444 was used to generate FUT8 and β4GALT1 knockouts by CRISPR/Cas9 targeted excision of exons within the catalytic domains of the glycosyltransferases. Exon 7 was completely excised from FUT8, and exon 2 was partially excised from β4GALT1. Functional knockouts were validated by analysis of JUG-444 glycan structures for lack of fucosylated or galactosylated species.
[0082] Design of FUT8 and β4 GALT1 synthetic circuits for integration into landing pads: Synthetic biological circuits were designed and constructed from an array of tunable and characterized parts, or modules, to perform logical functions that control cellular activities. In this example, synthetic FUT8 and β4 GALT1 genes were expressed under constitutive or small molecule inducible promoters (
[0083] microRNA control of synthetic genes expression: MicroRNAs (miRNAs) are important elements of the RNA interference system that controls gene regulation in eukaryotic cells (Bartel D. P., Cell. 2009 Jan. 23; 136(2): 215-33). miRNAs are processed by protein complexes to knock down mRNA levels in the cell, reducing protein expression. As such, incorporating synthetic microRNA Response Elements (MREs) in the 5′- and/or 3′-UTR of a protein of interest can be used to further down-regulate already low level constitutive promoters whose gene expression levels need to be tuned down even further. Specifically, 1×, 4× and 8×MREs are incorporated for a particular miRNA (FF4) (e.g., to FUT8 synthetic gene that is expressed from a weak constitutive promoter (e.g., hUBC and hACTB)). The complimentary synthetic miRNA-FF4 is constitutively expressed from either a human U6 promoter (high miR-FF4 expression) or from hEF1a-mKate-intronic construct (low miR-FF4 expression). In the latter case miR-FF4 is produced as a spliced-out intron from the fluorescent protein mKate, and red fluorescence indicates the presence of miR-FF4 (
[0084] Transcriptional regulation of FUT8 by synthetic promoter library: A synthetic promoter library is another approach to fine-tune regulation of gene expression at the transcriptional level. Gene expression of FUT8 with commonly used constitutive promoters such as hEF1a resulted in very high expression of FUT8, leading to wild-type levels of antibody fucosylation. Even low FUT8 mRNA levels lead to high levels of fucosylation. Thus, to achieve a broad range of fucosylation, a weak and wide range of expression is required. A synthetic promoter library previously constructed (Nissim L., Cell. 2017 Nov. 16; 171(5): 1138-50), comprising nearly 6000 different multiple transcription factor binding sites (TFBS), provides a solution to this problem (
[0085] Upstream ORF control of synthetic gene expression: Short, upstream open reading frames (uORFs), which encode a two-amino acid peptide, can be inserted upstream of an ORF encoding a protein of interest to suppress its expression (Ferreira J. P., et al., Proc. Natl. Acad. Sci. U.S.A. 2013 Jun. 9; 110(28): 11284-89). Varying the base sequence preceding the uORF or using multiple uORFs in series and non-AUG start codons results in variable translation initiation rates leading to expression levels spanning three orders of magnitude (
[0086] Design of synthetic circuits for tunable sialylation: Sialylation occurs on terminally galactosylated species and plays a role in anti-inflammatory activity of IgGs (Kaneko Y., Science. 2006 Aug. 4; 313(5787): 670-73). Galactosylation levels must be increased, as described in Example 2, before sialylation levels can be modulated. Cells expressing pMC2 in β4GALT1 KO cells can be used for integration of ST6GAL1 circuits in the third landing pad. Circuits with ST6GAL1 under constitutive and Dox-inducible promoters are used to modulate α-2,6-sialylation of JUG-444 (
Example 3: Validation of FUT8 and β4GALT1 Knockouts
[0087] FUT8 and β4GALT1 knockouts (KO) were generated by CRISPR/Cas9 targeted excision of exons essential for catalytic activity, similar to what has been done previously (Zong H., et al., Eng. Life Sci. 2017 Feb. 23; 17(7): 801-8; Sun T., et al., Eng. Life Sci. 2015 Jul. 21; 15(6): 660-66). KO clones were identified with a PCR screen of genomic DNA (
Example 4: FUT8 and β4GALT1 Expression Under Constitutive Promoters
[0088] Integration of the pMC1 circuit (see
