MODULATORS OF YAP1 EXPRESSION
20210123059 · 2021-04-29
Assignee
Inventors
- Youngsoo Kim (San Diego, CA)
- Xiaolin Luo (San Diego, CA, US)
- Robert MacLeod (San Diego, CA, US)
- Susan M. Freier (San Diego, CA)
- Huynh-Hoa Bui (San Diego, CA)
Cpc classification
A61K31/7125
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K45/00
HUMAN NECESSITIES
A61K31/712
HUMAN NECESSITIES
A61K9/0012
HUMAN NECESSITIES
A61K31/44
HUMAN NECESSITIES
C12N15/1135
CHEMISTRY; METALLURGY
C12N2310/3231
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
A61K31/7125
HUMAN NECESSITIES
A61K31/44
HUMAN NECESSITIES
C12N2310/3231
CHEMISTRY; METALLURGY
C12N2320/11
CHEMISTRY; METALLURGY
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K31/712
HUMAN NECESSITIES
C12N2310/346
CHEMISTRY; METALLURGY
International classification
A61K39/00
HUMAN NECESSITIES
A61K45/00
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present embodiments provide methods, compounds, and compositions useful for inhibiting YAP1 expression, which may be useful for treating, preventing, or ameliorating a cancer associated with YAP1.
Claims
1. (canceled)
2. (canceled)
3. (canceled)
4. (canceled)
5. (canceled)
6. (canceled)
7. (canceled)
8. (canceled)
9. (canceled)
10. (canceled)
11. (canceled)
12. (canceled)
13. (canceled)
14. (canceled)
15. (canceled)
16. (canceled)
17. (canceled)
18. (canceled)
19. (canceled)
20. (canceled)
21. (canceled)
22. (canceled)
23. (canceled)
24. (canceled)
25. (canceled)
26. (canceled)
27. (canceled)
28. (canceled)
29. (canceled)
30. (canceled)
31. (canceled)
32. (canceled)
33. (canceled)
34. (canceled)
35. (canceled)
36. (canceled)
37. (canceled)
38. (canceled)
39. (canceled)
40. (canceled)
41. A modified oligonucleotide, wherein an anion form of the modified oligonucleotide has the following chemical structure: ##STR00014## or a salt thereof.
42. A modified oligonucleotide according to the following chemical structure: ##STR00015## or a salt thereof.
43. A modified oligonucleotide according to the following chemical structure: ##STR00016##
44. A composition comprising the modified oligonucleotide of claim 41 and a pharmaceutically acceptable diluent or carrier.
45. A composition comprising the modified oligonucleotide of claim 41 and water.
46. (canceled)
47. A combination comprising the modified oligonucleotide of claim 41 and a secondary agent.
48. The combination of claim 47, wherein the secondary agent is a CDK4/6 inhibitor.
49. The combination of claim 48, wherein the CDK4/6 inhibitor is palbociclib, ribociclib, or abemaciclib.
50. The combination of claim 47, wherein the secondary agent is an EGFR inhibitor.
51. The combination of claim 50, wherein the EGFR inhibitor is cetuximab, necitumumab, panitumumab, vandetanib, dacomitinib, neratinib, osimertinib, gefitinib, lapatinib, or erlotinib.
52. The combination of claim 47, wherein the secondary agent is a kinase inhibitor.
53. The combination of claim 52, wherein the kinase inhibitor is sorafenib, regorafenib, or carbozantinib.
54. A method of treating or ameliorating cancer in an individual comprising administering to the individual the modified oligonucleotide of claim 41, thereby treating or ameliorating the cancer.
55. (canceled)
56. The method of claim 54, further comprising administering a secondary agent.
57. The method of claim 56, wherein the secondary agent is a CDK4/6 inhibitor.
58. The method of claim 57, wherein the CDK4/6 inhibitor is palbociclib, ribociclib, or abemaciclib.
59. The method of claim 56, wherein the secondary agent is an EGFR inhibitor.
60. The method of claim 59, wherein the EGFR inhibitor is cetuximab, necitumumab, panitumumab, vandetanib, dacomitinib, neratinib, osimertinib, gefitinib, lapatinib, or erlotinib.
61. The method of claim 56, wherein the secondary agent is a kinase inhibitor.
62. The method of claim 61, wherein the kinase inhibitor is sorafenib, regorafenib, or carbozantinib.
63. The method of claim 54, wherein the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas, esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoietic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, acute lymphocytic leukemia (ALL), a cancer having a mutant FAT1 gene, a cancer having a homozygous FAT1 gene mutation, a cancer having a heterozygous FAT1 gene mutation, a SCC having a mutant FAT1 gene, a HNSCC having a mutant FAT1 gene, an OTSCC having a mutant FAT1 gene, a pharynx carcinoma having a mutant FAT1 gene, or a laryngeal squamous cell carcinoma having a mutant FAT1 gene.
64. The method of claim 54, wherein administering the modified oligonucleotide inhibits or reduces cancer cell proliferation, tumor growth, or metastasis in the individual.
65. A method of inhibiting expression of YAP1 in a cell comprising contacting the cell with the modified oligonucleotide of claim 41, thereby inhibiting expression of YAP1 in the cell.
66. The method of claim 65, wherein the cell is a cancer cell.
67. The method of claim 66, wherein the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas, esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, acute lymphocytic leukemia (ALL), a cancer having a mutant FAT1 gene, a cancer having a homozygous FAT1 gene mutation, a cancer having a heterozygous FAT1 gene mutation, a SCC having a mutant FAT1 gene, a HNSCC having a mutant FAT1 gene, an OTSCC having a mutant FAT1 gene, a pharynx carcinoma having a mutant FAT1 gene, or a laryngeal squamous cell carcinoma having a mutant FAT1 gene.
68. A method of reducing or inhibiting cancer cell proliferation, tumor growth, or metastasis in an individual having cancer, comprising administering the modified oligonucleotide of claim 41 to the individual, thereby reducing or inhibiting cancer cell proliferation, tumor growth, or metastasis in the individual.
69. The method of claim 68, wherein the individual has hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas, esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, acute lymphocytic leukemia (ALL), a cancer having a mutant FAT1 gene, a cancer having a homozygous FAT1 gene mutation, a cancer having a heterozygous FAT1 gene mutation, a SCC having a mutant FAT1 gene, a HNSCC having a mutant FAT1 gene, an OTSCC having a mutant FAT1 gene, a pharynx carcinoma having a mutant FAT1 gene, or a laryngeal squamous cell carcinoma having a mutant FAT1 gene.
70. (canceled)
71. (canceled)
72. The method of claim 65, wherein the modified oligonucleotide is administered parenterally.
73. (canceled)
74. (canceled)
75. (canceled)
76. (canceled)
77. (canceled)
78. (canceled)
79. (canceled)
80. (canceled)
81. (canceled)
82. (canceled)
83. (canceled)
84. (canceled)
85. (canceled)
86. (canceled)
87. (canceled)
88. (canceled)
89. (canceled)
90. (canceled)
91. (canceled)
92. (canceled)
93. (canceled)
94. (canceled)
95. (canceled)
96. (canceled)
97. (canceled)
98. (canceled)
99. (canceled)
100. A composition, comprising the modified oligonucleotide of claim 42 and a pharmaceutically acceptable diluent or carrier.
101. A composition, comprising the modified oligonucleotide of claim 42 and water.
102. A composition, comprising the modified oligonucleotide of claim 43 and a pharmaceutically acceptable diluent or carrier.
103. A composition, comprising the modified oligonucleotide of claim 43 and water.
104. A method of treating or ameliorating cancer in an individual, comprising administering to the individual the modified oligonucleotide of claim 42, thereby treating or ameliorating the cancer.
105. The method of claim 104, wherein the individual has hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas, esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoietic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, acute lymphocytic leukemia (ALL), a cancer having a mutant FAT1 gene, a cancer having a homozygous FAT1 gene mutation, a cancer having a heterozygous FAT1 gene mutation, a SCC having a mutant FAT1 gene, a HNSCC having a mutant FAT1 gene, an OTSCC having a mutant FAT1 gene, a pharynx carcinoma having a mutant FAT1 gene, or a laryngeal squamous cell carcinoma having a mutant FAT1 gene.
106. A method of treating or ameliorating cancer in an individual, comprising administering to the individual the modified oligonucleotide of claim 43, thereby treating or ameliorating the cancer.
107. The method of claim 106, wherein the individual has hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas, esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoietic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, acute lymphocytic leukemia (ALL), a cancer having a mutant FAT1 gene, a cancer having a homozygous FAT1 gene mutation, a cancer having a heterozygous FAT1 gene mutation, a SCC having a mutant FAT1 gene, a HNSCC having a mutant FAT1 gene, an OTSCC having a mutant FAT1 gene, a pharynx carcinoma having a mutant FAT1 gene, or a laryngeal squamous cell carcinoma having a mutant FAT1 gene.
108. The method of claim 54, wherein the modified oligonucleotide is administered parenterally.
Description
DETAILED DESCRIPTION
[0005] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the embodiments, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting.
[0006] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, treatises, and GenBank and NCBI reference sequence records are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.
[0007] It is understood that the sequence set forth in each SEQ ID NO contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Compounds described by ION number indicate a combination of nucleobase sequence, chemical modification, and motif.
[0008] Unless otherwise indicated, the following terms have the following meanings:
[0009] “2′-deoxynucleoside” means a nucleoside comprising 2′-H(H) furanosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2′-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
[0010] “2′-O-methoxyethyl” (also 2′-MOE and 2′-O(CH.sub.2).sub.2-OCH.sub.3) refers to an O-methoxy-ethyl modification at the 2′ position of a furanosyl ring. A 2′-O-methoxyethyl modified sugar is a modified sugar.
[0011] “2′-MOE nucleoside” (also 2′-O-methoxyethyl nucleoside) means a nucleoside comprising a 2′-MOE modified sugar moiety.
[0012] “2′-substituted nucleoside” or “2-modified nucleoside” means a nucleoside comprising a 2′-substituted or 2′-modified sugar moiety. As used herein, “2′-substituted” or “2-modified” in reference to a sugar moiety means a sugar moiety comprising at least one 2′-substituent group other than H or OH.
[0013] “3′ target site” refers to the nucleotide of a target nucleic acid which is complementary to the 3′-most nucleotide of a particular compound.
[0014] “5′ target site” refers to the nucleotide of a target nucleic acid which is complementary to the 5′-most nucleotide of a particular compound.
[0015] “5-methylcytosine” means a cytosine with a methyl group attached to the 5 position.
[0016] “About” means within ±10% of a value. For example, if it is stated, “the compounds affected about 70% inhibition of YAP1”, it is implied that YAP1 levels are inhibited within a range of 60% and 80%.
[0017] “Administration” or “administering” refers to routes of introducing a compound or composition provided herein to an individual to perform its intended function. An example of a route of administration that can be used includes, but is not limited to parenteral administration, such as subcutaneous, intravenous, or intramuscular injection or infusion.
[0018] “Administered concomitantly” or “co-administration” means administration of two or more compounds in any manner in which the pharmacological effects of both are manifest in the patient. Concomitant administration does not require that both compounds be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. The effects of both compounds need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive. Concomitant administration or co-administration encompasses administration in parallel or sequentially.
[0019] “Amelioration” refers to an improvement or lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. In certain embodiments, amelioration includes a delay or slowing in the progression or severity of one or more indicators of a condition or disease. The progression or severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.
[0020] “Animal” refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
[0021] “Antibody,” as used in this disclosure, refers to an immunoglobulin or a fragment or a derivative thereof, and encompasses any polypeptide comprising an antigen-binding site, regardless of whether it is produced in vitro or in vivo. The term includes, but is not limited to, polyclonal, monoclonal, monospecific, polyspecific, non-specific, humanized, single-chain, chimeric, synthetic, recombinant, hybrid, mutated, and grafted antibodies. Unless otherwise modified by the term “intact,” as in “intact antibodies,” for the purposes of this disclosure, the term “antibody” also includes antibody fragments such as Fab, F(ab′)2, Fv, scFv, Fd, dAb, and other antibody fragments that retain antigen-binding function, i.e., the ability to bind, for example, CTLA-4 or PD-L1 specifically. Typically, such fragments would comprise an antigen-binding domain.
[0022] “Anti-CTLA-4 antibody” refers to an antibody or antigen binding fragment thereof that specifically binds a CTLA-4 polypeptide. Exemplary anti-CTLA-4 antibodies are described for example at U.S. Pat. Nos. 6,682,736; 7,109,003; 7,123,281; 7,411,057; 7,824,679; 8,143,379; 7,807,797; and 8,491,895 (Tremelimumab is 11.2.1, therein), which are herein incorporated by reference. Tremelimumab (U.S. Pat. No. 6,682,736) is an exemplary anti-CTLA-4 antibody. Tremelimumab VL, VH, and CDR amino acid sequences are provided at SEQ ID NOs: 1-8, herein.
[0023] “Anti-OX40 antibody” refers to an antibody or antigen binding fragment thereof that specifically binds OX40. OX40 antibodies include monoclonal and polyclonal antibodies that are specific for OX40 and antigen-binding fragments thereof. In certain aspects, anti-OX40 antibodies as described herein are monoclonal antibodies (or antigen-binding fragments thereof), e.g., murine, humanized, or fully human monoclonal antibodies. In one particular embodiment, the OX40 antibody is an OX40 receptor agonist, such as the mouse anti-human OX40 monoclonal antibody (9B12) described by Weinberg et al., J Immunother 29, 575-585 (2006). In another embodiment, an OX40 antibody is MEDI0562 as described in US 2016/0137740, incorporated herein by reference. MEDI0562 VH and VL amino acid sequences are provided at SEQ ID NOs: 25-26, herein. In other embodiments, the antibody which specifically binds to OX40, or an antigen-binding fragment thereof, binds to the same OX40 epitope as mAb 9B12.
[0024] “Anti-PD-L1 antibody” refers to an antibody or antigen binding fragment thereof that specifically binds a PD-L1 polypeptide. Exemplary anti-PD-L1 antibodies are described for example at US2013/0034559, U.S. Pat. Nos. 8,779,108 and 9,493,565 which are herein incorporated by reference. Durvalumab (MEDI4736) is an exemplary anti-PD-L1 antibody. Durvalumab VL, VH, and CDR amino acid sequences are provided at SEQ ID NOs: 9-16, herein. Other anti-PD-L1 antibodies include BMS-936559 (Bristol-Myers Squibb) and MPDL3280A (atezolizumab) (Roche).
[0025] “Anti-PD-1 antibody” refers to an antibody or antigen binding fragment thereof that specifically binds a PD-1 polypeptide. Exemplary anti-PD-1 antibodies are described for example at U.S. Pat. Nos. 7,521,051;
[0026] 8,008,449; 8,354,509; 9,073,994; 9,393,301; 9402899; and 9,439,962, which are herein incorporated by reference. Exemplary anti-PD-1 antibodies include, without limitation, nivolumab, pembrolizumab, pidilizumab, and AMP-514.
[0027] “Antigen-binding domain,” “antigen-binding fragment,” and “binding fragment” refer to a part of an antibody molecule that comprises amino acids responsible for the specific binding between the antibody and the antigen. In instances, where an antigen is large, the antigen-binding domain may only bind to a part of the antigen. A portion of the antigen molecule that is responsible for specific interactions with the antigen-binding domain is referred to as “epitope” or “antigenic determinant.” An antigen-binding domain typically comprises an antibody light chain variable region (VL) and an antibody heavy chain variable region (VH), however, it does not necessarily have to comprise both. For example, a so-called Fd antibody fragment consists only of a
[0028] VH domain, but still retains some antigen-binding function of the intact antibody. Binding fragments of an antibody are produced by recombinant DNA techniques, or by enzymatic or chemical cleavage of intact antibodies. Binding fragments include Fab, Fab′, F(ab′)2, Fv, and single-chain antibodies. An antibody other than a “bispecific” or “bifunctional” antibody is understood to have each of its binding sites identical. Digestion of antibodies with the enzyme, papain, results in two identical antigen-binding fragments, known also as “Fab” fragments, and a “Fc” fragment, having no antigen-binding activity but having the ability to crystallize. Digestion of antibodies with the enzyme, pepsin, results in the a F(ab′)2 fragment in which the two arms of the antibody molecule remain linked and comprise two-antigen binding sites. The F(ab′)2 fragment has the ability to crosslink antigen. “Fv” when used herein refers to the minimum fragment of an antibody that retains both antigen-recognition and antigen-binding sites. “Fab” when used herein refers to a fragment of an antibody that comprises the constant domain of the light chain and the CH1 domain of the heavy chain.
[0029] “mAb” refers to monoclonal antibody. Antibodies of the present disclosure comprise without limitation whole native antibodies, bispecific antibodies; chimeric antibodies; Fab, Fab′, single chain V region fragments (scFv), fusion polypeptides, and unconventional antibodies.
[0030] “Antisense activity” means any detectable and/or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound to the target.
[0031] “Antisense compound” means a compound comprising an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, oligonucleotides, ribozymes, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.
[0032] “Antisense inhibition” means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels in the absence of the antisense compound.
[0033] “Antisense mechanisms” are all those mechanisms involving hybridization of a compound with target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.
[0034] “Antisense oligonucleotide” means an oligonucleotide having a nucleobase sequence that is complementary to a target nucleic acid or region or segment thereof. In certain embodiments, an antisense oligonucleotide is specifically hybridizable to a target nucleic acid or region or segment thereof.
[0035] “Bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety. “Bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.
[0036] “Branching group” means a group of atoms having at least 3 positions that are capable of forming covalent linkages to at least 3 groups. In certain embodiments, a branching group provides a plurality of reactive sites for connecting tethered ligands to an oligonucleotide via a conjugate linker and/or a cleavable moiety.
[0037] “Cell-targeting moiety” means a conjugate group or portion of a conjugate group that is capable of binding to a particular cell type or particular cell types.
[0038] “cEt” or “constrained ethyl” means a bicyclic furanosyl sugar moiety comprising a bridge connecting the 4′-carbon and the 2′-carbon, wherein the bridge has the formula: 4′-CH(CH.sub.3)—O-2′.
[0039] “cEt nucleoside” means a nucleoside comprising a cEt modified sugar moiety.
[0040] “Chemical modification” in a compound describes the substitutions or changes through chemical reaction, of any of the units in the compound relative to the original state of such unit. “Modified nucleoside” means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase. “Modified oligonucleotide” means an oligonucleotide comprising at least one modified internucleoside linkage, a modified sugar, and/or a modified nucleobase.
[0041] “Chemically distinct region” refers to a region of a compound that is in some way chemically different than another region of the same compound. For example, a region having 2′-O-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2′-O-methoxyethyl modifications.
[0042] “Chimeric antisense compounds” means antisense compounds that have at least 2 chemically distinct regions, each position having a plurality of subunits.
[0043] “Chirally enriched population” means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more sterorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.
[0044] “Cleavable bond” means any chemical bond capable of being split. In certain embodiments, a cleavable bond is selected from among: an amide, a polyamide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, a di-sulfide, or a peptide.
[0045] “Cleavable moiety” means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.
[0046] “Complementary” in reference to an oligonucleotide means the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions. Nucleobase matches or complementary nucleobases, as described herein, are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methyl cytosine (mC) and guanine (G) unless otherwise specified. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. By contrast, “fully complementary” or “100% complementary” in reference to oligonucleotides means that such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches.
[0047] “Conjugate group” means a group of atoms that is attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
[0048] “Conjugate linker” means a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
[0049] “Conjugate moiety” means a group of atoms that is attached to an oligonucleotide via a conjugate linker.
[0050] “Contiguous” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence.
[0051] “Designing” or “Designed to” refer to the process of designing a compound that specifically hybridizes with a selected nucleic acid molecule.
[0052] “Diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition can be a liquid, e.g. saline solution.
[0053] “Differently modified” means chemical modifications or chemical substituents that are different from one another, including absence of modifications. Thus, for example, a MOE nucleoside and an unmodified DNA nucleoside are “differently modified,” even though the DNA nucleoside is unmodified. Likewise, DNA and RNA are “differently modified,” even though both are naturally-occurring unmodified nucleosides. Nucleosides that are the same but for comprising different nucleobases are not differently modified. For example, a nucleoside comprising a 2′-OMe modified sugar and an unmodified adenine nucleobase and a nucleoside comprising a 2′-OMe modified sugar and an unmodified thymine nucleobase are not differently modified.
[0054] “Dose” means a specified quantity of a compound or pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose may be administered in two or more boluses, tablets, or injections. For example, in certain embodiments, where subcutaneous administration is desired, the desired dose may require a volume not easily accommodated by a single injection. In such embodiments, two or more injections may be used to achieve the desired dose. In certain embodiments, a dose may be administered in two or more injections to minimize injection site reaction in an individual. In other embodiments, the compound or pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week or month.
[0055] “Dosing regimen” is a combination of doses designed to achieve one or more desired effects.
[0056] “Double-stranded antisense compound” means an antisense compound comprising two oligomeric compounds that are complementary to each other and form a duplex, and wherein one of the two said oligomeric compounds comprises an oligonucleotide.
[0057] “Effective amount” means the amount of compound sufficient to effectuate a desired physiological outcome in an individual in need of the compound. The effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.
[0058] “Efficacy” means the ability to produce a desired effect.
[0059] “Expression” includes all the functions by which a gene's coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to, the products of transcription and translation.
[0060] “Gapmer” means an oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.”
[0061] “Hybridization” means the annealing of oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a nucleic acid target.
[0062] “Immediately adjacent” means there are no intervening elements between the immediately adjacent elements of the same kind (e.g. no intervening nucleobases between the immediately adjacent nucleobases).
[0063] “Individual” means a human or non-human animal selected for treatment or therapy.
[0064] “Inhibiting the expression or activity” refers to a reduction or blockade of the expression or activity relative to the expression of activity in an untreated or control sample and does not necessarily indicate a total elimination of expression or activity.
[0065] “Internucleoside linkage” means a group or bond that forms a covalent linkage between adjacent nucleosides in an oligonucleotide. “Modified internucleoside linkage” means any internucleoside linkage other than a naturally occurring, phosphate internucleoside linkage. Non-phosphate linkages are referred to herein as modified internucleoside linkages.
[0066] “Lengthened oligonucleotides” are those that have one or more additional nucleosides relative to an oligonucleotide disclosed herein, e.g. a parent oligonucleotide.
[0067] “Linked nucleosides” means adjacent nucleosides linked together by an internucleoside linkage.
[0068] “Linker-nucleoside” means a nucleoside that links an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of a compound. Linker-nucleosides are not considered part of the oligonucleotide portion of a compound even if they are contiguous with the oligonucleotide.
[0069] “Mismatch” or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned. For example, nucleobases including but not limited to a universal nucleobase, inosine, and hypoxanthine, are capable of hybridizing with at least one nucleobase but are still mismatched or non-complementary with respect to nucleobase to which it hybridized. As another example, a nucleobase of a first oligonucleotide that is not capable of hybridizing to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned is a mismatch or non-complementary nucleobase.
[0070] “Modulating” refers to changing or adjusting a feature in a cell, tissue, organ or organism. For example, modulating YAP1 RNA can mean to increase or decrease the level of YAP1 RNA and/or YAP1 protein in a cell, tissue, organ or organism. A “modulator” effects the change in the cell, tissue, organ or organism. For example, a YAP1 compound can be a modulator that decreases the amount of YAP1 RNA and/or YAP1 protein in a cell, tissue, organ or organism.
[0071] “MOE” means methoxyethyl.
[0072] “Monomer” refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides.
[0073] “Motif” means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.
[0074] “Natural” or “naturally occurring” means found in nature.
[0075] “Non-bicyclic modified sugar” or “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.
[0076] “Nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, and double-stranded nucleic acids.
[0077] “Nucleobase” means a heterocyclic moiety capable of pairing with a base of another nucleic acid. As used herein a “naturally occurring nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). A “modified nucleobase” is a naturally occurring nucleobase that is chemically modified. A “universal base” or “universal nucleobase” is a nucleobase other than a naturally occurring nucleobase and modified nucleobase, and is capable of pairing with any nucleobase.
[0078] “Nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage.
[0079] “Nucleoside” means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. “Modified nucleoside” means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase.
[0080] “Oligomeric compound” means a compound comprising a single oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
[0081] “Oligonucleotide” means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another. Unless otherwise indicated, oligonucleotides consist of 8-80 linked nucleosides. “Modified oligonucleotide” means an oligonucleotide, wherein at least one sugar, nucleobase, or internucleoside linkage is modified. “Unmodified oligonucleotide” means an oligonucleotide that does not comprise any sugar, nucleobase, or internucleoside modification.
[0082] “Parent oligonucleotide” means an oligonucleotide whose sequence is used as the basis of design for more oligonucleotides of similar sequence but with different lengths, motifs, and/or chemistries. The newly designed oligonucleotides may have the same or overlapping sequence as the parent oligonucleotide.
[0083] “Parenteral administration” means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.
[0084] “Pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to an individual. For example, a pharmaceutically acceptable carrier can be a sterile aqueous solution, such as PBS or water-for-injection.
[0085] “Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds, such as oligomeric compounds or oligonucleotides, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
[0086] “Pharmaceutical agent” means a compound that provides a therapeutic benefit when administered to an individual.
[0087] “Pharmaceutical composition” means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition may comprise one or more compounds or salt thereof and a sterile aqueous solution.
[0088] “Phosphorothioate linkage” means a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced with a sulfur atom. A phosphorothioate internucleoside linkage is a modified internucleoside linkage.
[0089] “Phosphorus moiety” means a group of atoms comprising a phosphorus atom. In certain embodiments, a phosphorus moiety comprises a mono-, di-, or tri-phosphate, or phosphorothioate.
[0090] “Portion” means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an oligomeric compound.
[0091] “Prevent” refers to delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time from minutes to indefinitely.
[0092] “Prodrug” means a compound in a form outside the body which, when administered to an individual, is metabolized to another form within the body or cells thereof. In certain embodiments, the metabolized form is the active, or more active, form of the compound (e.g., drug). Typically conversion of a prodrug within the body is facilitated by the action of an enzyme(s) (e.g., endogenous or viral enzyme) or chemical(s) present in cells or tissues, and/or by physiologic conditions.
[0093] “Reduce” means to bring down to a smaller extent, size, amount, or number.
[0094] “RefSeq No.” is a unique combination of letters and numbers assigned to a sequence to indicate the sequence is for a particular target transcript (e.g., target gene). Such sequence and information about the target gene (collectively, the gene record) can be found in a genetic sequence database. Genetic sequence databases include the NCBI Reference Sequence database, GenBank, the European Nucleotide Archive, and the DNA Data Bank of Japan (the latter three forming the International Nucleotide Sequence Database Collaboration or INSDC).
[0095] “Region” is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.
[0096] “RNAi compound” means an antisense compound that acts, at least in part, through RISC or Ago2, but not through RNase H, to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.
[0097] “Segments” are defined as smaller or sub-portions of regions within a nucleic acid.
[0098] “Side effects” means physiological disease and/or conditions attributable to a treatment other than the desired effects. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise. For example, increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality. For example, increased bilirubin may indicate liver toxicity or liver function abnormality.
[0099] “Single-stranded” in reference to a compound means the compound has only one oligonucleotide. “Self-complementary” means an oligonucleotide that at least partially hybridizes to itself. A compound consisting of one oligonucleotide, wherein the oligonucleotide of the compound is self-complementary, is a single-stranded compound. A single-stranded compound may be capable of binding to a complementary compound to form a duplex.
[0100] “Sites” are defined as unique nucleobase positions within a target nucleic acid.
[0101] “Specifically hybridizable” refers to an oligonucleotide having a sufficient degree of complementarity between the oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids. In certain embodiments, specific hybridization occurs under physiological conditions.
[0102] “Specifically inhibit” with reference to a target nucleic acid means to reduce or block expression of the target nucleic acid while exhibiting fewer, minimal, or no effects on non-target nucleic acids. Reduction does not necessarily indicate a total elimination of the target nucleic acid's expression.
[0103] “Standard cell assay” means assay(s) described in the Examples and reasonable variations thereof
[0104] “Standard in vivo experiment” means the procedure(s) described in the Example(s) and reasonable variations thereof.
[0105] “Stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.
[0106] “Sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. “Unmodified sugar moiety” or “unmodified sugar” means a 2′-OH(H) furanosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2′-H(H) moiety, as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties have one hydrogen at each of the 1′, 3′, and 4′ positions, an oxygen at the 3′ position, and two hydrogens at the 5′ position. “Modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate. “Modified furanosyl sugar moiety” means a furanosyl sugar comprising a non-hydrogen substituent in place of at least one hydrogen of an unmodified sugar moiety. In certain embodiments, a modified furanosyl sugar moiety is a 2′-substituted sugar moiety. Such modified furanosyl sugar moieties include bicyclic sugars and non-bicyclic sugars.
[0107] “Sugar surrogate” means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary compounds or nucleic acids.
[0108] “Synergy” or “synergize” refers to an effect of a combination that is greater than additive of the effects of each component alone at the same doses.
[0109] “YAP1” means any nucleic acid or protein of YAP1. “YAP1 nucleic acid” means any nucleic acid encoding YAP1. For example, in certain embodiments, a YAP1 nucleic acid includes a DNA sequence encoding YAP1, an RNA sequence transcribed from DNA encoding YAP1 (including genomic DNA comprising introns and exons), and an mRNA sequence encoding YAP1. “YAP1 mRNA” means an mRNA encoding a YAP1 protein. The target may be referred to in either upper or lower case.
[0110] “YAP1 specific inhibitor” refers to any agent capable of specifically inhibiting YAP1 RNA and/or YAP1 protein expression or activity at the molecular level. For example, YAP1 specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of YAP1 RNA and/or YAP1 protein.
[0111] “Target gene” refers to a gene encoding a target.
[0112] “Targeting” means the specific hybridization of a compound to a target nucleic acid in order to induce a desired effect.
[0113] “Target nucleic acid,” “target RNA,” “target RNA transcript” and “nucleic acid target” all mean a nucleic acid capable of being targeted by compounds described herein.
[0114] “Target region” means a portion of a target nucleic acid to which one or more compounds is targeted.
[0115] “Target segment” means the sequence of nucleotides of a target nucleic acid to which a compound is targeted. “5′ target site” refers to the 5′-most nucleotide of a target segment. “3′ target site” refers to the 3′-most nucleotide of a target segment.
[0116] “Terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
[0117] “Therapeutically effective amount” means an amount of a compound, pharmaceutical agent, or composition that provides a therapeutic benefit to an individual.
[0118] “Treat” refers to administering a compound or pharmaceutical composition to an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal.
Certain Embodiments
[0119] Certain embodiments provide methods, compounds and compositions for inhibiting YAP1 expression.
[0120] Certain embodiments provide compounds targeted to a YAP1 nucleic acid. In certain embodiments, the YAP1 nucleic acid has the sequence set forth in RefSeq or GENBANK Accession No. NM_001282101.1 (SEQ ID NO: 1) or NC_000011.10 truncated from nucleotides 102107001 to 102236000 (SEQ ID NO: 2), each of which is incorporated by reference in its entirety. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.
[0121] Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides.
[0122] Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 9 to 80 linked nucleosides and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides.
[0123] Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 80 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides.
[0124] Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 11 to 80 linked nucleosides and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 11 to 30 linked nucleosides.
[0125] Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 12 to 80 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 12 to 30 linked nucleosides.
[0126] Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.
[0127] Certain embodiments provide a compound comprising a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.
[0128] In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide comprises an at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion within nucleotides 2565-2580, 2566-2581, or 4600-4615 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.
[0129] In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide comprises an at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion within nucleotides 123590-123605, 117330-117345, 117761-117776, 117757-117772, 117758-117773, 117330-117345, 119672-119687, 123591-123606, 125625-125640, or 117755-117770 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.
[0130] In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is complementary within nucleotides 2565-2580, 2566-2581, or 4600-4615 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.
[0131] In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is complementary within nucleotides 123590-123605, 117330-117345, 117761-117776, 117757-117772, 117758-117773, 117330-117345, 119672-119687, 123591-123606, 125625-125640, or 117755-117770 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.
[0132] In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide comprises an at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion of any one of the nucleobase sequences of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.
[0133] In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.
[0134] In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.
[0135] In certain embodiments, a compound targeted to YAP1 is ION 1198440. Out of over 3,000 compounds that were screened as described in the Examples section below, ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872 emerged as the top lead compounds. In particular, ION 1198440 exhibited the best combination of properties in terms of potency and tolerability out of over 3,000 compounds.
[0136] In certain embodiments, any of the foregoing modified oligonucleotides has at least one modified internucleoside linkage, at least one modified sugar, and/or at least one modified nucleobase.
[0137] In certain embodiments, at least one nucleoside of any of the foregoing modified oligonucleotides comprises a modified sugar. In certain embodiments, the modified sugar comprises a 2′-O-methoxyethyl group. In certain embodiments, the modified sugar is a bicyclic sugar, such as a 4′-CH(CH.sub.3)—O-2′ group, a 4′-CH.sub.2—O-2′ group, or a 4′-(CH.sub.2).sub.2—O-2′group.
[0138] In certain embodiments, at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage, such as a phosphorothioate internucleoside linkage.
[0139] In certain embodiments, at least one nucleobase of the foregoing modified oligonucleotides is a modified nucleobase, such as 5-methylcytosine.
[0140] In certain embodiments, any of the foregoing modified oligonucleotides has: [0141] a gap segment consisting of linked 2′-deoxynucleosides; [0142] a 5′ wing segment consisting of linked nucleosides; and [0143] a 3′ wing segment consisting of linked nucleosides;
[0144] wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 80 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.
[0145] In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides and has a nucleobase sequence consisting of the nucleobase sequence recited in any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.
[0146] In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 23-2940, wherein the modified oligonucleotide has: [0147] a gap segment consisting of linked 2′-deoxynucleosides; [0148] a 5′ wing segment consisting of linked nucleosides; and [0149] a 3′ wing segment consisting of linked nucleosides;
[0150] wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
[0151] In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863, wherein the modified oligonucleotide has: [0152] a gap segment consisting of linked 2′-deoxynucleosides; [0153] a 5′ wing segment consisting of linked nucleosides; and [0154] a 3′ wing segment consisting of linked nucleosides;
[0155] wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
[0156] In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 810 and 1404, wherein the modified oligonucleotide has:
[0157] a gap segment consisting of ten linked 2′-deoxynucleosides;
[0158] a 5′ wing segment consisting of three linked nucleosides; and
[0159] a 3′ wing segment consisting of three linked nucleosides;
[0160] wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
[0161] In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NO: 2868, wherein the modified oligonucleotide has a gapmer consisting of a 5′-region, a 3′-region, and a central region positioned between the 5′-region and the 3′-region wherein:
[0162] the 5′-region consists of 3 linked modified nucleosides, wherein each nucleoside of the 5′-region comprises a cEt nucleoside;
[0163] the 3′-region consists of 3 linked modified nucleosides, wherein each nucleoside of the 3′-region comprises a cEt nucleoside;
[0164] the central region consists of 10 linked nucleosides, wherein the second nucleoside from the 5′ end of the central region comprises a 2′-O-methyl modified sugar moiety and the first and third through tenth nucleosides from the 5′ end of the central region each comprises a 2′deoxynucleoside;
[0165] wherein each internucleoside linkage is a phosphorothioate linkage; and
wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
[0166] In certain embodiments, a compound comprises or consists of a modified oligonucleotide having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NO: 2868; wherein the modified oligonucleotide comprises the sugar motif kkk-d-y-d(8)-kkk, wherein “k” indicates a cEt modified sugar moiety, “d” indicates an unmodified 2′-deoxyribosyl sugar moiety, and “y” indicates a 2′-O-methyl modified sugar moiety; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
[0167] In certain embodiments, a compound comprises or consists of ION 1197270 having the nucleobase sequence and chemical motif: TksTksAksAdsAysGdsTdsGdsTdsAdsTdsGdsTdsmCksAksGk, wherein “d” represents a 2′-deoxyribose sugar, “k” represents a cEt modified sugar, “y” represents a 2′-O-methyl sugar, “s” represents a phosphorothioate internucleoside linkage, and “mC” refers to a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
[0168] In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NO: 2864, wherein the modified oligonucleotide has:
[0169] a gap segment consisting of ten linked 2′-deoxynucleosides;
[0170] a 5′ wing segment consisting of one linked nucleoside; and
[0171] a 3′ wing segment consisting of five linked nucleosides;
[0172] wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
[0173] In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NOs: 1404 or 1101, wherein the modified oligonucleotide has:
[0174] a gap segment consisting of nine linked 2′-deoxynucleosides;
[0175] a 5′ wing segment consisting of three linked nucleosides; and
[0176] a 3′ wing segment consisting of four linked nucleosides;
[0177] wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a cEt nucleoside, a cEt nucleoside, and a 2′-O-methoxyethyl nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
[0178] In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NO: 2812, wherein the modified oligonucleotide has:
[0179] a gap segment consisting of nine linked 2′-deoxynucleosides;
[0180] a 5′ wing segment consisting of three linked nucleosides; and
[0181] a 3′ wing segment consisting of four linked nucleosides;
[0182] wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein the 3′ wing segment comprises a 2′-O-methoxyethyl nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
[0183] In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NOs: 1200 or 2863, wherein the modified oligonucleotide has:
[0184] a gap segment consisting of nine linked 2′-deoxynucleosides;
[0185] a 5′ wing segment consisting of two linked nucleosides; and
[0186] a 3′ wing segment consisting of five linked nucleosides;
[0187] wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
[0188] In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NO: 2865, wherein the modified oligonucleotide has:
[0189] a gap segment consisting of ten linked 2′-deoxynucleosides;
[0190] a 5′ wing segment consisting of one linked nucleoside; and
[0191] a 3′ wing segment consisting of five linked nucleosides;
[0192] wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
[0193] Certain embodiments provide a modified oligonucleotide, wherein the anion form of the modified oligonucleotide has the following chemical structure:
##STR00001##
or a salt thereof.
[0194] Certain embodiments provide a modified oligonucleotide according to the following chemical structure:
##STR00002##
or a salt thereof.
[0195] Certain embodiments provide a modified oligonucleotide according to the following chemical structure:
##STR00003##
[0196] Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. Unless otherwise indicated, an oligonucleotide described herein and the term “oligonucleotide” are intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of a compound followed by the term “or a salt thereof” expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with a cation. In certain instances, one or more specific cation is identified.
[0197] In any of the foregoing embodiments, the compound or oligonucleotide can be at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to a nucleic acid encoding YAP1.
[0198] In any of the foregoing embodiments, the compound can be single-stranded. In certain embodiments, the compound comprises deoxyribonucleotides. In certain embodiments, the compound is double-stranded. In certain embodiments, the compound is double-stranded and comprises ribonucleotides. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.
[0199] In any of the foregoing embodiments, the compound can consist of 8 to 80, 10 to 30, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked nucleosides. In certain embodiments, the compound comprises or consists of an oligonucleotide.
[0200] In certain embodiments, compounds or compositions provided herein comprise a salt of the modified oligonucleotide. In certain embodiments, the salt is a sodium salt. In certain embodiments, the salt is a potassium salt.
[0201] In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having at least one of an increase an alanine transaminase (ALT) or aspartate transaminase (AST) value of no more than 4 fold, 3 fold, or 2 fold over saline treated animals or an increase in liver, spleen, or kidney weight of no more than 30%, 20%, 15%, 12%, 10%, 5%, or 2% compared to control treated animals. In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase of ALT or AST over control treated animals. In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase in liver, spleen, or kidney weight over control animals.
