<i>Siniperca chuatsi IL-6 </i>gene and detection method of disease-resistant SNP marker thereof
10988814 · 2021-04-27
Assignee
Inventors
Cpc classification
C12Q1/6888
CHEMISTRY; METALLURGY
Y02A40/81
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
Abstract
The invention provides a Siniperca chuatsi IL-6 gene and a detection method for a disease-resistant SNP marker. A cDNA sequence of S. chuatsi IL-6 gene is cloned, as shown in SEQ ID NO: 1. AIL-6 gene gDNA sequence containing an intron of the S. chuatsi IL-6 gene is cloned, as shown in SEQ ID NO: 2. A primer for amplifying a disease-resistant SNP locus is designed according to IL-6 gDNA sequence, and S. chuatsi IL-6 gene is amplified to obtain an amplification product which is sequenced, and the SNPs loci relevant to virus disease-resistance are found out and the SNP locus is determined according to DNA peak profile. The IL-6 cDNA full-length sequence and IL-6 gDNA full-length sequence are cloned firstly. The SNP locus relevant to virus disease resistance of S. chuatsi IL-6 gene is detected, thereby providing a new method for breeding of S. chuatsi.
Claims
1. A Siniperca chuatsi IL-6 cDNA comprising the cDNA sequence shown in SEQ ID NO: 1.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
(9) The present invention will be explained in more detail below with reference to the drawings and in connection with embodiments. It should be understood that, the exemplary embodiments and description thereof of the invention are used for illustrating the present invention and are not intended to limit the invention
(10) I Clone of IL-6 cDNA Sequence of S. chuatsi
(11) 1. Amplification of IL-6 5′ terminal sequence of S. chuatsi
(12) (1) Synthesis, Purification and Tailing of the First Strand of cDNA
(13) The first strand of cDNA of IL-6 was synthesized for the extracted total RNA using SUPERSCRIPT II RT enzyme and the primer GSP-IL-6-1. RNase Mix was used to perform RNA removal on the synthesized cDNA. Reverse transcription system was:
(14) TABLE-US-00003 GSP-IL-6-1 25 ng Template RNA 2 ul DEPC-treated water making up to 15.5 μl
(15) This system was incubated at 70° C. for 10 min, and immediately placed on ice to cool for 1 min, and then transient centrifugation was performed to collect liquid. The following system was added sequentially:
(16) TABLE-US-00004 10 × PCR bbuffer 2.5 μl 25 nM MgCl.sub.2 2.5 μl 10 nM dNTP mix 1 ul 0.1M DTT 2.5 ul
(17) The reaction system was mixed gently, centrifuged and incubated at 42° C. for 1 min. 1 μl SUPERSCRIPT II RT was added, mixed evenly and incubated at 42° C. for 50 min, at 70° C. for 15 min and then reaction was stopped. After centrifugation, the resulting product was placed at 37° C., and 1 μl of RNase mix was added to react for 30 min and then purification was performed. poly (c) was added at the purified cDNA terminal using TdT enzyme and dCTP, then the product was stored at a low temperate for use.
(18) (2) Quick Amplification of cDNA 5′ Ends
(19) The first round PCR amplification was performed on the cDNA to which the dC tail had been added using the primer GSP-IL-6-2. The 5′-RACE system was added in the following order:
(20) TABLE-US-00005 sterilized, distilled water 31.5 μl 10 × PCR buffer 5.0 μl 25 mM MgCl.sub.2 3.0 μl 10 mM dNTP mix 1.0 μl 10 μM nested GSP-TLR3-2 2.0 μl 10 uM Abridged Anchor Primer 2.0 μl dC-tailed cDNA 5.0 μl Taq DNA polymerase 0.5 μl final volume 50 μl
(21) The reaction conditions were as follows: pre-denaturation at 94° C. for 2 min, denaturation at 94° C. for 30 s, re-analysis annealing at 55° C. for 30 s, extension at 72° C. for 1 min, 30 cycles, and finally extension at 72° C. for 7 min.