TABLE-US-00002 TABLE 2 Composition of JUG-444 glycan species for FUT8 and β4GALT1 knockouts and with integrated constitutive circuits, pMC1 and pMC2, where terminal galactosylation refers to glycoforms with galactose terminating a glycan branch, and total galactosylation refers to all glycoforms containing galactose. Values marked with an asterisk include co-migration of other low-level non-terminal galactosylated glycan species. % % High % % Terminal % Total Sample Name Fucosylated Mannose Sialylated Galactosylated Galactosylated WT JUG-444 91.7 2.8 0.3 6.6 6.9 FUT8 KO 0.0 0.9 0.2 14.0 14.2 β4GALT1 KO 90.8 1.6 0.3 2.3* 2.6* pMC1, FUT8 KO 92.7 2.4 0.5 17.3 17.8 pMC2, β4GALT1 KO 93.5 0.8 6.8 80.3 87.1
Example 5: FUT8 or β4GALT1 Single Gene Regulation Under Inducible Promoters
[0089] Dox-inducible circuits for regulating FUT8 and β4GALT1 expression (pMC3 and pMC4) were integrated into the FUT8 or β4GALT1 single knockout cell lines. With no addition of Dox, basal level of FUT8 expression due to leaky expression from TRET promoter from pMC3 resulted in 8.2% total fucosylation of JUG-444. The highest level of total fucosylation reached was 81.9% with 1000 nM Dox (
[0090] ABA-inducible circuits for regulating FUT8 and β4GALT1 expression (pMC11 and pMC12) were integrated into the FUT8 or β4GALT1 single knockout cell lines. With no addition of ABA, basal level of FUT8 expression from pMC11 resulted in 2.0% total fucosylation of JUG-444. The highest level of total fucosylation reached was 68.8% with 250 uM ABA (
Example 6: Simultaneous Regulation of FUT8 and β4GALT1 Genes Under Inducible Promoters
[0091] For simultaneous and independent control of FUT8 and β4GALT1 genes, pMC11 and pMC4.1 circuits were integrated into the triple landing pad cell line containing both FUT8 and β4GALT1 knockouts. pMC11 was chosen for FUT8 expression because the ABA-inducible system results in a tighter regulation of fucosylation with no inducer. While afucosylation is easily achievable with knockouts, it is important that the lower range of total fucosylation be accessible for broad effector function modulation. pMC4.1 was chosen for β4GALT1 expression because the Dox-inducible system results in higher levels of galactosylation upon induction, which are desirable for effector function studies and are required for subsequent sialylation.
[0092] At 1000 nM Dox concentration, the levels of total galactosylation only reached intermediate levels at around 45%. At this level of galactosylation, a range from 1.6% to 74.1% total fucosylation was attained (
Example 7: JUG-444 Effector Function Study
[0093] The ADCC is initiated by the binding of Fab portion of IgG to the target antigen on target cells and Fc portion of IgG to FcγRIIIa on the surface of effector cells. The effector cells release cytotoxic factors that cause the death of the antibody-covered target cells. The glycosylation profile of the IgG can impact the binding of IgG to FcγRIIIa. The binding affinity of IgG to FcγRIIIa can be determined by surface plasmon resonance (SPR) analysis. JUG-444 with nine different glycosylation profiles (
Example 8: ST6GAL1 Expression Under a Constitutive Promoter
[0094] Surprisingly, expression of the pMC2 and pMC20 circuits (see
Example 9: Conclusions
[0095] This study demonstrates that synthetic biology approaches can be used to modulate mAb fucosylation and galactosylation independently and in a controlled manner. While there has been some progress in engineering the expression host or enzymatically modifying purified mAb, this is the first case in which endogenous FUT8 and β4GALT1 genes have been knocked out and synthetic versions integrated into the genome under inducible promoters. Therefore, this is also the first instance in which these glycosyltransferase genes have been stably expressed at tunable levels, allowing for a wide range of galactosylated and fucosylated species not easily accessible before in vivo. The power of simultaneous, precise modulation of each gene means mAbs can now be engineered in a cell-line manufacturing process with specific glycosylation patterns suited for particular Fc-mediated effector functions or to produce biopharmaceutical with any desirable level of fucosylation and galactosylation. This approach is not limited to FUT8 and β4GALT1 genes. Now that high levels of galactosylation can be reliably achieved, altering levels of sialylation also can be achieved and should open doors to developing new mAb therapeutics with desired potency, safety/immunogenicity and pharmokinetic properties. Importantly, this method should be broadly applicable beyond mAb therapeutics to any new recombinant protein therapeutics.