[0202] Certain embodiments provide a composition comprising the compound of any of the aforementioned embodiments or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition has a viscosity less than about 40 centipoise (cP), less than about 30 centipose (cP), less than about 20 centipose (cP), less than about 15 centipose (cP), or less than about 10 centipose (cP). In certain embodiments, the composition having any of the aforementioned viscosities comprises a compound provided herein at a concentration of about 100 mg/mL, about 125 mg/mL, about 150 mg/mL, about 175 mg/mL, about 200 mg/mL, about 225 mg/mL, about 250 mg/mL, about 275 mg/mL, or about 300 mg/mL. In certain embodiments, the composition having any of the aforementioned viscosities and/or compound concentrations has a temperature of room temperature or about 20° C., about 21° C., about 22° C., about 23° C., about 24° C., about 25° C., about 26° C., about 27° C., about 28° C., about 29° C., or about 30° C.
[0203] Non-limiting numbered embodiments include:
[0204] E1. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940.
[0205] E2. A compound comprising a modified oligonucleotide 9 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940.
[0206] E3. A compound comprising a modified oligonucleotide 10 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940.
[0207] E4. A compound comprising a modified oligonucleotide 11 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940.
[0208] E5. A compound comprising a modified oligonucleotide 12 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940.
[0209] E6. A compound comprising a modified oligonucleotide consisting of 16 to 80 linked nucleosides having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940.
[0210] E7. A compound comprising a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940.
[0211] E8. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides complementary within nucleotides 2565-2580, 2566-2581, or 4600-4615 of SEQ ID NO: 1 or within nucleotides 123590-123605, 117330-117345, 117761-117776, 117757-117772, 117758-117773, 117330-117345, 119672-119687, 123591-123606, 125625-125640, or 117755-117770 of SEQ ID NO: 2.
[0212] E9. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.
[0213] E10. A compound comprising a modified oligonucleotide 9 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.
[0214] E11. A compound comprising a modified oligonucleotide 10 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.
[0215] E12. A compound comprising a modified oligonucleotide 11 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.
[0216] E13. A compound comprising a modified oligonucleotide 12 to 80 linked nucleosides in length having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.
[0217] E14. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides having a nucleobase sequence comprising any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.
[0218] E15. A compound comprising a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.
[0219] E16. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides having a nucleobase sequence comprising any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.
[0220] E17. A compound comprising a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863.
[0221] E18. The compound of any one of embodiments El-E17, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage, at least one modified sugar, or at least one modified nucleobase.
[0222] E19. The compound of embodiment E18, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.
[0223] E20. The compound of embodiment E18 or E19, wherein the modified sugar is a bicyclic sugar.
[0224] E21. The compound of embodiment E20, wherein the bicyclic sugar is selected from the group consisting of: 4′-(CH.sub.2)-O-2′ (LNA); 4′-(CH.sub.2).sub.2-O-2′ (ENA); and 4′-CH(CH.sub.3)-O-2′ (cEt).
[0225] E22. The compound of embodiment E18 or E19, wherein the modified sugar is 2′-O-methoxyethyl.
[0226] E23. The compound of any one of embodiments E18-E22, wherein the modified nucleobase is a 5-methylcytosine.
[0227] E24. The compound of any one of embodiments E1-E23, wherein the modified oligonucleotide comprises:
[0228] a gap segment consisting of linked 2′-deoxynucleosides;
[0229] a 5′ wing segment consisting of linked nucleosides; and
[0230] a 3′ wing segment consisting of linked nucleosides;
[0231] wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
[0232] E25. A compound comprising a modified oligonucleotide consisting of 16 to 80 linked nucleosides having a nucleobase sequence comprising any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863, wherein the modified oligonucleotide comprises: [0233] a gap segment consisting of linked 2′-deoxynucleosides; [0234] a 5′ wing segment consisting of linked nucleosides; and [0235] a 3′ wing segment consisting of linked nucleosides;
[0236] wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
[0237] E26. A compound comprising a modified oligonucleotide consisting of 16-80 linked nucleobases having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 810 and 1404, wherein the modified oligonucleotide comprises:
[0238] a gap segment consisting of ten linked 2′-deoxynucleosides;
[0239] a 5′ wing segment consisting of three linked nucleosides; and
[0240] a 3′ wing segment consisting of three linked nucleosides;
[0241] wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.
[0242] E27. A compound comprising a modified oligonucleotide consisting of 16-80 linked nucleobases having a nucleobase sequence comprising the sequence recited in SEQ ID NOs: 2864, wherein the modified oligonucleotide comprises:
[0243] a gap segment consisting of ten linked 2′-deoxynucleosides;
[0244] a 5′ wing segment consisting of one linked nucleoside; and
[0245] a 3′ wing segment consisting of five linked nucleosides;
[0246] wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.
[0247] E28. A compound comprising a modified oligonucleotide consisting of 16-80 linked nucleobases having a nucleobase sequence comprising the sequence recited in SEQ ID NO: 2868, wherein the modified oligonucleotide comprises a gapmer consisting of a 5′-region, a 3′-region, and a central region positioned between the 5′-region and the 3′-region wherein: [0248] the 5′-region consists of 3 linked modified nucleosides, wherein each nucleoside of the 5′-region comprises a cEt nucleoside;
[0249] the 3′-region consists of 3 linked modified nucleosides, wherein each nucleoside of the 3′-region comprises a cEt nucleoside;
[0250] the central region consists of 10 linked nucleosides, wherein the second nucleoside from the 5′ end of the central region comprises a 2′-O-methyl modified sugar moiety and the first and third through tenth nucleosides from the 5′ end of the central region each comprises a 2′deoxynucleoside;
[0251] wherein each internucleoside linkage is a phosphorothioate linkage; and
[0252] wherein each cytosine is a 5-methylcytosine.
[0253] E29. A compound comprising a modified oligonucleotide consisting of 16-80 linked nucleobases having a nucleobase sequence comprising the sequence recited in SEQ ID NOs: 1200 or 2863, wherein the modified oligonucleotide comprises:
[0254] a gap segment consisting of nine linked 2′-deoxynucleosides;
[0255] a 5′ wing segment consisting of two linked nucleosides; and
[0256] a 3′ wing segment consisting of five linked nucleosides;
[0257] wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.
[0258] E30. A compound comprising or consisting of a modified oligonucleotide consisting of 16-80 linked nucleobases having a nucleobase sequence comprising the sequence recited in SEQ ID NO: 2865, wherein the modified oligonucleotide comprises:
[0259] a gap segment consisting of ten linked 2′-deoxynucleosides;
[0260] a 5′ wing segment consisting of one linked nucleoside; and
[0261] a 3′ wing segment consisting of five linked nucleosides;
[0262] wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.
[0263] E31. The compound of any one of embodiments E1-E30, wherein the oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of SEQ ID NOs: 1-10.
[0264] E32. The compound of any one of embodiments E1-E31, wherein the compound is single-stranded.
[0265] E33. The compound of any one of embodiments E1-E31, wherein the compound is double-stranded.
[0266] E34. The compound of any one of embodiments E1-E33, wherein the compound comprises ribonucleotides.
[0267] E35. The compound of any one of embodiments E1-E33, wherein the compound comprises deoxyribonucleotides.
[0268] E36. The compound of any one of embodiments E1-E35, wherein the modified oligonucleotide consists of 16 to 30 linked nucleosides.
[0269] E37. The compound of any preceding embodiment E1-E36, wherein the compound consists of the modified oligonucleotide.
[0270] E38. A compound consisting of a pharmaceutically acceptable salt of any of the compounds of embodiments E1-E36.
[0271] E39. The compound of embodiment E38, wherein the pharmaceutically acceptable salt is a sodium salt.
[0272] E40. The compound of embodiment E38, wherein the pharmaceutically acceptable salt is a potassium salt.
[0273] E41. A compound having the formula:
##STR00004##
or a salt thereof.
[0274] E42. A compound having the formula:
##STR00005##
[0275] E43. A composition comprising the compound of any one of embodiments E1-E42 and a pharmaceutically acceptable diluent or carrier.
[0276] E44. A composition comprising the compound of any one of embodiments E1-E42 and water.
[0277] E45. A composition comprising a compound or modified oligonucleotide of any preceding embodiment E1-E44, for use in therapy.
[0278] E46. A combination comprising the compound of any one of embodiments E1-E42 or the composition of any of embodiments E43-E45 and a secondary agent.
[0279] E47. The combination of embodiment E46, wherein the secondary agent is a CDK4/6 inhibitor.
[0280] E48. The combination of embodiment E47, wherein the CDK4/6 inhibitor is palbociclib, ribociclib, or abemaciclib.
[0281] E49. The combination of embodiment E46, wherein the secondary agent is an EGFR inhibitor.
[0282] E50. The combination of embodiment E49, wherein the EGFR inhibitor is cetuximab, necitumumab, panitumumab, vandetanib, dacomitinib, neratinib, osimertinib, gefitinib, lapatinib, or erlotinib.
[0283] E51. The combination of embodiment E46, wherein the secondary agent is a kinase inhibitor.
[0284] E52. The combination of embodiment E51, wherein the kinase inhibitor is sorafenib, regorafenib, or carbozantinib.
[0285] E53. A method of treating or ameliorating cancer in an individual comprising administering to the individual a compound targeted to YAP1, thereby treating or ameliorating the cancer.
[0286] E54. The method of embodiment E53, wherein the compound is an antisense compound targeted to YAP1.
[0287] E55. The method of embodiment E53 or E54, further comprising administering a secondary agent.
[0288] E56. The method of embodiment E55, wherein the secondary agent is a CDK4/6 inhibitor.
[0289] E57. The method of embodiment E56, wherein the CDK4/6 inhibitor is palbociclib, ribociclib, or abemaciclib.
[0290] E58. The method of embodiment E55, wherein the secondary agent is an EGFR inhibitor.
[0291] E59. The method of embodiment E58, wherein the EGFR inhibitor is cetuximab, necitumumab, panitumumab, vandetanib, dacomitinib, neratinib, osimertinib, gefitinib, lapatinib, or erlotinib.
[0292] E60. The method of embodiment E55, wherein the secondary agent is a kinase inhibitor.
[0293] E61. The method of embodiment E60, wherein the kinase inhibitor is sorafenib, regorafenib, or carbozantinib.
[0294] E62. The method of any of embodiments E53-E61, wherein the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL), a cancer having a mutant FAT1 gene, a cancer having a homozygous FAT1 gene mutation, or a cancer having a heterozygous FAT1 gene mutation, a squamous cell carcinoma (SCC) having a mutant FAT1 gene, a head and neck squamous cell carcinoma (HNSCC) having a mutant FAT1 gene, an oral tongue squamous cell carcinoma (OTSCC) having a mutant FAT1 gene, a pharynx carcinoma having a mutant FAT1 gene, or a laryngeal squamous cell carcinoma having a mutant FAT1 gene.
[0295] E63. The method of any of embodiments E53-E62, wherein administering the compound inhibits or reduces cancer cell proliferation, tumor growth, or metastasis.
[0296] E64. A method of inhibiting expression of YAP1 in a cell comprising contacting the cell with a compound targeted to YAP1, thereby inhibiting expression of YAP1 in the cell.
[0297] E65. The method of embodiment E64, wherein the cell a cancer cell.
[0298] E66. The method of embodiment E65, wherein the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL), a cancer having a mutant FAT1 gene, a cancer having a homozygous FAT1 gene mutation, or a cancer having a heterozygous FAT1 gene mutation, a squamous cell carcinoma (SCC) having a mutant FAT1 gene, a head and neck squamous cell carcinoma (HNSCC) having a mutant FAT1 gene, an oral tongue squamous cell carcinoma (OTSCC) having a mutant FAT1 gene, a pharynx carcinoma having a mutant FAT1 gene, or a laryngeal squamous cell carcinoma having a mutant FAT1 gene.
[0299] E67. A method of reducing or inhibiting cancer cell proliferation, tumor growth, or metastasis in an individual having cancer comprising administering a compound targeted to YAP1 to the individual, thereby reducing or inhibiting cancer cell proliferation, tumor growth, or metastasis in the individual.
[0300] E68. The method of embodiment E67, wherein the individual has hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL), a cancer having a mutant FAT1 gene, a cancer having a homozygous FAT1 gene mutation, or a cancer having a heterozygous FAT1 gene mutation, a squamous cell carcinoma (SCC) having a mutant FAT1 gene, a head and neck squamous cell carcinoma (HNSCC) having a mutant FAT1 gene, an oral tongue squamous cell carcinoma (OTSCC) having a mutant FAT1 gene, a pharynx carcinoma having a mutant FAT1 gene, or a laryngeal squamous cell carcinoma having a mutant FAT1 gene.
[0301] E69. The method of any one of embodiments E64-E68, wherein the compound is an antisense compound targeted to YAP1.
[0302] E70. The method of any one of embodiments E64-E69, wherein the compound is the compound of any one of embodiments 1-42 or composition of any one of embodiments 43-45.
[0303] E71. The method of any of embodiments E64-E70, wherein the compound is administered parenterally.
[0304] E72. Use of a compound targeted to YAP1 for treating, preventing, or ameliorating a cancer associated with YAP1.
[0305] E73. Use of a compound targeted to YAP1 and a secondary agent for treating, preventing, or ameliorating a cancer associated with YAP1.
[0306] E74. The use of embodiment E73, wherein the secondary agent is a CDK4/6 inhibitor.
[0307] E75. The use of embodiment E74, wherein the CDK4/6 inhibitor is palbociclib, ribociclib, or abemaciclib.
[0308] E76. The use of embodiment E73, wherein the secondary agent is an EGFR inhibitor.
[0309] E77. The use of embodiment E76, wherein the EGFR inhibitor is cetuximab, necitumumab, panitumumab, vandetanib, dacomitinib, neratinib, osimertinib, gefitinib, lapatinib, or erlotinib.
[0310] E78. The use of embodiment E73, wherein the secondary agent is a kinase inhibitor.
[0311] E79. The use of embodiment E78, wherein the kinase inhibitor is sorafenib, regorafenib, or carbozantinib.
[0312] E80. The use of any of embodiments E72-E79, wherein the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL), a cancer having a mutant FAT1 gene, a cancer having a homozygous FAT1 gene mutation, or a cancer having a heterozygous FAT1 gene mutation, a squamous cell carcinoma (SCC) having a mutant FAT1 gene, a head and neck squamous cell carcinoma (HNSCC) having a mutant FAT1 gene, an oral tongue squamous cell carcinoma (OTSCC) having a mutant FAT1 gene, a pharynx carcinoma having a mutant FAT1 gene, or a laryngeal squamous cell carcinoma having a mutant FAT1 gene.
[0313] E81. The use of any of embodiments E72-E80, wherein the compound is an antisense compound targeted to YAP1.
[0314] E82. The use of any of embodiments E72-E81, wherein the compound is the compound of any one of embodiments E1-E42 or composition of any one of embodiments E43-E45.
[0315] E83. Use of a compound targeted to YAP1 in the manufacture of a medicament for treating or ameliorating a cancer associated with YAP1.
[0316] E84. The use of embodiment E83, wherein the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL), a cancer having a mutant FAT1 gene, a cancer having a homozygous FAT1 gene mutation, or a cancer having a heterozygous FAT1 gene mutation, a squamous cell carcinoma (SCC) having a mutant FAT1 gene, a head and neck squamous cell carcinoma (HNSCC) having a mutant FAT1 gene, an oral tongue squamous cell carcinoma (OTSCC) having a mutant FAT1 gene, a pharynx carcinoma having a mutant FAT1 gene, or a laryngeal squamous cell carcinoma having a mutant FAT1 gene.
[0317] E85. The use of embodiment E83 or E84, wherein the compound is an antisense compound targeted to YAP1.
[0318] E86. The use of any one of embodiments E83-E85, wherein the compound is the compound of any one of embodiments 1-42 or composition of any one of embodiments E43-E45.
[0319] E87. Use of a compound targeted to YAP1 in the preparation of a medicament for treating or ameliorating a cancer associated with YAP1.
[0320] E88. The use of embodiment E87, wherein the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL), a cancer having a mutant FAT1 gene, a cancer having a homozygous FAT1 gene mutation, or a cancer having a heterozygous FAT1 gene mutation, a squamous cell carcinoma (SCC) having a mutant FAT1 gene, a head and neck squamous cell carcinoma (HNSCC) having a mutant FAT1 gene, an oral tongue squamous cell carcinoma (OTSCC) having a mutant FAT1 gene, a pharynx carcinoma having a mutant FAT1 gene, or a laryngeal squamous cell carcinoma having a mutant FAT1 gene.
[0321] E89. The use of embodiment E87 or E88, wherein the compound is an antisense compound targeted to YAP1.
[0322] E90. The use of any one of embodiments E87-E89, wherein the compound is the compound of any one of embodiments 1-42 or composition of any one of embodiments E43-E45.
Certain Indications
[0323] Certain embodiments provided herein relate to methods of inhibiting YAP1 expression, which can be useful for treating, preventing, or ameliorating a cancer associated with YAP1 in an individual, by administration of a compound that targets YAP1. In certain embodiments, the compound can be a YAP1 specific inhibitor. In certain embodiments, the compound can be an antisense compound, oligomeric compound, or oligonucleotide targeted to YAP1.
[0324] Examples of cancers associated with YAP1 treatable, preventable, and/or ameliorable with the compounds and methods provided herein include hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma.
[0325] In certain embodiments, a method of treating, preventing, or ameliorating a cancer associated with YAP1 in an individual comprises administering to the individual a compound comprising a YAP1 specific inhibitor, thereby treating, preventing, or ameliorating the cancer. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administering the compound inhibits or reduces cancer cell proliferation, tumor growth, or metastasis.
[0326] In certain embodiments, a method of treating or ameliorating caner comprises administering to the individual a compound comprising a YAP1 specific inhibitor, thereby treating or ameliorating the cancer. In certain embodiments, the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma.In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administering the compound inhibits or reduces cancer cell proliferation, tumor growth, or metastasis. In certain embodiments, the individual is identified as having or at risk of having a cancer associated with YAP1.
[0327] In certain embodiments, a method of inhibiting expression of YAP1 in an individual having, or at risk of having, a cancer associated with YAP1 comprises administering to the individual a compound comprising a YAP1 specific inhibitor, thereby inhibiting expression of YAP1 in the individual. In certain embodiments, administering the compound inhibits expression of YAP1 in a cancer cell in the individual. In certain embodiments, the individual has, or is at risk of having hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administering the compound inhibits or reduces cancer cell proliferation, tumor growth, or metastasis. In certain embodiments, the individual is identified as having or at risk of having a cancer associated with YAP1.
[0328] In certain embodiments, a method of inhibiting expression of YAP1 in a cell comprises contacting the cell with a compound comprising a YAP1 specific inhibitor, thereby inhibiting expression of YAP1 in the cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a liver cancer cell or squamous cancer cell. In certain embodiments, the cancer cell is in the liver, head, or neck of an individual having cancer. In certain embodiments, the cell is in an individual who has, or is at risk of having cancer, such as hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.
[0329] In certain embodiments, a method of reducing or inhibiting cancer cell proliferation, tumor growth, or metastasis of an individual having, or at risk of having, a cancer associated with YAP1 comprises administering to the individual a compound comprising a YAP1 specific inhibitor, thereby reducing or inhibiting cancer cell proliferation, tumor growth, or metastasis in the individual. In certain embodiments, the individual has, or is at risk of having, hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, the individual is identified as having or at risk of having a cancer associated with YAP1.
[0330] Certain embodiments are drawn to a compound comprising a YAP1 specific inhibitor for use in treating cancer. In certain embodiments, the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.
[0331] Certain embodiments are drawn to a compound comprising a YAP1 specific inhibitor for use in reducing or inhibiting cancer cell proliferation, tumor growth, or metastasis in an individual having cancer. In certain embodiments, the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.
[0332] Certain embodiments are drawn to use of a compound comprising a YAP1 specific inhibitor for the manufacture or preparation of a medicament for treating cancer. Certain embodiments are drawn to use of a compound comprising a YAP1 specific inhibitor for the preparation of a medicament for treating a cancer associated with YAP1. In certain embodiments, the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.
[0333] Certain embodiments are drawn to use of a compound comprising a YAP1 specific inhibitor for the manufacture or preparation of a medicament for reducing or inhibiting cancer cell proliferation, tumor growth, or metastasis in an individual having cancer. In certain embodiments, the cancer is hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, the compound comprises an antisense compound targeted to YAP1. In certain embodiments, the compound comprises an oligonucleotide targeted to YAP1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.
[0334] In any of the foregoing methods or uses, the compound can be targeted to YAP1. In certain embodiments, the compound comprises or consists of a modified oligonucleotide, for example a modified oligonucleotide consisting of 8 to 80 linked nucleosides, 10 to 30 linked nucleosides, 12 to 30 linked nucleosides, or 20 linked nucleosides. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of the nucleobase sequences recited in SEQ ID NOs: 1-10. In certain embodiments, at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage, at least one nucleoside of the modified oligonucleotide comprises a modified sugar and/or at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage, the modified sugar is a bicyclic sugar or a 2′-O-methoxyethyl, and the modified nucleobase is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide has a gap segment consisting of linked 2′-deoxynucleosides; a 5′ wing segment consisting of linked nucleosides; and a 3′ wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
[0335] In any of the foregoing embodiments, the modified oligonucleotide can consist of 12 to 30, 15 to 30, 15 to 25, 15 to 24, 16 to 24, 17 to 24, 18 to 24, 19 to 24, 20 to 24, 19 to 22, 20 to 22, 16 to 20, or 17 or 20 linked nucleosides. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of the nucleobase sequences recited in SEQ ID NOs: 1-10. In certain embodiments, at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage, at least one nucleoside of the modified oligonucleotide comprises a modified sugar and/or at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage, the modified sugar is a bicyclic sugar or a 2′-O-methoxyethyl, and the modified nucleobase is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide has a gap segment consisting of linked 2′-deoxynucleosides; a 5′ wing segment consisting of linked nucleosides; and a 3′ wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
[0336] In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940, wherein the modified oligonucleotide has: [0337] a gap segment consisting of linked 2′-deoxynucleosides; [0338] a 5′ wing segment consisting of linked nucleosides; and [0339] a 3′ wing segment consisting of linked nucleosides;
[0340] wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
[0341] In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 810, 1404, 2868, 2864, 2865, 1404, 1101, 2812, 1200, or 2863, wherein the modified oligonucleotide has: [0342] a gap segment consisting of linked 2′-deoxynucleosides; [0343] a 5′ wing segment consisting of linked nucleosides; and [0344] a 3′ wing segment consisting of linked nucleosides;
[0345] wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
[0346] In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 810 and 1404, wherein the modified oligonucleotide has:
[0347] a gap segment consisting of ten linked 2′-deoxynucleosides;
[0348] a 5′ wing segment consisting of three linked nucleosides; and
[0349] a 3′ wing segment consisting of three linked nucleosides;
[0350] wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
[0351] In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the sequence recited in SEQ ID NO: 2864, wherein the modified oligonucleotide has:
[0352] a gap segment consisting of ten linked 2′-deoxynucleosides;
[0353] a 5′ wing segment consisting of one linked nucleoside; and
[0354] a 3′ wing segment consisting of five linked nucleosides;
[0355] wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
[0356] In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NOs: 1200 or 2863, wherein the modified oligonucleotide has:
[0357] a gap segment consisting of nine linked 2′-deoxynucleosides;
[0358] a 5′ wing segment consisting of two linked nucleosides; and
[0359] a 3′ wing segment consisting of five linked nucleosides;
[0360] wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
[0361] In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in SEQ ID NO: 2865, wherein the modified oligonucleotide has:
[0362] a gap segment consisting of ten linked 2′-deoxynucleosides;
[0363] a 5′ wing segment consisting of one linked nucleoside; and
[0364] a 3′ wing segment consisting of five linked nucleosides;
[0365] wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment comprises a cEt nucleoside; wherein the 3′ wing segment comprises a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, a cEt nucleoside, a 2′-O-methoxyethyl nucleoside, and a cEt nucleoside in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
[0366] In any of the foregoing methods or uses, the compound can be a modified oligonucleotide, wherein the anion form of the modified oligonucleotide has the following chemical structure:
##STR00006##
or a salt thereof.
[0367] In any of the foregoing methods or uses, the compound can be a modified oligonucleotide according to the following chemical structure:
##STR00007##
or a salt thereof.
[0368] In any of the foregoing methods or uses, the compound can be a modified oligonucleotide according to the following chemical structure:
##STR00008##
[0369] In any of the foregoing methods or uses, the compound can be administered parenterally. For example, in certain embodiments the compound can be administered through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.
Certain Combinations and Combination Therapies
[0370] In certain embodiments, a first agent comprising a compound described herein is co-administered with one or more secondary agents. In certain embodiments, such second agents are designed to treat the same disease, disorder, or condition as the first agent described herein. In certain embodiments, such second agents are designed to treat a different disease, disorder, or condition as the first agent described herein. In certain embodiments, a first agent is designed to treat an undesired side effect of a second agent. In certain embodiments, second agents are co-administered with the first agent to treat an undesired effect of the first agent. In certain embodiments, such second agents are designed to treat an undesired side effect of one or more pharmaceutical compositions as described herein. In certain embodiments, second agents are co-administered with the first agent to produce a combinational effect. In certain embodiments, second agents are co-administered with the first agent to produce a synergistic effect. In certain embodiments, the co-administration of the first and second agents permits use of lower dosages than would be required to achieve a therapeutic or prophylactic effect if the agents were administered as independent therapy.
[0371] In certain embodiments, one or more compounds or compositions provided herein, such as ION 1198440, are co-administered with one or more secondary agents. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are administered at different times. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are prepared together in a single formulation. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are prepared separately. In certain embodiments, a secondary agent is selected from: CDK4/6 inhibitors including but not limited to palbociclib, ribociclib, or abemaciclib; EGFR inhibitors including but not limited to cetuximab, necitumumab, panitumumab, vandetanib, dacomitinib, neratinib, osimertinib, gefitinib, lapatinib, or erlotinib; or kinase inhibitors including but not limited to sorafenib, regorafenib, or carbozantinib.
[0372] Certain embodiments are directed to the use of a compound targeted to YAP1 as described herein, such as ION 1198440, in combination with a secondary agent. In particular embodiments such use is in a method of treating a patient suffering from cancer including, but not limited to, hepatocellular carcinoma (HCC), head and neck squamous cell carcinoma (HNSCC), head and neck cancer, pharynx carcinoma, laryngeal squamous cell carcinoma, oral tongue squamous cell carcinoma (OTSCC), squamous cell carcinoma (SCC), sarcomas (e.g. epitheloid, rhabdoid and synovial), esophageal cancer, gastric cancer, ovarian cancer, pancreatic cancer, tumors with mutations in SWI/SNF complex, lung cancer, non-small cell lung carcinoma (NSCLC), small-cell lung carcinoma (SCLC), gastrointestinal cancer, large intestinal cancer, small intestinal cancer, stomach cancer, colon cancer, colorectal cancer, bladder cancer, liver cancer, biliary tract cancer, urothelial cancer, breast cancer, triple-negative breast cancer (TNBC), endometrial cancer, cervical cancer, prostate cancer, mesothelioma, chordoma, renal cancer, renal cell carcinoma (RCC), brain cancer, neuroblastoma, glioblastoma, skin cancer, melanoma, basal cell carcinoma, merkel cell carcinoma, blood cancer, hematopoetic cancer, myeloma, multiple myeloma (MM), B cell malignancies, lymphoma, B cell lymphoma, Hodgkin lymphoma, T cell lymphoma, leukemia, or acute lymphocytic leukemia (ALL). In certain embodiments, the cancer has a mutant FAT1 gene. In certain embodiments, the cancer has a homozygous or heterozygous FAT1 gene mutation. In certain embodiments, the cancer having a mutant FAT1 gene, a homozygous FAT1 gene mutation, or a heterozygous FAT gene mutation is squamous cell carcinoma (SCC), head and neck squamous cell carcinoma (HNSCC), oral tongue squamous cell carcinoma (OTSCC), pharynx carcinoma, or laryngeal squamous cell carcinoma. In certain embodiments, a secondary agent is selected from: CDK4/6 inhibitors including but not limited to palbociclib, ribociclib, or abemaciclib; EGFR inhibitors including but not limited to cetuximab, necitumumab, panitumumab, vandetanib, dacomitinib, neratinib, osimertinib, gefitinib, lapatinib, or erlotinib; or kinase inhibitors including but not limited to sorafenib, regorafenib, or carbozantinib.
[0373] Certain embodiments are drawn to a combination of a compound targeted to YAP1 as described herein, such as ION 1198440, and a secondary agent, such as CDK4/6 inhibitors including but not limited to palbociclib, ribociclib, or abemaciclib; EGFR inhibitors including but not limited to cetuximab, necitumumab, panitumumab, vandetanib, dacomitinib, neratinib, osimertinib, gefitinib, lapatinib, or erlotinib; or kinase inhibitors including but not limited to sorafenib, regorafenib, or carbozantinib.
[0374] In certain embodiments the compound targeted to YAP1 as described herein, such as ION 1198440, and the secondary agent are used in combination treatment by administering the two agents simultaneously, separately or sequentially. In certain embodiments the two agents are formulated as a fixed dose combination product. In other embodiments the two agents are provided to the patient as separate units which can then either be taken simultaneously or serially (sequentially).
[0375] In certain embodiments, a compound targeted to YAP1 as described herein, such as ION 1198440, is used in combination with an immunomodulatory agent such as an anti-PD-L1 antibody (or an antigen-binding fragment thereof), an anti-PD-1 antibody (or an antigen-binding fragment thereof), an anti-CTLA-4 antibody (or an antigen-binding fragment thereof) or an OX40 agonist ((e.g., an OX40 ligand fusion protein, or an OX40 agonist antibody or antigen-binding fragment thereof).
[0376] In certain embodiments, a compound targeted to YAP1 as described herein, such as ION 1198440, is used in combination with an immune checkpoint inhibitor such as an anti-PD-L1 antibody (or an antigen-binding fragment thereof), an anti-PD-1 antibody (or an antigen-binding fragment thereof), or an anti-CTLA-4 antibody (or an antigen-binding fragment thereof).
[0377] Anti-PD-L1 antibodies are known in the art. Exemplary anti-PD-L1 antibodies include: MEDI4736 (durvalumab), MPDL3280A, BMS936559, 2.7A4, AMP-714, MDX-1105 and MPDL3280A (atezolizumab).
[0378] Anti-PD-1 antibodies are known in the art. Exemplary anti-PD-1 antibodies include: nivolumab, pembrolizumab, pidilizumab, and AMP-514
[0379] Anti-CTLA-4 antibodies are known in the art. Exemplary anti-CTLA-4 antibodies include: tremelimumab and ipilimumab, also termed MDX-010 (or BMS-734016).
[0380] OX40 agonists and antibodies are known in the art. Exemplary OX40 agonists and/or antibodies include: MEDI6383, 9B12 and MEDI0562.
[0381] In one embodiment, the combination includes the antisense oligonucleotide Ionis 1198440 or a salt thereof, and at least one immunomodulator selected from the group consisting of: MEDI4736, MPDL3280A, BMS936559, 2.7A4, AMP-714, MDX-1105, nivolumab, pembrolizumab, pidilizumab, MPDL3280A, tremelimumab, ipilimumab, MEDI0562 and MEDI0562.
[0382] In one embodiment, the combination includes the anti-PD-L1 antibody MEDI4736 (duvalumab) and ION 1198440.
[0383] In one embodiment, the combination includes ION 1198440, the anti-PD-L1 antibody MEDI4736 (durvalumab) and the anti-CTLA-4 antibody tremelimumab.
Certain Anti-PD-L1 Antibodies
[0384] Antibodies that specifically bind and inhibit PD-L1 are included in the present disclosure.
[0385] Durvalumab (MEDI4736) is an exemplary anti-PD-L1 antibody that is selective for a PD-L1 polypeptide and blocks the binding of PD-L1 to the PD-1 and CD80 receptors. Durvalumab can relieve PD-L1-mediated suppression of human T-cell activation in vitro and inhibits tumor growth in a xenograft model via a T-cell dependent mechanism.
[0386] Information regarding durvalumab (or fragments thereof) for use in the methods provided herein can be found in U.S. Pat. No. 8,779,108, the disclosure of which is incorporated herein by reference in its entirety. The fragment crystallizable (Fc) domain of durvalumab contains a triple mutation in the constant domain of the IgG1 heavy chain that reduces binding to the complement component C1q and the Fcy receptors responsible for mediating antibody-dependent cell-mediated cytotoxicity (ADCC).
[0387] Durvalumab and antigen-binding fragments thereof for use in the methods provided herein comprises a heavy chain and a light chain or a heavy chain variable region and a light chain variable region. In certain embodiments, MEDI4736 or an antigen-binding fragment thereof for use in the methods provided herein comprises the variable heavy chain and variable light chain CDR sequences of the 2.14H9OPT antibody as disclosed in U.S. Pat. Nos. 8,779,108 and 9,493,565, which is herein incorporated by reference in its entirety.
[0388] There are numerous anti-PD-L1 antibodies in the published literature that could feature in the present disclosure, including compounds in development and/or in clinical trials such as: durvalumab (MEDI4736), MPDL3280A, BMS936559, 2.7A4, AMP-714 and MDX-1105. Patent specifications disclosing anti-PD-L1 antibodies that may be useful in the present disclosure include: U.S. Pat. Nos. 7,943,743; 8,383,796; 9,102,725; 9,273,135 (BMS/Medarex), US2006/0153841 (Dana Farber), US2011/0271358 (Dana Farber), U.S. Pat. Nos. 8,552,154 and 9,102,727 (Dana Farber), U.S. Pat. No. 8,217,149 (Genentech), including issued U.S. Pat. No. 8,217,149, US2012/0039906 (INSERM), US2016/0031990 (Amplimmune), U.S. Pat. No. 8,779,108 (Medlmmune—for durvalumab/MEDI4726 and 2.7A4), US2014/0044738 (Amplimmune—for AMP-714) and US2010/0285039 (John's Hopkins University). Each of these disclosures is herein incorporated by reference in its entirety.
Certain Anti-CTLA-4 Antibodies
[0389] Antibodies that specifically bind CTLA-4 and inhibit CTLA-4 activity are useful for enhancing an anti-tumor immune response. Information regarding tremelimumab (or antigen-binding fragments thereof) for use in the methods provided herein can be found in U.S. Pat. No. 6,682,736 (where it is referred to as 11.2.1), the disclosure of which is incorporated herein by reference in its entirety. Tremelimumab (also known as CP-675,206, CP-675, CP-675206, and ticilimumab) is a human IgG2 monoclonal antibody that is highly selective for CTLA-4 and blocks binding of CTLA-4 to CD80 (B7.1) and CD86 (B7.2). It has been shown to result in immune activation in vitro and some patients treated with tremelimumab have shown tumor regression.
[0390] Tremelimumab for use in the methods provided herein comprises a heavy chain and a light chain or a heavy chain variable region and a light chain variable region. In a specific aspect, tremelimumab or an antigen-binding fragment thereof for use in the methods provided herein comprises a light chain variable region comprising the amino acid sequences shown herein above and a heavy chain variable region comprising the amino acid sequence shown herein above. In a specific aspect, tremelimumab or an antigen-binding fragment thereof for use in the methods provided herein comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises the Kabat-defined CDR1, CDR2, and CDR3 sequences shown herein above, and wherein the light chain variable region comprises the Kabat-defined CDR1, CDR2, and CDR3 sequences shown herein above. Those of ordinary skill in the art would easily be able to identify Chothia-defined, Abm-defined or other CDR definitions known to those of ordinary skill in the art. In a specific aspect, tremelimumab or an antigen-binding fragment thereof for use in the methods provided herein comprises the variable heavy chain and variable light chain CDR sequences of the 11.2.1 antibody as disclosed in U.S. Pat. No. 6,682,736, which is herein incorporated by reference in its entirety.
[0391] Other anti-CTLA-4 antibodies are described, for example, in US 20070243184. In one embodiment, the anti-CTLA-4 antibody is Ipilimumab, also termed MDX-010; BMS-734016.
Certain OX40 Agonists
[0392] OX40 agonists interact with the OX40 receptor on CD4+ T-cells during, or shortly after, priming by an antigen resulting in an increased response of the CD4+ T-cells to the antigen. An OX40 agonist interacting with the OX40 receptor on antigen specific CD4+ T-cells can increase T cell proliferation as compared to the response to antigen alone. The elevated response to the antigen can be maintained for a period of time substantially longer than in the absence of an OX40 agonist. Thus, stimulation via an OX40 agonist enhances the antigen specific immune response by boosting T-cell recognition of antigens, e.g., tumor cells. OX40 agonists are described, for example, in U.S. Pat. Nos. 6,312,700, 7,504,101, 7,622,444, and 7,959,925, which are incorporated herein by reference in their entireties. Methods of using such agonists in cancer treatment are described, for example, in US2015/0098942 and in US2015/0157710, each of which are incorporated herein by reference in its entirety.
[0393] OX40 agonists include, but are not limited to OX40 binding molecules, e.g., binding polypeptides, e.g., OX40 ligand (“OX40L”) or an OX40-binding fragment, variant, or derivative thereof, such as soluble extracellular ligand domains and OX40L fusion proteins, and anti-OX40 antibodies (for example, monoclonal antibodies such as humanized monoclonal antibodies), or an antigen-binding fragment, variant or derivative thereof. Examples of anti-OX40 monoclonal antibodies are described, for example, in U.S. Pat. Nos. 5,821,332 and 6,156,878, the disclosures of which are incorporated herein by reference in their entireties. In certain embodiments, the anti-OX40 monoclonal antibody is 9B12, or an antigen-binding fragment, variant, or derivative thereof, as described in Weinberg, A. D., et al. J Immunother 29, 575-585 (2006), which is incorporated herein by reference in its entirety. In another embodiment, an OX40 antibody is MEDI0562 as described in US 2016/0137740.
[0394] In certain embodiments, the antibody which specifically binds to OX40, or an antigen-binding fragment thereof binds to the same OX40 epitope as mAb 9B12. An example of a humanized OX40 antibody is described by Morris et al., Mol Immunol. May 2007; 44(12): 3112-3121. 9B12 is a murine IgG1, anti-OX40 mAb directed against the extracellular domain of human OX40 (CD134) (Weinberg, A. D., et al. J Immunother 29, 575-585 (2006)). It was selected from a panel of anti-OX40 monoclonal antibodies because of its ability to elicit an agonist response for OX40 signaling, stability, and for its high level of production by the hybridoma. For use in clinical applications, 9B12 mAb is equilibrated with phosphate buffered saline, pH 7.0, and its concentration is adjusted to 5.0 mg/ml by diafiltration.
[0395] “OX40 ligand” (“OX40L”) (also variously termed tumor necrosis factor ligand superfamily member 4, gp34, TAX transcriptionally-activated glycoprotein-1, and CD252) is found largely on antigen presenting cells
[0396] (APCs), and can be induced on activated B cells, dendritic cells (DCs), Langerhans cells, plamacytoid DCs, and macrophages (Croft, M., (2010) Ann Rev Immunol 28:57-78). Other cells, including activated T cells, NK cells, mast cells, endothelial cells, and smooth muscle cells can express OX4OL in response to inflammatory cytokines (Id.). OX4OL specifically binds to the OX40 receptor. The human protein is described in U.S. Pat. No. 6,156,878. The mouse OX40L is described in U.S. Pat. No. 5,457,035. OX40L is expressed on the surface of cells and includes an intracellular, a transmembrane and an extracellular receptor-binding domain. A functionally active soluble form of OX40L can be produced by deleting the intracellular and transmembrane domains as described, e.g., in U.S. Pat. Nos. 5,457,035; 6,312,700; 6,156,878; 6,242,566; 6,528,055; 6,528,623; 7,098,184; and 7,125,670, the disclosures of which are incorporated herein for all purposes. A functionally active form of OX40L is a form that retains the capacity to bind specifically to OX40, that is, that possesses an OX40 “receptor binding domain.” An example is amino acids 51 to 183 of human OX40L. Methods of determining the ability of an OX40L molecule or derivative to bind specifically to OX40 are discussed below. Methods of making and using OX40L and its derivatives (such as derivatives that include an OX40 binding domain) are described in U.S. Pat. Nos. 6,156,878; 6,242,566; 6,528,055; 6,528,623; 7,098,184; and 7,125,670, which also describe proteins comprising the soluble form of OX40L linked to other peptides, such as human immunoglobulin (“Ig”) Fc regions, that can be produced to facilitate purification of OX40 ligand from cultured cells, or to enhance the stability of the molecule after in vivo administration to a mammal (see also, U.S. Pat. Nos. 5,457,035 and 7,959,925, both of which are incorporated by reference herein in their entireties).