(22) The nested second round PCR amplification was performed using the primer GSP-IL-6-3 and abridged universal amplification primer AUAP, and the system was as follows:
(23) TABLE-US-00006 sterilized, distilled water 33.5 μl 10 × PCR buffer 5.0 μl 25 mM MgCl.sub.2 3.0 μl 10 mM dNTP mix 1.0 μl 10 μM nested GSP-TLR3-3 1.0 μl 10 uM AUAP 1.0 μl dilution of primary PCR product 5.0 μl Taq DNA polymerase 0.5 μl final volume 50 μl
(24) The reaction conditions were as follows: pre-denaturation at 94° C. for 2 min, denaturation at 94° C. for 30 s, re-analysis annealing at 59° C. for 30 s, extension at 72° C. for 1 min, 30 cycles, and finally extension at 72° C. for 7 min.
(25) Agarose gel electrophoresis (1.2%) was performed on the product of the second round PCR, the target bands were recycled by gel extraction using Gel Extraction Kit (Sangon Shanghai). The purified PCR product was recycled and cloned to the pMD18-T vector (TaKaRa), and positive clones were selected for sequencing. 2. Amplification of IL-6 3′ terminal sequence of S. chuatsi
(26) (1) Synthesis and Purification of the First Strand of cDNA
(27) Reverse transcription was performed on the total extracted RNA using SUPERSCRIPT II RT enzyme and the primer 3′CDS primer A (SMARTer™ RACE cDNA Amplification Kit, Clontech). The used primer was 3′CDS primer A, and the other components and conditions were the same as those of 5′ terminal amplification.
(28) (2) Quick Amplification of cDNA Ends
(29) The first round PCR amplification was performed using the primers GSP-IL-6-4 and UPM using the cDNA synthesized previously as a template, and the 3′-RACE reaction system was added in the following order (the reaction conditions were the same as those of the 5′ ends amplification):
(30) TABLE-US-00007 sterilized, distilled water 31.5 μl 10 × PCR buffer 5.0 μl 25 mM MgCl.sub.2 3.0 μl 10 mM dNTP mix 1.0 μl 10 μM GSP-IL-6-4 2.0 μl 10 uM UPM 2.0 μl dC-tailed cDNA 5.0 μl Taq DNA polymerase 0.5 μl final volume 50 μl
(31) The PCR product from the first round amplification was diluted 50 times to perform the second round PCR amplification, the other systems were the same as those of the first round PCR amplification other than the primers GSP-IL-6-5 and UPM, and the reaction conditions were the same as those of 5′ amplification. Agarose gel electrophoresis (1.2%) was performed on the product of the second round PCR, and the target band was recycled by gel extraction, as shown in
(32) TABLE-US-00008 TABLE 1 Primer Sequences for amplification of IL-6 gene cDNA Primers Sequences (5′-3′) Target GSP-IL-6-1 CTGGGGCACTCCTTCT IL-6 5′-Race (SEQ ID NO: 4) GSP-IL-6-2 AACCTGTGGAGACAAGCC IL-6 5′-Race (SEQ ID NO: 5) GSP-IL-6-3 CTGAAGTTGGAGTAAGGGCA IL-6 5′-Race (SEQ ID NO: 6) 3′CDS Primer A AAGCAGTGGTATCAACGCAGACTA IL-6 3′-Race (SEQ ID NO: 7) C GSP-IL-6-4 CGCCAGCTCCACTACTTCCTTGTCG IL-6 3′-Race (SEQ ID NO: 8) GSP-IL-6-5 AAAGGGAGTTCAGAGCAAGTATGG IL-6 3′-Race (SEQ ID NO: 9) C AUAP GGCCACGCGTCGACTAGTAC universal 5′-Race (SEQ ID NO: 10) UPM CTAATACGACTCACTATAGGGC universal 3′-Race (SEQ ID NO: 11) 3. Obtaining of S. chuatsi IL-6 gDNA
(33) With reference to the known IL-6 gDNA structure of other fishes, the specific primers were designed for the spliced complete fragment of S. chuatsi IL-6 cDNA to amplify the intron of IL-6 gene (table 2), wherein the fragment should contain overlapping regions for facilitating the subsequent sequence assembly. The genomic DNA of S. chuatsi was used as a template to perform fragment PCR amplification. The amplification conditions were as follows: pre-denaturation at 94° C. for 5 min, denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, extension at 72° C. for 1 min, 30 cycles, and finally extension at 72° C. for 7 min. Agarose gel electrophoresis (1.5%) was performed on the PCR product, as shown in
(34) TABLE-US-00009 TABLE 2 Primer sequences for amplifying the intron of IL-6 gene Primers Primer sequences (5′-3′) IL-6-1F (SEQ ID NO: 12) CTCAGCATCAGCGGAAACTC IL-6-1R (SEQ ID NO: 13) TGCCCCTGTTGGCCATACTT 4. Detection of disease-resistant SNP marker
(35) (1) Primers (table 3) were designed according to the sequence of S. chuatsi IL-6 gDNA. The PCR reaction system is shown in table 4.