Example 10. Methods and Materials for Examples 11-14
[0096] Landing pad cell construction: Multi-landing pad CHO cell lines were constructed targeting LP2 and LP20 loci. Briefly, donor vectors containing hEF1a-attP-BxB1-EBFP-P2A-Bla (cassette1) or hEF1a-attP-BxB1-GA-EYFP-P2A-Hygro (cassette2), with left and right homologous arms were co-transfected with pSpCas9(BB) vector and GeneArt® CRISPR U6 Strings™ DNA using Neon electroporation. After CRISPR/Cas9-mediated homologous recombination, BFP positive cells were single cell sorted by FACS.
[0097] Vector construction: Gibson assembly cloning method was used to insert promoters and gene fragments into entry vectors. Expression vectors were constructed by LR cloning with destination plasmids.
[0098] CHO cell culture and fed-batch culture: Suspension CHO cells were grown on serum-free CD-CHO medium supplemented with 8 mM L-glutamine. Cultures were incubated in shaking incubator (37° C.) with 7% CO.sub.2 at 130 rpm. Seven-day fed-batch cultures were performed in 250-mL in Erlenmeyer flask containing 50 mL working volume or 125-mL in Erlenmeyer flask containing 25 mL working volume. On day 0, the cells were seeded at a seeding density of 1.5×10.sup.6 cells/mL. From day 3 through day 6, pH was titrated with 0.94 M Na.sub.2CO.sub.3/0.06 M K.sub.2CO.sub.3 twice a day and cell culture were supplemented with Cell Boost 5 Supplement (Hyclone) and 20% (w/v) D-glucose. On day 7, cultures were harvested and clarified media.
[0099] RNA extraction and RT-qPCR: Total RNA was extracted with TRIzol Reagent (Invitrogen) and 1 ug was used for cDNA synthesis using QuantiTect Reverse Transcription kit (Qiagen). mRNA expressions were quantified by SYBR Green RT-qPCR assay in LightCycler® 96 system (Roche). Relative gene expressions were analyzed by the ΔΔC.sub.T method using B-actin as the reference gene for normalization.
Example 11. Constitutive FUT8 Expressions Using Promoter Mini Libraries Results in Mostly High Fucosylation Level of mAbs
[0100] To restore the FUT8 expression in knockout cell lines, genetic circuits expressing synthetic version of FUT8 under commonly used mammalian constitutive promoters were introduced (hEF1a, RSV, hPGK, hUBC, HSV-TK, hACTB) (
TABLE-US-00003 TABLE 3 Constitutive promoters used in this study. Promoter name Promoter size Origin hEF1a (human Elongation 1174 bp human Factor 1 alpha) RSV (Rous sarcoma virus) 228 bp Retrovirus Viral promoter hPGK (human phosphoglycerate 541 bp human kinase 1 promoter) hUBC (human Ubiquitin C promoter) 403 bp + 1.sup.st human intron 814 bp TK (Herpes simplex virus (HSV) 252 bp Retrovirus herpes thymidine kinase promoter) simplex virus hACTB (human Actin Beta) 614 bp human
TABLE-US-00004 TABLE 4 Glycosylation analysis of mAb produced from constitutive expressing cell lines. Total G2 G1 G0 Cell Galactosylation Fucosylation Sialylation Species Species Species line Vector design (%) (%) (%) (%) (%) (%) Jug444 WT 10.88 ± 0.48 95.37 ± 0.34 0.61 ± 0.05 1.3 ± 0.05 9.58 ± 0.5 87.83 ± 0.35 MC1 hEF1a-FUT8_hEF1a-mKate 18.71 ± 0.61 96.99 ± 0.07 0.28 ± 0.03 1.68 ± 0.34 17.03 ± 0.29 78.75 ± 0.57 GJ118 RSV-FUT8_hEF1a-mKate 20.5 ± 0.17 95.89 ± 0.18 1.73 ± 0.13 3.45 ± 0.05 17.04 ± 0.21 77.19 ± 0.18 GJ116 hUBC-FUT8_hEF1a-mKate 18.43 ± 1.25 89.01 ± 1.17 3.4 ± 0.94 5.26 ± 1.5 13.17 ± 0.29 76.91 ± 2.29 GJ117 TK-FUT8_hEF1a-mKate 21.86 ± 0.6 87.6 ± 0.42 1.5 ± 0.26 2.93 ± 0.53 18.93 ± 0.43 76.92 ± 0.53 GJ120 hACTB-FUT8_hEF1a-mKate 14.34 ± 2.4 27.91 ± 1.79 0.45 ± 0 1.48 ± 0.67 12.86 ± 1.74 84 ± 2.95 GJ121 hPGK-FUT8_hEF1a-mKate 22.46 ± 0.37 98.06 ± 0.02 0.93 ± 0.03 2.44 ± 0.03 20.01 ± 0.33 76.02 ± 0.38