[0397] Also included within the definition of OX40L are OX40 ligand variants which vary in amino acid sequence from naturally occurring OX40 ligand molecules but which retain the ability to specifically bind to an OX40 receptor. Such variants are described in U.S. Pat. Nos. 5,457,035; 6,156,878; 6,242,566; 6,528,055; 6,528,623; 7,098,184; and 7,125,670. In a related embodiment, a mutant of OX40L which has lost the ability to specifically bind to OX40, for example amino acids 51 to 183, in which the phenylalanine at position 180 of the receptor-binding domain of human OX40L has been replaced with alanine (F180A) is used.
[0398] OX40 agonists include a fusion protein in which one or more domains of OX40L is covalently linked to one or more additional protein domains. Exemplary OX40L fusion proteins that can be used as OX40 agonists are described in U.S. Pat. No. 6,312,700, the disclosure of which is incorporated herein by reference in its entirety. In one embodiment, an OX40 agonist includes an OX40L fusion polypeptide that self-assembles into a multimeric (e.g., trimeric or hexameric) OX40L fusion protein. Such fusion proteins are described, e.g., in U.S. Pat. No. 7,959,925, which is incorporated by reference herein in its entirety. The multimeric OX40L fusion protein exhibits increased efficacy in enhancing antigen specific immune response in a subject, particularly a human subject, due to its ability to spontaneously assemble into highly stable trimers and hexamers.
[0399] In another embodiment, an OX40 agonist capable of assembling into a multimeric form includes a fusion polypeptide comprising in an N-terminal to C-terminal direction: an immunoglobulin domain, wherein the immunoglobulin domain includes an Fc domain, a trimerization domain, wherein the trimerization domain includes a coiled coil trimerization domain, and a receptor binding domain, wherein the receptor binding domain is an OX40 receptor binding domain, e.g., an OX40L or an OX40-binding fragment, variant, or derivative thereof, where the fusion polypeptide can self-assemble into a trimeric fusion protein. In one aspect, an OX40 agonist capable of assembling into a multimeric form is capable of binding to the OX40 receptor and stimulating at least one OX40 mediated activity. In certain aspects, the OX40 agonist includes an extracellular domain of OX40 ligand.
[0400] The trimerization domain of an OX40 agonist capable of assembling into a multimeric form serves to promote self-assembly of individual OX40L fusion polypeptide molecules into a trimeric protein. Thus, an OX40L fusion polypeptide with a trimerization domain self-assembles into a trimeric OX40L fusion protein. In one aspect, the trimerization domain is an isoleucine zipper domain or other coiled coli polypeptide structure. Exemplary coiled coil trimerization domains include: TRAF2 (GENBANK® Accession No. Q12933, amino acids 299-348; Thrombospondin 1 (Accession No. PO7996, amino acids 291-314; Matrilin-4 (Accession No. O95460, amino acids 594-618; CMP (matrilin-1) (Accession No. NP-002370, amino acids 463-496; HSF1 (Accession No. AAX42211, amino acids 165-191; and Cubilin (Accession No. NP-001072, amino acids 104-138. In certain specific aspects, the trimerization domain includes a TRAF2 trimerization domain, a Matrilin-4 trimerization domain, or a combination thereof.
[0401] OX40L FP is a human OX40 ligand IgG4P fusion protein that specifically binds to, and triggers signaling by, the human OX40 receptor, a member of the TNFR superfamily. OX40L FP is also disclosed in US2016/0024176, incorporated herein by reference in its entirety. OX40L FP is composed of three distinct domains: (1) human OX40 ligand extracellular receptor binding domains (RBDs) that form homotrimers and bind the OX40 receptor; (2) isoleucine zipper trimerization domains derived from TNFR-associated factor 2 that stabilize the homotrimeric structure of the OX40 ligand RBDs; and (3) human IgG4 fragment crystallizable gamma (Fcγ) domains that facilitate Fcy receptor clustering of the fusion protein when bound to OX40 receptors, and contain a serine to proline substitution at position 228 (according to EU numbering) in the hinge regions (IgG4P) to promote stability of two sets of OX40 ligand RBD homotrimers. The IgG4P Fc domain is fused directly to an isoleucine zipper trimerization domain derived from amino acid residues 310-349 of human tumor necrosis factor 2 (TRAF2). Fused to the c-terminus of the TRAF2 domain are amino acid residues 51-183 of the extracellular receptor binding domain (RBD) of human OX40L (gene name TNFSF4). The TRAF2 domain stabilizes the homotrimeric structure of OX40L RBDs to enable OX40 binding and activation, while the IgG4P Fc domain confers serum stability, dimerization of OX40L trimers, and facilitates Fcy receptor clustering of the hexameric fusion protein. One OX40L FP variant possesses a phenylalanine (F) to alanine (A) mutation at the amino acid corresponding to position 180 in OX40L. Another OX40L FP variant has the IgG4P Fc domain replaced with a human IgG1 Fc domain. In particular embodiments, the OX40 agonist for use in the present disclosure is one of the OX40L FP variants.
[0402] In particular embodiments, the OX40 agonist for use in the present disclosure has been modified to increase its serum half-life. For example, the serum half-life of an OX40 agonist can be increased by conjugation to a heterologous molecule such as serum albumin, an antibody Fc region, or PEG. In certain embodiments, OX40 agonists can be conjugated to other therapeutic agents or toxins to form immunoconjugates and/or fusion proteins. In certain embodiments, the OX40 agonist can be formulated so as to facilitate administration and promote stability of the active agent.
Antibody Derivatives
[0403] Antibodies for use in the present disclosure (e.g., anti-CTLA-4, anti-PD-L1, anti-PD-1, anti-OX40) may include variants of these sequences that retain the ability to specifically bind their targets. Such variants may be derived from the sequence of these antibodies by a skilled artisan using techniques well known in the art. For example, amino acid substitutions, deletions, or additions, can be made in the FRs and/or in the CDRs. While changes in the FRs are usually designed to improve stability and immunogenicity of the antibody, changes in the CDRs are typically designed to increase affinity of the antibody for its target. Variants of FRs also include naturally occurring immunoglobulin allotypes. Such affinity-increasing changes may be determined empirically by routine techniques that involve altering the CDR and testing the affinity antibody for its target. For example, conservative amino acid substitutions can be made within any one of the disclosed CDRs. Various alterations can be made according to the methods described in Antibody Engineering, 2nd ed., Oxford University Press, ed. Borrebaeck, 1995. These include but are not limited to nucleotide sequences that are altered by the substitution of different codons that encode a functionally equivalent amino acid residue within the sequence, thus producing a “silent” change. For example, the nonpolar amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine. The polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. The positively charged (basic) amino acids include arginine, lysine, and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid.
[0404] Derivatives and analogs of antibodies of the present disclosure can be produced by various techniques well known in the art, including recombinant and synthetic methods (Maniatis (1990) Molecular Cloning, A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., and Bodansky et al. (1995) The Practice of Peptide Synthesis, 2nd ed., Spring Verlag, Berlin, Germany). Analogous shuffling or combinatorial techniques are also disclosed by Stemmer (Nature (1994) 370: 389-391), who describes the technique in relation to a β-lactamase gene but observes that the approach may be used for the generation of antibodies.
[0405] One may generate novel VH or VL regions carrying one or more sequences derived from the sequences disclosed herein using random mutagenesis of one or more selected VH and/or VL genes. One such technique, error-prone PCR, is described by Gram et al. (Proc. Nat. Acad. Sci. U.S.A. (1992) 89: 3576-3580).
[0406] Another method that may be used is to direct mutagenesis to CDRs of VH or VL genes. Such techniques are disclosed by Barbas et al. (Proc. Nat. Acad. Sci. U.S.A. (1994) 91: 3809-3813) and Schier et al. (J. Mol. Biol. (1996) 263: 551-567).
[0407] Similarly, one or more, or all three CDRs may be grafted into a repertoire of VH or VL domains, which are then screened for an antigen-binding fragment specific for CTLA-4 or PD-L1.
[0408] A portion of an immunoglobulin variable domain will comprise at least one of the CDRs substantially as set out herein and, optionally, intervening framework regions from the scFv fragments as set out herein. The portion may include at least about 50% of either or both of FR1 and FR4, the 50% being the C-terminal 50% of FR1 and the N-terminal 50% of FR4. Additional residues at the N-terminal or C-terminal end of the substantial part of the variable domain may be those not normally associated with naturally occurring variable domain regions. For example, construction of antibodies by recombinant DNA techniques may result in the introduction of N- or C-terminal residues encoded by linkers introduced to facilitate cloning or other manipulation steps. Other manipulation steps include the introduction of linkers to join variable domains to further protein sequences including immunoglobulin heavy chain constant regions, other variable domains (for example, in the production of diabodies), or proteinaceous labels as discussed in further detail below.
[0409] A skilled artisan will recognize that antibodies for use in the present disclosure may comprise antigen-binding fragments containing only a single CDR from either VL or VH domain. Either one of the single chain specific binding domains can be used to screen for complementary domains capable of forming a two-domain specific antigen-binding fragment capable of, for example, binding to CTLA-4 and PD-L1.
[0410] Antibodies for use in the present disclosure described herein can be linked to another functional molecule, e.g., another peptide or protein (albumin, another antibody, etc.). For example, the antibodies can be linked by chemical cross-linking or by recombinant methods. The antibodies may also be linked to one of a variety of nonproteinaceous polymers, e.g., polyethylene glycol, polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S. Pat. Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192; or 4,179,337. The antibodies can be chemically modified by covalent conjugation to a polymer, for example, to increase their circulating half-life. Exemplary polymers and methods to attach them are also shown in U.S. Pat. Nos. 4,766,106; 4,179,337; 4,495,285, and 4,609,546.
[0411] The antibodies may also be altered to have a glycosylation pattern that differs from the native pattern. For example, one or more carbohydrate moieties can be deleted and/or one or more glycosylation sites added to the original antibody. Addition of glycosylation sites to the presently disclosed antibodies may be accomplished by altering the amino acid sequence to contain glycosylation site consensus sequences known in the art. Another means of increasing the number of carbohydrate moieties on the antibodies is by chemical or enzymatic coupling of glycosides to the amino acid residues of the antibody. Such methods are described in WO 87/05330, and in Aplin et al. (1981) CRC Crit. Rev. Biochem., 22: 259-306. Removal of any carbohydrate moieties from the antibodies may be accomplished chemically or enzymatically, for example, as described by Hakimuddin et al. (1987) Arch. Biochem. Biophys., 259: 52; and Edge et al. (1981) Anal. Biochem., 118: 131 and by Thotakura et al. (1987) Meth. Enzymol., 138: 350. The antibodies may also be tagged with a detectable, or functional, label. Detectable labels include radiolabels such as 131I or 99Tc, which may also be attached to antibodies using conventional chemistry. Detectable labels also include enzyme labels such as horseradish peroxidase or alkaline phosphatase. Detectable labels further include chemical moieties such as biotin, which may be detected via binding to a specific cognate detectable moiety, e.g., labeled avidin.
[0412] Antibodies, in which CDR sequences differ only insubstantially from those set forth herein are encompassed within the scope of this present disclosure. Typically, an amino acid is substituted by a related amino acid having similar charge, hydrophobic, or stereochemical characteristics. Such substitutions would be within the ordinary skills of an artisan. Unlike in CDRs, more substantial changes can be made in FRs without adversely affecting the binding properties of an antibody. Changes to FRs include, but are not limited to, humanizing a non-human derived or engineering certain framework residues that are important for antigen contact or for stabilizing the binding site, e.g., changing the class or subclass of the constant region, changing specific amino acid residues which might alter the effector function such as Fc receptor binding, e.g., as described in U.S. Pat. Nos. 5,624,821 and 5,648,260 and Lund et al. (1991) J. Immun. 147: 2657-2662 and Morgan et al. (1995) Immunology 86: 319-324, or changing the species from which the constant region is derived.
[0413] One of skill in the art will appreciate that the modifications described above are not all-exhaustive, and that many other modifications would be obvious to a skilled artisan in light of the teachings of the present disclosure.
Certain Compounds
[0414] In certain embodiments, compounds described herein can be antisense compounds. In certain embodiments, the antisense compound comprises or consists of an oligomeric compound. In certain embodiments, the oligomeric compound comprises a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.
[0415] In certain embodiments, a compound described herein comprises or consists of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.
[0416] In certain embodiments, a compound or antisense compound is single-stranded. Such a single-stranded compound or antisense compound comprises or consists of an oligomeric compound. In certain embodiments, such an oligomeric compound comprises or consists of an oligonucleotide and optionally a conjugate group. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of a single-stranded antisense compound or oligomeric compound comprises a self-complementary nucleobase sequence.
[0417] In certain embodiments, compounds are double-stranded. Such double-stranded compounds comprise a first modified oligonucleotide having a region complementary to a target nucleic acid and a second modified oligonucleotide having a region complementary to the first modified oligonucleotide. In certain embodiments, the modified oligonucleotide is an RNA oligonucleotide. In such embodiments, the thymine nucleobase in the modified oligonucleotide is replaced by a uracil nucleobase. In certain embodiments, compound comprises a conjugate group. In certain embodiments, one of the modified oligonucleotides is conjugated. In certain embodiments, both the modified oligonucleotides are conjugated. In certain embodiments, the first modified oligonucleotide is conjugated. In certain embodiments, the second modified oligonucleotide is conjugated. In certain embodiments, the first modified oligonucleotide consists of 12-30 linked nucleosides and the second modified oligonucleotide consists of 12-30 linked nucleosides. In certain embodiments, one of the modified oligonucleotides has a nucleobase sequence comprising at least 8 contiguous nucleobases of any of SEQ ID NOs: 23-2940.
[0418] In certain embodiments, antisense compounds are double-stranded. Such double-stranded antisense compounds comprise a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound. The first oligomeric compound of such double stranded antisense compounds typically comprises or consists of a modified oligonucleotide and optionally a conjugate group. The oligonucleotide of the second oligomeric compound of such double-stranded antisense compound may be modified or unmodified. Either or both oligomeric compounds of a double-stranded antisense compound may comprise a conjugate group. The oligomeric compounds of double-stranded antisense compounds may include non-complementary overhanging nucleosides.
[0419] Examples of single-stranded and double-stranded compounds include but are not limited to oligonucleotides, siRNAs, microRNA targeting oligonucleotides, and single-stranded RNAi compounds, such as small hairpin RNAs (shRNAs), single-stranded siRNAs (ssRNAs), and microRNA mimics.
[0420] In certain embodiments, a compound described herein has a nucleobase sequence that, when written in the 5′ to 3′ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
[0421] In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 10 to 30 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 12 to 30 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 12 to 22 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 14 to 30 linked subunits. In certain embodiments, compound described herein comprises an oligonucleotide consisting of 14 to 20 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 15 to 30 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 15 to 20 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 16 to 30 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 16 to 20 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 17 to 30 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 17 to 20 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 18 to 30 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 18 to 21 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 18 to 20 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 20 to 30 linked subunits. In other words, such oligonucleotides consist of 12 to 30 linked subunits, 14 to 30 linked subunits, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits, 16 to 30 subunits, 16 to 20 subunits, 17 to 30 subunits, 17 to 20 subunits, 18 to 30 subunits, 18 to 20 subunits, 18 to 21 subunits, 20 to 30 subunits, or 12 to 22 linked subunits, respectively. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 14 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 16 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 17 linked subunits. In certain embodiments, compound described herein comprises an oligonucleotide consisting of 18 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 19 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 20 linked subunits. In other embodiments, a compound described herein comprises an oligonucleotide consisting of 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked subunits. In certain such embodiments, the compound described herein comprises an oligonucleotide consisting of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits, or a range defined by any two of the above values. In some embodiments the linked subunits are nucleotides, nucleosides, or nucleobases.
[0422] In certain embodiments, the compound may further comprise additional features or elements, such as a conjugate group, that are attached to the oligonucleotide. In certain embodiments, such compounds are antisense compounds. In certain embodiments, such compounds are oligomeric compounds. In embodiments where a conjugate group comprises a nucleoside (i.e. a nucleoside that links the conjugate group to the oligonucleotide), the nucleoside of the conjugate group is not counted in the length of the oligonucleotide.
[0423] In certain embodiments, compounds may be shortened or truncated. For example, a single subunit may be deleted from the 5′ end (5′ truncation), or alternatively from the 3′ end (3′ truncation). A shortened or truncated compound targeted to an YAP1 nucleic acid may have two subunits deleted from the 5′ end, or alternatively may have two subunits deleted from the 3′ end, of the compound. Alternatively, the deleted nucleosides may be dispersed throughout the compound.
[0424] When a single additional subunit is present in a lengthened compound, the additional subunit may be located at the 5′ or 3′ end of the compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in a compound having two subunits added to the 5′ end (5′ addition), or alternatively to the 3′ end (3′ addition), of the compound. Alternatively, the added subunits may be dispersed throughout the compound.
[0425] It is possible to increase or decrease the length of a compound, such as an oligonucleotide, and/or introduce mismatch bases without eliminating activity (Woolf et al. Proc. Natl. Acad. Sci. USA 1992, 89:7305-7309; Gautschi et al. J. Natl. Cancer Inst. March 2001, 93:463-471; Maher and Dolnick Nuc. Acid. Res. 1998, 16:3341-3358). However, seemingly small changes in oligonucleotide sequence, chemistry and motif can make large differences in one or more of the many properties required for clinical development (Seth et al. J. Med. Chem. 2009, 52, 10; Egli et al. J. Am. Chem. Soc. 2011, 133, 16642).
[0426] In certain embodiments, compounds described herein are interfering RNA compounds (RNAi), which include double-stranded RNA compounds (also referred to as short-interfering RNA or siRNA) and single-stranded RNAi compounds (or ssRNA). Such compounds work at least in part through the RISC pathway to degrade and/or sequester a target nucleic acid (thus, include microRNA/microRNA-mimic compounds). As used herein, the term siRNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others. In addition, as used herein, the term “RNAi” is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics.
[0427] In certain embodiments, a compound described herein can comprise any of the oligonucleotide sequences targeted to YAP1 described herein. In certain embodiments, the compound can be double-stranded. In certain embodiments, the compound comprises a first strand comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobase portion of any one of SEQ ID NOs: 23-2940 and a second strand. In certain embodiments, the compound comprises a first strand comprising the nucleobase sequence of any one of SEQ ID NOs: 23-2940 and a second strand. In certain embodiments, the compound comprises ribonucleotides in which the first strand has uracil (U) in place of thymine (T) in any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises (i) a first strand comprising a nucleobase sequence complementary to the site on YAP1 to which any of SEQ ID NOs: 23-2940 is targeted, and (ii) a second strand. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2′ position in the sugar contains a halogen (such as fluorine group; 2′-F) or contains an alkoxy group (such as a methoxy group; 2′-OMe). In certain embodiments, the compound comprises at least one 2′-F sugar modification and at least one 2′-OMe sugar modification. In certain embodiments, the at least one 2′-F sugar modification and at least one 2′-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the dsRNA compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. The compounds may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661. In other embodiments, the compound contains one or two capped strands, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000.
[0428] In certain embodiments, the first strand of the compound is an siRNA guide strand and the second strand of the compound is an siRNA passenger strand. In certain embodiments, the second strand of the compound is complementary to the first strand. In certain embodiments, each strand of the compound consists of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides. In certain embodiments, the first or second strand of the compound can comprise a conjugate group.
[0429] In certain embodiments, a compound described herein can comprise any of the oligonucleotide sequences targeted to YAP1 described herein. In certain embodiments, the compound is single stranded. In certain embodiments, such a compound is a single-stranded RNAi (ssRNAi) compound. In certain embodiments, the compound comprises at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobase portion of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises the nucleobase sequence of any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises ribonucleotides in which uracil (U) is in place of thymine (T) in any one of SEQ ID NOs: 23-2940. In certain embodiments, the compound comprises a nucleobase sequence complementary to the site on YAP1 to which any of SEQ ID NOs: 23-2940 is targeted. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2′ position in the sugar contains a halogen (such as fluorine group; 2′-F) or contains an alkoxy group (such as a methoxy group; 2′-OMe). In certain embodiments, the compound comprises at least one 2′-F sugar modification and at least one 2′-OMe sugar modification. In certain embodiments, the at least one 2′-F sugar modification and at least one 2′-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. The compounds may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661. In other embodiments, the compound contains a capped strand, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000. In certain embodiments, the compound consists of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides. In certain embodiments, the compound can comprise a conjugate group.
[0430] In certain embodiments, compounds described herein comprise modified oligonucleotides. Certain modified oligonucleotides have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as α or β such as for sugar anomers, or as (D) or (L) such as for amino acids etc. Included in the modified oligonucleotides provided herein are all such possible isomers, including their racemic and optically pure forms, unless specified otherwise. Likewise, all cis- and trans-isomers and tautomeric forms are also included.
[0431] The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the .sup.1H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: .sup.2H or .sup.3H in place of .sup.1H, .sup.13C or .sup.14C in place of .sup.12C, .sup.15N in place of .sup.14N, .sup.17O or .sup.18O in place of .sup.16O, and .sup.33S, .sup.34S, .sup.35S, or .sup.36S in place of .sup.32S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes, such as an imaging assay.
Certain Mechanisms
[0432] In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein are antisense compounds. In certain embodiments, compounds comprise oligomeric compounds. In certain embodiments, compounds described herein are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity. In certain embodiments, compounds described herein selectively affect one or more target nucleic acid. Such compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in a significant undesired antisense activity.
[0433] In certain antisense activities, hybridization of a compound described herein to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain compounds described herein result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, compounds described herein are sufficiently “DNA-like” to elicit RNase H activity. Further, in certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.
[0434] In certain antisense activities, compounds described herein or a portion of the compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain compounds described herein result in cleavage of the target nucleic acid by Argonaute. Compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).
[0435] In certain embodiments, hybridization of compounds described herein to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain such embodiments, hybridization of the compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of the compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain such embodiments, hybridization of the compound to a target nucleic acid results in alteration of translation of the target nucleic acid.
[0436] Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and/or a phenotypic change in a cell or animal.
Target Nucleic Acids, Target Regions and Nucleotide Sequences
[0437] In certain embodiments, compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: an mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is an mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron.
[0438] Nucleotide sequences that encode YAP1 include, without limitation, the following: GENBANK or RefSEQ No. NM_001282101.1 (SEQ ID NO: 1); NC_000011.10 truncated from nucleotides 102107001 to 102236000 (SEQ ID NO: 2); NM_006106.4 (SEQ ID NO: 3); NM_001130145.2 (SEQ ID NO: 4); NM_001195044.1 (SEQ ID NO: 5); NM_001195045.1 (SEQ ID NO: 6); NM_001282097.1 (SEQ ID NO: 7); NM_001282098.1 (SEQ ID NO: 8); NM_001282099.1 (SEQ ID NO: 9); and NM_001282100.1 (SEQ ID NO: 10), each of which is incorporated by reference in its entirety.
Hybridization
[0439] In some embodiments, hybridization occurs between a compound disclosed herein and a YAP1 nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.
[0440] Hybridization can occur under varying conditions. Hybridization conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.
[0441] Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the compounds provided herein are specifically hybridizable with a YAP1 nucleic acid.
Complementarity
[0442] An oligonucleotide is said to be complementary to another nucleic acid when the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions. Nucleobase matches or complementary nucleobases, as described herein, are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methyl cytosine (mC) and guanine (G) unless otherwise specified. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. An oligonucleotide is fully complementary or 100% complementary when such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches.
[0443] In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein are antisense compounds. In certain embodiments, compounds comprise oligomeric compounds. Non-complementary nucleobases between a compound and a YAP1 nucleic acid may be tolerated provided that the compound remains able to specifically hybridize to a target nucleic acid. Moreover, a compound may hybridize over one or more segments of a YAP1 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).
[0444] In certain embodiments, the compounds provided herein, or a specified portion thereof, are, are at least, or are up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a YAP1 nucleic acid, a target region, target segment, or specified portion thereof. In certain embodiments, the compounds provided herein, or a specified portion thereof, are 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, 95% to 100%, or any number in between these ranges, complementary to a YAP1 nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of a compound with a target nucleic acid can be determined using routine methods.
[0445] For example, a compound in which 18 of 20 nucleobases of the compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, a compound which consists of 18 nucleobases having four non-complementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid. Percent complementarity of a compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).
[0446] In certain embodiments, compounds described herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof. For example, a compound may be fully complementary to a YAP1 nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, “fully complementary” means each nucleobase of a compound is complementary to the corresponding nucleobase of a target nucleic acid. For example, a 20 nucleobase compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the compound. Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase compound can be “fully complementary” to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase compound is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the compound. At the same time, the entire 30 nucleobase compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the compound are also complementary to the target sequence.
[0447] In certain embodiments, compounds described herein comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain such embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain such embodiments selectivity of the compound is improved. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5′-end of the gap region. In certain such embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3′-end of the gap region. In certain such embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5′-end of the wing region. In certain such embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3′-end of the wing region. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide not having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5′-end of the oligonucleotide. In certain such embodiments, the mismatch is at position , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3′-end of the oligonucleotide.
[0448] The location of a non-complementary nucleobase may be at the 5′ end or 3′ end of the compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e. linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer oligonucleotide.
[0449] In certain embodiments, compounds described herein that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a YAP1 nucleic acid, or specified portion thereof.
[0450] In certain embodiments, compounds described herein that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a YAP1 nucleic acid, or specified portion thereof.
[0451] In certain embodiments, compounds described herein also include those which are complementary to a portion of a target nucleic acid. As used herein, “portion” refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A “portion” can also refer to a defined number of contiguous nucleobases of a compound. In certain embodiments, the-compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 9 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 15 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 16 nucleobase portion of a target segment. Also contemplated are compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.
Identity
[0452] The compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific ION number, or portion thereof In certain embodiments, compounds described herein are antisense compounds or oligomeric compounds. In certain embodiments, compounds described herein are modified oligonucleotides. As used herein, a compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the compounds described herein as well as compounds having non-identical bases relative to the compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the compound. Percent identity of an compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.
[0453] In certain embodiments, compounds described herein, or portions thereof, are, or are at least, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the compounds or SEQ ID NOs, or a portion thereof, disclosed herein. In certain embodiments, compounds described herein are about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical, or any percentage between such values, to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific ION number, or portion thereof, in which the compounds comprise an oligonucleotide having one or more mismatched nucleobases. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5′-end of the oligonucleotide. In certain such embodiments, the mismatch is at position , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3′-end of the oligonucleotide.
[0454] In certain embodiments, compounds described herein comprise or consist of antisense compounds. In certain embodiments, a portion of the antisense compound is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
[0455] In certain embodiments, compounds described herein comprise or consist of oligonucleotides. In certain embodiments, a portion of the oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
Certain Modified Compounds
[0456] In certain embodiments, compounds described herein comprise or consist of oligonucleotides consisting of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA (i.e., comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage).
[0457] A. Modified Nucleosides
[0458] Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modifed sugar moiety and a modified nucleobase.
[0459] 1. Modified Sugar Moieties
[0460] In certain embodiments, sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.
[0461] In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more acyclic substituent, including but not limited to substituents at the 2′, 4′, and/or 5′ positions. In certain embodiments one or more acyclic substituent of non-bicyclic modified sugar moieties is branched. Examples of 2′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2′-F, 2′-OCH.sub.3(“OMe” or “O-methyl”), and 2′-O(CH.sub.2).sub.2OCH.sub.3(“MOE”). In certain embodiments, 2′-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF.sub.3, OCF.sub.3, alkoxy, O—C.sub.1-C.sub.10 substituted alkoxy, O—C.sub.1-C.sub.10 alkyl, O—C.sub.1-C.sub.10 substituted alkyl, S-alkyl, N(R.sub.m)-alkyl, O-alkenyl, S-alkenyl, N(R.sub.m)-alkenyl, O-alkynyl, S-alkynyl, N(R.sub.m)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(R.sub.m)(R.sub.n) or OCH.sub.2C(═O)—N(R.sub.m)(R.sub.n), where each R.sub.m and R.sub.n is, independently, H, an amino protecting group, or substituted or unsubstituted C.sub.1-C.sub.10 alkyl, and the 2′-substituent groups described in Cook et al., U.S. Pat. No. 6,531,584; Cook et al., U.S. Pat. No. 5,859,221; and Cook et al., U.S. Pat. No. 6,005,087. Certain embodiments of these 2′-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO.sub.2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 4′-substituent groups suitable for linearly non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128. Examples of 5′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5′-methyl (R or S), 5′-vinyl, and 5′-methoxy. In certain embodiments, non-bicyclic modified sugars comprise more than one non-bridging sugar substituent, for example, 2′-F-5′-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., US2010/190837 and Rajeev et al., US2013/0203836.
[0462] In certain embodiments, a 2′-substituted nucleoside or 2′-non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2′-substituent group selected from: F, NH.sub.2, N.sub.3, OCF.sub.3, OCH.sub.3, O(CH.sub.2).sub.3NH.sub.2, CH.sub.2CH═CH.sub.2, OCH.sub.2CH═CH.sub.2, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(R.sub.m)(R.sub.n), O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and N-substituted acetamide (OCH.sub.2C(═O)—N(R.sub.m)(R.sub.n)), where each R.sub.m and R.sub.n is, independently, H, an amino protecting group, or substituted or unsubstituted C.sub.1-C.sub.10 alkyl.
[0463] In certain embodiments, a 2′-substituted nucleoside or 2′-non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2′-substituent group selected from: F, OCF.sub.3, OCH.sub.3, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(CH.sub.3).sub.2, O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and OCH.sub.2C(═O)—N(H)CH.sub.3 (“NMA”).
[0464] In certain embodiments, a 2′-substituted nucleoside or 2′-non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2′-substituent group selected from: F, OCH.sub.3, and OCH.sub.2CH.sub.2OCH.sub.3.
[0465] Nucleosides comprising modified sugar moieties, such as non-bicyclic modified sugar moieties, are referred to by the position(s) of the substitution(s) on the sugar moiety of the nucleoside. For example, nucleosides comprising 2′-substituted or 2-modified sugar moieties are referred to as 2′-substituted nucleosides or 2-modified nucleosides.
[0466] Certain modifed sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4′ and the 2′ furanose ring atoms. Examples of such 4′ to 2′ bridging sugar substituents include but are not limited to: 4′-CH.sub.2-2′, 4′-(CH.sub.2).sub.2-2′, 4′-(CH.sub.2).sub.3-2′, (“LNA”), 4′-(CH.sub.2).sub.2-O-2′ (“ENA”), 4′-CH(CH.sub.3)—O-2′ (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4′-CH.sub.2—O—CH.sub.2-2′, 4′-CH.sub.2-N(R)-2′, 4′-CH(CH.sub.2OCH.sub.3)—O-2′ (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 7,399,845, Bhat et al., U.S. Pat. No. 7,569,686, Swayze et al., U.S. Pat. No. 7,741,457, and Swayze et al., U.S. Pat. No. 8,022,193), 4′-C(CH.sub.3)(CH.sub.3)—O-2′ and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 8,278,283), 4′-CH.sub.2—N(OCH.sub.3)-2′ and analogs thereof (see, e.g., Prakash et al., U.S. Pat. No. 8,278,425), 4′-CH.sub.2—O—N(CH.sub.3)-2′ (see, e.g., Allerson et al., U.S. Pat. No. 7,696,345 and Allerson et al., U.S. Pat. No. 8,124,745), 4′-CH.sub.2—C(H)(CH.sub.3)-2′ (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4′-CH.sub.2—C(═CH.sub.2)-2′ and analogs thereof (see e.g., Seth et al., U.S. Pat. No. 8,278,426), 4′-C(R.sub.aR.sub.b)—N(R)—O-2′, 4′-C(R.sub.aR.sub.b)—O—N(R)-2′, 4′-CH.sub.2—O—N(R)-2′, and 4′-CH.sub.2—N(R)—O-2′, wherein each R, R.sub.a, and R.sub.b is, independently, H, a protecting group, or C.sub.1-C.sub.12 alkyl (see, e.g. Imanishi et al., U.S. Pat. No. 7,427,672).
[0467] In certain embodiments, such 4′ to 2′ bridges independently comprise from 1 to 4 linked groups independently selected from: —[C(R.sub.a)(R.sub.b)].sub.n—, —[C(R.sub.a)(R.sub.b)].sub.n—O—, —C(R.sub.a)═C(R.sub.b)—, —C(R.sub.a)═N—, —C(═NR.sub.a)—, —C(═O)—, —C(═S)—, —O—, —Si(R.sub.a).sub.2—, —S(═O).sub.x—, and —N(R.sub.a)—;
[0468] wherein:
[0469] x is 0, 1, or 2;
[0470] n is 1, 2, 3, or 4;
[0471] each R.sub.a and R.sub.b is, independently, H, a protecting group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7 alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical, halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1, acyl (C(═O)—H), substituted acyl, CN, sulfonyl (S(═O).sub.2-J.sub.1), or sulfoxyl (S(═O)-J.sub.1); and each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl (C(═O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12 aminoalkyl, or a protecting group.
[0472] Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379; Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wengel et al., U.S. Pat. No. 7,053,207, Imanishi et al., U.S. Pat. No. 6,268,490, Imanishi et al. U.S. Pat. No. 6,770,748, Imanishi et al., U.S. RE44,779; Wengel et al., U.S. Pat. No. 6,794,499, Wengel et al., U.S. Pat. No. 6,670,461; Wengel et al., U.S. Pat. No. 7,034,133, Wengel et al., U.S. Pat. No. 8,080,644; Wengel et al., U.S. Pat. No. 8,034,909; Wengel et al., U.S. Pat. No. 8,153,365; Wengel et al., U.S. Pat. No. 7,572,582; and Ramasamy et al., U.S. Pat. No. 6,525,191, Torsten et al., WO 2004/106356, Wengel et al., WO 1999/014226; Seth et al., WO 2007/134181; Seth et al., U.S. Pat. No. 7,547,684; Seth et al., U.S. Pat. No. 7,666,854; Seth et al., U.S. Pat. No. 8,088,746; Seth et al., U.S. Pat. No. 7,750,131; Seth et al., U.S. Pat. No. 8,030,467; Seth et al., U.S. Pat. No. 8,268,980; Seth et al., U.S. Pat. No. 8,546,556; Seth et al., U.S. Pat. No. 8,530,640; Migawa et al., U.S. Pat. No. 9,012,421; Seth et al., U.S. Pat. No. 8,501,805; Allerson et al., US2008/0039618; and Migawa et al., US2015/0191727.
[0473] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the α-L configuration or in the β-D configuration.
##STR00009##
α-L-methyleneoxy (4′-CH.sub.2—O-2′) or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the β-D configuration, unless otherwise specified.
[0474] In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5′-substituted and 4′-2′ bridged sugars).
[0475] In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4′-sulfur atom and a substitution at the 2′-position (see, e.g., Bhat et al., U.S. Pat. No. 7,875,733 and Bhat et al., U.S. Pat. No. 7,939,677) and/or the 5′ position.
[0476] In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see e.g., Leumann, C J. Bioorg. & Med. Chem. 2002,10, 841-854), fluoro HNA:
##STR00010##
(“F-HNA”, see e.g., Swayze et al., U.S. Pat. No. 8,088,904; Swayze et al., U.S. Pat. No. 8,440,803; and Swayze et al., U.S. Pat. No. 9,005,906, F-HNA can also be referred to as a F-THP or 3′-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula:
##STR00011##
wherein, independently, for each of said modified THP nucleoside:
[0477] Bx is a nucleobase moiety;
[0478] T.sub.3 and T.sub.4 are each, independently, an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T.sub.3 and T.sub.4 is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5′ or 3′-terminal group; q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each, independently, H, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, or substituted C.sub.2-C.sub.6 alkynyl; and each of R.sub.1 and R.sub.2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(═X)J.sub.1, OC(═X)NJ.sub.1J.sub.2, NJ.sub.3C(═X)NJ.sub.1J.sub.2, and CN, wherein X is O, S or NJ.sub.1, and each J.sub.1, J.sub.2, and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl.
[0479] In certain embodiments, modified THP nucleosides are provided wherein q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is other than H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R.sub.1 and R.sub.2 is F. In certain embodiments, R.sub.1 is F and R.sub.2 is H, in certain embodiments, R.sub.1 is methoxy and R.sub.2 is H, and in certain embodiments, R.sub.1 is methoxyethoxy and R.sub.2 is H.
[0480] In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. Pat. No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. Pat. No. 5,034,506). As used here, the term “morpholino” means a sugar surrogate having the following structure:
##STR00012##
In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are refered to herein as “modifed morpholinos.”
[0481] In certain embodiments, sugar surrogates comprise acyclic moieites. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US2013/130378.
[0482] Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides.
[0483] 2. Modified Nucleobases
[0484] Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications can impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds.
[0485] In certain embodiments, compounds described herein comprise modified oligonucleotides. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.
[0486] In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimi¬dines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, 5-methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (C≡C—CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S. T., Ed., CRC Press, 2008, 163-166 and 442-443.
[0487] Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manoharan et al., US2003/0158403, Manoharan et al., US2003/0175906; Dinh et al., U.S. Pat. No. 4,845,205; Spielvogel et al., U.S. Pat. No. 5,130,302; Rogers et al., U.S. Pat. No. 5,134,066; Bischofberger et al., U.S. Pat. No. 5,175,273; Urdea et al., U.S. Pat. No. 5,367,066; Benner et al., U.S. Pat. No. 5,432,272; Matteucci et al., U.S. Pat. No. 5,434,257; Gmeiner et al., U.S. Pat. No. 5,457,187; Cook et al., U.S. Pat. No. 5,459,255; Froehler et al., U.S. Pat. No. 5,484,908; Matteucci et al., U.S. Pat. No. 5,502,177; Hawkins et al., U.S. Pat. No. 5,525,711; Haralambidis et al., U.S. Pat. No. 5,552,540; Cook et al., U.S. Pat. No. 5,587,469; Froehler et al., U.S. Pat. No. 5,594,121; Switzer et al., U.S. Pat. No. 5,596,091; Cook et al., U.S. Pat. No. 5,614,617; Froehler et al., U.S. Pat. No. 5,645,985; Cook et al., U.S. Pat. No. 5,681,941; Cook et al., U.S. Pat. No. 5,811,534; Cook et al., U.S. Pat. No. 5,750,692; Cook et al., U.S. Pat. No. 5,948,903; Cook et al., U.S. Pat. No. 5,587,470; Cook et al., U.S. Pat. No. 5,457,191; Matteucci et al., U.S. Pat. No. 5,763,588; Froehler et al., U.S. Pat. No. 5,830,653; Cook et al., U.S. Pat. No. 5,808,027; Cook et al., U.S. Pat. No. 6,166,199; and Matteucci et al., U.S. Pat. No. 6,005,096.
[0488] In certain embodiments, compounds targeted to a YAP1 nucleic acid comprise one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.
[0489] 3. Modified Internucleoside Linkages
[0490] The naturally occuring internucleoside linkage of RNA and DNA is a 3′ to 5′ phosphodiester linkageln certain embodiments, compounds described herein having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
[0491] Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
##STR00013##
Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
[0492] In certain embodiments, compounds targeted to an YAP1 nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.