(36) TABLE-US-00010 TABLE 3 Primer sequences for obtaining disease-resistant SNP loci by amplifying S. chuatsi IL-6 gene Primers Primer sequences (5′-3′) IL-6- L1F (SEQ ID NO: 14) AACCCAAAGAGGCAGGTGAC IL-6- L1R (SEQ ID NO: 15) ACCATCCAATTTCCCTGAGGT
(37) TABLE-US-00011 TABLE 4 PCR reaction system for obtaining disease-resistant SNP loci by amplifying S. chuatsi IL-6 gene Components Volume μl) Template DNA 2 Primer R (10 μl) 1 Primer F (10 μl) 1 2 × Easy Taq PCR Super Mix 25 ddH.sub.2O 21 Total 50
(38) Steps of PCR amplification were as follows: (1) pre-denaturation at 94° C. for 5 min, (2) denaturation at 94° C. for 30 s, (3) annealing at 52° C. for 30 s, (4) extension at 72° C. for 1 min, 30 cycles, and (5) extension at 72° C. for 10 min, (1) 4° C. end of the reaction.
(39) (2) Agarose gel electrophoresis (1.5%) was performed on the PCR product to get the PCR amplification product, as shown in
(40) The multiple sequence alignment was performed on the sequencing results using DNAMAN software, to find out the SNPs loci relevant to the virus disease resistance. Then DNA sequencing chromatogram was observed via Chromas software, single peak was a homozygotic SNP locus, and the nested peak was a heterozygous SNP locus.
(41) II Detection Results of Disease-Resistant SNP Marker Based on S. chuatsi IL-6 Gene
(42) The same population of S. chuatsi was bred under the same feeding conditions, and after breeding for about two months, 100 Mandarin fish were randomly selected for challenge experiments from the cultured population. Each fish was intraperitoneally injected with infectious spleen and kidney necrosis virus (ISKNV) (also known as iridescent virus), 10×TCID50 ISKNV. After observing for 10 days, it was observed that the disease symptoms are the same as those of the ISKNV infection in the natural environment. The diseased fish swam slowly on the water surface, or evenly floated on the water surface, the body surface was undamaged and the colour of body was white. The fish gills were ischemic whitish. By means of anatomy, it was found that there were ascites in enterocoelia, the liver, the stomach wall and the intestinal wall were congestive, and there was yellow effusion in intestinal tract. While the disease-resistant fish were normal all the time. The PCR detection indicated that the head kidney of the diseased S. chuatsi were ISKNV-positive, this shows that the death was caused by ISKNV infection.
(43) 9 undiseased fish and 3 diseased fish (marked as E05, H07, A07) were selected, and a small quantity of tail fin was cut and placed in absolute ethyl alcohol and stored at 4° C., respectively. In terms of the detection method of disease-resistant SNP marker as described in above examples, the PCR amplification product was obtained, as shown in
(44) The peak profile of suspected mutant base at 233 bp in the above sequence was observed by Chromas software, as shown in
(45) The above preferred embodiments are described for illustration only, and are not intended to limit the scope of the invention. It should be understood, for a person skilled in the art, that various improvements or variations can be made therein without departing from the spirit and scope of the invention, and these improvements or variations should be covered within the protecting scope of the invention.