Example 12. Reduced Fucosylation in mAbs Resulted from Intronic miRNA Circuits
[0101] To reduce the fucosylation level of mAb, miRNA binding sites were inserted in the 3′ UTR of synthetic FUT8 sequences (
TABLE-US-00005 TABLE 5 Glycan analysis from mAbs produced from intronic miRNA circuit cell lines. Total G2 G1 G0 Cell Fucosylation Galactosylation Sialylation Species Species Species line Vector design (%) (%) (%) (%) (%) (%) GJ127 hPGK-FUT8-1xFF4- 97.86 ± 0.14 24.02 ± 0.67 1.11 ± 0.07 3.12 ± 0.13 20.9 ± 0.55 75.07 ± 0.76 bs_hef1a-mKate-intr-FF4 GJ128 hPGK-FUT8-4xFF4- 89.43 ± 0.22 23.83 ± 0.67 0.92 ± 0.16 3.12 ± 0.66 20.71 ± 0.16 75.26 ± 0.74 bs_hef1a-mKate-intr-FF4 GJ131 hUBC-FUT8-1xFF4- 80.06 ± 0.96 23.94 ± 1.93 1.21 ± 0.79 3.67 ± 1.41 20.27 ± 0.53 75.14 ± 2.26 bs_hef1a-mKate-intr-FF4 GJ132 hUBC-FUT8-4xFF4- 37.55 ± 1.11 18.26 ± 2.09 1.15 ± 0.73 3.79 ± 1.69 14.47 ± 0.43 79.33 ± 3.05 bs_hef1a-mKate-intr-FF4 GJ133 RSV-FUT8-1xFF4- 93.24 ± 0.13 24.55 ± 0.43 1.16 ± 0.07 3.37 ± 0.26 21.18 ± 0.24 74.51 ± 0.44 bs_hef1a-mKate-intr-FF4 GJ134 RSV-FUT8-4xFF4- 83.25 ± 0.3 22.09 ± 0.55 0.56 ± 0.27 3.16 ± 0.31 18.92 ± 0.62 76.05 ± 0.59 bs_hef1a-mKate-intr-FF4
Example 13. Highly Reduced Fucosylation in mAbs Achieved from U6 Promoter-Transcribed miRNAs Circuits
[0102] To further reduce fucosylation levels, additional miRNA expressing circuits were constructed (
TABLE-US-00006 TABLE 6 Glycan analysis from mAbs produced from U6-transcribed miRNA circuit cell lines. Total G2 G1 G0 Cell Fucosylation Galactosylation Sialylation Species Species Species line Vector design (%) (%) (%) (%) (%) (%) GJ135 hUBC-FUT8-1xFF4- 59.09 ± 0.3 20.28 ± 0.25 0.65 ± 0.12 2.05 ± 0.18 18.23 ± 0.09 79.24 ± 0.21 bs_U6-FF4_hef1a-mKate GJ136 hUBC-FUT8-4xFF4- 11.95 ± 1.17 15.35 ± 2.1 0.36 ± 0.2 1.61 ± 0.62 13.74 ± 1.5 82.92 ± 2.8 bs_U6-FF4_hef1a-mKate GJ137 hUBC-4xFF4-bs-FUT8-4xFF4- 12.96 ± 0.68 16.82 ± 0.15 0.52 ± 0.08 1.72 ± 0.15 15.1 ± 0.05 81.47 ± 0.18 bs_U6-FF4_hef1a-mKate GJ138 hACTB-FUT8-1xFF4- 14.06 ± 0.48 12.46 ± 0.55 0.11 ± 0.04 1.04 ± 0.2 11.42 ± 0.37 86.17 ± 0.47 bs_U6-FF4_hef1a-mKate GJ139 hACTB-FUT8-4xFF4- 0.91 ± 0.01 11.97 ± 0.13 0.4 ± 0.07 1.36 ± 0.1 10.6 ± 0.1 86.07 ± 0.16 bs_U6-FF4_hef1a-mKate GJ140 hACTB-4xFF4-bs-FUT8-4xFF4- 3.23 ± 0.79 16.05 ± 0.99 1.71 ± 0.55 3 ± 0.53 13.05 ± 0.57 78.97 ± 1.67 bs_U6-FF4_hef1a-mKate
Example 14. Engineered Cells Maintained the Cell Line Stability During the Long-Term Culture
[0103] It is critical to maintain the quality of protein and titer for therapeutic recombinant protein production using CHO cells. To evaluate engineered cell line stability, MC1 and GJ138 cell pools were sub-cultured for three months and fed-batch culture was performed every four weeks. Antibodies from harvested clarified media were analyzed by HILIC and measured the titer using Octet platform. There was no significant decrease in titer during 3-month culture, approximately 90 generations (