[0493] In certain embodiments, compounds described herein comprise oligonucleotides. Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.
[0494] In certain embodiments, nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include but are not limited to phosphates, which contain a phosphodiester bond (“P═O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (“P═S”), and phosphorodithioates (“HS—P═S”). Representative non-phosphorus containing internucleoside linking groups include but are not limited to methylenemethylimino (—CH2-N(CH3)-O—CH2-), thiodiester, thionocarbamate (—O—C(═O)(NH)—S—); siloxane (—O—SiH2-O—); and N,N′-dimethylhydrazine (—CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative chiral internucleoside linkages include but are not limited to alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.
[0495] Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3′-CH2-N(CH3)-O-5′), amide-3 (3′-CH2-C(═O)—N(H)-5′), amide-4 (3′-CH2-N(H)—C(═O)-5′), formacetal (3′-O—CH2-O-5), methoxypropyl, and thioformacetal (3′-S—CH2-O-5′). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.
[0496] In certain embodiments, oligonucleotides comprise modified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified internucleoside linkage motif. In certain embodiments, internucleoside linkages are arranged in a gapped motif. In such embodiments, the internucleoside linkages in each of two wing regions are different from the internucleoside linkages in the gap region. In certain embodiments the internucleoside linkages in the wings are phosphodiester and the internucleoside linkages in the gap are phosphorothioate. The nucleoside motif is independently selected, so such oligonucleotides having a gapped internucleoside linkage motif may or may not have a gapped nucleoside motif and if it does have a gapped nucleoside motif, the wing and gap lengths may or may not be the same.
[0497] In certain embodiments, oligonucleotides comprise a region having an alternating internucleoside linkage motif. In certain embodiments, oligonucleotides comprise a region of uniformly modified internucleoside linkages. In certain such embodiments, the oligonucleotide comprises a region that is uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one internucleoside linkage is phosphorothioate.
[0498] In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least block of at least one 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3′ end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3′ end of the oligonucleotide.
[0499] In certain embodiments, oligonucleotides comprise one or more methylphosponate linkages. In certain embodiments, oligonucleotides having a gapmer nucleoside motif comprise a linkage motif comprising all phosphorothioate linkages except for one or two methylphosponate linkages. In certain embodiments, one methylphosponate linkage is in the central gap of an oligonucleotide having a gapmer nucleoside motif.
[0500] In certain embodiments, it is desirable to arrange the number of phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, it is desirable to arrange the number and position of phosphorothioate internucleoside linkages and the number and position of phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, the number of phosphorothioate internucleoside linkages may be decreased and the number of phosphodiester internucleoside linkages may be increased. In certain embodiments, the number of phosphorothioate internucleoside linkages may be decreased and the number of phosphodiester internucleoside linkages may be increased while still maintaining nuclease resistance. In certain embodiments it is desirable to decrease the number of phosphorothioate internucleoside linkages while retaining nuclease resistance. In certain embodiments it is desirable to increase the number of phosphodiester internucleoside linkages while retaining nuclease resistance.
Certain Motifs
[0501] In certain embodiments, compounds described herein comprise oligonucleotides. Oligonucleotides can have a motif, e.g. a pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages. In certain embodiments, modified oligonucleotides comprise one or more modified nucleoside comprising a modified sugar. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).
[0502] a. Certain Sugar Motifs
[0503] In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein.
[0504] In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif, which comprises two external regions or “wings” and a central or internal region or “gap.” The three regions of a gapmer motif (the 5′-wing, the gap, and the 3′-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3′-most nucleoside of the 5′-wing and the 5′-most nucleoside of the 3′-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5′-wing differs from the sugar motif of the 3′-wing (asymmetric gapmer).
[0505] In certain embodiments, the wings of a gapmer comprise 1-5 nucleosides. In certain embodiments, the wings of a gapmer comprise 2-5 nucleosides. In certain embodiments, the wings of a gapmer comprise 3-5 nucleosides. In certain embodiments, the nucleosides of a gapmer are all modified nucleosides.
[0506] In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, the gap of a gapmer comprises 7-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 8-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 10 nucleosides. In certain embodiment, each nucleoside of the gap of a gapmer is an unmodified 2′-deoxy nucleoside.
[0507] In certain embodiments, the gapmer is a deoxy gapmer. In such embodiments, the nucleosides on the gap side of each wing/gap junction are unmodified 2′-deoxy nucleosides and the nucleosides on the wing sides of each wing/gap junction are modified nucleosides. In certain such embodiments, each nucleoside of the gap is an unmodified 2′-deoxy nucleoside. In certain such embodiments, each nucleoside of each wing is a modified nucleoside.
[0508] In certain embodiments, a modified oligonucleotide has a fully modified sugar motif wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif wherein each nucleoside of the region comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified comprises the same 2′-modification.
[0509] In certain embodiments, a modified oligonucleotide can comprise a sugar motif described in Swayze et al., US2010/0197762; Freier et al., US2014/0107330; Freier et al., US2015/0184153; and Seth et al., US2015/0267195, each of which is incorporated by reference in its entirety herein.
[0510] Certain embodiments provided herein are directed to modified oligomeric compounds useful for inhibiting target nucleic acid expression, which can be useful for treating, preventing, ameliorating, or slowing progression of a disease associated with such a target nucleic acid. In certain embodiments, the modified oligomeric compounds comprise antisense oligonucleotides that are gapmers having certain sugar motifs. In certain embodiments, the gapmer sugar motifs provided herein can be combined with any nucleobase sequence and any internucleoside linkage motif to form potent antisense oligonucleotides.
[0511] In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: ekk-d9-kkee, wherein ‘d’ represents a 2′-deoxyribose sugar, 1′ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.
[0512] In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: k-d9-kekeke, wherein ‘d’ represents a 2′-deoxyribose sugar, 1′ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.
[0513] In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kkk-d8-kekek, wherein ‘d’ represents a 2′-deoxyribose sugar, 1′ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.
[0514] In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kkk-d9-keke, wherein ‘d’ represents a 2′-deoxyribose sugar, 1′ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.
[0515] In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kk-d9-kdkdk, wherein ‘d’ represents a 2′-deoxyribose sugar, 1′ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.
[0516] In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kk-d9-eeekk, wherein ‘d’ represents a 2′-deoxyribose sugar, 1′ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kk-d9-eeekk, wherein ‘d’ represents a 2′-deoxyribose sugar, 1′ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.
[0517] In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kk-d9-ekeke, wherein represents a 2′-deoxyribose sugar, 1′ represents a cEt nucleoside, and ‘e’ represents a 2′-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject's cancer.
[0518] b. Certain Nucleobase Motifs
[0519] In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines.
[0520] In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3′-end of the oligonucleotide. In certain embodiments, the block is at the 5′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5′-end of the oligonucleotide.
[0521] In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2′-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine.
[0522] c. Certain Internucleoside Linkage Motifs
[0523] In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, essentially each internucleoside linking group is a phosphate internucleoside linkage (P═O). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate (P═S). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is independently selected from a phosphorothioate and phosphate internucleoside linkage. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphate linkages. In certain embodiments, the terminal internucleoside linkages are modified.
[0524] 4. Certain Modified Oligonucleotides
[0525] In certain embodiments, compounds described herein comprise modified oligonucleotides. In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification, motifs, and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region of the sugar motif. Likewise, such gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Furthermore, in certain instances, an oligonucleotide is described by an overall length or range and by lengths or length ranges of two or more regions (e.g., a regions of nucleosides having specified sugar modifications), in such circumstances it may be possible to select numbers for each range that result in an oligonucleotide having an overall length falling outside the specified range. In such circumstances, both elements must be satisfied. For example, in certain embodiments, a modified oligonucleotide consists of 15-20 linked nucleosides and has a sugar motif consisting of three regions, A, B, and C, wherein region A consists of 2-6 linked nucleosides having a specified sugar motif, region B consists of 6-10 linked nucleosides having a specified sugar motif, and region C consists of 2-6 linked nucleosides having a specified sugar motif. Such embodiments do not include modified oligonucleotides where A and C each consist of 6 linked nucleosides and B consists of 10 linked nucleosides (even though those numbers of nucleosides are permitted within the requirements for A, B, and C) because the overall length of such oligonucleotide is 22, which exceeds the upper limit of the overall length of the modified oligonucleotide (20). Herein, if a description of an oligonucleotide is silent with respect to one or more parameter, such parameter is not limited. Thus, a modified oligonucleotide described only as having a gapmer sugar motif without further description may have any length, internucleoside linkage motif, and nucleobase motif. Unless otherwise indicated, all modifications are independent of nucleobase sequence.
Certain Conjugated Compounds
[0526] In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2′-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3′ and/or 5′-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3′-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5′-end of oligonucleotides.
[0527] In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of a compound has a nucleobase sequence that is complementary to a target nucleic acid. In certain embodiments, oligonucleotides are complementary to a messenger RNA (mRNA). In certain embodiments, oligonucleotides are complementary to a sense transcript.
[0528] Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.
[0529] A. Certain Conjugate Groups
[0530] In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearanceln certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide.
[0531] Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic, a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), -an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, i, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; doi:10.1038/mtna.2014.72 and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014/179620).
[0532] 1. Conjugate Moieties
[0533] Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
[0534] In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
[0535] 2. Conjugate Linkers
[0536] Conjugate moieties are attached to oligonucleotides through conjugate linkers. In certain compounds, a conjugate group is a single chemical bond (i.e. conjugate moiety is attached to an oligonucleotide via a conjugate linker through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.
[0537] In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.
[0538] In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One ofthe functional groups is selected to bind to a particular site on a compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
[0539] Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C.sub.1-C.sub.10 alkyl, substituted or unsubstituted C.sub.2-C.sub.10 alkenyl or substituted or unsubstituted C.sub.2-C.sub.10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
[0540] In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.
[0541] Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which a compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, a compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such a compound is more than 30. Alternatively, an compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such a compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.
[0542] In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. For example, in certain circumstances compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate may comprise one or more cleavable moieties, typically within the conjugate linker. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
[0543] In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.
[0544] In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, one or more linker-nucleosides are linked to one another and/or to the remainder of the compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2′-deoxy nucleoside that is attached to either the 3′ or 5′-terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2′-deoxyadenosine.
Compositions and Methods for Formulating Pharmaceutical Compositions
[0545] Compounds described herein may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
[0546] Certain embodiments provide pharmaceutical compositions comprising one or more compounds or a salt thereof. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compounds comprise or consist of a modified oligonucleotide. In certain such embodiments, the pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises a sterile saline solution and one or more compound. In certain embodiments, such pharmaceutical composition consists of a sterile saline solution and one or more compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more compound and sterile water. In certain embodiments, a pharmaceutical composition consists of one compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises one or more compound and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more compound and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
[0547] A compound described herein targeted to YAP1 nucleic acid can be utilized in pharmaceutical compositions by combining the compound with a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutically acceptable diluent is water, such as sterile water suitable for injection. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising a compound targeted to YAP1 nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is water. In certain embodiments, the compound comprises or consists of a modified oligonucleotide provided herein.
[0548] Pharmaceutical compositions comprising compounds provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
[0549] A prodrug can include the incorporation of additional nucleosides at one or both ends of a compound which are cleaved by endogenous nucleases within the body, to form the active compound. In certain embodiments, the compounds or compositions further comprise a pharmaceutically acceptable carrier or diluent.
EXAMPLES
[0550] The Examples below describe the screening process to identify lead compounds targeted to YAP1. Out of over 3,000 oligonucleotides that were screened, ION 958499, 1076453, 1197270, 1198439, 1198440, 1198605, 1198623, 1198728, 1198831, or 1198872 emerged as the top lead compounds. In particular, ION 1198440 exhibited the best combination of properties in terms of potency and tolerability out of over 3,000 oligonucleotides.
Non-Limiting Disclosure and Incorporation by Reference
[0551] Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2′-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2′-OH for the natural 2′-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) for natural uracil of RNA).
[0552] Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligonucleotide having the nucleobase sequence “ATCGATCG” encompasses any oligonucleotides having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and compounds having other modified nucleobases, such as “AT.sup.mCGAUCG,” wherein .sup.mC indicates a cytosine base comprising a methyl group at the 5-position.
[0553] While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.
Example 1
Antisense Inhibition of Human Yap1 in A-431 Cells by cEt Gapmers
[0554] Modified oligonucleotides were designed to target a Yap1 nucleic acid and were tested for their effect on Yap1 mRNA level in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured A-431 cells at a density of 5,000 cells per well were treated using free uptake with 2,000 nM of modified oligonucleotide. After a treatment period of approximately 48 hours, RNA was isolated from the cells and Yap1 mRNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS4814 (forward sequence GGGAAGTGAGCCTGTTTGGA, designated herein as SEQ ID NO.: 11; reverse sequence ACTGTTGAACAAACTAAATGCTGTGA, designated herein as SEQ ID NO.: 12; probe sequence ATGGATGCCATTCCTTTTGCCCAGTT, designated herein as SEQ ID NO.: 13) was used to measure mRNA levels. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). The modified oligonucleotides with percent control values marked with an asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides targeting the amplicon region.
[0555] The newly designed modified oligonucleotides in the Tables below were designed as 3-10-3 cEt gapmers. The gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on the 5′ direction and the 3′ direction comprising three nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has a cEt sugar modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P═S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.
[0556] “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either SEQ ID NO.: 1 (GENBANK Accession No. NM_001282101.1), or SEQ ID NO.: 2 (GENBANK Accession No. NC_000011.10 truncated from nucleotides 102107001 to 102236000). ‘N/A’ indicates that the modified oligonucleotide does not target that particular gene sequence with 100% complementarity. ‘N.D.’ indicates that the % UTC is not defined for that particular modified oligonucleotide in that particular experiment. Activity of the modified oligonucleotide may be defined in a different experiment.
TABLE-US-00001 TABLE 1 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compound Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO 715400 559 574 4019 4034 CTCCGAGTCCCCGCGG 107 23 715403 658 673 4118 4133 GAAGGAGTCGGGCAGC 72 24 715406 664 679 4124 4139 CTTGAAGAAGGAGTCG 58 25 715409 704 719 N/A N/A CAGTACTGGCCTGTCG 76 26 715412 710 725 7144 7159 CTGCATCAGTACTGGC 66 27 715415 744 759 7178 7193 CGAACATGCTGTGGAG 24 28 715418 798 813 7232 7247 AGTGTCCCAGGAGAAA 126 29 715421 949 964 N/A N/A GTGATTTAAGAAGTAT 71 30 715424 972 987 55467 55482 TGCCATGTTGTTGTCT 58 31 715427 1081 1096 79022 79037 CCATCCATCAGGAAGA 90 32 715430 1102 1117 79043 79058 ATCCTGAGTCATGGCT 118 33 715433 1133 1148 79074 79089 TGTTCTTATGGTTTAT 36 34 715436 1178 1193 N/A N/A TGGCAAAACGAGGGTC 126 35 715439 1184 1199 N/A N/A GGTTCATGGCAAAACG 99 36 715442 1210 1225 98912 98927 CACTGGAGCACTCTGA 64 37 715445 1460 1475 116649 116664 CATCCTGCTCCAGTGT 87 38 715448 1509 1524 116698 116713 CTCAATTCCTGAGACA 97 39 715451 1516 1531 116705 116720 CATTGTTCTCAATTCC 75 40 715454 1558 1573 N/A N/A ATAGGTGCCACTGTTA 78 41 715457 1564 1579 120469 120484 AGAGTGATAGGTGCCA 47 42 715460 1570 1585 120475 120490 ATCTCGAGAGTGATAG 114 43 715463 1608 1623 120513 120528 CTGTAGCTGCTCATGC 73 44 715466 1751 1766 122776 122791 CAAGGTCCACATTTGT 83 45 715469 1870 1885 122895 122910 TAGCTTGGTGGCAGCC 94 46 715472 1876 1891 122901 122916 TTTATCTAGCTTGGTG 52 47 715475 1883 1898 122908 122923 AGCTTTCTTTATCTAG 103 48 715478 3560 3575 124585 124600 ACCATTATTACTCCTG 7 49 715481 3566 3581 124591 124606 TTGGAAACCATTATTA 66 50 715484 3572 3587 101152 101167 TACTCTTTGGAAACCA 123 51 124597 124612 715487 3630 3645 124655 124670 ATTACTTCATAGCTTA 22 52 715490 3636 3651 124661 124676 CCAACTATTACTTCAT 38 53 715493 3665 3680 124690 124705 GTGCTAGCTGGTGCCA 62 54 715496 3720 3735 124745 124760 CCCTTGAAAATAAGGG 124 55 715499 3726 3741 124751 124766 TATGAACCCTTGAAAA 126 56 715502 4011 4026 125036 125051 CCAGACTTAATTCAAG 91 57 715505 4684 4699 125709 125724 ATTGGTTTATTGTAAA 84 58 715508 1397 1412 102529 102544 CTGTGCTGGGATTGAT 24 59 715511 1419 1434 N/A N/A TCCTGACATTTTGGAG 107 60 715514 N/A N/A 4573 4588 GAGCGAAGGTGCGGAG 121 61 715517 N/A N/A 5151 5166 GGCCTATGAGTCAACC 109 62 715520 N/A N/A 5544 5559 TTCTTTCCACTCAAGT 122 63 715523 N/A N/A 7140 7155 ATCAGTACTGGCCTAT 32 64 715526 N/A N/A 7385 7400 ACTTACTTTAAGAAGT 112 65 715529 N/A N/A 8646 8661 TGAAACCTGATCCTTT 148 66 715532 N/A N/A 8820 8835 TAACAACCTGGTTTGT 91 67 715535 N/A N/A 8906 8921 CTATTAAGCTGTTTAA 91 68 715538 N/A N/A 10383 10398 CTTTGTAACTTAAAAG 110 69 715541 N/A N/A 10918 10933 CTTGAAGAACTATTTC 105 70 715544 N/A N/A 10924 10939 CAACTACTTGAAGAAC 128 71 715547 N/A N/A 10930 10945 GTTGACCAACTACTTG 98 72 715550 N/A N/A 10938 10953 AGGAAGTTGTTGACCA 70 73 715553 N/A N/A 10944 10959 AGAAATAGGAAGTTGT 90 74 715556 N/A N/A 10965 10980 AAGTTATTCAGCAGCT 63 75 715559 N/A N/A 28556 28571 CTGCCATTTAAGAAAT 114 76 715562 N/A N/A 37601 37616 CACACAACTCAGACAG 77 77 715565 N/A N/A 37826 37841 GGATAAATGAATTATA 115 78 715568 N/A N/A 37832 37847 AAGGTAGGATAAATGA 116 79 715571 N/A N/A 105518 105533 AAAATCCTGCCAACAT 127 80 715574 N/A N/A 79119 79134 TACCAAAACGAGGGTC 118 81 715577 N/A N/A 80085 80100 GCATTCACAGAGTTAA 21 82 715580 N/A N/A 80919 80934 GCCTGTCTGGAATACA 101 83 715583 N/A N/A 80954 80969 GGGCCACAAAATAAAA 164 84 715586 N/A N/A 80980 80995 AAAAGGTCTGGAACAG 53 85 715589 N/A N/A 81086 81101 CCAGCAGCTAACAGCT 107 86 715592 N/A N/A 81151 81166 TTCTTTGGCAGAGATA 89 87 715595 N/A N/A 98883 98898 TCATGGCTGAAATGAA 104 88 715598 N/A N/A 102395 102410 CCCAAGCTACCCAAGA 103 89 715601 N/A N/A 102401 102416 AGAATTCCCAAGCTAC 106 90 715604 N/A N/A 102407 102422 TAGCACAGAATTCCCA 107 91 715607 N/A N/A 102413 102428 TCACCATAGCACAGAA 116 92 715610 N/A N/A 102451 102466 GGCTGTGTAGGCTGAC 87 93 715613 N/A N/A 102473 102488 ATTACTTTAAGCCACA 85 94 715616 N/A N/A 102484 102499 GACGGATAAAAATTAC 95 95 715619 N/A N/A 102490 102505 AAATAAGACGGATAAA 114 96 715622 N/A N/A 102496 102511 AGTAAAAAATAAGACG 137 97 715625 N/A N/A 102506 102521 ATTGCCTAAGAGTAAA 99 98 715628 N/A N/A 102555 102570 GCCTACCTGACATTTT 114 99 715631 N/A N/A 102561 102576 ATAAGAGCCTACCTGA 134 100
TABLE-US-00002 TABLE 2 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compound Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO 715401 562 577 4022 4037 GGTCTCCGAGTCCCCG 84 101 715404 660 675 4120 4135 AAGAAGGAGTCGGGCA 64 102 715407 666 681 4126 4141 GGCTTGAAGAAGGAGT 53 103 715410 706 721 N/A N/A ATCAGTACTGGCCTGT 61 104 715413 740 755 7174 7189 CATGCTGTGGAGTCAG 96 105 715416 746 761 7180 7195 CTCGAACATGCTGTGG 53 106 715419 929 944 7363 7378 GACCAGAAGATGTCTT 107 107 715422 968 983 55463 55478 ATGTTGTTGTCTGATC 57 108 715425 976 991 55471 55486 GTCCTGCCATGTTGTT 98 109 715428 1083 1098 79024 79039 TCCCATCCATCAGGAA 106 110 715431 1104 1119 79045 79060 CCATCCTGAGTCATGG 99 111 715434 1136 1151 79077 79092 TCTTGTTCTTATGGTT 31 112 715437 1180 1195 N/A N/A CATGGCAAAACGAGGG 89 113 715440 1186 1201 N/A N/A CTGGTTCATGGCAAAA 85 114 715443 1212 1227 98914 98929 TTCACTGGAGCACTCT 40 115 715446 1505 1520 116694 116709 ATTCCTGAGACATCCC 81 116 715449 1511 1526 116700 116715 TTCTCAATTCCTGAGA 124 117 715452 1518 1533 116707 116722 GTCATTGTTCTCAATT 71 118 715455 1560 1575 N/A N/A TGATAGGTGCCACTGT 65 119 715458 1566 1581 120471 120486 CGAGAGTGATAGGTGC 58 120 715461 1572 1587 120477 120492 TCATCTCGAGAGTGAT 153 121 715464 1745 1760 122770 122785 CCACATTTGTCCCAGG 89 122 715467 1769 1784 122794 122809 CATCTCCTTCCAGTGT 77 123 715470 1872 1887 122897 122912 TCTAGCTTGGTGGCAG 83 124 715473 1878 1893 122903 122918 TCTTTATCTAGCTTGG 32 125 715476 1885 1900 122910 122925 AAAGCTTTCTTTATCT 84 126 715479 3562 3577 124587 124602 AAACCATTATTACTCC 38 127 715482 3568 3583 124593 124608 CTTTGGAAACCATTAT 58 128 715485 3574 3589 124599 124614 AATACTCTTTGGAAAC 72 129 715488 3632 3647 124657 124672 CTATTACTTCATAGCT 66 130 715491 3638 3653 124663 124678 AACCAACTATTACTTC 71 131 715494 3668 3683 124693 124708 GAGGTGCTAGCTGGTG 46 132 715497 3722 3737 124747 124762 AACCCTTGAAAATAAG 155 133 715500 3966 3981 11043 11058 AAGCCTTAGAGTCAAT 30 134 124991 125006 715503 4013 4028 125038 125053 CCCCAGACTTAATTCA 136 135 715506 4686 4701 125711 125726 AAATTGGTTTATTGTA 112 136 715509 1399 1414 102531 102546 TGCTGTGCTGGGATTG 42 137 715512 N/A N/A 4550 4565 AGGCGCGCGCATTGTG 97 138 715515 N/A N/A 5147 5162 TATGAGTCAACCTGCA 94 139 715518 N/A N/A 5477 5492 TTTGGGCAAAGTTCCT 60 140 715521 N/A N/A 5546 5561 TCTTCTTTCCACTCAA 72 141 715524 N/A N/A 7381 7396 ACTTTAAGAAGTATCT 93 142 715527 N/A N/A 7387 7402 TCACTTACTTTAAGAA 111 143 715530 N/A N/A 8816 8831 AACCTGGTTTGTTTCC 61 144 715533 N/A N/A 8822 8837 CCTAACAACCTGGTTT 97 145 715536 N/A N/A 8908 8923 GGCTATTAAGCTGTTT 137 146 715539 N/A N/A 10637 10652 AGATCTCACTGACCTA 102 147 715542 N/A N/A 10920 10935 TACTTGAAGAACTATT 120 148 715545 N/A N/A 10926 10941 ACCAACTACTTGAAGA 87 149 715548 N/A N/A 10934 10949 AGTTGTTGACCAACTA 117 150 715551 N/A N/A 10940 10955 ATAGGAAGTTGTTGAC 82 151 715554 N/A N/A 10961 10976 TATTCAGCAGCTTATA 93 152 715557 N/A N/A 10967 10982 GGAAGTTATTCAGCAG 46 153 715560 N/A N/A 37563 37578 CCCTTTACAAAAATAG 98 154 715563 N/A N/A 37603 37618 AGCACACAACTCAGAC 86 155 715566 N/A N/A 37828 37843 TAGGATAAATGAATTA 94 156 715569 N/A N/A 37834 37849 CAAAGGTAGGATAAAT 122 157 715572 N/A N/A 78867 78882 TCAGAGAAGAAAGGTA 97 158 715575 N/A N/A 79123 79138 CCTTTACCAAAACGAG 134 159 715578 N/A N/A 80087 80102 TGGCATTCACAGAGTT 50 160 715581 N/A N/A 80921 80936 AAGCCTGTCTGGAATA 106 161 715584 N/A N/A 80976 80991 GGTCTGGAACAGATTA 96 162 715587 N/A N/A 80982 80997 TGAAAAGGTCTGGAAC 79 163 715590 N/A N/A 81147 81162 TTGGCAGAGATAAAAC 84 164 715593 N/A N/A 81153 81168 ATTTCTTTGGCAGAGA 60 165 715596 N/A N/A 98885 98900 GTTCATGGCTGAAATG 104 166 715599 N/A N/A 102397 102412 TTCCCAAGCTACCCAA 82 167 715602 N/A N/A 102403 102418 ACAGAATTCCCAAGCT 110 168 715605 N/A N/A 102409 102424 CATAGCACAGAATTCC 112 169 715608 N/A N/A 102430 102445 AATTGTATCCAGACAT 100 170 715611 N/A N/A 102469 102484 CTTTAAGCCACATGGT 106 171 715614 N/A N/A 102475 102490 AAATTACTTTAAGCCA 110 172 715617 N/A N/A 102486 102501 AAGACGGATAAAAATT 98 173 715620 N/A N/A 102492 102507 AAAAATAAGACGGATA 111 174 715623 N/A N/A 102502 102517 CCTAAGAGTAAAAAAT 113 175 715626 N/A N/A 102551 102566 ACCTGACATTTTGGAG 64 176 715629 N/A N/A 102557 102572 GAGCCTACCTGACATT 112 177 715632 N/A N/A 109609 109624 ATCCAATTATGTCCCA 109 178
TABLE-US-00003 TABLE 3 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compound Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO 715402 656 671 4116 4131 AGGAGTCGGGCAGCTT 59 179 715405 662 677 4122 4137 TGAAGAAGGAGTCGGG 60 180 715408 668 683 4128 4143 GCGGCTTGAAGAAGGA 60 181 715411 708 723 7142 7157 GCATCAGTACTGGCCT 94 182 715414 742 757 7176 7191 AACATGCTGTGGAGTC 31 183 715417 749 764 7183 7198 GAGCTCGAACATGCTG 104 184 715420 947 962 N/A N/A GATTTAAGAAGTATCT 107 185 715423 970 985 55465 55480 CCATGTTGTTGTCTGA 30 186 715426 1079 1094 79020 79035 ATCCATCAGGAAGAGG 80 187 715429 1100 1115 79041 79056 CCTGAGTCATGGCTTG 62 188 715432 1106 1121 79047 79062 CTCCATCCTGAGTCAT 65 189 715435 1138 1153 79079 79094 GGTCTTGTTCTTATGG 36 190 715438 1182 1197 N/A N/A TTCATGGCAAAACGAG 82 191 715441 1188 1203 N/A N/A CTCTGGTTCATGGCAA 57 192 715444 1249 1264 98951 98966 TCCCTGTGGGCTCTGG 84 193 715447 1507 1522 116696 116711 CAATTCCTGAGACATC 81 194 715450 1514 1529 116703 116718 TTGTTCTCAATTCCTG 53 195 715453 1556 1571 N/A N/A AGGTGCCACTGTTAAG 59 196 715456 1562 1577 120467 120482 AGTGATAGGTGCCACT 96 197 715459 1568 1583 120473 120488 CTCGAGAGTGATAGGT 93 198 715462 1574 1589 120479 120494 TCTCATCTCGAGAGTG 94 199 715465 1747 1762 122772 122787 GTCCACATTTGTCCCA 91 200 715468 1868 1883 122893 122908 GCTTGGTGGCAGCCAA 90 201 715471 1874 1889 122899 122914 TATCTAGCTTGGTGGC 36 202 715474 1881 1896 122906 122921 CTTTCTTTATCTAGCT 78 203 715477 3543 3558 124568 124583 AGACACATACTCTAGT 61 204 715480 3564 3579 124589 124604 GGAAACCATTATTACT 23 205 715483 3570 3585 124595 124610 CTCTTTGGAAACCATT 15 206 715486 3628 3643 124653 124668 TACTTCATAGCTTATA 27 207 715489 3634 3649 124659 124674 AACTATTACTTCATAG 90 208 715492 3663 3678 124688 124703 GCTAGCTGGTGCCACT 76 209 715495 3671 3686 124696 124711 ACAGAGGTGCTAGCTG 80 210 715498 3724 3739 124749 124764 TGAACCCTTGAAAATA 91 211 715501 3968 3983 64588 64603 AAAAGCCTTAGAGTCA 28 212 124993 125008 715504 4682 4697 125707 125722 TGGTTTATTGTAAAAG 70 213 715507 1391 1406 102523 102538 TGGGATTGATATTCCG 95 214 715510 1402 1417 102534 102549 ATTTGCTGTGCTGGGA 22 215 715513 N/A N/A 4554 4569 GCGGAGGCGCGCGCAT 125 216 715516 N/A N/A 5149 5164 CCTATGAGTCAACCTG 77 217 715519 N/A N/A 5540 5555 TTCCACTCAAGTTACA 96 218 715522 N/A N/A 5548 5563 ACTCTTCTTTCCACTC 87 219 715525 N/A N/A 7383 7398 TTACTTTAAGAAGTAT 100 220 715528 N/A N/A 8644 8659 AAACCTGATCCTTTGA 98 221 715531 N/A N/A 8818 8833 ACAACCTGGTTTGTTT 94 222 715534 N/A N/A 8885 8900 TCCCCAGGTCAGCATG 112 223 715537 N/A N/A 10155 10170 ACTTGGCACCAAAAGC 122 224 715540 N/A N/A 10916 10931 TGAAGAACTATTTCCT 82 225 715543 N/A N/A 10922 10937 ACTACTTGAAGAACTA 72 226 715546 N/A N/A 10928 10943 TGACCAACTACTTGAA 59 227 715549 N/A N/A 10936 10951 GAAGTTGTTGACCAAC 66 228 715552 N/A N/A 10942 10957 AAATAGGAAGTTGTTG 86 229 715555 N/A N/A 10963 10978 GTTATTCAGCAGCTTA 21 230 715558 N/A N/A 10969 10984 CAGGAAGTTATTCAGC 37 231 715561 N/A N/A 37599 37614 CACAACTCAGACAGGG 69 232 715564 N/A N/A 37605 37620 CAAGCACACAACTCAG 75 233 715567 N/A N/A 37830 37845 GGTAGGATAAATGAAT 99 234 715570 N/A N/A 37836 37851 GCCAAAGGTAGGATAA 79 235 715573 N/A N/A 64347 64362 TATATATGGTAGTCTA 76 236 715576 N/A N/A 79125 79140 AACCTTTACCAAAACG 80 237 715579 N/A N/A 80917 80932 CTGTCTGGAATACACA 100 238 715582 N/A N/A 80924 80939 GTCAAGCCTGTCTGGA 33 239 715585 N/A N/A 80978 80993 AAGGTCTGGAACAGAT 73 240 715588 N/A N/A 81084 81099 AGCAGCTAACAGCTTG 96 241 715591 N/A N/A 81149 81164 CTTTGGCAGAGATAAA 41 242 715594 N/A N/A 81155 81170 ATATTTCTTTGGCAGA 39 243 715597 N/A N/A 98888 98903 CTGGTTCATGGCTGAA 89 244 715600 N/A N/A 102399 102414 AATTCCCAAGCTACCC 82 245 715603 N/A N/A 102405 102420 GCACAGAATTCCCAAG 106 246 715606 N/A N/A 102411 102426 ACCATAGCACAGAATT 88 247 715609 N/A N/A 102448 102463 TGTGTAGGCTGACTTA 56 248 715612 N/A N/A 102471 102486 TACTTTAAGCCACATG 77 249 715615 N/A N/A 102482 102497 CGGATAAAAATTACTT 94 250 715618 N/A N/A 102488 102503 ATAAGACGGATAAAAA 101 251 715621 N/A N/A 102494 102509 TAAAAAATAAGACGGA 106 252 715624 N/A N/A 102504 102519 TGCCTAAGAGTAAAAA 123 253 715627 N/A N/A 102553 102568 CTACCTGACATTTTGG 88 254 715630 N/A N/A 102559 102574 AAGAGCCTACCTGACA 94 255 715633 N/A N/A 120466 120481 GTGATAGGTGCCACTA 78 256
Example 2
Antisense Inhibition of Human Yap1 in A-431 Cells by cEt Gapmers
[0557] Modified oligonucleotides were designed to target a Yap1 nucleic acid and were tested for their effect on Yap1 mRNA level in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured A-431 cells at a density of 5,000 cells per well were treated using free uptake with 2,000 nM of modified oligonucleotide. After a treatment period of approximately 48 hours, RNA was isolated from the cells and Yap1 mRNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS4814 was used to measure mRNA levels. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). The modified oligonucleotides with percent control values marked with an asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides targeting the amplicon region.
[0558] The newly designed modified oligonucleotides in the Tables below were designed as 3-10-3 cEt gapmers. The gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on the 5′ direction and the 3′ direction comprising three nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has a cEt sugar modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P═S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.
[0559] “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Gapmers listed in the Tables below are targeted to either SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 (GENBANK Accession No. NM_006106.4), or SEQ ID NO: 4 (GENBANK Accession No. NM_001130145.2). ‘N/A’ indicates that the modified oligonucleotide does not target that particular gene sequence with 100% complementarity. ‘N.D.’ indicates that the % UTC is not defined for that particular modified oligonucleotide in that particular experiment. Activity ofthe modified oligonucleotide may be defined in a different experiment.
TABLE-US-00004 TABLE 4 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compound Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO 716346 1 16 3461 3476 TTTCCCTGGCGGCGGC 77 257 716349 107 122 3567 3582 ACTTTTTCCCTCCAAC 78 258 716352 184 199 3644 3659 CTGCGCCCCGGCTCCA 105 259 716355 279 294 3739 3754 GACGGCTGCGGGCCGG 96 260 716358 331 346 3791 3806 CGAGGGCTACGCCCGG 104 261 716361 405 420 3865 3880 GGTTGAGGCGGCGGCT 75 262 716364 493 508 3953 3968 CGCCGCGGGTGCCGGT 110 263 716367 631 646 4091 4106 CATGGGCACGGTCTGG 70 264 716370 716 731 7150 7165 CAGTGCCTGCATCAGT 25 265 716373 775 790 7209 7224 CAACTGCAGAGAAGCT 69 266 716376 855 870 7289 7304 CGAAGATGCTGAGCTG 35 267 716379 927 942 7361 7376 CCAGAAGATGTCTTTG 123 268 716382 993 1008 55488 55503 AGCATGGCCTTCCTGG 73 269 716385 1084 1099 79025 79040 TTCCCATCCATCAGGA 87 270 716388 1144 1159 79085 79100 AGAGGTGGTCTTGTTC 55 271 716391 1206 1221 98908 98923 GGAGCACTCTGACTGA 44 272 716394 1304 1319 99006 99021 GTTGCTGCAGTCGCAT 120 273 716397 1365 1380 99067 99082 GGCCTCACCTGCCGAA 88 274 716400 1423 1438 N/A N/A TAACTCCTGACATTTT 106 275 716403 1491 1506 116680 116695 CCGGGAGAAGACACTG 110 276 716406 1576 1591 120481 120496 ACTCTCATCTCGAGAG 117 277 716409 1636 1651 120541 120556 CAGGAAGTCATCTGGG 99 278 716412 1717 1732 122742 122757 GTAGTCTGGGAAACGG 41 279 716415 1794 1809 122819 122834 AGCTCCTCTCCTTCTA 90 280 716418 1910 1925 122935 122950 CCTGAGGGCTCTATAA 75 281 716421 1996 2011 123021 123036 TATTAGCCTGAAAACT 86 282 716424 2064 2079 123089 123104 GCAATGGACAAGGAAG 25 283 716427 2170 2185 123195 123210 AGCCCCCAAAATGAAC 86 284 716430* 2221 2236 123246 123261 TAACTGGGCAAAAGGA 28 285 716433* 2272 2287 123297 123312 AGCATCTGACTTCTAA 20 286 716436 2329 2344 123354 123369 ACTGGACAAAGGAAGC 59 287 716439 2387 2402 123412 123427 GTATTTAATATCAGAT 77 288 716442 2466 2481 123491 123506 GCACTAGGAGGAAAAG 63 289 716445 2559 2574 123584 123599 GTATGTGGCAATAATT 28 290 716448 2683 2698 123708 123723 CCGACAAAACCAACCA 62 291 716451 2734 2749 123759 123774 CCCAAGCTACAACTAT 67 292 716454 2803 2818 123828 123843 CGAGATTTAAATAAGG 27 293 716457 2883 2898 123908 123923 AAAGGATACATTCCAC 61 294 716460 2946 2961 123971 123986 TATTCTAAATGCATAC 86 295 716463 2998 3013 124023 124038 GACTGCCCCAACCAGA 64 296 716466 3071 3086 124096 124111 GTGGAGCACTCCCCTA 58 297 716469 3122 3137 124147 124162 GTTTGCTCCTTTCCAA 25 298 716472 3204 3219 124229 124244 GTCATGCACATTATGA 78 299 716475 3272 3287 124297 124312 CTTCCAAAACTAAGGC 63 300 716478 3330 3345 124355 124370 TATTTTAATCTAGTCG 46 301 716481 3382 3397 121835 121850 TCAGCATAGAAGTAGG 23 302 124407 124422 716484 3433 3448 124458 124473 CACTTTTCCAGCTAAC 35 303 716487 3541 3556 42912 42927 ACACATACTCTAGTTA 64 304 124566 124581 716490 3640 3655 124665 124680 ACAACCAACTATTACT 63 305 716493 3692 3707 124717 124732 ACATTGAAAGACCCTT 30 306 716496 3745 3760 124770 124785 GAAGAGATTTTATGCC 19 307 716499 3852 3867 124877 124892 TTTTGCCCTCCTCCAA 102 308 716502 3913 3928 124938 124953 CACAGTGATTGCATTT 11 309 716505 3996 4011 125021 125036 GATTTAATCTTTCTGC 35 310 716508 4065 4080 125090 125105 CTAGGTAGAATTTCAT 67 311 716511 4131 4146 125156 125171 GATCTTCTGCACATTA 51 312 716514 4201 4216 125226 125241 GCTGATATATAAGATA 68 313 716517 4255 4270 125280 125295 TTCACAACCCCCCCCC 53 314 716520 4312 4327 125337 125352 AGTCTTTATTAAAGAG 96 315 716523 4426 4441 125451 125466 CAAATTAAAGTTGAGG 37 316 716526 4481 4496 125506 125521 TCAAAGCACTGTGCCA 88 317 716529 4544 4559 125569 125584 CAAACTCAAAAAGGGA 61 318 716532 4615 4630 125640 125655 CAAGAAGCAGTTAAGC 70 319 716535 4737 4752 125762 125777 CCTGACTGAAAATAAC 86 320 716538 4789 4804 125814 125829 TCTGAAACTCCAAATC 77 321 716541 4840 4855 125865 125880 TAAAGGCACTACATTT 92 322 716544 4898 4913 125923 125938 TACTTAACACAGCAAC 71 323 716547 4986 5001 44309 44324 GGTATGAATTCTGAAT 44 324 126011 126026 716550 5037 5052 126062 126077 GCACTGAATATTGCCA 77 325 716553 5088 5103 126113 126128 ATCCACCTGAGCACTC 54 326 716556 5211 5226 126236 126251 GCATTAAAGAATTCTC 39 327 716559 5294 5309 126319 126334 CCTAACATATGAGCAT 62 328 716565 N/A N/A 5516 5531 GGGCTAACTACATTGC 129 329 716568 N/A N/A 5640 5655 GATTTTTTCTGAGTTC 72 330 716574 N/A N/A 11831 11846 TACACTGTATATGTTC 91 331 11769 11784 716577 N/A N/A 58766 58781 TCTGTCAGTTATCCTA 21 332 58782 58797
TABLE-US-00005 TABLE 5 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compound Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO 716347 64 79 3524 3539 TGCCTTTCCCCGCCTC 85 333 716350 129 144 3589 3604 CTCGGACCTGCGGCGC 99 334 716353 216 231 3676 3691 GCATCCCCCGCCCCGG 98 335 716356 296 311 3756 3771 CGAGGTGGAGAAGCGG 112 336 716359 348 363 3808 3823 CCCCTGACCCAGGCGA 101 337 716362 433 448 3893 3908 AGGCGGCTGCCCTTGG 94 338 716365 533 548 3993 4008 TCTGATGCCCGGCGGG 83 339 716368 652 667 4112 4127 GTCGGGCAGCTTCCGG 86 340 716371 733 748 7167 7182 TGGAGTCAGGGCTCCT 115 341 716374 802 817 7236 7251 GGTCAGTGTCCCAGGA 54 342 716377 876 891 7310 7325 GGTATCTCAAAAGAAG 76 343 716380 944 959 7378 7393 TTAAGAAGTATCTCTG 54 344 716383 1049 1064 55544 55559 TCATCATATTCTGCTG 98 345 716386 1110 1125 79051 79066 ATTTCTCCATCCTGAG 60 346 716389 1161 1176 79102 79117 AGCCTTGGGTCTAGCC 93 347 716392 1266 1281 98968 98983 CTGCCACCCATGACGC 95 348 716395 1331 1346 99033 99048 GCCGCAGCCTCTCCTT 92 349 716398 1382 1397 N/A N/A TATTCCGCATTGCCTG 70 350 716401 1440 1455 116629 116644 AACTGGCTACGCAGGG 92 351 716404 1519 1534 116708 116723 CGTCATTGTTCTCAAT 63 352 716407 1593 1608 120498 120513 CTTAGTCCACTGTCTG 35 353 716410 1668 1683 N/A N/A GTATCACCTGTATCCA 52 354 716413 1753 1768 122778 122793 TCCAAGGTCCACATTT 79 355 716416 1834 1849 122859 122874 AAGGATGTCAGAACTC 45 356 716419 1962 1977 122987 123002 TTTCCGGTGCATGTGT 36 357 716422 2030 2045 123055 123070 AGTATCTTGCTGGACG 39 358 716425 2081 2096 123106 123121 GCAATACATTAACAGC 71 359 716428* 2187 2202 123212 123227 ACAGGCTCACTTCCCC 10 360 716431* 2238 2253 123263 123278 AATGATTGGTGAACAT 55 361 716434* 2289 2304 123314 123329 TAAATGCTGTGACATG 44 362 716437 2349 2364 123374 123389 CCAGTAAATCATGTTT 41 363 716440 2406 2421 123431 123446 CTCTTCAAATCAGCAT 45 364 716443 2483 2498 123508 123523 TTATGTGACTAATGAT 73 365 716446 2597 2612 123622 123637 GCACACCCACAAAATT 83 366 716449 2700 2715 123725 123740 GGTCATTTGCCTAGGT 49 367 716452 2759 2774 123784 123799 TTACCAAAACAACTAC 98 368 716455 2849 2864 123874 123889 GTTATGTTTGGGTGTG 17 369 716458 2900 2915 123925 123940 AAGCAGGGAAACCTAA 94 370 716461 2963 2978 123988 124003 ATAAACTACTAGTCAT 123 371 716464 3015 3030 124040 124055 TACTTCAAACATCTGC 62 372 716467 3088 3103 124113 124128 CCGTATGCCCAGAGGG 99 373 716470 3170 3185 124195 124210 AATCGAGACTTAAAAA 104 374 716473 3221 3236 124246 124261 CTATAAAGCTTATTTC 104 375 716476 3292 3307 124317 124332 GAACTACAAACTAGAA 91 376 716479 3348 3363 124373 124388 GAACAATCTTGAAGGC 32 377 716482 3399 3414 124424 124439 CTATCCAGGGTCAATT 83 378 716485 3461 3476 124486 124501 ACTACCAATATACATT 84 379 716488 3558 3573 38751 38766 CATTATTACTCCTGTA 67 380 124583 124598 716491 3658 3673 124683 124698 CTGGTGCCACTTTAAT 54 381 716494 3709 3724 124734 124749 AAGGGCTTATTCTAGA 112 382 716497 3762 3777 124787 124802 AGCAGCTTTTGCCAGG 65 383 716500 3869 3884 124894 124909 AACTTCTTACTTCCAA 18 384 716503 3951 3966 124976 124991 TTATTATGAGTGATCA 33 385 716506 4031 4046 125056 125071 TCTGCAGTGGCCATTT 62 386 716509 4083 4098 125108 125123 TATACCCAATTTTGCA 70 387 716512 4150 4165 125175 125190 ACTCCTTCCAAGTAGC 99 388 716515 4218 4233 125243 125258 TAAGCTAAAGCTAATC 123 389 716518 4272 4287 125297 125312 CAAGGTCCCCCTAAAT 88 390 716521 4329 4344 125354 125369 CAGCACGGTGTAAGAC 79 391 716524 4443 4458 125468 125483 ACTGAGGTATAACTGG 35 392 716527 4502 4517 125527 125542 AGTACAGAGGGCATCG 64 393 716530 4561 4576 125586 125601 ACATCAAGGCTATGAT 83 394 716533 4666 4681 125691 125706 CAATTCAAGAATACCC 64 395 716536 4754 4769 125779 125794 AAGTAGATCTAAGAAG 94 396 716539 4806 4821 125831 125846 AATAGTGCTTTGGAAG 59 397 716542 4863 4878 125888 125903 CTTCCCTGTGTTCATT 45 398 716545 4916 4931 125941 125956 GCATGTATTTAATATG 91 399 716548 5003 5018 126028 126043 GAGTTTCAACACTGAT 31 400 716551 5054 5069 126079 126094 CGCTAGAAAAGTGTTA 76 401 716554 5105 5120 126130 126145 ATGCTTGCGAGGATAA 30 402 716557 5243 5258 126268 126283 ATTGGTACTATATATA 80 403 716560 5312 5327 126337 126352 TAACAATTTATGTAAG 107 404 716563 N/A N/A 5445 5460 TGAAGCAAGTTCTCAA 126 405 716566 N/A N/A 5552 5567 GGTAACTCTTCTTTCC 102 406 716569 N/A N/A 5674 5689 CTCCTTAACCCGGGTT 115 407 716572 N/A N/A 126465 126480 CAGTAAGAAGCCAAAA 122 408 716575 N/A N/A 30867 30882 AAAGAACTTAGTTCCC 84 409 31189 31204 716578 N/A N/A 70445 70460 AACTTTCACATAAACT 102 410 70695 70710
TABLE-US-00006 TABLE 6 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compound Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO 716348 84 99 3544 3559 ACGGAGGCCGGACAGC 107 411 716351 166 181 3626 3641 GGTCTGGCGGCTGCGC 112 412 716354 251 266 3711 3726 TCGCTCTCAGGGCCGG 114 413 716357 314 329 3774 3789 CGCCCCGGCTCCACGG 127 414 716360 388 403 3848 3863 CTGCCCGGGATCCATG 118 415 716363 467 482 3927 3942 CGGACGGCGGGCCCTG 103 416 716366 568 583 4028 4043 CAGGTCGGTCTCCGAG 95 417 716369 670 685 4130 4145 CGGCGGCTTGAAGAAG 94 418 716372 751 766 7185 7200 ATGAGCTCGAACATGC 61 419 716375 819 834 7253 7268 GAGACTACTCCAGTGG 63 420 716378 893 908 7327 7342 GCAGAGGTACATCATC 44 421 716381 961 976 55456 55471 TGTCTGATCGATGTGA 35 422 716384 1066 1081 N/A N/A AGGACCTGAAGCCGAG 71 423 716387 1127 1142 79068 79083 TATGGTTTATATAGTA 33 424 716390 1189 1204 N/A N/A TCTCTGGTTCATGGCA 66 425 716393 1285 1300 98987 99002 TTGCTGCTGGTTGGAG 46 426 716396 1348 1363 99050 99065 CAGTTCTTGCTGTTTC 123 427 716399 1403 1418 102535 102550 AATTTGCTGTGCTGGG 40 428 716402 1474 1489 116663 116678 ATTTTGAGTCCCACCA 85 429 716405 1547 1562 116736 116751 TGTTAAGGAAAGGATC 149 430 716408 1610 1625 120515 120530 CACTGTAGCTGCTCAT 54 431 716411 1700 1715 122725 122740 TCTGCTGTGAGGGCAG 102 432 716414 1777 1792 122802 122817 GTTCATTCCATCTCCT 59 433 716417 1891 1906 122916 122931 TGTAAGAAAGCTTTCT 78 434 716420 1979 1994 24076 24091 CAACTGGCTTATGGAA 50 435 123004 123019 716423 2047 2062 71297 71312 GCAAAATAGAGGATTA 43 436 123072 123087 716426 2115 2130 123140 123155 TTTGATTCTTTAGAGC 45 437 716429* 2204 2219 123229 123244 TGGCATCCATCATCCA 28 438 716432* 2255 2270 123280 123295 TCTGAGTATTTAGTTA 30 439 716435* 2306 2321 123331 123346 ACAACTGTTGAACAAA 45 440 716438 2366 2381 123391 123406 ATTTTTGGCTTGTCAG 32 441 716441 2423 2438 123448 123463 GCCTTGGTTTCAGCTA 57 442 716444 2528 2543 123553 123568 AAATTGTCTCATGCCT 40 443 716447 2666 2681 123691 123706 CCAACCAACCCCCCCA 97 444 716450 2717 2732 123742 123757 AACAGATTCACTAATA 83 445 716453 2786 2801 123811 123826 GGTAAAAAAAACCAGG 87 446 716456 2866 2881 123891 123906 ACCACACTATTATAAA 96 447 716459 2926 2941 123951 123966 CGCTACCATTTTAAAA 121 448 716462 2981 2996 124006 124021 TTAAACTACCAGTGAA 86 449 716465 3036 3051 124061 124076 GCTCTTTCTAGAACAC 82 450 716468 3105 3120 124130 124145 TCATCAGATAATATCT 118 451 716471 3187 3202 124212 124227 CCTACTCACTGAATTC 48 452 716474 3238 3253 124263 124278 TAAATGAAGGTAAACC 120 453 716477 3309 3324 124334 124349 GTGTTCATTACAAATG 42 454 716480 3365 3380 124390 124405 GCAAGTCTTGTAAGTA 18 455 716483 3416 3431 15582 15597 CAAAACCTTATAGTAT 159 456 82739 82754 124441 124456 716486 3494 3509 124519 124534 ATCATGATTATCTCTA 68 457 716489 3606 3621 124631 124646 AGTTAATTCATGCTCG 23 458 716492 3675 3690 124700 124715 AAACACAGAGGTGCTA 72 459 716495 3728 3743 124753 124768 GTTATGAACCCTTGAA 58 460 716498 3833 3848 124858 124873 GAAGGGCCAAAATACT 92 461 716501 3891 3906 124916 124931 GCACTGAAAGTACTTA 32 462 716504 3970 3985 6107 6122 ATAAAAGCCTTAGAGT 112 463 62583 62598 124995 125010 716507 4048 4063 125073 125088 ACTACTCTAAAACTCC 53 464 716510 4102 4117 125127 125142 CAACATGCTATGTAAT 122 465 716513 4184 4199 125209 125224 AATCTTAATCTGTGGC 30 466 716516 4237 4252 125262 125277 AACTTTCCCACCCTCC 84 467 716519 4290 4305 125315 125330 GTTTATAAAGTTCTCT 57 468 716522 4363 4378 125388 125403 GTGACTGAAACTCTAG 47 469 716525 4460 4475 125485 125500 CACAGTACTGCTACAA 64 470 716528 4520 4535 125545 125560 TTAGGTCTCCTTCAGG 70 471 716531 4580 4595 125605 125620 GGACATAAAACAAGAG 65 472 716534 4693 4708 125718 125733 GATTATAAAATTGGTT 90 473 716537 4772 4787 125797 125812 ATGTGCTCCATCAACC 36 474 716540 4823 4838 125848 125863 GAAAAGTTATTACAAC 120 475 716543 4880 4895 125905 125920 TATTTGTAGCAAAGTC 35 476 716546 4968 4983 125993 126008 CACAATTAATTACTGT 103 477 716549 5020 5035 126045 126060 CCACTTTTGCAATGTT 44 478 716552 5071 5086 126096 126111 TTTCTCAGATGTACCA 53 479 716555 5167 5182 126192 126207 TACTTTTTCAAGATAC 99 480 716558 5277 5292 126302 126317 CTCTTACATCTAAAAC 81 481 716561 5338 5353 126363 126378 AAGGTATTACATAAGA 58 482 716564 N/A N/A 5479 5494 CTTTTGGGCAAAGTTC 103 483 716567 N/A N/A 5599 5614 GACTATACAACAGGCC 134 484 716570 N/A N/A 5717 5732 AAGTGTTTAGGCAAGC 56 485 716573 N/A N/A 126516 126531 AGTTACTACTGTAATC 116 486 716576 N/A N/A 58764 58779 TGTCAGTTATCCTATC 52 487 58780 58795 716579 N/A N/A 94212 94227 ATAGAGATTTTCCCTC 84 488 103505 103520
TABLE-US-00007 TABLE 7 Inhibition of Yap1 nRNA by 3-10-3 cEt gapmers targeting SEQ ID NO: 3, and 4 SEQ ID SEQ ID SEQ ID SEQ ID NO: 3 NO: 3 NO: 4 NO: 4 YAP1 Compound Start Stop Start Stop (% SEQ ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO 716562 N/A N/A 1359 1374 GCCTGCCGAAGCAGTT 103 489 716571 1062 1077 N/A N/A GCTGAAGCCGAGTTCA 91 490
Example 3
Antisense Inhibition of Human Yap1 in A-431 Cells by cEt Gapmers
[0560] Modified oligonucleotides were designed to target a Yap1 nucleic acid and were tested for their effect on Yap1 mRNA level in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured A-431 cells at a density of 5,000 cells per well were treated using free uptake with 2,000 nM of modified oligonucleotide. After a treatment period of approximately 48 hours, RNA was isolated from the cells and Yap1 mRNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS36584 (forward sequence ACGACCAATAGCTCAGATCCT, designated herein as SEQ ID NO.: 14; reverse sequence CACCTGTATCCATCTCATCCAC, designated herein as SEQ ID NO.: 15; probe sequence TGTAGCTGCTCATGCTTAGTCCACTG, designated herein as SEQ ID NO.: 16) was used to measure mRNA levels. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). The modified oligonucleotides with percent control values marked with an asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides targeting the amplicon region.
[0561] The newly designed modified oligonucleotides in the Tables below were designed as 3-10-3 cEt gapmers. The gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on the 5′ direction and the 3′ direction comprising three nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has a cEt sugar modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P═S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.
[0562] “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either SEQ ID NO.: 1 or SEQ ID NO.: 2. ‘N/A’ indicates that the modified oligonucleotide does not target that particular gene sequence with 100% complementarity. ‘N.D.’ indicates that the % UTC is not defined for that particular modified oligonucleotide in that particular experiment. Activity of the modified oligonucleotide may be defined in a different experiment.
TABLE-US-00008 TABLE 8 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compound Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO 715483 3570 3585 124595 124610 CTCTTTGGAAACCATT 2 206 715491 3638 3653 124663 124678 AACCAACTATTACTTC 8 131 958348 556 571 4016 4031 CGAGTCCCCGCGGACG 122 491 958349 557 572 4017 4032 CCGAGTCCCCGCGGAC 81 492 958350 558 573 4018 4033 TCCGAGTCCCCGCGGA 106 493 958351 560 575 4020 4035 TCTCCGAGTCCCCGCG 67 494 958352 563 578 4023 4038 CGGTCTCCGAGTCCCC 110 495 958353 564 579 4024 4039 TCGGTCTCCGAGTCCC 43 496 958354 565 580 4025 4040 GTCGGTCTCCGAGTCC 31 497 958355 611 626 4071 4086 CGTTGGCCGTCTTGGG 51 498 958356 663 678 4123 4138 TTGAAGAAGGAGTCGG 9 499 958357 667 682 4127 4142 CGGCTTGAAGAAGGAG 12 500 958358 669 684 4129 4144 GGCGGCTTGAAGAAGG 34 501 958359 709 724 7143 7158 TGCATCAGTACTGGCC 117 502 958360 745 760 7179 7194 TCGAACATGCTGTGGA 12 503 958361 747 762 7181 7196 GCTCGAACATGCTGTG 8 504 958362 748 763 7182 7197 AGCTCGAACATGCTGT 58 505 958363 750 765 7184 7199 TGAGCTCGAACATGCT 70 506 958364 969 984 55464 55479 CATGTTGTTGTCTGAT 19 507 958365 971 986 55466 55481 GCCATGTTGTTGTCTG 34 508 958366 1607 1622 120512 120527 TGTAGCTGCTCATGCT 16* 509 958367 1871 1886 122896 122911 CTAGCTTGGTGGCAGC 105 510 958368 1873 1888 122898 122913 ATCTAGCTTGGTGGCA 11 511 958369 1875 1890 122900 122915 TTATCTAGCTTGGTGG 4 512 958370 1877 1892 122902 122917 CTTTATCTAGCTTGGT 7 513 958371 3637 3652 124662 124677 ACCAACTATTACTTCA 2 514 958372 3666 3681 124691 124706 GGTGCTAGCTGGTGCC 49 515 958373 3667 3682 124692 124707 AGGTGCTAGCTGGTGC 8 516 958374 3670 3685 124695 124710 CAGAGGTGCTAGCTGG 38 517 958375 3967 3982 11044 11059 AAAGCCTTAGAGTCAA 2 518 124992 125007 958376 1392 1407 102524 102539 CTGGGATTGATATTCC 31 519 958377 1393 1408 102525 102540 GCTGGGATTGATATTC 9 520 958378 N/A N/A 7141 7156 CATCAGTACTGGCCTA 25 521 958379 N/A N/A 3336 3351 GCGCCCGCCCGCACCG 124 522 958380 N/A N/A 3337 3352 CGCGCCCGCCCGCACC 106 523 958381 N/A N/A 3344 3359 TCCTCTGCGCGCCCGC 146 524 958382 N/A N/A 3345 3360 TTCCTCTGCGCGCCCG 111 525 958383 N/A N/A 3346 3361 CTTCCTCTGCGCGCCC 96 526 958384 N/A N/A 3347 3362 CCTTCCTCTGCGCGCC 131 527 958385 N/A N/A 4548 4563 GCGCGCGCATTGTGCA 115 528 958386 N/A N/A 4549 4564 GGCGCGCGCATTGTGC 111 529 958387 N/A N/A 4551 4566 GAGGCGCGCGCATTGT 131 530 958388 N/A N/A 4552 4567 GGAGGCGCGCGCATTG 112 531 958389 N/A N/A 4553 4568 CGGAGGCGCGCGCATT 126 532 958390 N/A N/A 4571 4586 GCGAAGGTGCGGAGCG 145 533 958391 N/A N/A 4572 4587 AGCGAAGGTGCGGAGC 102 534 958392 N/A N/A 5148 5163 CTATGAGTCAACCTGC 50 535 958393 N/A N/A 5150 5165 GCCTATGAGTCAACCT 89 536 958394 N/A N/A 8647 8662 TTGAAACCTGATCCTT 54 537 958395 N/A N/A 8821 8836 CTAACAACCTGGTTTG 114 538 958396 N/A N/A 8909 8924 AGGCTATTAAGCTGTT 131 539 958397 N/A N/A 8910 8925 CAGGCTATTAAGCTGT 127 540 958398 N/A N/A 8911 8926 GCAGGCTATTAAGCTG 76 541 958399 N/A N/A 10927 10942 GACCAACTACTTGAAG 45 542 958400 N/A N/A 10929 10944 TTGACCAACTACTTGA 26 543 958401 N/A N/A 10964 10979 AGTTATTCAGCAGCTT 19 544 958402 N/A N/A 29057 29072 CTCTTACACAGCCTAG 28 545 958403 N/A N/A 36596 36611 CAGTTTATGTAGTAGT 5 546 958404 N/A N/A 37602 37617 GCACACAACTCAGACA 52 547 958405 N/A N/A 44925 44940 TTATGGGATGAGTGCT 24 548 958406 N/A N/A 55773 55788 TTTCAGTTATCGGCCC 29 549 958407 N/A N/A 63319 63334 AATACTGATCTGCAGC 35 550 958408 N/A N/A 64348 64363 CTATATATGGTAGTCT 20 551 958409 N/A N/A 79120 79135 TTACCAAAACGAGGGT 99 552 958410 N/A N/A 79121 79136 TTTACCAAAACGAGGG 70 553 958411 N/A N/A 79122 79137 CTTTACCAAAACGAGG 90 554 958412 N/A N/A 79124 79139 ACCTTTACCAAAACGA 49 555 958413 N/A N/A 90343 90358 CTAGTAATCTTACTGG 80 556 958414 N/A N/A 102402 102417 CAGAATTCCCAAGCTA 73 557 958415 N/A N/A 102449 102464 CTGTGTAGGCTGACTT 16 558 958416 N/A N/A 102450 102465 GCTGTGTAGGCTGACT 36 559 958417 N/A N/A 102483 102498 ACGGATAAAAATTACT 85 560 958418 N/A N/A 102558 102573 AGAGCCTACCTGACAT 47 561 958419 N/A N/A 102560 102575 TAAGAGCCTACCTGAC 68 562 958420 N/A N/A 109095 109110 TTCATAATCTGACTAG 66 563 958421 N/A N/A 112417 112432 CTCCGTGGTGATCCCA 13 564 958422 N/A N/A 115003 115018 TTTCTTAACCAGCGGA 15 565 958423 N/A N/A 121122 121137 GATCAACATGCTAACA 51 566
TABLE-US-00009 TABLE 9 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compound Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO 715483 3570 3585 124595 124610 CTCTTTGGAAACCATT 1 206 958436 91 106 3551 3566 TCCCTTGACGGAGGCC 124 567 958441 281 296 3741 3756 GCGACGGCTGCGGGCC 72 568 958446 346 361 3806 3821 CCTGACCCAGGCGAGC 70 569 958451 538 553 3998 4013 CACGATCTGATGCCCG 10 570 958456 824 839 7258 7273 GGCCAGAGACTACTCC 90 571 958461 1355 1370 99057 99072 GCCGAAGCAGTTCTTG 79 572 958466 1840 1855 122865 122880 GTCATTAAGGATGTCA 9 573 958471 1943 1958 122968 122983 CTTAGATCCTTCACAG 14 574 958476 1961 1976 122986 123001 TTCCGGTGCATGTGTC 2 575 958481 1980 1995 123005 123020 GCAACTGGCTTATGGA 6 576 958486 2106 2121 123131 123146 TTAGAGCCAACTGTGA 9 577 958491 2291 2306 123316 123331 ACTAAATGCTGTGACA 4 578 958496 2515 2530 123540 123555 CCTTATAAGCTCCTAA 3 579 958501 2693 2708 123718 123733 TGCCTAGGTTCCGACA 41 580 958506 2812 2827 123837 123852 GCAGATAATCGAGATT 6 581 958511 2870 2885 123895 123910 CACTACCACACTATTA 31 582 958516 3003 3018 124028 124043 CTGCAGACTGCCCCAA 38 583 958521 3112 3127 124137 124152 TTCCAATTCATCAGAT 14 584 958526 3353 3368 124378 124393 AGTAAGAACAATCTTG 6 585 958531 3371 3386 124396 124411 GTAGGAGCAAGTCTTG 5 586 958536 3393 3408 124418 124433 AGGGTCAATTTTCAGC 3 587 958541 3404 3419 124429 124444 GTATTCTATCCAGGGT 4 588 958546 3538 3553 124563 124578 CATACTCTAGTTACAT 6 589 958551 3550 3565 124575 124590 CTCCTGTAGACACATA 5 590 958556 3639 3654 124664 124679 CAACCAACTATTACTT 10 591 958561 3673 3688 124698 124713 ACACAGAGGTGCTAGC 48 592 958566 3935 3950 124960 124975 ACCTATGAACTATTAT 18 593 958571 4105 4120 125130 125145 CAACAACATGCTATGT 43 594 958576 4173 4188 125198 125213 GTGGCTACTGGCAAAT 53 595 958581 4203 4218 125228 125243 CTGCTGATATATAAGA 26 596 958586 4331 4346 125356 125371 GGCAGCACGGTGTAAG 78 597 958591 4461 4476 125486 125501 TCACAGTACTGCTACA 38 598 958596 4610 4625 125635 125650 AGCAGTTAAGCACTTT 3 599 958601 4844 4859 125869 125884 CCTTTAAAGGCACTAC 17 600 958606 5087 5102 126112 126127 TCCACCTGAGCACTCA 31 601 958611 5284 5299 126309 126324 GAGCATGCTCTTACAT 92 602 958616 1141 1156 79082 79097 GGTGGTCTTGTTCTTA 10 603 958621 1172 1187 79113 79128 AACGAGGGTCAAGCCT 29 604 958626 N/A N/A 5475 5490 TGGGCAAAGTTCCTAT 158 605 958631 N/A N/A 5583 5598 TGCAAATAGGAGAGGG 122 606 958636 N/A N/A 3328 3343 CCGCACCGCGGCCCGG 126 607 958641 N/A N/A 7512 7527 AGCTACAGAGCTTAAC 102 608 958646 N/A N/A 10769 10784 TATTATATGGCTAAGC 26 609 958651 N/A N/A 12678 12693 AACTAAAGAGGACTTA 62 610 958656 N/A N/A 17870 17885 ACGCAATCTGTGATCC 48 611 958661 N/A N/A 21191 21206 TGCCGTTGGCCCCTCC 120 612 958666 N/A N/A 24643 24658 GAAAAGGGCAATCATA 52 613 958671 N/A N/A 30409 30424 CATTATATGGCACCCA 19 614 958676 N/A N/A 31186 31201 GAACTTAGTTCCCTAT 34 615 958681 N/A N/A 34104 34119 AATTAACACCTGAGCT 84 616 958686 N/A N/A 36190 36205 CGCAATATAGTCTATA 4 617 958691 N/A N/A 38179 38194 TCAGTTGGCAACAGTC 20 618 958696 N/A N/A 40280 40295 GCATACTACACTATAA 56 619 958701 N/A N/A 41534 41549 TTAAACTAGGCACATT 98 620 958706 N/A N/A 45392 45407 TCGCATGGCCACTGCC 112 621 958711 N/A N/A 48862 48877 CCAAATAAGGATCTGT 34 622 958716 N/A N/A 54493 54508 ATGGACTGTATGCAGC 84 623 958721 N/A N/A 56973 56988 GTAGTATAATGAGTTA 1 624 105504 105519 958726 N/A N/A 58765 58780 CTGTCAGTTATCCTAT 3 625 58781 58796 958731 N/A N/A 58768 58783 GCTCTGTCAGTTATCC 7 626 58784 58799 59523 59538 958736 N/A N/A 62193 62208 GTGATATGGATTCTGT 3 627 958741 N/A N/A 66072 66087 GTTACTGCAACTGCCC 14 628 958746 N/A N/A 70253 70268 GTTATCCTCTATAGTC 22 629 958751 N/A N/A 75535 75550 TCAATGCAGGATTCCA 30 630 958756 N/A N/A 79463 79478 GTGTTGCATGACAGCC 15 631 958761 N/A N/A 82824 82839 AGTCTCAACAACCTTC 7 632 958766 N/A N/A 86559 86574 TAACATATGTCTACTC 23 633 958771 N/A N/A 92071 92086 CTACAGACGAATTCCA 18 634 958776 N/A N/A 94770 94785 GGTACTCTCCTTCAGA 94 635 958781 N/A N/A 97391 97406 GTCATCTATGTGTCCT 6 636 958786 N/A N/A 99922 99937 TATGTCCTACTTTCCC 10 637 958791 N/A N/A 102044 102059 CATAAGAAAAGACGAC 123 638 958796 N/A N/A 103309 103324 ATTATATGGTTGCTTC 3 639 958801 N/A N/A 108999 109014 CGCTAGCACGCGCGCT 131 640 958806 N/A N/A 112159 112174 TGCCTAGGGTTCTGTG 30 641 958811 N/A N/A 115185 115200 CACTGAGGCACGGCCC 92 642 958816 N/A N/A 120622 120637 GTGATAACATATCCCA 71 643
TABLE-US-00010 TABLE 10 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compound Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO 715483 3570 3585 124595 124610 CTCTTTGGAAACCATT 2 206 958437 134 149 3594 3609 AGGCACTCGGACCTGC 84 644 958442 290 305 3750 3765 GGAGAAGCGGCGACGG 21 645 958447 404 419 3864 3879 GTTGAGGCGGCGGCTG 48 646 958452 571 586 4031 4046 CTCCAGGTCGGTCTCC 26 647 958457 857 872 7291 7306 GTCGAAGATGCTGAGC 5 648 958462 1439 1454 116628 116643 ACTGGCTACGCAGGGC 46 649 958467 1864 1879 122889 122904 GGTGGCAGCCAAAACA 32 650 958472 1945 1960 122970 122985 TCCTTAGATCCTTCAC 5 651 958477 1963 1978 122988 123003 ATTTCCGGTGCATGTG 2 652 958482 2000 2015 123025 123040 TCTGTATTAGCCTGAA 10 653 958487 2192 2207 123217 123232 TCCAAACAGGCTCACT 10 654 958492 2356 2371 123381 123396 TGTCAGACCAGTAAAT 12 655 958497 2534 2549 123559 123574 ATATGGAAATTGTCTC 1 656 958502 2722 2737 123747 123762 CTATTAACAGATTCAC 13 657 958507 2814 2829 123839 123854 GAGCAGATAATCGAGA 6 658 958512 2875 2890 123900 123915 CATTCCACTACCACAC 14 659 958517 3030 3045 124055 124070 TCTAGAACACTAAACT 88 660 958522 3156 3171 124181 124196 AATTAGTCCAAGGGAG 32 661 958527 3356 3371 124381 124396 GTAAGTAAGAACAATC 4 662 958532 3374 3389 124399 124414 GAAGTAGGAGCAAGTC 2 663 958537 3394 3409 124419 124434 CAGGGTCAATTTTCAG 3 664 79237 79252 958542 3408 3423 124433 124448 TATAGTATTCTATCCA 4 665 96503 96518 102951 102966 958547 3540 3555 124565 124580 CACATACTCTAGTTAC 4 666 56579 56594 958552 3555 3570 124580 124595 TATTACTCCTGTAGAC 16 667 958557 3641 3656 124666 124681 CACAACCAACTATTAC 10 668 958562 3691 3706 124716 124731 CATTGAAAGACCCTTA 6 669 958567 3938 3953 124963 124978 TCAACCTATGAACTAT 3 670 958572 4159 4174 125184 125199 ATTATAGGCACTCCTT 5 671 958577 4176 4191 125201 125216 TCTGTGGCTACTGGCA 4 672 958582 4206 4221 125231 125246 AATCTGCTGATATATA 21 673 958587 4364 4379 125389 125404 GGTGACTGAAACTCTA 2 674 958592 4488 4503 125513 125528 CGTAAGATCAAAGCAC 12 675 958597 4626 4641 125651 125666 CCCAATACAACCAAGA 6 676 958602 4936 4951 125961 125976 TGCCATGTTCCATATA 16 677 958607 5109 5124 126134 126149 CAACATGCTTGCGAGG 11 678 958612 5295 5310 126320 126335 ACCTAACATATGAGCA 18 679 958617 1143 1158 79084 79099 GAGGTGGTCTTGTTCT 40 680 958622 1384 1399 102516 102531 GATATTCCGCATTGCC 3 681 958627 N/A N/A 5476 5491 TTGGGCAAAGTTCCTA 61 682 958632 N/A N/A 5610 5625 CTCCGACAGGAGACTA 55 683 958637 N/A N/A 4394 4409 CCGCAGAGAGAAACTC 101 684 958642 N/A N/A 8249 8264 GACATCAATTTCAGTC 91 685 958647 N/A N/A 10939 10954 TAGGAAGTTGTTGACC 11 686 958652 N/A N/A 14156 14171 GCTACGACGGCTGGCC 136 687 958657 N/A N/A 18786 18801 CAGTATAATATCCTAA 37 688 958662 N/A N/A 21800 21815 GAACAGATAGGACTAC 51 689 958667 N/A N/A 25870 25885 TGCCGGGCCCCTATGC 80 690 958672 N/A N/A 30864 30879 GAACTTAGTTCCCTTC 67 691 958677 N/A N/A 31187 31202 AGAACTTAGTTCCCTA 51 692 958682 N/A N/A 34164 34179 CCATGAGGGACTCCCA 123 693 958687 N/A N/A 36660 36675 ACACTATGTGTTCTGC 57 694 958692 N/A N/A 39314 39329 GGCTAGAGGCCGGGTG 105 695 958697 N/A N/A 40306 40321 CTAAAGATGACTACTG 39 696 958702 N/A N/A 41672 41687 TGATGTCTTGTCCAGA 16 697 958707 N/A N/A 46503 46518 TCAATGCTGTATCAGA 23 698 958712 N/A N/A 49103 49118 TTATATAGGTTACAGA 52 699 958717 N/A N/A 55730 55745 AATAATATAGCTTACG 11 700 958722 N/A N/A 57612 57627 CATAATAGGACACAAC 59 701 958727 N/A N/A 58767 58782 ATCTGTCAGTTATCCT 2 702 958732 N/A N/A 59675 59690 AGCACGGTGTAGCTTT 60 703 958737 N/A N/A 62586 62601 GGAATACAAGCCCGAG 8 704 958742 N/A N/A 66232 66247 AGCAATATGGTATTAG 4 705 958747 N/A N/A 72144 72159 GTAAAGAGGGTGACAT 106 706 958752 N/A N/A 75582 75597 GAATTTTTAGTCCAGT 2 707 958757 N/A N/A 79978 79993 GTGATCTGCACATTGT 5 708 958762 N/A N/A 84225 84240 GATTAGAGGACTCATT 16 709 958767 N/A N/A 86751 86766 ACGAATAAGGCATTAG 6 710 958772 N/A N/A 92334 92349 CAACAAACATAGTTAC 61 711 958777 N/A N/A 94786 94801 GTAACTGTTTCTAGGT 10 712 958782 N/A N/A 97670 97685 ATGGTCTCCCAGTCAC 20 713 958787 N/A N/A 101109 101124 TGGGCAAAGTTCCTCT 67 714 958792 N/A N/A 102355 102370 GCCAATGGAGTCACCA 46 715 958797 N/A N/A 105351 105366 ACGAGCACAGCACCCT 13 716 958802 N/A N/A 110683 110698 AGATAATCATCCTCAA 25 717 958807 N/A N/A 112517 112532 TCATTGTAGTCTGTCT 3 718 958812 N/A N/A 115821 115836 TACTATAAGACACCAA 31 719 958817 N/A N/A 121734 121749 TGCCAGGTAAGCCACA 30 720