TABLE-US-00007 TABLE 7 Glycan analysis of mAb for cell line stability. Total G0 G1 G2 Fucosylated (%) Galactosylated (%) Sialylated (%) Species Species Species MC1-P30 97.19 ± 0.09 16.96 ± 1.67 0.41 ± 0.13 80.37 ± 1.59 15.58 ± 1.15 1.37 ± 0.52 MC1-P60 95.69 ± 0.51 19.44 ± 0.59 0.54 ± 0.04 76.46 ± 0.41 17.82 ± 0.59 1.62 ± 0.10 MC1-P90 98.05 ± 0.03 18.45 ± 1.78 0.38 ± 0.21 79.94 ± 1.73 17.23 ± 1.34 1.22 ± 0.45 average 96.98 ± 1.09 18.28 ± 1.66 0.44 ± 0.13 78.93 ± 2.08 16.88 ± 1.39 1.41 ± 0.31 GJ138-P30 14.06 ± 0.48 12.46 ± 0.55 0.11 ± 0.04 86.17 ± 0.47 11.42 ± 0.37 1.04 ± 0.20 GJ138-P60 12.74 ± 0.48 13.52 ± 0.87 0.16 ± 0.16 85.17 ± 1.05 12.45 ± 0.61 1.07 ± 0.32 GJ138-P90 11.68 ± 0.32 15.29 ± 0.49 0.46 ± 0.14 83.23 ± 0.57 13.57 ± 0.28 1.72 ± 0.22 average 12.83 ± 0.89 13.76 ± 1.42 0.27 ± 0.21 84.85 ± 1.50 12.48 ± 1.03 1.27 ± 0.43
TABLE-US-00008 TABLE 8 mAb titer from long-term fed-batch culture. Titer (μg/ml) MC1-P30 51.67 ± 4.82 MC1-P60 54.67 ± 9.35 MC1-P90 48.63 ± 2.24 GJ138-P30 55.87 ± 2.33 GJ138-P60 61.20 ± 1.22 GJ138-P90 64.97 ± 0.21
REFERENCES
[0104] 1. Bartel D. P., MicroRNAs: Target Recognition and Regulatory Functions, Cell. 2009 Jan. 23; 136(2): 215-33. [0105] 2. Chiu M. L. and Gilliland G. L., Engineering antibody therapeutics, Curr. Opin. Struct. Biol. 2016 June; 38: 163-73. [0106] 3. Dow L. E., Nasr Z., Saborowski M., Ebbesen S. H., Manchado E., Tasdemir N., Lee T., Pelletier J., and Lowe S. W., Conditional Reverse Tet-Transactivator Mouse Strains for the Efficient Induction of TRE-Regulated Transgenes in Mice, PLoS One. 2014 Apr. 17; 9(4): e95236. [0107] 4. Duportet X., Wroblewska L., Guye P., Li Y., Eyquem J., Rieders J., Rimachala T., Batt G., and Weiss R., A platform for rapid prototyping of synthetic gene networks in mammalian cells, Nucleic Acids Res. 2014 Dec. 1; 42(21): 13440-51. [0108] 5. Ferreira J. P., Overton K. W., and Wang C. L., Tuning gene expression with synthetic upstream open reading frames, Proc. Natl. Acad. Sci. U.S.A. 2013 Jun. 9; 110(28): 11284-89. [0109] 6. Gaidukov L., Wroblewska L., Teague B., Nelson T., Zhang X., Liu Y., Jagtap K., Mamo S., Tseng W. A., Lowe A., Das J., Bandara K., Baijuraj S., Sumers N. M., Lu T. K., Zhang L., Weiss R., Multi-landing pad DNA integration platform for mammalian cell engineering, Nucleic Acids Res. 2018 May 4; 46(8): 4072-86. [0110] 7. Gao Y., Xiong X., Wong S., Charles E. J., Lim W. A., and Qi L. S., Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat. Methods. 2016 December; 13(12): 1043-49. [0111] 8. Ho S. C., Koh E. Y., van Beers M., Mueller M., Wan C., Teo G., Song Z., Tong Y. W., Bardor M., and Yang Y., Control of IgG LC:HC ratio in stably transfected CHO cells and study of the impact on expression, aggregation, glycosylation and conformational stability, J. Biotechnol. 2013 Jun. 10; 165(3-4): 157-66. [0112] 9. Inniss M. C., Bandara K., Jusiak B., Lu T. K., Weiss R., Wroblewska L., and Zhang L., A novel Bxbl integrase RMCE system for high fidelity site-specific integration of mAb expression cassette in CHO Cells, Biotechnol. Bioeng. 2017 August; 114(8): 1837-46. [0113] 10. Jefferis R., Recombinant antibody therapeutics: the impact of glycosylation on mechanisms of action, Trends Pharmacol. Sci. 2009 July; 30(7): 356-62. [0114] 11. Kanda Y., Imai-Nishiya H., Kuni-Kamochi R., Mori K., Inoue M., Kitajima-Miyama K., Okezaki A., lida S., Shitara K., and Satoh M., Establishment of a GDP-mannose 4,6-dehydratase (GMD) knockout host cell line: A new strategy for generating completely non-fucosylated recombinant therapeutics, J. Biotechnol. 