TABLE-US-00011 TABLE 11 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compound Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO 715483 3570 3585 124595 124610 CTCTTTGGAAACCATT 1 206 958438 181 196 3641 3656 CGCCCCGGCTCCACTG 61 721 958443 306 321 3766 3781 CTCCACGGGCCGAGGT 90 722 958448 437 452 3897 3912 GCGAAGGCGGCTGCCC 86 723 958453 635 650 4095 4110 GCCTCATGGGCACGGT 70 724 958458 1006 1021 55501 55516 GTTCATCTGGGACAGC 12 725 958463 1502 1517 116691 116706 CCTGAGACATCCCGGG 63 726 958468 1866 1881 122891 122906 TTGGTGGCAGCCAAAA 86 727 958473 1948 1963 122973 122988 GTCTCCTTAGATCCTT 5 728 958478 1967 1982 122992 123007 GGAAATTTCCGGTGCA 14 729 958483 2039 2054 123064 123079 GAGGATTAAAGTATCT 17 730 958488 2209 2224 123234 123249 AGGAATGGCATCCATC 41 731 958493 2435 2450 123460 123475 AAACAGTCTTCAGCCT 16 732 958498 2561 2576 74512 74527 GAGTATGTGGCAATAA 1 733 123586 123601 958503 2740 2755 123765 123780 AACCATCCCAAGCTAC 15 734 958508 2816 2831 123841 123856 GAGAGCAGATAATCGA 7 735 958513 2927 2942 123952 123967 GCGCTACCATTTTAAA 104 736 958518 3047 3062 124072 124087 CCACAGTAATAGCTCT 1 737 958523 3174 3189 124199 124214 TTCCAATCGAGACTTA 3 738 958528 3362 3377 124387 124402 AGTCTTGTAAGTAAGA 18 739 958533 3379 3394 124404 124419 GCATAGAAGTAGGAGC 3 740 958538 3397 3412 31598 31613 ATCCAGGGTCAATTTT 10 741 124422 124437 958543 3412 3427 124437 124452 ACCTTATAGTATTCTA 4 742 958548 3542 3557 124567 124582 GACACATACTCTAGTT 21 743 958553 3559 3574 38752 38767 CCATTATTACTCCTGT 1 744 121706 121721 124584 124599 958558 3643 3658 124668 124683 TTCACAACCAACTATT 9 745 958563 3759 3774 124784 124799 AGCTTTTGCCAGGAGA 3 746 958568 3947 3962 124972 124987 TATGAGTGATCAACCT 5 747 958573 4164 4179 125189 125204 GGCAAATTATAGGCAC 2 748 958578 4181 4196 125206 125221 CTTAATCTGTGGCTAC 4 749 958583 4210 4225 125235 125250 AGCTAATCTGCTGATA 89 750 958588 4373 4388 125398 125413 GTGTACTTAGGTGACT 10 751 958593 4506 4521 125531 125546 GGTCAGTACAGAGGGC 7 752 958598 4636 4651 125661 125676 CCCAATGCTACCCAAT 4 753 958603 4987 5002 44310 44325 TGGTATGAATTCTGAA 3 754 75463 75478 126012 126027 958608 5136 5151 126161 126176 TGATAGGCACACCCAC 11 755 958613 1062 1077 55557 55572 CCTGAAGCCGAGTTCA 15 756 958618 1149 1164 79090 79105 AGCCAAGAGGTGGTCT 36 757 958623 1386 1401 102518 102533 TTGATATTCCGCATTG 3 758 958628 N/A N/A 5514 5529 GCTAACTACATTGCAG 81 759 958633 N/A N/A 5656 5671 TGTCATCAGGTTAAGT 76 760 958638 N/A N/A 4565 4580 GTGCGGAGCGCGCGGA 127 761 958643 N/A N/A 8457 8472 TAGCAACCCACCCTGG 59 762 958648 N/A N/A 10980 10995 GAATACTGAGTCAGGA 7 763 958653 N/A N/A 15503 15518 TTACACACAGGCTATG 17 764 958658 N/A N/A 18787 18802 ACAGTATAATATCCTA 6 765 958663 N/A N/A 22200 22215 CTATTAGGGACTGAAC 32 766 958668 N/A N/A 27649 27664 GTGATCTGTGAGAGGT 2 767 958673 N/A N/A 30865 30880 AGAACTTAGTTCCCTT 30 768 958678 N/A N/A 32244 32259 GGAGGAGTCACCATGG 74 769 958683 N/A N/A 34256 34271 TATTGTGCTGCATCTC 16 770 958688 N/A N/A 36686 36701 GGCTATGTAGCCTTCC 82 771 958693 N/A N/A 39371 39386 GTGGTGTCTCACAGGC 99 772 958698 N/A N/A 40400 40415 CTTATTAGCCCTCAAA 30 773 958703 N/A N/A 43429 43444 GATAACTAAGCACTAC 49 774 958708 N/A N/A 46790 46805 ATGTCAGATGTCAATT 19 775 958713 N/A N/A 50391 50406 TGCTAGAGGCTGTTCC 55 776 958718 N/A N/A 55941 55956 GAACACTATAGCTTGG 4 777 958723 N/A N/A 58021 58036 AACCCACTAAAACCGG 63 778 958728 N/A N/A 45026 45041 TATCTGTCAGTTATCC 10 779 58768 58783 58784 58799 958733 N/A N/A 60397 60412 TAATAGACTAGACTTA 67 780 958738 N/A N/A 63528 63543 TCTATATGTTTCCCCC 11 781 958743 N/A N/A 66740 66755 GACTATAAAGGGTTTA 30 782 958748 N/A N/A 72564 72579 ACATGTGACATTCCGG 83 783 958753 N/A N/A 76248 76263 TGTATATGCCGTTCCC 4 784 958758 N/A N/A 79985 80000 CTATTCAGTGATCTGC 2 785 958763 N/A N/A 84603 84618 CACAATACAAGATGCA 3 786 958768 N/A N/A 87653 87668 GTGCAAGCAGGTTCCC 17 787 958773 N/A N/A 93005 93020 AGCTGGTAGGGCAAGA 43 788 958778 N/A N/A 95129 95144 GCTACCTGGAGCGAAG 75 789 958783 N/A N/A 98257 98272 TGATCTGATGCTTGCT 35 790 958788 N/A N/A 101110 101125 CTGGGCAAAGTTCCTC 54 791 958793 N/A N/A 102510 102525 CCGCATTGCCTAAGAG 9 792 958798 N/A N/A 107371 107386 TGCAGTATAATATCCT 3 793 958803 N/A N/A 110998 111013 GATAATCATCCTCAGC 24 794 958808 N/A N/A 113126 113141 AGCGATTGGCCTCCCA 59 795 958813 N/A N/A 116872 116887 TTACAGAGAGATTCAT 8 796 958818 N/A N/A 121757 121772 GTTGTCAACTCTAGGG 23 797
TABLE-US-00012 TABLE 12 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compound Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO 715483 3570 3585 124595 124610 CTCTTTGGAAACCATT 1 206 958439 182 197 3642 3657 GCGCCCCGGCTCCACT 77 798 958444 315 330 3775 3790 ACGCCCCGGCTCCACG 97 799 958449 468 483 3928 3943 CCGGACGGCGGGCCCT 84 800 958454 754 769 7188 7203 GGAATGAGCTCGAACA 3 801 958459 1061 1076 55556 55571 CTGAAGCCGAGTTCAT 28 802 958464 1600 1615 120505 120520 GCTCATGCTTAGTCCA 3* 803 958469 1904 1919 122929 122944 GGCTCTATAACCATGT 17 804 958474 1950 1965 122975 122990 GTGTCTCCTTAGATCC 3 805 958479 1969 1984 122994 123009 ATGGAAATTTCCGGTG 15 806 958484 2067 2082 123092 123107 GCAGCAATGGACAAGG 2 807 958489 2262 2277 123287 123302 TTCTAAGTCTGAGTAT 14 808 958494 2468 2483 123493 123508 TAGCACTAGGAGGAAA 28 809 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 1 810 958504 2805 2820 123830 123845 ATCGAGATTTAAATAA 63 811 958509 2851 2866 123876 123891 ATGTTATGTTTGGGTG 4 812 958514 2957 2972 123982 123997 TACTAGTCATGTATTC 20 813 958519 3061 3076 124086 124101 CCCCTAGGCACTATCC 20 814 958524 3199 3214 124224 124239 GCACATTATGAACCTA 13 815 958529 3364 3379 124389 124404 CAAGTCTTGTAAGTAA 3 816 958534 3383 3398 121836 121851 TTCAGCATAGAAGTAG 3 817 124408 124423 958539 3400 3415 124425 124440 TCTATCCAGGGTCAAT 11 818 958544 3471 3486 124496 124511 GCTAAATTCAACTACC 8 819 958549 3546 3561 100828 100843 TGTAGACACATACTCT 8 820 110388 110403 124571 124586 958554 3561 3576 38754 38769 AACCATTATTACTCCT 1 821 120229 120244 124586 124601 958559 3645 3660 124670 124685 AATTCACAACCAACTA 17 822 958564 3841 3856 124866 124881 TCCAAATTGAAGGGCC 62 823 958569 3965 3980 124990 125005 AGCCTTAGAGTCAATT 3 824 958574 4166 4181 125191 125206 CTGGCAAATTATAGGC 13 825 958579 4183 4198 125208 125223 ATCTTAATCTGTGGCT 4 826 958584 4221 4236 125246 125261 CCCTAAGCTAAAGCTA 74 827 958589 4409 4424 125434 125449 GTAAAGGAAGATCTCC 4 828 958594 4523 4538 125548 125563 CTCTTAGGTCTCCTTC 8 829 958599 4663 4678 125688 125703 TTCAAGAATACCCAGT 5 830 958604 5055 5070 126080 126095 ACGCTAGAAAAGTGTT 94 831 958609 5221 5236 126246 126261 TGACAAGTGTGCATTA 16 832 958614 1137 1152 79078 79093 GTCTTGTTCTTATGGT 6 833 958619 1156 1171 79097 79112 TGGGTCTAGCCAAGAG 71 834 958624 1390 1405 102522 102537 GGGATTGATATTCCGC 74 835 958629 N/A N/A 5523 5538 CCCGAGTGGGCTAACT 128 836 958634 N/A N/A 5673 5688 TCCTTAACCCGGGTTT 61 837 958639 N/A N/A 6783 6798 GTTATGGGTGCTTTTC 18 838 958644 N/A N/A 8524 8539 ATGATCAAACCTTTTC 5 839 958649 N/A N/A 12237 12252 TGCCACTGGTGAATAC 36 840 958654 N/A N/A 16919 16934 AATGGAGTGGCCGGGC 110 841 958659 N/A N/A 18852 18867 GTTGTATTACTCTCCA 2 842 958664 N/A N/A 23239 23254 ACGAACTAAGGTGTAC 40 843 958669 N/A N/A 28420 28435 GCTATCTTTGGATCCA 76 844 958674 N/A N/A 30866 30881 AAGAACTTAGTTCCCT 25 845 31188 31203 958679 N/A N/A 33917 33932 GTAACTGCCACAGTTA 77 846 958684 N/A N/A 35513 35528 GCTGAAGACGGCCCTT 70 847 958689 N/A N/A 36864 36879 CATTAAGGAGGTTATG 87 848 958694 N/A N/A 39375 39390 ATTGGTGGTGTCTCAC 41 849 958699 N/A N/A 40415 40430 GACTAGAAAGATCATC 20 850 958704 N/A N/A 43572 43587 CCCTACACTCGAGGAT 122 851 958709 N/A N/A 46944 46959 TCAATCTATGAGACCC 57 852 958714 N/A N/A 52275 52290 GAGCACTGCGCCCTGG 82 853 958719 N/A N/A 56409 56424 GTACATAATGGGCTAA 49 854 958724 N/A N/A 58762 58777 TCAGTTATCCTATCCC 2 855 958729 N/A N/A 58763 58778 GTCAGTTATCCTATCT 4 856 58779 58794 958734 N/A N/A 61207 61222 ACACATAGAGCTAAGG 7 857 958739 N/A N/A 64256 64271 AGCAATAGAGTAACCA 4 858 958744 N/A N/A 67858 67873 GCATACTGGTGCCCCA 45 859 958749 N/A N/A 74623 74638 CCACAAGGGCAGTACG 51 860 958754 N/A N/A 77489 77504 CCTTAGGAAGGCTCCC 31 861 958759 N/A N/A 81664 81679 GCCTATCGCCCCAAGC 61 862 958764 N/A N/A 85543 85558 TGGGTCTCTTGATTTC 34 863 958769 N/A N/A 89667 89682 CATTGCCACGATCTAA 36 864 958774 N/A N/A 94013 94028 TGCTAGATATCGCCAA 33 865 958779 N/A N/A 95898 95913 TCGAATATAGAGGCCT 80 866 958784 N/A N/A 99202 99217 GGCTGGATAGAATGCT 79 867 958789 N/A N/A 101277 101292 TACTATATAATACCCT 17 868 958794 N/A N/A 102512 102527 TTCCGCATTGCCTAAG 14 869 958799 N/A N/A 107814 107829 ATTACTCAATCATGGT 2 870 958804 N/A N/A 110999 111014 AGATAATCATCCTCAG 17 871 958809 N/A N/A 113144 113159 TCTTAACACCTGAGCT 66 872 958814 N/A N/A 117837 117852 GGCTATGCCTCTCTTA 214 873 958819 N/A N/A 122502 122517 TGCTTCAACATTGTTC 9 874
TABLE-US-00013 TABLE 13 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compound Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO 715483 3570 3585 124595 124610 CTCTTTGGAAACCATT 1 206 958440 183 198 3643 3658 TGCGCCCCGGCTCCAC 54 875 958445 327 342 3787 3802 GGCTACGCCCGGACGC 63 876 958450 496 511 3956 3971 GGTCGCCGCGGGTGCC 59 877 958455 757 772 7191 7206 AGAGGAATGAGCTCGA 43 878 958460 1294 1309 98996 99011 TCGCATCTGTTGCTGC 52 879 958465 1726 1741 122751 122766 GGCTTCAAGGTAGTCT 84 880 958470 1941 1956 8781 8796 TAGATCCTTCACAGAT 18 881 45134 45149 122966 122981 958475 1959 1974 122984 122999 CCGGTGCATGTGTCTC 37 882 958480 1978 1993 24075 24090 AACTGGCTTATGGAAA 24 883 123003 123018 958485 2089 2104 56507 56522 AGAGGTCAGCAATACA 3 884 122015 122030 123114 123129 958490 2281 2296 123306 123321 GTGACATGAAGCATCT 5 885 958495 2488 2503 123513 123528 GGTCATTATGTGACTA 56 886 958500 2570 2585 123595 123610 TCTATATTAGAGTATG 5 887 958505 2809 2824 123834 123849 GATAATCGAGATTTAA 6 888 958510 2867 2882 123892 123907 TACCACACTATTATAA 43 889 958515 2993 3008 124018 124033 CCCCAACCAGATTTAA 28 890 958520 3091 3106 124116 124131 CTACCGTATGCCCAGA 27 891 958525 3235 3250 124260 124275 ATGAAGGTAAACCACT 3 892 958530 3367 3382 124392 124407 GAGCAAGTCTTGTAAG 20 893 958535 3392 3407 124417 124432 GGGTCAATTTTCAGCA 10 894 958540 3402 3417 124427 124442 ATTCTATCCAGGGTCA 8 895 958545 3535 3550 5536 5551 ACTCTAGTTACATCAT 3 896 124560 124575 958550 3548 3563 124573 124588 CCTGTAGACACATACT 4 897 958555 3619 3634 124644 124659 GCTTATATTGAAGAGT 4 898 958560 3656 3671 124681 124696 GGTGCCACTTTAATTC 22 899 958565 3895 3910 124920 124935 TTGAGCACTGAAAGTA 4 900 958570 4092 4107 125117 125132 TGTAATTCATATACCC 5 901 958575 4171 4186 125196 125211 GGCTACTGGCAAATTA 9 902 958580 4186 4201 125211 125226 ATAATCTTAATCTGTG 4 903 958585 4278 4293 125303 125318 CTCTATCAAGGTCCCC 5 904 958590 4439 4454 125464 125479 AGGTATAACTGGGCAA 2 905 958595 4563 4578 125588 125603 CCACATCAAGGCTATG 8 906 958600 4752 4767 125777 125792 GTAGATCTAAGAAGCC 8 907 958605 5068 5083 126093 126108 CTCAGATGTACCAACG 7 908 958610 5250 5265 126275 126290 AGGTAACATTGGTACT 34 909 958615 1139 1154 79080 79095 TGGTCTTGTTCTTATG 3 910 958620 1162 1177 79103 79118 AAGCCTTGGGTCTAGC 57 911 958625 1394 1409 102526 102541 TGCTGGGATTGATATT 6 912 958630 N/A N/A 5554 5569 GCGGTAACTCTTCTTT 52 913 958635 N/A N/A 5713 5728 GTTTAGGCAAGCAGCT 43 914 958640 N/A N/A 7413 7428 TAGATAACTGTCTCCC 13 915 958645 N/A N/A 9559 9574 GCCCATAGTTGACAGG 54 916 958650 N/A N/A 12498 12513 TCAATTGAGTCTGCTA 3 917 958655 N/A N/A 17868 17883 GCAATCTGTGATCCCA 12 918 958660 N/A N/A 19378 19393 CCCACTGGGTTTGTCC 106 919 958665 N/A N/A 23878 23893 CTGCATACCCTCCAGC 84 920 958670 N/A N/A 28665 28680 GGTCTTGGTGATTGGC 20 921 958675 N/A N/A 31177 31192 TCCCTATCAGCTGGGC 112 922 958680 N/A N/A 34103 34118 ATTAACACCTGAGCTG 50 923 958685 N/A N/A 35577 35592 AGCTATGGAAAGTGTC 24 924 958690 N/A N/A 37103 37118 TGGACTCTTGATCACA 26 925 958695 N/A N/A 39759 39774 TCAATTCTCCACCAGA 45 926 958700 N/A N/A 41085 41100 CTAATATAGACTACTC 55 927 958705 N/A N/A 45162 45177 GGCCATCAATAAAGAC 112 928 958710 N/A N/A 47735 47750 AGGGAACCCTTGGCTA 77 929 958715 N/A N/A 53767 53782 GTAATAGGAGGTAAGA 48 930 958720 N/A N/A 56594 56609 GTCTACTAGAGCTGCC 12 931 958725 N/A N/A 58763 58778 GTCAGTTATCCTATCC 1 932 958730 N/A N/A 58783 58798 CTCTGTCAGTTATCCT 4 933 958735 N/A N/A 61265 61280 AGCAATCTTGTGGATC 7 934 958740 N/A N/A 65047 65062 CGGCACCAAACACCCA 57 935 958745 N/A N/A 69906 69921 TCCCAGCCGCATGGCT 78 936 958750 N/A N/A 75333 75348 TGTAAGAGGAGACCAC 28 937 958755 N/A N/A 78709 78724 TAACATAAGACACGGA 12 938 958760 N/A N/A 82249 82264 AGTAATAGATCTACAA 76 939 958765 N/A N/A 86532 86547 GTACAGGAGAGATTGC 37 940 958770 N/A N/A 90915 90930 ACAGAGCGGTGCACCC 64 941 958775 N/A N/A 94061 94076 GTCTATACGGGAGATT 29 942 958780 N/A N/A 96542 96557 TCAACTACTTTTCAGC 24 943 958785 N/A N/A 99371 99386 GCAATCCACAATTCCA 2 944 958790 N/A N/A 102039 102054 GAAAAGACGACACAGT 68 945 958795 N/A N/A 102514 102529 TATTCCGCATTGCCTA 8 946 958800 N/A N/A 108359 108374 TCGATAATATATGGCA 22 947 958805 N/A N/A 111001 111016 CAAGATAATCATCCTC 6 948 958810 N/A N/A 114182 114197 TTATATACGGGAAAAT 47 949 958815 N/A N/A 120003 120018 GGGCGAGGAGACAGGT 16 950 958820 N/A N/A 126468 126483 GACCAGTAAGAAGCCA 49 951
Example 4
Antisense Inhibition of Human Yap1 in A-431 Cells by cEt Gapmers
[0563] Modified oligonucleotides were designed to target a Yap1 nucleic acid and were tested for their effect on Yap1 mRNA level in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured A-431 cells at a density of 5,000 cells per well were treated using free uptake with 2,000 nM of modified oligonucleotide. After a treatment period of approximately 48 hours, RNA was isolated from the cells and Yap1 mRNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS4814 was used to measure mRNA levels. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). The modified oligonucleotides with percent control values marked with an asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides targeting the amplicon region.
[0564] The newly designed modified oligonucleotides in the Tables below were designed as 3-10-3 cEt gapmers. The gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on the 5′ direction and the 3′ direction comprising three nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has a cEt sugar modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P═S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.
[0565] “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either SEQ ID NO.: 1, SEQ ID NO.: 2, SEQ ID NO.: 3 (GENBANK Accession No. NM_006106.4), or SEQ ID NO.: 4 (GENBANK Accession No. NM_001130145.2). ‘N/A’ indicates that the modified oligonucleotide does not target that particular gene sequence with 100% complementarity. ‘N.D.’ indicates that the %UTC is not defined for that particular modified oligonucleotide in that particular experiment. Activity of the modified oligonucleotide may be defined in a different experiment.
TABLE-US-00014 TABLE 14 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compound Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 2 810 1074112 97 112 3557 3572 TCCAACTCCCTTGACG 83 952 1074144 285 300 3745 3760 AGCGGCGACGGCTGCG 92 953 1074176 364 379 3824 3839 CTCCCCCGACGCGCAC 84 954 1074208 541 556 4001 4016 GTGCACGATCTGATGC 96 955 1074240 896 911 7330 7345 CTGGCAGAGGTACATC 29 956 1074272 1118 1133 79059 79074 TATAGTAAATTTCTCC 16 957 1074304 1357 1372 99059 99074 CTGCCGAAGCAGTTCT 109 958 1074336 1451 1466 116640 116655 CCAGTGTTGGTAACTG 97 959 1074368 1672 1687 N/A N/A GATAGTATCACCTGTA 8 960 1074400 1928 1943 122953 122968 GATTTAGAATTCAGTC 42 961 1074432 2243 2258 123268 123283 GTTAAAATGATTGGTG 3* 962 1074464 2564 2579 123589 123604 TTAGAGTATGTGGCAA 2 963 1074496 2743 2758 123768 123783 AATAACCATCCCAAGC 69 964 1074528 2996 3011 124021 124036 CTGCCCCAACCAGATT 25 965 1074560 3172 3187 124197 124212 CCAATCGAGACTTAAA 3 966 1074592 3368 3383 124393 124408 GGAGCAAGTCTTGTAA 23 967 1074624 3706 3721 124731 124746 GGCTTATTCTAGAAAC 65 968 1074656 4008 4023 125033 125048 GACTTAATTCAAGATT 31 969 1074688 4224 4239 125249 125264 TCCCCCTAAGCTAAAG 83 970 1074720 4403 4418 125428 125443 GAAGATCTCCATATTC 58 971 1074752 4592 4607 125617 125632 CATTAGGAACAAGGAC 10 972 1074784 4758 4773 125783 125798 CCATAAGTAGATCTAA 25 973 1074816 5032 5047 126057 126072 GAATATTGCCACCCAC 15 974 1074848 5140 5155 126165 126180 GTTATGATAGGCACAC 11 975 1074912 N/A N/A 5525 5540 ATCCCGAGTGGGCTAA 85 976 1074944 N/A N/A 5623 5638 AAAACCCTTTGGTCTC 89 977 1074976 N/A N/A 126479 126494 TTCTATTGGAAGACCA 35 978 1075008 N/A N/A 5286 5301 TAATCGAACATTGTGT 61 979 1075040 N/A N/A 7618 7633 TTATAAAGAGGCTCAG 10 980 1075072 N/A N/A 9650 9665 TCCGGGTAAATATCTC 37 981 1075104 N/A N/A 11109 11124 ATTATAAGGTCCTACA 67 982 1075136 N/A N/A 13294 13309 CTAGAATATTAAAGGG 87 983 1075168 N/A N/A 16596 16611 CATCAAAATTTCACGA 49 984 1075200 N/A N/A 21836 21851 CATATTAACTAGATGA 120 985 1075232 N/A N/A 24676 24691 ATTTATCAGCCATTGT 13 986 1075264 N/A N/A 27401 27416 GAATAATATGCAGAAC 53 987 1075296 N/A N/A 30827 30842 ATTATAAGCTGTGTTG 18 988 1075328 N/A N/A 32291 32306 CTCGCAAAGCCTCTTC 21 989 1075360 N/A N/A 34021 34036 AGGCAACAACATCTAA 50 990 1075392 N/A N/A 36045 36060 GACGGGTGAACCTGTT 95 991 1075424 N/A N/A 38749 38764 TTATTAATCCTGTCCA 18 992 1075456 N/A N/A 40812 40827 TTACGAAATGTTTAGT 61 993 1075488 N/A N/A 42808 42823 CAGAATAAGGGAGATC 56 994 1075520 N/A N/A 45363 45378 CCCCAACAACTGCTAA 77 995 1075552 N/A N/A 47526 47541 GATTATAACATGCTGT 74 996 1075584 N/A N/A 49326 49341 AATAATTGACCTAGCA 57 997 1075616 N/A N/A 51128 51143 GTAAAACCGATTTTTC 46 998 1075648 N/A N/A 52713 52728 TCAATAAAGTGGGACT 67 999 1075680 N/A N/A 55168 55183 ATTATTACCCCTTCTA 73 1000 1075712 N/A N/A 57557 57572 GACGCGAAATACTTAC 7 1001 1075744 N/A N/A 59642 59657 TTCGGGTTAGCAGACT 6 1002 1075776 N/A N/A 62195 62210 ATGTGATATGGATTCT 10 1003 1075808 N/A N/A 64255 64270 GCAATAGAGTAACCAG 3 1004 1075840 N/A N/A 67174 67189 CCTAAAATAGGAATGC 89 1005 1075872 N/A N/A 70920 70935 CAATTATGACAAACAG 21 1006 1075904 N/A N/A 73288 73303 GTATAGGATCTACTAA 51 1007 1075936 N/A N/A 76577 76592 CTTATATTCTCTCCGA 49 1008 1075968 N/A N/A 80319 80334 TATTTAAGCCAAACCG 5 1009 1076000 N/A N/A 82082 82097 CCTAATATGACTCCTT 4 1010 1076032 N/A N/A 84424 84439 TATAATTTCCCTGATC 105 1011 1076064 N/A N/A 86676 86691 TATGAACAATGTACTC 5 1012 1076096 N/A N/A 90315 90330 AATAATAAACGATTCT 71 1013 1076128 N/A N/A 92094 92109 TCTAAACCTAAAGACT 118 1014 1076160 N/A N/A 93143 93158 TTATACTAGTACGGCA 20 1015 1076192 N/A N/A 95979 95994 CTACAACCTGGACTTT 34 1016 1076224 N/A N/A 97726 97741 TATAAACCTTGCTACA 67 1017 1076256 N/A N/A 100250 100265 TTATTTAGGCCCCATA 4 1018 1076288 N/A N/A 103352 103367 CTTATTTAGCATAGTG 3 1019 1076320 N/A N/A 105383 105398 CATTAACCTCACCCAT 52 1020 1076352 N/A N/A 109308 109323 GATAACCCTGAAACAA 37 1021 1076384 N/A N/A 111269 111284 TATAAGGGACTTGCTG 25 1022 1076416 N/A N/A 113834 113849 ACCGAAATGATACTGA 8 1023 1076448 N/A N/A 117100 117115 CTTATAATGCAATCCT 2 1024 1076480 N/A N/A 119636 119651 GTAAATATCCATTACC 72 1025 1076512 N/A N/A 122045 122060 CATAAACCATTAAGTG 65 1026 1076544 N/A N/A 71389 71404 GACCAACCTCCCCTTG 89 1027
TABLE-US-00015 TABLE 15 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 1 810 1074113 98 113 3558 3573 CTCCAACTCCCTTGAC 61 1028 1074145 286 301 3746 3761 AAGCGGCGACGGCTGC 73 1029 1074177 365 380 3825 3840 CCTCCCCCGACGCGCA 69 1030 1074209 640 655 4100 4115 CCGGAGCCTCATGGGC 72 1031 1074241 921 936 7355 7370 GATGTCTTTGCCATCT 72 1032 1074273 1129 1144 79070 79085 CTTATGGTTTATATAG 34 1033 1074305 1360 1375 99062 99077 CACCTGCCGAAGCAGT 64 1034 1074337 1469 1484 116658 116673 GAGTCCCACCATCCTG 10 1035 1074369 1673 1688 N/A N/A TGATAGTATCACCTGT 19 1036 1074401 1960 1975 122985 123000 TCCGGTGCATGTGTCT 18 1037 1074433 2258 2273 123283 123298 AAGTCTGAGTATTTAG 5* 1038 1074465 2572 2587 123597 123612 AATCTATATTAGAGTA 44 1039 1074497 2744 2759 123769 123784 CAATAACCATCCCAAG 26 1040 1074529 3001 3016 124026 124041 GCAGACTGCCCCAACC 50 1041 1074561 3176 3191 124201 124216 AATTCCAATCGAGACT 10 1042 1074593 3369 3384 124394 124409 AGGAGCAAGTCTTGTA 6 1043 1074625 3711 3726 124736 124751 ATAAGGGCTTATTCTA 42 1044 1074657 4016 4031 125041 125056 TCCCCCCAGACTTAAT 59 1045 1074689 4225 4240 125250 125265 CTCCCCCTAAGCTAAA 70 1046 1074721 4404 4419 125429 125444 GGAAGATCTCCATATT 43 1047 1074753 4594 4609 125619 125634 TACATTAGGAACAAGG 4 1048 1074785 4759 4774 125784 125799 ACCATAAGTAGATCTA 10 1049 1074817 5034 5049 126059 126074 CTGAATATTGCCACCC 8 1050 1074849 5141 5156 126166 126181 TGTTATGATAGGCACA 18 1051 1074913 N/A N/A 5526 5541 CATCCCGAGTGGGCTA 99 1052 1074945 N/A N/A 5624 5639 CAAAACCCTTTGGTCT 74 1053 1074977 N/A N/A 126483 126498 CTTGTTCTATTGGAAG 94 1054 1075009 N/A N/A 5287 5302 ATAATCGAACATTGTG 43 1055 1075041 N/A N/A 7620 7635 GATTATAAAGAGGCTC 5 1056 1075073 N/A N/A 9719 9734 CATAAAAGTTCCCCAG 51 1057 1075105 N/A N/A 11110 11125 AATTATAAGGTCCTAC 42 1058 1075137 N/A N/A 13320 13335 GATTAAATACTGACCA 3 1059 1075169 N/A N/A 16611 16626 AAAACGGAGTAATGCC 39 1060 1075201 N/A N/A 21864 21879 CTTTAAAGCCCTAATT 114 1061 1075233 N/A N/A 24679 24694 GTAATTTATCAGCCAT 2 1062 1075265 N/A N/A 27404 27419 TCTGAATAATATGCAG 44 1063 1075297 N/A N/A 30831 30846 GTTAATTATAAGCTGT 10 1064 1075329 N/A N/A 32457 32472 AGGGAAAACTTTGCAC 26 1065 1075361 N/A N/A 34085 34100 TCTTAAGGGAATGTAT 69 1066 1075393 N/A N/A 36169 36184 CTTAACCTATGCCAAA 37 1067 1075425 N/A N/A 38750 38765 ATTATTAATCCTGTCC 26 1068 1075457 N/A N/A 40828 40843 AGTAATATGTACATGG 5 1069 1075489 N/A N/A 42854 42869 GAGCAACAACTATGAG 51 1070 1075521 N/A N/A 45427 45442 AAATCGAGGCGAATCT 65 1071 1075553 N/A N/A 47527 47542 TGATTATAACATGCTG 77 1072 1075585 N/A N/A 49327 49342 AAATAATTGACCTAGC 52 1073 1075617 N/A N/A 51372 51387 TAAGAACGACATATGC 27 1074 1075649 N/A N/A 52715 52730 CTTCAATAAAGTGGGA 56 1075 1075681 N/A N/A 55170 55185 TAATTATTACCCCTTC 37 1076 1075713 N/A N/A 57571 57586 AATCAACCTTGTTAGA 58 1077 1075745 N/A N/A 59682 59697 CTTCAAAAGCACGGTG 58 1078 1075777 N/A N/A 62196 62211 TATGTGATATGGATTC 12 1079 1075809 N/A N/A 64257 64272 TAGCAATAGAGTAACC 13 1080 1075841 N/A N/A 67205 67220 ATTTAGGTACTCAGTA 27 1081 1075873 N/A N/A 70936 70951 CTTGAATACTACACCA 16 1082 1075905 N/A N/A 73332 73347 CCTGAACACAGGAGTA 43 1083 1075937 N/A N/A 76578 76593 ACTTATATTCTCTCCG 36 1084 1075969 N/A N/A 80320 80335 GTATTTAAGCCAAACC 11 1085 1076001 N/A N/A 82122 82137 ACTCAAGGAACCATTT 24 1086 1076033 N/A N/A 84540 84555 CATTAGTAGGTATTTC 8 1087 1076065 N/A N/A 86761 86776 CTTTAGTAACACGAAT 36 1088 1076097 N/A N/A 90316 90331 CAATAATAAACGATTC 70 1089 1076129 N/A N/A 92131 92146 CATAAACCTTAGTCCT 26 1090 1076161 N/A N/A 93145 93160 TCTTATACTAGTACGG 14 1091 1076193 N/A N/A 96059 96074 TTAATACACAGGTTCC 29 1092 1076225 N/A N/A 97727 97742 ATATAAACCTTGCTAC 66 1093 1076257 N/A N/A 100265 100280 CTAAGAAACTCATAGT 54 1094 1076289 N/A N/A 103430 103445 AACGGACAACTTAACA 21 1095 1076321 N/A N/A 105417 105432 CAATATCACTTGGGCC 63 1096 1076353 N/A N/A 109381 109396 ATTAAACATTCGGATT 30 1097 1076385 N/A N/A 111270 111285 ATATAAGGGACTTGCT 32 1098 1076417 N/A N/A 113840 113855 CTTTACACCGAAATGA 42 1099 1076449 N/A N/A 117101 117116 CCTTATAATGCAATCC 2 1100 1076481 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC 1 1101 1076513 N/A N/A 122094 122109 CATTAACACTCCTCAG 36 1102 1076545 N/A N/A 76624 76639 AACCAACCTTCCCTAC 68 1103
TABLE-US-00016 TABLE 16 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compound Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 2 810 1074114 109 124 3569 3584 GAACTTTTTCCCTCCA 30 1104 1074146 287 302 3747 3762 GAAGCGGCGACGGCTG 91 1105 1074178 366 381 3826 3841 GCCTCCCCCGACGCGC 95 1106 1074210 641 656 4101 4116 TCCGGAGCCTCATGGG 113 1107 1074242 925 940 7359 7374 AGAAGATGTCTTTGCC 56 1108 1074274 1132 1147 79073 79088 GTTCTTATGGTTTATA 4 1109 1074306 1363 1378 99065 99080 CCTCACCTGCCGAAGC 107 1110 1074338 1476 1491 116665 116680 GGATTTTGAGTCCCAC 77 1111 1074370 1674 1689 N/A N/A TTGATAGTATCACCTG 8 1112 1074402 1971 1986 122996 123011 TTATGGAAATTTCCGG 25 1113 1074434 2264 2279 123289 123304 ACTTCTAAGTCTGAGT 51* 1114 1074466 2651 2666 123676 123691 ACCGACCCTGCCAAAA 32 1115 1074498 2745 2760 123770 123785 ACAATAACCATCCCAA 17 1116 1074530 3021 3036 124046 124061 CTAAACTACTTCAAAC 88 1117 1074562 3177 3192 124202 124217 GAATTCCAATCGAGAC 30 1118 1074594 3370 3385 124395 124410 TAGGAGCAAGTCTTGT 6 1119 1074626 3730 3745 124755 124770 CTGTTATGAACCCTTG 5 1120 1074658 4023 4038 125048 125063 GGCCATTTCCCCCCAG 89 1121 1074690 4226 4241 125251 125266 CCTCCCCCTAAGCTAA 81 1122 1074722 4405 4420 125430 125445 AGGAAGATCTCCATAT 57 1123 1074754 4598 4613 125623 125638 CTTTTACATTAGGAAC 11 1124 1074786 4760 4775 125785 125800 AACCATAAGTAGATCT 28 1125 1074818 5035 5050 126060 126075 ACTGAATATTGCCACC 12 1126 1074850 5142 5157 126167 126182 TTGTTATGATAGGCAC 5 1127 1074914 N/A N/A 5529 5544 TTACATCCCGAGTGGG 97 1128 1074946 N/A N/A 5625 5640 CCAAAACCCTTTGGTC 109 1129 1074978 N/A N/A 126492 126507 TTGCCAGTTCTTGTTC 38 1130 1075010 N/A N/A 5288 5303 AATAATCGAACATTGT 88 1131 1075042 N/A N/A 7676 7691 TTAAAAGGTTTGGCAC 17 1132 1075074 N/A N/A 9744 9759 TATAGTAAGACTAATC 105 1133 1075106 N/A N/A 11112 11127 CAAATTATAAGGTCCT 10 1134 1075138 N/A N/A 13444 13459 AATAATAGATACTGCC 4 1135 1075170 N/A N/A 17299 17314 ACTAAAATCCCCAAGG 94 1136 1075202 N/A N/A 21884 21899 AATTATATAAGGCTGT 26 1137 1075234 N/A N/A 24701 24716 GTAAATACTCTAGTTC 22 1138 1075266 N/A N/A 27425 27440 TATTAGGACAAAGTAC 57 1139 1075298 N/A N/A 30895 30910 ATCTCGGAAATTTAAA 128 1140 1075330 N/A N/A 32458 32473 GAGGGAAAACTTTGCA 63 1141 1075362 N/A N/A 34134 34149 CAGGAAAAATCTAGGT 50 1142 1075394 N/A N/A 36170 36185 TCTTAACCTATGCCAA 27 1143 1075426 N/A N/A 38752 38767 GTATTATTAATCCTGT 49 1144 1075458 N/A N/A 40971 40986 CCACAATATACTCCAA 7 1145 1075490 N/A N/A 42884 42899 CATATACGCAATTAGT 27 1146 1075522 N/A N/A 45428 45443 CAAATCGAGGCGAATC 82 1147 1075554 N/A N/A 47574 47589 TTGCAATAGTCACCCA 56 1148 1075586 N/A N/A 49373 49388 TATTAGCACCTGGGTA 64 1149 1075618 N/A N/A 51375 51390 TTTTAAGAACGACATA 69 1150 1075650 N/A N/A 52783 52798 ATATTACAATCCCAGC 48 1151 1075682 N/A N/A 55172 55187 GATAATTATTACCCCT 35 1152 1075714 N/A N/A 57577 57592 AATTACAATCAACCTT 42 1153 1075746 N/A N/A 59700 59715 GATTAACCCAGTAGAG 28 1154 1075778 N/A N/A 62239 62254 CATTTATACCAGGCAC 3 1155 1075810 N/A N/A 64258 64273 GTAGCAATAGAGTAAC 7 1156 1075842 N/A N/A 67207 67222 GTATTTAGGTACTCAG 2 1157 1075874 N/A N/A 71096 71111 CTTAACAACCCTACGA 113 1158 1075906 N/A N/A 73792 73807 CCTCAATACAGATGAA 39 1159 1075938 N/A N/A 76754 76769 GAATATATGGGTTTCA 55 1160 1075970 N/A N/A 80333 80348 GCTTAAAAGGACAGTA 34 1161 1076002 N/A N/A 82141 82156 ATTTAATGGCTTGCAT 21 1162 1076034 N/A N/A 84970 84985 AATTAGAAACTTGGCC 74 1163 1076066 N/A N/A 87168 87183 CATATAAGATGTTTGC 8 1164 1076098 N/A N/A 90319 90334 TTACAATAATAAACGA 94 1165 1076130 N/A N/A 92149 92164 CTGGAATAGTGGGTGC 34 1166 1076162 N/A N/A 93320 93335 ATTTACTTGGCAACTC 9 1167 1076194 N/A N/A 96060 96075 TTTAATACACAGGTTC 22 1168 1076226 N/A N/A 97728 97743 CATATAAACCTTGCTA 36 1169 1076258 N/A N/A 100563 100578 CTTTAGGTGCCTCCTT 10 1170 1076290 N/A N/A 103434 103449 CTCCAACGGACAACTT 28 1171 1076322 N/A N/A 106041 106056 ATTTACAAGTGAGCAC 21 1172 1076354 N/A N/A 109382 109397 GATTAAACATTCGGAT 13 1173 1076386 N/A N/A 111389 111404 AGTTATAACAGTGTAA 7 1174 1076418 N/A N/A 113873 113888 TATAATAACCCATTGT 63 1175 1076450 N/A N/A 117136 117151 CTTGAATAGCTATGTG 13 1176 1076482 N/A N/A 119679 119694 CTTTAGACTAAGTAAG 107 1177 1076514 N/A N/A 122224 122239 CCTTAGGAGATGCACC 18 1178 1076546 N/A N/A 79333 79348 CCCCAACCTGAGGAGC 94 1179
TABLE-US-00017 TABLE 17 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 3 810 1074115 110 125 3570 3585 AGAACTTTTTCCCTCC 33 1180 1074147 288 303 3748 3763 AGAAGCGGCGACGGCT 23 1181 1074179 383 398 3843 3858 CGGGATCCATGGCTTC 49 1182 1074211 643 658 4103 4118 CTTCCGGAGCCTCATG 67 1183 1074243 932 947 7366 7381 TCTGACCAGAAGATGT 60 1184 1074275 1146 1161 79087 79102 CAAGAGGTGGTCTTGT 73 1185 1074307 1367 1382 99069 99084 GTGGCCTCACCTGCCG 105 1186 1074339 1479 1494 116668 116683 ACTGGATTTTGAGTCC 31 1187 1074371 1675 1690 122700 122715 GTTGATAGTATCACCT 31 1188 1074403 1973 1988 122998 123013 GCTTATGGAAATTTCC 9 1189 1074435 2265 2280 123290 123305 GACTTCTAAGTCTGAG 19* 1190 1074467 2652 2667 123677 123692 CACCGACCCTGCCAAA 31 1191 1074499 2746 2761 123771 123786 TACAATAACCATCCCA 10 1192 1074531 3023 3038 124048 124063 CACTAAACTACTTCAA 73 1193 1074563 3178 3193 124203 124218 TGAATTCCAATCGAGA 4 1194 1074595 3376 3391 124401 124416 TAGAAGTAGGAGCAAG 4 1195 1074627 3731 3746 124756 124771 CCTGTTATGAACCCTT 3 1196 1074659 4042 4057 125067 125082 CTAAAACTCCATCTGC 12 1197 1074691 4227 4242 125252 125267 CCCTCCCCCTAAGCTA 76 1198 1074723 4410 4425 125435 125450 GGTAAAGGAAGATCTC 6 1199 1074755 4600 4615 125625 125640 CACTTTTACATTAGGA 3 1200 1074787 4761 4776 125786 125801 CAACCATAAGTAGATC 13 1201 1074819 5039 5054 126064 126079 AAGCACTGAATATTGC 33 1202 1074851 5143 5158 126168 126183 ATTGTTATGATAGGCA 6 1203 1074915 N/A N/A 5531 5546 AGTTACATCCCGAGTG 65 1204 1074947 N/A N/A 5626 5641 TCCAAAACCCTTTGGT 99 1205 1074979 N/A N/A 126493 126508 ATTGCCAGTTCTTGTT 32 1206 1075011 N/A N/A 5292 5307 GCACAATAATCGAACA 44 1207 1075043 N/A N/A 7834 7849 CCCCAAAAGCCCTACT 73 1208 1075075 N/A N/A 9942 9957 AATTTTATAAGCCCAC 9 1209 1075107 N/A N/A 11251 11266 TAAAAACATTGTGGCC 114 1210 1075139 N/A N/A 13448 13463 CCCAAATAATAGATAC 65 1211 1075171 N/A N/A 17320 17335 CCCCAATATAAAGAAC 88 1212 1075203 N/A N/A 21885 21900 TAATTATATAAGGCTG 68 1213 1075235 N/A N/A 24702 24717 AGTAAATACTCTAGTT 38 1214 1075267 N/A N/A 27547 27562 CTATTTAGAATAAGTG 83 1215 1075299 N/A N/A 31204 31219 GATAACCAATGCACCA 21 1216 1075331 N/A N/A 32471 32486 GATAAACACTGCAGAG 33 1217 1075363 N/A N/A 34223 34238 ACACAATATCAAGTCC 25 1218 1075395 N/A N/A 36225 36240 ATGAATAAGTATGCCA 4 1219 1075427 N/A N/A 38797 38812 TATAAGGCATCTTGGA 60 1220 1075459 N/A N/A 41050 41065 AACCAAGGATAGTCAT 37 1221 1075491 N/A N/A 43058 43073 GACGGAAGTTGCAAGG 93 1222 1075523 N/A N/A 45517 45532 AATTAAGGGCCCACAA 78 1223 1075555 N/A N/A 47585 47600 GCCAAAAATTCTTGCA 92 1224 1075587 N/A N/A 49375 49390 CTTATTAGCACCTGGG 50 1225 1075619 N/A N/A 51414 51429 CTTAGATACTACTTTG 54 1226 1075651 N/A N/A 52784 52799 TATATTACAATCCCAG 57 1227 1075683 N/A N/A 55227 55242 CTGAAAAAGTTATGCC 56 1228 1075715 N/A N/A 57578 57593 GAATTACAATCAACCT 12 1229 1075747 N/A N/A 59709 59724 ATTTAGCATGATTAAC 43 1230 1075779 N/A N/A 62290 62305 GTATTACAAACTGATT 28 1231 1075811 N/A N/A 64261 64276 ATTGTAGCAATAGAGT 10 1232 1075843 N/A N/A 67232 67247 CATGAAATGATGGAAC 47 1233 1075875 N/A N/A 71097 71112 ACTTAACAACCCTACG 72 1234 1075907 N/A N/A 73846 73861 AATTACTACTGGCCAT 55 1235 1075939 N/A N/A 76757 76772 CTTGAATATATGGGTT 6 1236 1075971 N/A N/A 80380 80395 TATTAACATACCTCAT 28 1237 1076003 N/A N/A 82142 82157 AATTTAATGGCTTGCA 8 1238 1076035 N/A N/A 84972 84987 GTAATTAGAAACTTGG 9 1239 1076067 N/A N/A 87169 87184 GCATATAAGATGTTTG 4 1240 1076099 N/A N/A 90414 90429 CCTCAAAACTTGGATT 41 1241 1076131 N/A N/A 92180 92195 TATTATGAGGACTGAT 23 1242 1076163 N/A N/A 93798 93813 GATATAAGTTACCAAT 16 1243 1076195 N/A N/A 96248 96263 AATAACATGGTTCTGT 20 1244 1076227 N/A N/A 97800 97815 ACTTATAAGGCCAGCA 16 1245 1076259 N/A N/A 100700 100715 ATTTAACTCCTGAAGT 61 1246 1076291 N/A N/A 103541 103556 GATTAATGGTGGCATT 4 1247 1076323 N/A N/A 106043 106058 CAATTTACAAGTGAGC 5 1248 1076355 N/A N/A 109562 109577 CTACAAAAGAGCTATG 92 1249 1076387 N/A N/A 111398 111413 TGACAACACAGTTATA 13 1250 1076419 N/A N/A 113874 113889 ATATAATAACCCATTG 47 1251 1076451 N/A N/A 117183 117198 CCTTAAGAACATGAGG 77 1252 1076483 N/A N/A 119774 119789 ACGGGAAATCATATAG 5 1253 1076515 N/A N/A 122246 122261 CTGCAAGAATACTTTA 30 1254 1076547 N/A N/A 97024 97039 GACCAACCTCCCTCAG 89 1255
TABLE-US-00018 TABLE 18 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compound Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 1 810 1074116 111 126 3571 3586 GAGAACTTTTTCCCTC 112 1256 1074148 292 307 3752 3767 GTGGAGAAGCGGCGAC 66 1257 1074180 384 399 3844 3859 CCGGGATCCATGGCTT 86 1258 1074212 644 659 4104 4119 GCTTCCGGAGCCTCAT 53 1259 1074244 933 948 7367 7382 CTCTGACCAGAAGATG 95 1260 1074276 1147 1162 79088 79103 CCAAGAGGTGGTCTTG 87 1261 1074308 1376 1391 N/A N/A GCATTGCCTGTGGCCT 132 1262 1074340 1493 1508 116682 116697 TCCCGGGAGAAGACAC 120 1263 1074372 1680 1695 122705 122720 CTTTGGTTGATAGTAT 10 1264 1074404 1974 1989 122999 123014 GGCTTATGGAAATTTC 16 1265 1074436 2277 2292 123302 123317 CATGAAGCATCTGACT 31* 1266 1074468 2653 2668 123678 123693 CCACCGACCCTGCCAA 34 1267 1074500 2747 2762 123772 123787 CTACAATAACCATCCC 10 1268 1074532 3026 3041 124051 124066 GAACACTAAACTACTT 59 1269 1074564 3179 3194 124204 124219 CTGAATTCCAATCGAG 4 1270 1074596 3401 3416 124426 124441 TTCTATCCAGGGTCAA 12 1271 1074628 3732 3747 124757 124772 GCCTGTTATGAACCCT 5 1272 1074660 4057 4072 125082 125097 AATTTCATTACTACTC 48 1273 1074692 4245 4260 125270 125285 CCCCCCCAAACTTTCC 101 1274 1074724 4411 4426 125436 125451 GGGTAAAGGAAGATCT 22 1275 1074756 4601 4616 125626 125641 GCACTTTTACATTAGG 3 1276 1074788 4762 4777 125787 125802 TCAACCATAAGTAGAT 25 1277 1074820 5046 5061 126071 126086 AAGTGTTAAGCACTGA 85 1278 1074852 5144 5159 126169 126184 AATTGTTATGATAGGC 4 1279 1074916 N/A N/A 5532 5547 AAGTTACATCCCGAGT 75 1280 1074948 N/A N/A 5630 5645 GAGTTCCAAAACCCTT 61 1281 1074980 N/A N/A 126494 126509 TATTGCCAGTTCTTGT 26 1282 1075012 N/A N/A 5349 5364 CTATTGGAATGTTAAC 119 1283 1075044 N/A N/A 7844 7859 AATTAGACTCCCCCAA 58 1284 1075076 N/A N/A 10048 10063 CATAACATCATGGAAG 25 1285 1075108 N/A N/A 11252 11267 CTAAAAACATTGTGGC 67 1286 1075140 N/A N/A 13661 13676 CTTTAGGTTAAGCAAT 86 1287 1075172 N/A N/A 17404 17419 CTTTACATGAACTGAT 14 1288 1075204 N/A N/A 22115 22130 GTTAAACACATCTCAG 43 1289 1075236 N/A N/A 24827 24842 TATAATACCACAAAGT 81 1290 1075268 N/A N/A 27596 27611 TATTAACCTGGAGAGT 47 1291 1075300 N/A N/A 31414 31429 CGTGAAAAGAAAGGCC 98 1292 1075332 N/A N/A 32520 32535 AGCGGGTTTAGAATGC 66 1293 1075364 N/A N/A 34293 34308 CGAAAATAGTTCTCAA 59 1294 1075396 N/A N/A 36570 36585 ATTATCGCACATACAT 89 1295 1075428 N/A N/A 38799 38814 TATATAAGGCATCTTG 53 1296 1075460 N/A N/A 41053 41068 AATAACCAAGGATAGT 30 1297 1075492 N/A N/A 43309 43324 GCTAAAATGATACTTC 29 1298 1075524 N/A N/A 45518 45533 TAATTAAGGGCCCACA 71 1299 1075556 N/A N/A 47618 47633 TGGCAAAAGAGTGGTG 68 1300 1075588 N/A N/A 49376 49391 ACTTATTAGCACCTGG 27 1301 1075620 N/A N/A 51476 51491 GATGAAGAATCTATAG 88 1302 1075652 N/A N/A 52785 52800 GTATATTACAATCCCA 40 1303 1075684 N/A N/A 55228 55243 TCTGAAAAAGTTATGC 78 1304 1075716 N/A N/A 57654 57669 GCCGAAATACTCTCAT 19 1305 1075748 N/A N/A 59723 59738 GTAAATCAAGTTGCAT 7 1306 1075780 N/A N/A 62440 62455 TATAATAATCCAGAAC 98 1307 1075812 N/A N/A 64470 64485 CATTAAGATTTTAACC 103 1308 1075844 N/A N/A 67247 67262 TATTAAATAAGAGCTC 84 1309 1075876 N/A N/A 71176 71191 GTATTTATGATGATTC 6 1310 1075908 N/A N/A 74518 74533 AATAAGGAGTAGGTGG 50 1311 1075940 N/A N/A 77113 77128 ACTCAACAACCCCAAG 54 1312 1075972 N/A N/A 80426 80441 TCACAAGGGCTAATTC 22 1313 1076004 N/A N/A 82143 82158 TAATTTAATGGCTTGC 2 1314 1076036 N/A N/A 84973 84988 CGTAATTAGAAACTTG 19 1315 1076068 N/A N/A 87383 87398 CTAAAATGACCTTAGC 73 1316 1076100 N/A N/A 90552 90567 AATAAGGGACTACTTT 65 1317 1076132 N/A N/A 92207 92222 CATCAATACTGACATC 28 1318 1076164 N/A N/A 93799 93814 TGATATAAGTTACCAA 50 1319 1076196 N/A N/A 96347 96362 TATCAAGGGAATTATT 113 1320 1076228 N/A N/A 98039 98054 ATTAACCTCAGTGAGC 69 1321 1076260 N/A N/A 100704 100719 CTTAATTTAACTCCTG 3 1322 1076292 N/A N/A 103572 103587 TATTATTGAGTTATCC 27 1323 1076324 N/A N/A 106059 106074 GCTCAAAAGGTCTCTC 13 1324 1076356 N/A N/A 109576 109591 CATAATTGGACTGTCT 99 1325 1076388 N/A N/A 111483 111498 GAAATATTCGAGAAGA 6 1326 1076420 N/A N/A 113876 113891 CCATATAATAACCCAT 26 1327 1076452 N/A N/A 117193 117208 GGACTATAGCCCTTAA 16 1328 1076484 N/A N/A 119777 119792 GAAACGGGAAATCATA 10 1329 1076516 N/A N/A 122314 122329 CATAAACATGAGTGGT 8 1330 1076548 N/A N/A 116744 116759 CACCAACCTGTTAAGG 106 1331
TABLE-US-00019 TABLE 19 Inhibition of Yap 1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 2 810 1074117 117 132 3577 3592 GCGCCTGAGAACTTTT 87 1332 1074149 298 313 3758 3773 GCCGAGGTGGAGAAGC 58 1333 1074181 385 400 3845 3860 CCCGGGATCCATGGCT 107 1334 1074213 654 669 4114 4129 GAGTCGGGCAGCTTCC 55 1335 1074245 941 956 7375 7390 AGAAGTATCTCTGACC 5 1336 1074277 1153 1168 79094 79109 GTCTAGCCAAGAGGTG 18 1337 1074309 1378 1393 N/A N/A CCGCATTGCCTGTGGC 80 1338 1074341 1494 1509 116683 116698 ATCCCGGGAGAAGACA 106 1339 1074373 1681 1696 122706 122721 GCTTTGGTTGATAGTA 26 1340 1074405 1991 2006 123016 123031 GCCTGAAAACTGCAAC 27 1341 1074437 2278 2293 123303 123318 ACATGAAGCATCTGAC 4* 1342 1074469 2654 2669 123679 123694 CCCACCGACCCTGCCA 77 1343 1074501 2748 2763 123773 123788 ACTACAATAACCATCC 9 1344 1074533 3028 3043 124053 124068 TAGAACACTAAACTAC 80 1345 1074565 3180 3195 124205 124220 ACTGAATTCCAATCGA 5 1346 1074597 3405 3420 124430 124445 AGTATTCTATCCAGGG 5 1347 1074629 3742 3757 124767 124782 GAGATTTTATGCCTGT 3 1348 1074661 4058 4073 125083 125098 GAATTTCATTACTACT 36 1349 1074693 4246 4261 125271 125286 CCCCCCCCAAACTTTC 92 1350 1074725 4437 4452 125462 125477 GTATAACTGGGCAAAT 17 1351 1074757 4607 4622 125632 125647 AGTTAAGCACTTTTAC 21 1352 1074789 4763 4778 125788 125803 ATCAACCATAAGTAGA 17 1353 1074821 5049 5064 126074 126089 GAAAAGTGTTAAGCAC 18 1354 1074853 5145 5160 126170 126185 CAATTGTTATGATAGG 15 1355 1074917 N/A N/A 5533 5548 CAAGTTACATCCCGAG 80 1356 1074949 N/A N/A 5642 5657 GTGATTTTTTCTGAGT 31 1357 1074981 N/A N/A 126495 126510 TTATTGCCAGTTCTTG 9 1358 1075013 N/A N/A 5768 5783 CATAAACCCACTTCGA 102 1359 1075045 N/A N/A 7845 7860 AAATTAGACTCCCCCA 18 1360 1075077 N/A N/A 10057 10072 TATACGGTCCATAACA 35 1361 1075109 N/A N/A 11253 11268 ACTAAAAACATTGTGG 71 1362 1075141 N/A N/A 13863 13878 TATACGAGAAGTTGAA 54 1363 1075173 N/A N/A 17464 17479 CTTTAGGGCAACTGTA 22 1364 1075205 N/A N/A 22160 22175 ATTAAATGAGCACCAC 29 1365 1075237 N/A N/A 25230 25245 GCTGAAAATGCTAACT 105 1366 1075269 N/A N/A 27597 27612 TTATTAACCTGGAGAG 13 1367 1075301 N/A N/A 31460 31475 CAGCAACACCTAAGGA 92 1368 1075333 N/A N/A 32529 32544 AGTTAACAAAGCGGGT 14 1369 1075365 N/A N/A 34295 34310 CACGAAAATAGTTCTC 11 1370 1075397 N/A N/A 36571 36586 CATTATCGCACATACA 79 1371 1075429 N/A N/A 38974 38989 CTTTACTATCTGGGTC 23 1372 1075461 N/A N/A 41056 41071 CTAAATAACCAAGGAT 64 1373 1075493 N/A N/A 43320 43335 AGACAAGGGATGCTAA 67 1374 1075525 N/A N/A 45519 45534 TTAATTAAGGGCCCAC 130 1375 1075557 N/A N/A 47655 47670 TATTAAGGTGGCTTAC 57 1376 1075589 N/A N/A 49390 49405 AATTAGCAGGGCAGAC 84 1377 1075621 N/A N/A 51645 51660 GATTAACATTGATACT 61 1378 1075653 N/A N/A 53476 53491 CATAAACTCTGCTGTC 58 1379 1075685 N/A N/A 55369 55384 CATAATCAAAGGGTGC 60 1380 1075717 N/A N/A 57665 57680 CATAAATTTCAGCCGA 10 1381 1075749 N/A N/A 59800 59815 AATTATGAATGATGGG 4 1382 1075781 N/A N/A 62475 62490 CATATATTGTGACTTC 2 1383 1075813 N/A N/A 64652 64667 ACTAATATGCAACTCT 4 1384 1075845 N/A N/A 67654 67669 GTGGAAAAGTATGATC 19 1385 1075877 N/A N/A 71248 71263 CTGGAAAAGTACATTC 28 1386 1075909 N/A N/A 74519 74534 AAATAAGGAGTAGGTG 93 1387 1075941 N/A N/A 77150 77165 AGTCAATAGCAATCAC 11 1388 1075973 N/A N/A 80581 80596 CCGCAACACCATTCTT 8 1389 1076005 N/A N/A 82193 82208 GTACAAAATCTCCAGG 69 1390 1076037 N/A N/A 84987 85002 CTTAAATTCTCTTACG 21 1391 1076069 N/A N/A 87384 87399 TCTAAAATGACCTTAG 118 1392 1076101 N/A N/A 90553 90568 AAATAAGGGACTACTT 71 1393 1076133 N/A N/A 92254 92269 CATACTAATTTGGTAA 60 1394 1076165 N/A N/A 93923 93938 CCCCAAGGACTTGCCA 79 1395 1076197 N/A N/A 96350 96365 TATTATCAAGGGAATT 94 1396 1076229 N/A N/A 98040 98055 AATTAACCTCAGTGAG 91 1397 1076261 N/A N/A 100852 100867 CCCCAACAAGTTCCTG 39 1398 1076293 N/A N/A 103575 103590 GCTTATTATTGAGTTA 3 1399 1076325 N/A N/A 106620 106635 CTAATAATGGAAGAGT 16 1400 1076357 N/A N/A 109680 109695 TCCAAAAACTTCTTAG 22 1401 1076389 N/A N/A 111486 111501 ATCGAAATATTCGAGA 76 1402 1076421 N/A N/A 113900 113915 AATTATGACCTCCATG 65 1403 1076453 N/A N/A 117330 117345 GTAATATTGCAATCTG 1 1404 1076485 N/A N/A 119781 119796 AAACGAAACGGGAAAT 55 1405 1076517 N/A N/A 122329 122344 CATAATAAGACTAAAC 102 1406 1076549 N/A N/A 117537 117552 GTGCAAAATACCTTTG 8 1407
TABLE-US-00020 TABLE 20 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compound Start Stop Start Stop (% SEQ ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 1 810 1074118 131 146 3591 3606 CACTCGGACCTGCGGC 66 1408 1074150 299 314 3759 3774 GGCCGAGGTGGAGAAG 85 1409 1074182 386 401 3846 3861 GCCCGGGATCCATGGC 82 1410 1074214 672 687 4132 4147 TCCGGCGGCTTGAAGA 89 1411 1074246 942 957 7376 7391 AAGAAGTATCTCTGAC 11 1412 1074278 1158 1173 79099 79114 CTTGGGTCTAGCCAAG 31 1413 1074310 1379 1394 N/A N/A TCCGCATTGCCTGTGG 100 1414 1074342 1495 1510 116684 116699 CATCCCGGGAGAAGAC 56 1415 1074374 1682 1697 122707 122722 TGCTTTGGTTGATAGT 13 1416 1074406 2032 2047 123057 123072 AAAGTATCTTGCTGGA 16 1417 1074438 2279 2294 123304 123319 GACATGAAGCATCTGA 1* 1418 1074470 2657 2672 123682 123697 CCCCCCACCGACCCTG 69 1419 1074502 2749 2764 123774 123789 AACTACAATAACCATC 31 1420 1074534 3041 3056 124066 124081 TAATAGCTCTTTCTAG 88 1421 1074566 3181 3196 124206 124221 CACTGAATTCCAATCG 3 1422 1074598 3410 3425 124435 124450 CTTATAGTATTCTATC 46 1423 1074630 3743 3758 124768 124783 AGAGATTTTATGCCTG 5 1424 1074662 4062 4077 125087 125102 GGTAGAATTTCATTAC 30 1425 1074694 4247 4262 125272 125287 CCCCCCCCCAAACTTT 79 1426 1074726 4438 4453 125463 125478 GGTATAACTGGGCAAA 2 1427 1074758 4608 4623 125633 125648 CAGTTAAGCACTTTTA 4 1428 1074790 4764 4779 125789 125804 CATCAACCATAAGTAG 28 1429 1074822 5051 5066 126076 126091 TAGAAAAGTGTTAAGC 25 1430 1074854 5146 5161 126171 126186 ACAATTGTTATGATAG 23 1431 1074918 N/A N/A 5534 5549 TCAAGTTACATCCCGA 60 1432 1074950 N/A N/A 5652 5667 ATCAGGTTAAGTGATT 120 1433 1074982 N/A N/A 126500 126515 ACCTTTTATTGCCAGT 13 1434 1075014 N/A N/A 6038 6053 GGAGAAATAAAAGTCG 46 1435 1075046 N/A N/A 7846 7861 AAAATTAGACTCCCCC 12 1436 1075078 N/A N/A 10061 10076 CAACTATACGGTCCAT 3 1437 1075110 N/A N/A 11254 11269 GACTAAAAACATTGTG 120 1438 1075142 N/A N/A 13865 13880 GATATACGAGAAGTTG 16 1439 1075174 N/A N/A 17491 17506 CCTGAAAAGACAGTCC 74 1440 1075206 N/A N/A 22161 22176 TATTAAATGAGCACCA 36 1441 1075238 N/A N/A 25596 25611 CTTAAACAGGTGCCAA 24 1442 1075270 N/A N/A 27599 27614 CTTTATTAACCTGGAG 18 1443 1075302 N/A N/A 31497 31512 CCTTAAAGCTTCCACC 75 1444 1075334 N/A N/A 32542 32557 TTAATAATCTACCAGT 60 1445 1075366 N/A N/A 34296 34311 ACACGAAAATAGTTCT 27 1446 1075398 N/A N/A 36612 36627 TATATATGGCCCTTTA 49 1447 1075430 N/A N/A 39017 39032 CTTAACTAACTTGACC 96 1448 1075462 N/A N/A 41259 41274 GTTTATAGACAAGTCA 15 1449 1075494 N/A N/A 43450 43465 TCTCAACAATTTGCTA 47 1450 1075526 N/A N/A 45520 45535 TTTAATTAAGGGCCCA 110 1451 1075558 N/A N/A 47656 47671 ATATTAAGGTGGCTTA 51 1452 1075590 N/A N/A 49396 49411 CATCAAAATTAGCAGG 50 1453 1075622 N/A N/A 51771 51786 TCTTATACCTATCTTC 56 1454 1075654 N/A N/A 53501 53516 TATTAAGACGAATCCA 76 1455 1075686 N/A N/A 55578 55593 GTAATTACAGTGTCTC 10 1456 1075718 N/A N/A 57703 57718 CCACTAAAACCAAGTT 48 1457 1075750 N/A N/A 59801 59816 CAATTATGAATGATGG 10 1458 1075782 N/A N/A 62506 62521 TATTAGGTTTCCCGTT 10 1459 1075814 N/A N/A 64821 64836 TATAAAGCAGGGCATT 47 1460 1075846 N/A N/A 67670 67685 GATTAAGAGCCTATCT 96 1461 1075878 N/A N/A 71286 71301 GATTATCAAGTAGTTT 35 1462 1075910 N/A N/A 74520 74535 GAAATAAGGAGTAGGT 93 1463 1075942 N/A N/A 77172 77187 TGACTATACATGGTGA 46 1464 1075974 N/A N/A 80589 80604 AAAAAATTCCGCAACA 39 1465 1076006 N/A N/A 82219 82234 TTTAAACCTGAGACTC 41 1466 1076038 N/A N/A 85047 85062 AGGCAAGAATTGGGTA 11 1467 1076070 N/A N/A 87434 87449 ATTAGTAATGCACAGG 6 1468 1076102 N/A N/A 90613 90628 CTTAACAAATCAGCCC 32 1469 1076134 N/A N/A 92267 92282 GATTAGAGTTGGGCAT 10 1470 1076166 N/A N/A 93997 94012 ATTTACACCACCGCCC 77 1471 1076198 N/A N/A 96351 96366 CTATTATCAAGGGAAT 81 1472 1076230 N/A N/A 98041 98056 GAATTAACCTCAGTGA 50 1473 1076262 N/A N/A 101120 101135 AGACAATAGTCTGGGC 41 1474 1076294 N/A N/A 103629 103644 TATATTAGTGCCCCCT 6 1475 1076326 N/A N/A 106621 106636 GCTAATAATGGAAGAG 4 1476 1076358 N/A N/A 109745 109760 GTTTAACAAACTTGTA 43 1477 1076390 N/A N/A 111487 111502 GATCGAAATATTCGAG 54 1478 1076422 N/A N/A 113901 113916 GAATTATGACCTCCAT 13 1479 1076454 N/A N/A 117469 117484 TAAACTAATCCCATAT 35 1480 1076486 N/A N/A 119782 119797 GAAACGAAACGGGAAA 5 1481 1076518 N/A N/A 122341 122356 GATAAGCACCACCATA 25 1482 1076550 N/A N/A 120573 120588 TACCAACCTGTATCCA 61 1483
TABLE-US-00021 TABLE 21 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compound Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 1 810 1074119 132 147 3592 3607 GCACTCGGACCTGCGG 71 1484 1074151 300 315 3760 3775 GGGCCGAGGTGGAGAA 81 1485 1074183 407 422 3867 3882 CCGGTTGAGGCGGCGG 90 1486 1074215 674 689 4134 4149 GCTCCGGCGGCTTGAA 77 1487 1074247 955 970 N/A N/A ATCGATGTGATTTAAG 43 1488 1074279 1165 1180 79106 79121 GTCAAGCCTTGGGTCT 13 1489 1074311 1380 1395 N/A N/A TTCCGCATTGCCTGTG 24 1490 1074343 1498 1513 116687 116702 AGACATCCCGGGAGAA 18 1491 1074375 1688 1703 122713 122728 GCAGGGTGCTTTGGTT 33 1492 1074407 2033 2048 123058 123073 TAAAGTATCTTGCTGG 6 1493 1074439 2283 2298 123308 123323 CTGTGACATGAAGCAT 2* 1494 1074471 2658 2673 123683 123698 CCCCCCCACCGACCCT 69 1495 1074503 2750 2765 123775 123790 CAACTACAATAACCAT 29 1496 1074535 3042 3057 124067 124082 GTAATAGCTCTTTCTA 5 1497 1074567 3189 3204 124214 124229 AACCTACTCACTGAAT 38 1498 1074599 3423 3438 124448 124463 GCTAACTCAAAACCTT 12 1499 1074631 3765 3780 124790 124805 CATAGCAGCTTTTGCC 9 1500 1074663 4069 4084 125094 125109 CATTCTAGGTAGAATT 79 1501 1074695 4266 4281 125291 125306 CCCCCTAAATCTTCAC 49 1502 1074727 4440 4455 125465 125480 GAGGTATAACTGGGCA 9 1503 1074759 4619 4634 125644 125659 CAACCAAGAAGCAGTT 43 1504 1074791 4767 4782 125792 125807 CTCCATCAACCATAAG 20 1505 1074823 5080 5095 126105 126120 GAGCACTCATTTCTCA 77 1506 1074855 5213 5228 126238 126253 GTGCATTAAAGAATTC 29 1507 1074887 N/A N/A 5450 5465 TAGCCTGAAGCAAGTT 57 1508 1074919 N/A N/A 5535 5550 CTCAAGTTACATCCCG 48 1509 1074951 N/A N/A 5653 5668 CATCAGGTTAAGTGAT 85 1510 1074983 N/A N/A 126501 126516 CACCTTTTATTGCCAG 11 1511 1075015 N/A N/A 6067 6082 CAGAATAAGTATGATT 55 1512 1075047 N/A N/A 7847 7862 TAAAATTAGACTCCCC 7 1513 1075079 N/A N/A 10149 10164 CACCAAAAGCTTAGTT 40 1514 1075111 N/A N/A 11385 11400 TAGGAATATGGGTAGT 5 1515 1075143 N/A N/A 13883 13898 CCTTATTAGTCAGTTC 2 1516 1075175 N/A N/A 17507 17522 ACTGAAAGATTCCATG 99 1517 1075207 N/A N/A 22162 22177 CTATTAAATGAGCACC 4 1518 1075239 N/A N/A 25597 25612 TCTTAAACAGGTGCCA 27 1519 1075271 N/A N/A 27652 27667 GATGTGATCTGTGAGA 11 1520 1075303 N/A N/A 31554 31569 TAAACTAATCTACAAC 100 1521 1075335 N/A N/A 32543 32558 CTTAATAATCTACCAG 30 1522 1075367 N/A N/A 34502 34517 CATTACTTAGGGCTTA 12 1523 1075399 N/A N/A 36614 36629 CATATATATGGCCCTT 15 1524 1075431 N/A N/A 39045 39060 TAACTAAACTGATTCC 74 1525 1075463 N/A N/A 41370 41385 CTTAATCCAAAGCTTC 34 1526 1075495 N/A N/A 43489 43504 CTTAATTGGTAACTGA 19 1527 1075527 N/A N/A 45521 45536 ATTTAATTAAGGGCCC 82 1528 1075559 N/A N/A 47657 47672 GATATTAAGGTGGCTT 24 1529 1075591 N/A N/A 49541 49556 GTAATAATCACCTTAC 76 1530 1075623 N/A N/A 51815 51830 CATAATCAAAATGGGC 48 1531 1075655 N/A N/A 53502 53517 CTATTAAGACGAATCC 38 1532 1075687 N/A N/A 55642 55657 TAAACGAGTAATGACT 23 1533 1075719 N/A N/A 58015 58030 CTAAAACCGGCTGGAC 76 1534 1075751 N/A N/A 59839 59854 GAGGAACAAGATCTCA 72 1535 1075783 N/A N/A 62684 62699 CTTAATTTACCTGAAC 36 1536 1075815 N/A N/A 64822 64837 GTATAAAGCAGGGCAT 36 1537 1075847 N/A N/A 67823 67838 CTTTATAGCAGATGCC 14 1538 1075879 N/A N/A 71353 71368 GAATAAAGAAGTCACC 77 1539 1075911 N/A N/A 74637 74652 TGACAAAACAGGCACC 41 1540 1075943 N/A N/A 77361 77376 GTATATCAAACCTTTT 15 1541 1075975 N/A N/A 80592 80607 GGAAAAAAATTCCGCA 84 1542 1076007 N/A N/A 82293 82308 CATTAGGCCTTTTACT 27 1543 1076039 N/A N/A 85200 85215 GATTAGAGCTGTATTC 29 1544 1076071 N/A N/A 87435 87450 TATTAGTAATGCACAG 14 1545 1076103 N/A N/A 90614 90629 GCTTAACAAATCAGCC 79 1546 1076135 N/A N/A 92319 92334 CATAATTGACAGGTAT 14 1547 1076167 N/A N/A 93999 94014 AAATTTACACCACCGC 33 1548 1076199 N/A N/A 96382 96397 TATCAAAAGTCCATCC 37 1549 1076231 N/A N/A 98106 98121 TTAGAAATGGACTGGG 16 1550 1076263 N/A N/A 101298 101313 AATAACCAAGTGAGTT 21 1551 1076295 N/A N/A 103630 103645 GTATATTAGTGCCCCC 2 1552 1076327 N/A N/A 106694 106709 GATAAGCAAGGTTCTC 7 1553 1076359 N/A N/A 109776 109791 ATTTATCCTAGTTACC 29 1554 1076391 N/A N/A 111530 111545 CAAATATAGTTAGCCT 22 1555 1076423 N/A N/A 114068 114083 CCTGAACCTTCTGGAT 93 1556 1076455 N/A N/A 117635 117650 ACTAAATACTTTTAGC 86 1557 1076487 N/A N/A 119786 119801 GTACGAAACGAAACGG 21 1558 1076519 N/A N/A 122375 122390 ACACAACACGACAGCA 31 1559 1076551 N/A N/A 5268 5283 GTGGAATAGCAGCCAT 67 1560
TABLE-US-00022 TABLE 22 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compound Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 1 810 1074120 137 152 3597 3612 GCGAGGCACTCGGACC 50 1561 1074152 301 316 3761 3776 CGGGCCGAGGTGGAGA 77 1562 1074184 408 423 3868 3883 GCCGGTTGAGGCGGCG 100 1563 1074216 681 696 4141 4156 GATTTGGGCTCCGGCG 58 1564 1074248 956 971 N/A N/A GATCGATGTGATTTAA 29 1565 1074280 1166 1181 79107 79122 GGTCAAGCCTTGGGTC 43 1566 1074312 1383 1398 102515 102530 ATATTCCGCATTGCCT 18 1567 1074344 1500 1515 116689 116704 TGAGACATCCCGGGAG 99 1568 1074376 1706 1721 122731 122746 AACGGTTCTGCTGTGA 44 1569 1074408 2036 2051 123061 123076 GATTAAAGTATCTTGC 23 1570 1074440 2284 2299 123309 123324 GCTGTGACATGAAGCA 38* 1571 1074472 2660 2675 123685 123700 AACCCCCCCACCGACC 107 1572 1074504 2804 2819 123829 123844 TCGAGATTTAAATAAG 76 1573 1074536 3043 3058 124068 124083 AGTAATAGCTCTTTCT 6 1574 1074568 3190 3205 124215 124230 GAACCTACTCACTGAA 12 1575 1074600 3425 3440 124450 124465 CAGCTAACTCAAAACC 29 1576 1074632 3766 3781 124791 124806 TCATAGCAGCTTTTGC 12 1577 1074664 4070 4085 125095 125110 GCATTCTAGGTAGAAT 49 1578 1074696 4268 4283 125293 125308 GTCCCCCTAAATCTTC 38 1579 1074728 4441 4456 125466 125481 TGAGGTATAACTGGGC 3 1580 1074760 4620 4635 125645 125660 ACAACCAAGAAGCAGT 11 1581 1074792 4776 4791 125801 125816 ATCAATGTGCTCCATC 4 1582 1074824 5083 5098 126108 126123 CCTGAGCACTCATTTC 53 1583 1074856 5223 5238 126248 126263 TTTGACAAGTGTGCAT 15 1584 1074888 N/A N/A 5453 5468 GTTTAGCCTGAAGCAA 58 1585 1074920 N/A N/A 5536 5551 ACTCAAGTTACATCCC 68 1586 1074952 N/A N/A 5661 5676 GTTTTTGTCATCAGGT 42 1587 1074984 N/A N/A 126503 126518 ATCACCTTTTATTGCC 31 1588 1075016 N/A N/A 6068 6083 TCAGAATAAGTATGAT 100 1589 1075048 N/A N/A 7848 7863 GTAAAATTAGACTCCC 4 1590 1075080 N/A N/A 10219 10234 ATTACAAAGACAGCCC 18 1591 1075112 N/A N/A 11388 11403 ATATAGGAATATGGGT 6 1592 1075144 N/A N/A 14659 14674 ACCCTATATCCTATAT 82 1593 1075176 N/A N/A 17544 17559 AATTACCCGGGAACTA 70 1594 1075208 N/A N/A 22191 22206 ACTGAACACAGGCTAC 24 1595 1075240 N/A N/A 25749 25764 TAAACGGTTTATATTC 16 1596 1075272 N/A N/A 28023 28038 AATTAGCCAGCATGCA 110 1597 1075304 N/A N/A 31613 31628 CACGGGTACCAGAAAA 50 1598 1075336 N/A N/A 32544 32559 GCTTAATAATCTACCA 32 1599 1075368 N/A N/A 34751 34766 GAGAATAAGCAATCAG 24 1600 1075400 N/A N/A 36641 36656 TAGCAATAGTCAGGTA 11 1601 1075432 N/A N/A 39046 39061 CTAACTAAACTGATTC 121 1602 1075464 N/A N/A 41448 41463 CCACTAAACCACCTAA 77 1603 1075496 N/A N/A 43503 43518 TTATATAATGCAGGCT 22 1604 1075528 N/A N/A 45616 45631 ATCGAAGGGCAAACTC 42 1605 1075560 N/A N/A 47723 47738 GCTAAATAAAGGTTAC 86 1606 1075592 N/A N/A 49542 49557 CGTAATAATCACCTTA 55 1607 1075624 N/A N/A 51848 51863 ATCTATAACCCTTATT 91 1608 1075656 N/A N/A 53591 53606 AAAACGGTTTTTCTAA 103 1609 1075688 N/A N/A 55673 55688 GACAATAAACATCACC 12 1610 1075720 N/A N/A 58458 58473 CTTTACTACATATAGC 47 1611 1075752 N/A N/A 60020 60035 CATAATTATACTGATC 19 1612 1075784 N/A N/A 62703 62718 ATTTTATAGGGCCATT 3 1613 1075816 N/A N/A 64824 64839 TAGTATAAAGCAGGGC 7 1614 1075848 N/A N/A 67963 67978 GATTACAATGGGCAGT 9 1615 1075880 N/A N/A 71412 71427 ATTAACTACACCACGA 30 1616 1075912 N/A N/A 74743 74758 AGTTATACACAACCAC 13 1617 1075944 N/A N/A 77599 77614 TATTAGGAACAGATCA 25 1618 1075976 N/A N/A 80964 80979 ATTAAAAGTCGGGCCA 92 1619 1076008 N/A N/A 82386 82401 AGCGAAAATAACATTA 33 1620 1076040 N/A N/A 85319 85334 CTTAAAGAAGCACTAG 105 1621 1076072 N/A N/A 87726 87741 CACAAAAACTGGTCTG 18 1622 1076104 N/A N/A 90640 90655 ACGAAATAGTAACTGT 24 1623 1076136 N/A N/A 92372 92387 CAACAACCTCATGTAA 60 1624 1076168 N/A N/A 94000 94015 CAAATTTACACCACCG 23 1625 1076200 N/A N/A 96417 96432 GATTACACTATCAAAA 67 1626 1076232 N/A N/A 98125 98140 GTAATACACCATTTGG 15 1627 1076264 N/A N/A 101302 101317 ACCCAATAACCAAGTG 40 1628 1076296 N/A N/A 103670 103685 TATAAAGACCCAATGC 68 1629 1076328 N/A N/A 107005 107020 ACTGAACCGCTGCCTC 33 1630 1076360 N/A N/A 109778 109793 CTATTTATCCTAGTTA 59 1631 1076392 N/A N/A 111564 111579 TATTAATCAAATAGGG 64 1632 1076424 N/A N/A 114085 114100 ACTTAACCTGACAGCT 76 1633 1076456 N/A N/A 117763 117778 CTTTAAAGTGTATGTC 2 1634 1076488 N/A N/A 119867 119882 GCCAATAAGATAAGAA 19 1635 1076520 N/A N/A 122407 122422 AATTATATGCAGCAGC 21 1636 1076552 N/A N/A 11807 11822 ATGTATAAATACCAGG 7 1637