2007 Jun. 20; 130(3): 300-10. [0115] 12. Kaneko Y., Nimmerjahn F., and Ravetch J. V., Anti-inflammatory activity of immunoglobulin G resulting from Fc sialylation, Science. 2006 Aug. 4; 313(5787): 670-73. [0116] 13. Li F., Vijayasankaran N., Shen A. Y., Kiss R., and Amanullah A., Cell culture processes for monoclonal antibody production, MAbs. 2010 September-October; 2(5): 466-79. [0117] 14. Liang F. S., Ho W. Q., and Crabtree G. R., Engineering the ABA plant stress pathway for regulation of induced proximity, Sci. Signal. 2011 Mar. 15; 4(164): rs2. [0118] 15. Liu L., Antibody glycosylation and its impact on the pharmacokinetics and pharmacodynamics of monoclonal antibodies and Fc-fusion proteins, J. Pharm. Sci. 2015 June; 104(6): 1866-84. [0119] 16. Liu S. D., Chalouni C., Young J. C., Junttila T. T., Sliwkowski M. X., and Lowe J. B., Afucosylated antibodies increase activation of FcγRIIIa-dependent signaling components to intensify processes promoting ADCC, Cancer Immunol. Res. 2015 February; 3(2): 173-83. [0120] 17. Mori K., Kuni-Kamochi R., Yamane-Ohnuki N., Wakitani M., Yamano K., Imai H., Kanda Y., Niwa R., lida S., Uchida K., Shitara K., and Satoh M., Engineering Chinese hamster ovary cells to maximize effector function of produced antibodies using FUT8 siRNA, Biotechnol. Bioeng. 2004 Dec. 30; 88(7): 901-8. [0121] 18. Mullick A., Xu Y., Warren R., Koutroumanis M., Builbault C., Broussau S., Malenfant F., Bourget L., Lamoureux L., Lo R., Caron A. W., Pilotte A., and Massie B., The cumate gene-switch: A system for regulated expression in mammalian cells, BMC Biotechnol. 2006 Nov. 3; 6: 43. [0122] 19. Nissim L., Wu M. R., Pery E., Binder-Nissim A., Suzuki H. I., Stupp D., Wehrspaun C., Tabach Y., Sharp P. A., and Lu T. K., Synthetic RNA-Based Immunomodulatory Gene Circuits for Cancer Immunotherapy, Cell. 2017 Nov. 16; 171(5): 1138-50. [0123] 20. Shang T. Q., Saait A., Toler K. N., Mo J., Li H., Matlosz T., Lin X., Schenk J., Ng C. K., Duffy T., Porter T. J., and Rouse J. C., Development and application of a robust N-glycan profiling method for heightened characterization of monoclonal antibodies and related glycoproteins, J. Pharm. Sci. 2014 July; 103(7): 1967-78. [0124] 21. Sun T., Li C., Han L., Jiang H., Xie Y., Zhang B., Qian X., Lu H., and Zhu J., Functional knockout of FUT8 in Chinese hamster ovary cells using CRISPR/Cas9 to produce a defucosylated antibody, Eng. Life Sci. 2015 Jul. 21; 15(6): 660-66. [0125] 22. Thomann M., Reckermann K., Reusch D., Prasser J., and Tejada M. L., Fc-galactosylation modulates antibody-dependent cellular cytotoxicity of therapeutic antibodies, Mol. Immunol. 2016 May; 73: 69-75. [0126] 23. Vaquerizas J. M., Kummerfeld S. K., Teichmann S. A., and Luscombe N. M., A census of human transcription factors: function, expression and evolution, Nat. Rev. Genet. 2009 April; 10(4): 252-63. [0127] 24. Weiner L. M., Murray J. C., and Shuptrine C. W., Antibody-based immunotherapy of cancer, Cell. 2012 Mar. 16; 148(6): 1081-84. [0128] 25. Wingender E., Schoeps T., and Donitz, J., TFClass: An expandable hierarchical classification of human transcription factors, Nucleic Acids Res. 2013 January; 41. [0129] 26. Yamane-Ohnuki N., Kinoshita S., Inoue-Urakubo M., Kusunoki M., Lida S., Nakano R., Wqakitani M., Niwa R., Sakurada M., Uchida K., Shitara K., and Satoh M., Establishment of FUT8 knockout Chinese hamster ovary cells: An ideal host cell line for producing completely defucosylated antibodies with enhanced antibody-dependent cellular cytotoxicity, Biotechnol. Bioeng. 2004 Sep. 5; 87(5): 614-22. [0130] 27. Yang Z., Wang S., Halim A., Schulz M. A., Frodin M., Rahman S. H., Vester-Christensen M. B., Behrens C., Kristensen C., Vakhurshev S. Y., Bennett E. P., Wandall H. H., and Clausen H., Engineered CHO cells for production of diverse, homogeneous glycoproteins, Nat. Biotechnol. 2015 August; 33(8): 842-44. [0131] 28. Zong H., Han L., Ding K., Wang J., Sun T., Zhang X., Cagliero C., Jian H., Xie Y., Xu J., Zhang B., and Zhu J., Producing defucosylated antibodies with enhanced in vitro antibody-dependent cellular cytotoxicity via FUT8 knockout CHO-S cells. Eng. Life Sci. 2017 Feb. 23; 17(7): 801-8.
OTHER EMBODIMENTS
[0132] All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.
[0133] From the above description, one skilled in the art can easily ascertain the essential characteristics of the present disclosure, and without departing from the spirit and scope thereof, can make various changes and modifications of the disclosure to adapt it to various usages and conditions. Thus, other embodiments are also within the claims.
EQUIVALENTS
[0134] While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the function and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the inventive teachings is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.
[0135] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.
[0136] All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.
[0137] The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.”
[0138] The phrase “and/or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with “and/or” should be construed in the same fashion, i.e., “one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the “and/or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to “A and/or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
[0139] As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and/or” as defined above. For example, when separating items in a list, “or” or “and/or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of” or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e. “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law.
[0140] As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and/or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
[0141] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.
[0142] In the claims, as well as in the specification above, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases “consisting of” and “consisting essentially of” shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03. It should be appreciated that embodiments described in this document using an open-ended transitional phrase (e.g., “comprising”) are also contemplated, in alternative embodiments, as “consisting of” and “consisting essentially of” the feature described by the open-ended transitional phrase. For example, if the disclosure describes “a composition comprising A and B”, the disclosure also contemplates the alternative embodiments “a composition consisting of A and B” and “a composition consisting essentially of A and B”.