TABLE-US-00023 TABLE 23 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compound Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 2 810 1074121 138 153 3598 3613 TGCGAGGCACTCGGAC 87 1638 1074153 303 318 3763 3778 CACGGGCCGAGGTGGA 78 1639 1074185 409 424 3869 3884 GGCCGGTTGAGGCGGC 91 1640 1074217 682 697 4142 4157 GGATTTGGGCTCCGGC 74 1641 1074249 957 972 N/A N/A TGATCGATGTGATTTA 23 1642 1074281 1169 1184 79110 79125 GAGGGTCAAGCCTTGG 91 1643 1074313 1385 1400 102517 102532 TGATATTCCGCATTGC 5 1644 1074345 1533 1548 116722 116737 TCTGAGCTATTGGTCG 8 1645 1074377 1707 1722 122732 122747 AAACGGTTCTGCTGTG 52 1646 1074409 2037 2052 123062 123077 GGATTAAAGTATCTTG 6 1647 1074441 2294 2309 123319 123334 CAAACTAAATGCTGTG 5* 1648 1074473 2661 2676 123686 123701 CAACCCCCCCACCGAC 82 1649 1074505 2806 2821 123831 123846 AATCGAGATTTAAATA 83 1650 1074537 3044 3059 124069 124084 CAGTAATAGCTCTTTC 3 1651 1074569 3191 3206 124216 124231 TGAACCTACTCACTGA 8 1652 1074601 3426 3441 124451 124466 CCAGCTAACTCAAAAC 24 1653 1074633 3774 3789 124799 124814 GAGGCTTTTCATAGCA 78 1654 1074665 4072 4087 125097 125112 TTGCATTCTAGGTAGA 17 1655 1074697 4274 4289 125299 125314 ATCAAGGTCCCCCTAA 44 1656 1074729 4445 4460 125470 125485 ACACTGAGGTATAACT 9 1657 1074761 4628 4643 125653 125668 TACCCAATACAACCAA 15 1658 1074793 4777 4792 125802 125817 AATCAATGTGCTCCAT 9 1659 1074825 5084 5099 126109 126124 ACCTGAGCACTCATTT 36 1660 1074857 5245 5260 126270 126285 ACATTGGTACTATATA 25 1661 1074889 N/A N/A 5454 5469 AGTTTAGCCTGAAGCA 42 1662 1074921 N/A N/A 5537 5552 CACTCAAGTTACATCC 65 1663 1074953 N/A N/A 5663 5678 GGGTTTTTGTCATCAG 32 1664 1074985 N/A N/A 126504 126519 AATCACCTTTTATTGC 49 1665 1075017 N/A N/A 6099 6114 CTTAAAGTGATACACC 19 1666 1075049 N/A N/A 7912 7927 GAAATATTGGTAAGTC 10 1667 1075081 N/A N/A 10220 10235 GATTACAAAGACAGCC 7 1668 1075113 N/A N/A 11804 11819 TATAAATACCAGGTAC 67 1669 1075145 N/A N/A 15306 15321 TCCCAAAAGGAGTAGC 58 1670 1075177 N/A N/A 17546 17561 GAAATTACCCGGGAAC 27 1671 1075209 N/A N/A 22213 22228 CATCAACAATGGTCTA 11 1672 1075241 N/A N/A 25786 25801 GATAATTACTAACTGA 31 1673 1075273 N/A N/A 28145 28160 AAATTATGGTCAGGCT 18 1674 1075305 N/A N/A 31621 31636 AAACGAAACACGGGTA 66 1675 1075337 N/A N/A 32561 32576 GCTTATATCCTGTAAC 48 1676 1075369 N/A N/A 34752 34767 GGAGAATAAGCAATCA 31 1677 1075401 N/A N/A 36720 36735 CGATTAAAACACTGGT 3 1678 1075433 N/A N/A 39050 39065 TTAACTAACTAAACTG 124 1679 1075465 N/A N/A 41471 41486 GATTTATTGAACTGAG 7 1680 1075497 N/A N/A 43504 43519 ATTATATAATGCAGGC 14 1681 1075529 N/A N/A 45618 45633 AAATCGAAGGGCAAAC 84 1682 1075561 N/A N/A 47742 47757 GTAAGTAAGGGAACCC 32 1683 1075593 N/A N/A 49605 49620 CATTAGAGTATGAACT 99 1684 1075625 N/A N/A 51849 51864 AATCTATAACCCTTAT 49 1685 1075657 N/A N/A 53594 53609 TAAAAAACGGTTTTTC 84 1686 1075689 N/A N/A 55744 55759 CAACTATACAAGGCAA 4 1687 1075721 N/A N/A 58637 58652 TTAAATACCTTCTAGC 67 1688 1075753 N/A N/A 60167 60182 CTAGAACCTTTTCCAG 65 1689 1075785 N/A N/A 62704 62719 CATTTTATAGGGCCAT 2 1690 1075817 N/A N/A 65591 65606 CCTAAAGAAGTCTTGG 100 1691 1075849 N/A N/A 67996 68011 CTAGAACACGCTGATG 55 1692 1075881 N/A N/A 71413 71428 GATTAACTACACCACG 23 1693 1075913 N/A N/A 75193 75208 CCCCTATACTTTTTGA 46 1694 1075945 N/A N/A 77600 77615 GTATTAGGAACAGATC 11 1695 1075977 N/A N/A 80965 80980 GATTAAAAGTCGGGCC 73 1696 1076009 N/A N/A 82387 82402 TAGCGAAAATAACATT 69 1697 1076041 N/A N/A 85661 85676 GTTAAAGAGTGGAAAT 47 1698 1076073 N/A N/A 88094 88109 CTTTAAGGTCTAGTTA 47 1699 1076105 N/A N/A 90641 90656 TACGAAATAGTAACTG 13 1700 1076137 N/A N/A 92375 92390 CACCAACAACCTCATG 45 1701 1076169 N/A N/A 94082 94097 CTACTATATCTTTGGG 10 1702 1076201 N/A N/A 96469 96484 CTAAAAAGACAGGGCC 99 1703 1076233 N/A N/A 98280 98295 CCAATAAAGCAAGTAG 13 1704 1076265 N/A N/A 101306 101321 TATTACCCAATAACCA 9 1705 1076297 N/A N/A 103671 103686 TTATAAAGACCCAATG 52 1706 1076329 N/A N/A 107153 107168 AATTATACTGGCTACT 14 1707 1076361 N/A N/A 109944 109959 TGGGAAAAGCTACCAC 87 1708 1076393 N/A N/A 111591 111606 CTTTACTTACTGGTGG 4 1709 1076425 N/A N/A 114175 114190 CGGGAAAATTCTGGAG 32 1710 1076457 N/A N/A 117800 117815 GAACTATAATCTTATA 74 1711 1076489 N/A N/A 119885 119900 CAAAATAGGTGAGTCA 2 1712 1076521 N/A N/A 122446 122461 ACTAAAGGAGTCATGA 67 1713 1076553 N/A N/A 37304 37319 TGGGAATAATTTGGCC 69 1714
TABLE-US-00024 TABLE 24 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compound Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 2 810 1074122 139 154 3599 3614 CTGCGAGGCACTCGGA 73 1715 1074154 304 319 3764 3779 CCACGGGCCGAGGTGG 100 1716 1074186 410 425 3870 3885 GGGCCGGTTGAGGCGG 74 1717 1074218 726 741 7160 7175 AGGGCTCCTGCAGTGC 70 1718 1074250 958 973 N/A N/A CTGATCGATGTGATTT 6 1719 1074282 1170 1185 79111 79126 CGAGGGTCAAGCCTTG 83 1720 1074314 1387 1402 102519 102534 ATTGATATTCCGCATT 12 1721 1074346 1534 1549 116723 116738 ATCTGAGCTATTGGTC 10 1722 1074378 1708 1723 122733 122748 GAAACGGTTCTGCTGT 31 1723 1074410 2041 2056 123066 123081 TAGAGGATTAAAGTAT 32 1724 1074442 2351 2366 123376 123391 GACCAGTAAATCATGT 21 1725 1074474 2662 2677 123687 123702 CCAACCCCCCCACCGA 71 1726 1074506 2807 2822 123832 123847 TAATCGAGATTTAAAT 107 1727 1074538 3049 3064 124074 124089 ATCCACAGTAATAGCT 31 1728 1074570 3192 3207 124217 124232 ATGAACCTACTCACTG 12 1729 1074602 3427 3442 124452 124467 TCCAGCTAACTCAAAA 24 1730 1074634 3777 3792 124802 124817 GCTGAGGCTTTTCATA 55 1731 1074666 4085 4100 125110 125125 CATATACCCAATTTTG 16 1732 1074698 4275 4290 125300 125315 TATCAAGGTCCCCCTA 78 1733 1074730 4463 4478 125488 125503 TATCACAGTACTGCTA 46 1734 1074762 4630 4645 125655 125670 GCTACCCAATACAACC 6 1735 1074794 4779 4794 125804 125819 CAAATCAATGTGCTCC 5 1736 1074826 5090 5105 126115 126130 AAATCCACCTGAGCAC 51 1737 1074858 5246 5261 126271 126286 AACATTGGTACTATAT 23 1738 1074890 N/A N/A 5456 5471 GAAGTTTAGCCTGAAG 58 1739 1074922 N/A N/A 5542 5557 CTTTCCACTCAAGTTA 87 1740 1074954 N/A N/A 5665 5680 CCGGGTTTTTGTCATC 91 1741 1074986 N/A N/A 126511 126526 CTACTGTAATCACCTT 78 1742 1075018 N/A N/A 6100 6115 CCTTAAAGTGATACAC 29 1743 1075050 N/A N/A 8047 8062 ACCCAACGGTCATGTT 94 1744 1075082 N/A N/A 10252 10267 CTTTAGATACAAGAGG 80 1745 1075114 N/A N/A 11805 11820 GTATAAATACCAGGTA 26 1746 1075146 N/A N/A 15570 15585 GTATTAAGGGATTTTC 8 1747 1075178 N/A N/A 17552 17567 CTGGAAGAAATTACCC 47 1748 1075210 N/A N/A 22314 22329 GTATTTTAACCTAAAC 100 1749 1075242 N/A N/A 25790 25805 CAGGGATAATTACTAA 7 1750 1075274 N/A N/A 28203 28218 AATAATCCAGCCTAGG 86 1751 1075306 N/A N/A 31622 31637 TAAACGAAACACGGGT 30 1752 1075338 N/A N/A 32572 32587 CCCAAAAACTAGCTTA 56 1753 1075370 N/A N/A 34931 34946 CTTACGAATCACATAT 32 1754 1075402 N/A N/A 36792 36807 GAGCAACACAAGCATA 45 1755 1075434 N/A N/A 39406 39421 GTAAAAGAGGTGCATC 96 1756 1075466 N/A N/A 41511 41526 TCCAAAAACCATCAGT 28 1757 1075498 N/A N/A 43505 43520 CATTATATAATGCAGG 9 1758 1075530 N/A N/A 45619 45634 GAAATCGAAGGGCAAA 30 1759 1075562 N/A N/A 47824 47839 GTATTTATGGCAACAT 15 1760 1075594 N/A N/A 49676 49691 TGAGAATATTCCTCCC 64 1761 1075626 N/A N/A 51926 51941 CATTAGCCAAAGCTCA 34 1762 1075658 N/A N/A 53595 53610 GTAAAAAACGGTTTTT 103 1763 1075690 N/A N/A 55750 55765 CGTTAACAACTATACA 33 1764 1075722 N/A N/A 58638 58653 GTTAAATACCTTCTAG 88 1765 1075754 N/A N/A 60230 60245 CTTAAATGGCACAGTT 20 1766 1075786 N/A N/A 62749 62764 CTATATTGATTCCAGA 19 1767 1075818 N/A N/A 65659 65674 CATAACTTAGAACCAT 35 1768 1075850 N/A N/A 68030 68045 CTATAGGTACTTAGAA N.D. 1769 1075882 N/A N/A 71422 71437 GAAAATCCTGATTAAC 73 1770 1075914 N/A N/A 75298 75313 ATTTAGGATGCCTTTA 14 1771 1075946 N/A N/A 77683 77698 GCTGAATAAGTAACTT 20 1772 1075978 N/A N/A 80966 80981 AGATTAAAAGTCGGGC 11 1773 1076010 N/A N/A 82396 82411 TATAAACAATAGCGAA 44 1774 1076042 N/A N/A 85704 85719 CTTAAGCAAGAGTCCA 35 1775 1076074 N/A N/A 88162 88177 CTAATTAGCTTTCAGC 92 1776 1076106 N/A N/A 90642 90657 CTACGAAATAGTAACT 77 1777 1076138 N/A N/A 92409 92424 AGCCAACAATTTTTGG 113 1778 1076170 N/A N/A 94131 94146 AGTAAAGAGTACTGTA 16 1779 1076202 N/A N/A 96470 96485 TCTAAAAAGACAGGGC 32 1780 1076234 N/A N/A 98304 98319 CCTTAATATATCCACA 24 1781 1076266 N/A N/A 101308 101323 ATTATTACCCAATAAC 72 1782 1076298 N/A N/A 103672 103687 GTTATAAAGACCCAAT 10 1783 1076330 N/A N/A 107154 107169 GAATTATACTGGCTAC 3 1784 1076362 N/A N/A 110095 110110 CCACTAAATAAAGCAG 16 1785 1076394 N/A N/A 111629 111644 CCTAAATTAGACTTGA 20 1786 1076426 N/A N/A 114176 114191 ACGGGAAAATTCTGGA 9 1787 1076458 N/A N/A 117825 117840 CTTAATTAGCCTCAGT 6 1788 1076490 N/A N/A 119886 119901 CCAAAATAGGTGAGTC 2 1789 1076522 N/A N/A 122448 122463 GCACTAAAGGAGTCAT 35 1790 1076554 N/A N/A 38773 38788 TGGGAATAGTGAATTT 30 1791
TABLE-US-00025 TABLE 25 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compound Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5′ to 3′) UTC) ID NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 1 810 1074123 140 155 3600 3615 GCTGCGAGGCACTCGG 72 1792 1074155 311 326 3771 3786 CCCGGCTCCACGGGCC 87 1793 1074187 439 454 3899 3914 CTGCGAAGGCGGCTGC 47 1794 1074219 730 745 7164 7179 AGTCAGGGCTCCTGCA 30 1795 1074251 959 974 N/A N/A TCTGATCGATGTGATT 7 1796 1074283 1174 1189 79115 79130 AAAACGAGGGTCAAGC 12 1797 1074315 1388 1403 102520 102535 GATTGATATTCCGCAT 3 1798 1074347 1546 1561 116735 116750 GTTAAGGAAAGGATCT 34 1799 1074379 1711 1726 122736 122751 TGGGAAACGGTTCTGC 20 1800 1074411 2095 2110 123120 123135 TGTGAAAGAGGTCAGC 3 1801 1074443 2354 2369 123379 123394 TCAGACCAGTAAATCA 7 1802 1074475 2663 2678 123688 123703 ACCAACCCCCCCACCG 72 1803 1074507 2808 2823 123833 123848 ATAATCGAGATTTAAA 74 1804 1074539 3051 3066 124076 124091 CTATCCACAGTAATAG 62 1805 1074571 3193 3208 124218 124233 TATGAACCTACTCACT 37 1806 1074603 3428 3443 124453 124468 TTCCAGCTAACTCAAA 17 1807 1074635 3783 3798 124808 124823 TCCCAAGCTGAGGCTT 31 1808 1074667 4107 4122 125132 125147 CCCAACAACATGCTAT 15 1809 1074699 4276 4291 125301 125316 CTATCAAGGTCCCCCT 27 1810 1074731 4467 4482 125492 125507 CAGGTATCACAGTACT 19 1811 1074763 4631 4646 125656 125671 TGCTACCCAATACAAC 25 1812 1074795 4780 4795 125805 125820 CCAAATCAATGTGCTC 4 1813 1074827 5092 5107 126117 126132 TAAAATCCACCTGAGC 39 1814 1074859 5248 5263 126273 126288 GTAACATTGGTACTAT 16 1815 1074891 N/A N/A 5457 5472 TGAAGTTTAGCCTGAA 31 1816 1074923 N/A N/A 5556 5571 GGGCGGTAACTCTTCT 73 1817 1074955 N/A N/A 5666 5681 CCCGGGTTTTTGTCAT 93 1818 1074987 N/A N/A 4228 4243 GCCGCGGCTCCCGAGC 94 1819 1075019 N/A N/A 6185 6200 CATTAGAGTTTGATTA 64 1820 1075051 N/A N/A 8055 8070 AATAAACAACCCAACG 56 1821 1075083 N/A N/A 10265 10280 CAACAACACTCCTCTT 54 1822 1075115 N/A N/A 11890 11905 GTATAGCCTTATTCTT 6 1823 1075147 N/A N/A 15583 15598 TATAAACCTTACAGTA 57 1824 1075179 N/A N/A 18169 18184 AATTAGCCGGTCCCAG 107 1825 1075211 N/A N/A 22668 22683 AATAAAGGGTCCTAAC 91 1826 1075243 N/A N/A 26237 26252 CTTAGTAAGAATTGTC 4 1827 1075275 N/A N/A 28517 28532 CTAGAAAGGCCATGTA 76 1828 1075307 N/A N/A 31624 31639 ATTAAACGAAACACGG 28 1829 1075339 N/A N/A 32573 32588 ACCCAAAAACTAGCTT 70 1830 1075371 N/A N/A 34942 34957 CTGCAAAAGTTCTTAC 90 1831 1075403 N/A N/A 36942 36957 CTTAATCAGGTACTAT 18 1832 1075435 N/A N/A 39516 39531 CTTAAACGATAAAGTA 93 1833 1075467 N/A N/A 41522 41537 CATTAATGCCATCCAA 60 1834 1075499 N/A N/A 43601 43616 GCTAAAAAATGAGTAG 99 1835 1075531 N/A N/A 45685 45700 CTTAATAGTTTAACCT 66 1836 1075563 N/A N/A 47947 47962 CCATATAACCAGTTTT 12 1837 1075595 N/A N/A 49869 49884 TATAATACATCTCCCC 50 1838 1075627 N/A N/A 51985 52000 ATAAGATAGTCGGTTC 19 1839 1075659 N/A N/A 53597 53612 AAGTAAAAAACGGTTT 125 1840 1075691 N/A N/A 55841 55856 CGTCAAAATTAACAGA 46 1841 1075723 N/A N/A 58758 58773 TTATCCTATCCCTGGT 32 1842 1075755 N/A N/A 60231 60246 ACTTAAATGGCACAGT 73 1843 1075787 N/A N/A 62761 62776 CTTAAGGATTGGCTAT 28 1844 1075819 N/A N/A 65672 65687 GTATATCCGTTCTCAT 2 1845 1075851 N/A N/A 68466 68481 GCCGAATATGGGAAAA 70 1846 1075883 N/A N/A 71454 71469 ACTAAAACCATTTGCC 20 1847 1075915 N/A N/A 75299 75314 AATTTAGGATGCCTTT 16 1848 1075947 N/A N/A 78266 78281 CTTTATAGGAATAGAG 95 1849 1075979 N/A N/A 81132 81147 CATAATCCACTATGCA 18 1850 1076011 N/A N/A 82397 82412 ATATAAACAATAGCGA 61 1851 1076043 N/A N/A 85727 85742 CAAAAAGGCTATTGAG 36 1852 1076075 N/A N/A 88209 88224 ACACAAGGGTTGCTAA 38 1853 1076107 N/A N/A 90801 90816 CATTACCAACTTCTTC 23 1854 1076139 N/A N/A 92416 92431 CGAAAAAAGCCAACAA 18 1855 1076171 N/A N/A 94134 94149 ATTAGTAAAGAGTACT 30 1856 1076203 N/A N/A 96576 96591 GTTAATACATGGCCAA 29 1857 1076235 N/A N/A 98318 98333 TCAAAATAATCAGCCC 34 1858 1076267 N/A N/A 101345 101360 ATTTAAGGTGCATAAG 13 1859 1076299 N/A N/A 103673 103688 CGTTATAAAGACCCAA 3 1860 1076331 N/A N/A 107265 107280 CATTATTCAGTAGTTG 71 1861 1076363 N/A N/A 110104 110119 CATAAAAGTCCACTAA 72 1862 1076395 N/A N/A 111649 111664 GTAACTAACCTAAGGA 34 1863 1076427 N/A N/A 114212 114227 CAAATTTACTGATCTC 3 1864 1076459 N/A N/A 117903 117918 CTTCAACAAGACAGGT 4 1865 1076491 N/A N/A 119888 119903 AGCCAAAATAGGTGAG 12 1866 1076523 N/A N/A 122559 122574 ATTTATATCAGGTCAA 5 1867 1076555 N/A N/A 74684 74699 TGGGAATAGTACACAG 19 1868
TABLE-US-00026 TABLE 26 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compund Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5' to 3') UTC) ID NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 1 810 1074124 141 156 3601 3616 GGCTGCGAGGCACTCG 94 1869 1074156 329 344 3789 3804 AGGGCTACGCCCGGAC 96 1870 1074188 440 455 3900 3915 GCTGCGAAGGCGGCTG 113 1871 1074220 752 767 7186 7201 AATGAGCTCGAACATG 22 1872 1074252 997 1012 55492 55507 GGACAGCATGGCCTTC 50 1873 1074284 1175 1190 79116 79131 CAAAACGAGGGTCAAG 21 1874 1074316 1389 1404 102521 102536 GGATTGATATTCCGCA 33 1875 1074348 1578 1593 120483 120498 GTACTCTCATCTCGAG 100 1876 1074380 1714 1729 122739 122754 GTCTGGGAAACGGTTC 11 1877 1074412 2096 2111 123121 123136 CTGTGAAAGAGGTCAG 55 1878 1074444 2368 2383 123393 123408 ACATTTTTGGCTTGTC 3 1879 1074476 2685 2700 123710 123725 TTCCGACAAAACCAAC 18 1880 1074508 2818 2833 123843 123858 GAGAGAGCAGATAATC 7 1881 1074540 3052 3067 124077 124092 ACTATCCACAGTAATA 26 1882 1074572 3194 3209 124219 124234 TTATGAACCTACTCAC 17 1883 1074604 3446 3461 124471 124486 TTATTAATCTGATCAC 12 1884 1074636 3791 3806 124816 124831 ATCTATCTTCCCAAGC 56 1885 1074668 4108 4123 125133 125148 TCCCAACAACATGCTA 20 1886 1074700 4320 4335 125345 125360 GTAAGACAAGTCTTTA 26 1887 1074732 4468 4483 125493 125508 CCAGGTATCACAGTAC 30 1888 1074764 4632 4647 125657 125672 ATGCTACCCAATACAA 18 1889 1074796 4782 4797 125807 125822 CTCCAAATCAATGTGC 22 1890 1074828 5093 5108 126118 126133 ATAAAATCCACCTGAG 58 1891 1074860 5252 5267 126277 126292 AAAGGTAACATTGGTA 9 1892 1074892 N/A N/A 5458 5473 CTGAAGTTTAGCCTGA 42 1893 1074924 N/A N/A 5585 5600 CCTGCAAATAGGAGAG 87 1894 1074956 N/A N/A 5667 5682 ACCCGGGTTTTTGTCA 104 1895 1074988 N/A N/A 4324 4339 ACCGCGGCGGAGTGGA 94 1896 1075020 N/A N/A 6193 6208 TTAATTAGCATTAGAG 30 1897 1075052 N/A N/A 8204 8219 ATATATACTTGATCCA 3 1898 1075084 N/A N/A 10268 10283 TGACAACAACACTCCT 9 1899 1075116 N/A N/A 11969 11984 CTTAACATTTAATGGC 15 1900 1075148 N/A N/A 16000 16015 CGGAAAAAACACCTAG 66 1901 1075180 N/A N/A 18759 18774 TATTACTACAACCATA 56 1902 1075212 N/A N/A 22669 22684 CAATAAAGGGTCCTAA 76 1903 1075244 N/A N/A 26292 26307 ACCCAAAAATTCTGTG 76 1904 1075276 N/A N/A 28647 28662 GACCAATACAATGGGA 78 1905 1075308 N/A N/A 31625 31640 AATTAAACGAAACACG 97 1906 1075340 N/A N/A 32580 32595 CCCGAACACCCAAAAA 103 1907 1075372 N/A N/A 34997 35012 ATATATAGACTTGAGA 27 1908 1075404 N/A N/A 37268 37283 ATATAACCTGAACTAA 102 1909 1075436 N/A N/A 39517 39532 CCTTAAACGATAAAGT 89 1910 1075468 N/A N/A 41570 41585 CACCAATACTGAGTAT 91 1911 1075500 N/A N/A 43668 43683 TAAATTAAGCCAACAC 26 1912 1075532 N/A N/A 45686 45701 ACTTAATAGTTTAACC 121 1913 1075564 N/A N/A 48028 48043 ATATAACAGGCCACCA 81 1914 1075596 N/A N/A 49870 49885 ATATAATACATCTCCC 91 1915 1075628 N/A N/A 52040 52055 CCGCAAAATATTAATT 118 1916 1075660 N/A N/A 53599 53614 CAAAGTAAAAAACGGT 72 1917 1075692 N/A N/A 55999 56014 TAAGAACACCATAGCA 11 1918 1075724 N/A N/A 58769 58784 CTATCTGTCAGTTATC 44 1919 1075756 N/A N/A 60243 60258 ATTTACCCTGCCACTT 49 1920 1075788 N/A N/A 62762 62777 TCTTAAGGATTGGCTA 15 1921 1075820 N/A N/A 65896 65911 TCTGAACGGGCTGTTG 27 1922 1075852 N/A N/A 68471 68486 GATAAGCCGAATATGG 58 1923 1075884 N/A N/A 71468 71483 ATTAGTAATGACTAAC 116 1924 1075916 N/A N/A 75300 75315 CAATTTAGGATGCCTT 6 1925 1075948 N/A N/A 78306 78321 GGACTAAAGAATACAG 31 1926 1075980 N/A N/A 81219 81234 CAATATCCTACACCAT 43 1927 1076012 N/A N/A 82398 82413 AATATAAACAATAGCG 34 1928 1076044 N/A N/A 85729 85744 ATCAAAAAGGCTATTG 73 1929 1076076 N/A N/A 88372 88387 TATCAATACTTTAGTC 57 1930 1076108 N/A N/A 90863 90878 AAACAAAACCGGCTTT 116 1931 1076140 N/A N/A 92417 92432 ACGAAAAAAGCCAACA 28 1932 1076172 N/A N/A 94135 94150 TATTAGTAAAGAGTAC 98 1933 1076204 N/A N/A 96620 96635 GATAATGAATCCTTGT 11 1934 1076236 N/A N/A 98440 98455 GGAGAACCTTATTTAT 51 1935 1076268 N/A N/A 101514 101529 GTACAATAATGCTTCC 10 1936 1076300 N/A N/A 103687 103702 AAAAAATGGCTTCACG 22 1937 1076332 N/A N/A 107285 107300 TATAAGGAATGGCAAC 107 1938 1076364 N/A N/A 110105 110120 CCATAAAAGTCCACTA 30 1939 1076396 N/A N/A 111672 111687 CTATATTTGAGCCATG 2 1940 1076428 N/A N/A 114406 114421 ATTAAAAAGAAGCACG 53 1941 1076460 N/A N/A 117914 117929 TAATATAGCCCCTTCA 7 1942 1076492 N/A N/A 120180 120195 AAAAGATACCCCCAGT 47 1943 1076524 N/A N/A 122560 122575 AATTTATATCAGGTCA 6 1944 1076556 N/A N/A 116991 117006 GTATAGGCAGAAGCAA 9 1945
TABLE-US-00027 TABLE 27 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compund Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5' to 3') UTC) ID NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 2 810 1074125 160 175 3620 3635 GCGGCTGCGCCTCGGG 94 1946 1074157 333 348 3793 3808 AGCGAGGGCTACGCCC 103 1947 1074189 441 456 3901 3916 GGCTGCGAAGGCGGCT 96 1948 1074221 753 768 7187 7202 GAATGAGCTCGAACAT 6 1949 1074253 1001 1016 55496 55511 TCTGGGACAGCATGGC 11 1950 1074285 1176 1191 N/A N/A GCAAAACGAGGGTCAA 17 1951 1074317 1406 1421 102538 102553 GAGAATTTGCTGTGCT 12 1952 1074349 1580 1595 120485 120500 CTGTACTCTCATCTCG 30 1953 1074381 1715 1730 122740 122755 AGTCTGGGAAACGGTT 16 1954 1074413 2097 2112 123122 123137 ACTGTGAAAGAGGTCA 4 1955 1074445 2471 2486 123496 123511 TGATAGCACTAGGAGG 6 1956 1074477 2686 2701 123711 123726 GTTCCGACAAAACCAA 10 1957 1074509 2850 2865 123875 123890 TGTTATGTTTGGGTGT 5 1958 1074541 3053 3068 124078 124093 CACTATCCACAGTAAT 23 1959 1074573 3195 3210 124220 124235 ATTATGAACCTACTCA 14 1960 1074605 3464 3479 124489 124504 TCAACTACCAATATAC 20 1961 1074637 3792 3807 124817 124832 AATCTATCTTCCCAAG 36 1962 1074669 4109 4124 125134 125149 ATCCCAACAACATGCT 13 1963 1074701 4322 4337 125347 125362 GTGTAAGACAAGTCTT 17 1964 1074733 4469 4484 125494 125509 GCCAGGTATCACAGTA 47 1965 1074765 4634 4649 125659 125674 CAATGCTACCCAATAC 34 1966 1074797 4783 4798 125808 125823 ACTCCAAATCAATGTG 31 1967 1074829 5095 5110 126120 126135 GGATAAAATCCACCTG 92 1968 1074861 5279 5294 126304 126319 TGCTCTTACATCTAAA 23 1969 1074893 N/A N/A 5459 5474 GCTGAAGTTTAGCCTG 78 1970 1074925 N/A N/A 5586 5601 GCCTGCAAATAGGAGA 94 1971 1074957 N/A N/A 5668 5683 AACCCGGGTTTTTGTC 102 1972 1074989 N/A N/A 4423 4438 GAGGGAAAGCACGCCC 105 1973 1075021 N/A N/A 6245 6260 TTACAACCTAGATTTG 68 1974 1075053 N/A N/A 8205 8220 AATATATACTTGATCC 4 1975 1075085 N/A N/A 10318 10333 TGCGGAAACAAGTGTA 11 1976 1075117 N/A N/A 12081 12096 CCTCAATAGCAAGACA 48 1977 1075149 N/A N/A 16001 16016 GCGGAAAAAACACCTA 50 1978 1075181 N/A N/A 18762 18777 TTATATTACTACAACC 15 1979 1075213 N/A N/A 22670 22685 ACAATAAAGGGTCCTA 33 1980 1075245 N/A N/A 26692 26707 CCTAATATGCTATTGT 34 1981 1075277 N/A N/A 28762 28777 TTATAAGAACTGTGGC 13 1982 1075309 N/A N/A 31626 31641 TAATTAAACGAAACAC 110 1983 1075341 N/A N/A 32592 32607 GCTGAACAATCTCCCG 31 1984 1075373 N/A N/A 34998 35013 TATATATAGACTTGAG 13 1985 1075405 N/A N/A 37270 37285 CTATATAACCTGAACT 84 1986 1075437 N/A N/A 39572 39587 TATTAGTACGAGCTAC 85 1987 1075469 N/A N/A 41723 41738 TGATATAATGACCAAG 25 1988 1075501 N/A N/A 43670 43685 CATAAATTAAGCCAAC 67 1989 1075533 N/A N/A 45730 45745 GATTACTCAGCTATGT 65 1990 1075565 N/A N/A 48029 48044 TATATAACAGGCCACC 52 1991 1075597 N/A N/A 49954 49969 ATTAACATTTGCCCGC 47 1992 1075629 N/A N/A 52041 52056 GCCGCAAAATATTAAT 100 1993 1075661 N/A N/A 53794 53809 GAATAGGATACAAGCA 74 1994 1075693 N/A N/A 56014 56029 CATTAAAAGTTGGGTT 36 1995 1075725 N/A N/A 58772 58787 ATCCTATCTGTCAGTT 18 1996 1075757 N/A N/A 60324 60339 CTTAATACATTATTCC 2 1997 1075789 N/A N/A 62993 63008 AATTACAAGCTAATGC 79 1998 1075821 N/A N/A 66155 66170 CTTAACTTCCCACTCG 22 1999 1075853 N/A N/A 68653 68668 GAGCGATAAGCTGTAT 72 2000 1075885 N/A N/A 71469 71484 CATTAGTAATGACTAA 112 2001 1075917 N/A N/A 75472 75487 AGCAAAAAGTGATATG 55 2002 1075949 N/A N/A 78635 78650 TAGGAACACCAAGGTT 48 2003 1075981 N/A N/A 81222 81237 AAGCAATATCCTACAC 40 2004 1076013 N/A N/A 82644 82659 GTTTAATACCTCTGAC 76 2005 1076045 N/A N/A 85776 85791 GTGCAATAAATAGTTC 11 2006 1076077 N/A N/A 88420 88435 GGATTAAAGTTTTCAC 5 2007 1076109 N/A N/A 91026 91041 CTTAAATGACCAATTC 23 2008 1076141 N/A N/A 92418 92433 TACGAAAAAAGCCAAC 29 2009 1076173 N/A N/A 94244 94259 CAATATATCCTGAGAT 91 2010 1076205 N/A N/A 96783 96798 TAGTATAATTCATGAC 51 2011 1076237 N/A N/A 98456 98471 ACTAAAGGACAAAGGT 109 2012 1076269 N/A N/A 101560 101575 GACGAAAAATATTCTT 28 2013 1076301 N/A N/A 104195 104210 GTATAAGACCTTGGGA 34 2014 1076333 N/A N/A 107286 107301 CTATAAGGAATGGCAA 97 2015 1076365 N/A N/A 110141 110156 TAAGAAGGGCCAATGG 15 2016 1076397 N/A N/A 111675 111690 AACCTATATTTGAGCC 4 2017 1076429 N/A N/A 114456 114471 CATTACAAGCATAGGC 26 2018 1076461 N/A N/A 117917 117932 GATTAATATAGCCCCT 3 2019 1076493 N/A N/A 120197 120212 TGACAATAAGGGACAA 34 2020 1076525 N/A N/A 122561 122576 GAATTTATATCAGGTC 3 2021 1076557 N/A N/A 55411 55426 AACAAATACCAGGTTC 111 2022
TABLE-US-00028 TABLE 28 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compund Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5' to 3') UTC) ID NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 2 810 1074126 163 178 3623 3638 CTGGCGGCTGCGCCTC 111 2023 1074158 334 349 3794 3809 GAGCGAGGGCTACGCC 72 2024 1074190 463 478 3923 3938 CGGCGGGCCCTGCCCC 114 2025 1074222 755 770 7189 7204 AGGAATGAGCTCGAAC 5 2026 1074254 1002 1017 55497 55512 ATCTGGGACAGCATGG 13 2027 1074286 1193 1208 98895 98910 TGATTCTCTGGTTCAT 32 2028 1074318 1407 1422 102539 102554 GGAGAATTTGCTGTGC 4 2029 1074350 1591 1606 120496 120511 TAGTCCACTGTCTGTA 14 2030 1074382 1719 1734 122744 122759 AGGTAGTCTGGGAAAC 8 2031 1074414 2098 2113 123123 123138 AACTGTGAAAGAGGTC 6 2032 1074446 2472 2487 123497 123512 ATGATAGCACTAGGAG 3 2033 1074478 2691 2706 123716 123731 CCTAGGTTCCGACAAA 69 2034 1074510 2878 2893 123903 123918 ATACATTCCACTACCA 10 2035 1074542 3056 3071 124081 124096 AGGCACTATCCACAGT 21 2036 1074574 3196 3211 124221 124236 CATTATGAACCTACTC 17 2037 1074606 3500 3515 124525 124540 GGTATAATCATGATTA 4 2038 1074638 3816 3831 124841 124856 AGATTTTGTAATTGGG 2 2039 1074670 4141 4156 125166 125181 AAGTAGCTTTGATCTT 49 2040 1074702 4323 4338 125348 125363 GGTGTAAGACAAGTCT 16 2041 1074734 4470 4485 125495 125510 TGCCAGGTATCACAGT 51 2042 1074766 4638 4653 125663 125678 ATCCCAATGCTACCCA 8 2043 1074798 4800 4815 125825 125840 GCTTTGGAAGATCTGA 4 2044 1074830 5097 5112 126122 126137 GAGGATAAAATCCACC 89 2045 1074862 5287 5302 126312 126327 TATGAGCATGCTCTTA 56 2046 1074894 N/A N/A 5460 5475 TGCTGAAGTTTAGCCT 79 2047 1074926 N/A N/A 5592 5607 CAACAGGCCTGCAAAT 111 2048 1074958 N/A N/A 5669 5684 TAACCCGGGTTTTTGT 107 2049 1074990 N/A N/A 4687 4702 GCCGCAAAGGAAAGGG 108 2050 1075022 N/A N/A 6247 6262 ATTTACAACCTAGATT 91 2051 1075054 N/A N/A 8206 8221 CAATATATACTTGATC 48 2052 1075086 N/A N/A 10392 10407 AGTTATAGACTTTGTA 25 2053 1075118 N/A N/A 12281 12296 CTATTTACTCTGTCAC 4 2054 1075150 N/A N/A 16002 16017 AGCGGAAAAAACACCT 35 2055 1075182 N/A N/A 18766 18781 GATATTATATTACTAC 61 2056 1075214 N/A N/A 22671 22686 AACAATAAAGGGTCCT 45 2057 1075246 N/A N/A 26760 26775 GATAACTAGTAACCGT 6 2058 1075278 N/A N/A 28866 28881 TATACTAACATTCACG 48 2059 1075310 N/A N/A 31627 31642 GTAATTAAACGAAACA 84 2060 1075342 N/A N/A 32636 32651 ACTAAAAGGGAGTAGG 87 2061 1075374 N/A N/A 35122 35137 GAAAATACTCCTCCTA 27 2062 1075406 N/A N/A 37271 37286 ACTATATAACCTGAAC 99 2063 1075438 N/A N/A 39657 39672 CATATTAGAGTTGAGG 22 2064 1075470 N/A N/A 41860 41875 GCCAATAAGTTATCAA 50 2065 1075502 N/A N/A 44236 44251 CTTAACATGATTCTAG 61 2066 1075534 N/A N/A 45787 45802 ACCCAAGGACAGCACA 53 2067 1075566 N/A N/A 48030 48045 ATATATAACAGGCCAC 50 2068 1075598 N/A N/A 49955 49970 AATTAACATTTGCCCG 62 2069 1075630 N/A N/A 52052 52067 TATAACCAAATGCCGC 60 2070 1075662 N/A N/A 53888 53903 AAGGGATACAAGTGTT 78 2071 1075694 N/A N/A 56015 56030 ACATTAAAAGTTGGGT 11 2072 1075726 N/A N/A 58776 58791 AGTTATCCTATCTGTC 14 2073 1075758 N/A N/A 60403 60418 GTAATTTAATAGACTA 73 2074 1075790 N/A N/A 63026 63041 TCAGAAGAACTCCCAT 14 2075 1075822 N/A N/A 66205 66220 CTTAGTAATTGCCCAT 35 2076 1075854 N/A N/A 68837 68852 CTTATAATAGAGCTAA 52 2077 1075886 N/A N/A 71526 71541 CATAACACTGAAGGTG 60 2078 1075918 N/A N/A 75510 75525 CTTAAACTAACTGTTG 82 2079 1075950 N/A N/A 78649 78664 TGACAATACCTTCCTA 30 2080 1075982 N/A N/A 81227 81242 CATGAAAGCAATATCC 23 2081 1076014 N/A N/A 82658 82673 AATCAACCTATGAGGT 98 2082 1076046 N/A N/A 85784 85799 CTTAAATGGTGCAATA 28 2083 1076078 N/A N/A 89187 89202 CTTTAGCCTCTATACC 23 2084 1076110 N/A N/A 91091 91106 CTTTACCTAAATGTTG 53 2085 1076142 N/A N/A 92419 92434 ATACGAAAAAAGCCAA 38 2086 1076174 N/A N/A 94299 94314 GATATATGGTAGCATA 3 2087 1076206 N/A N/A 96835 96850 CAATAAACTTACCCTT 55 2088 1076238 N/A N/A 98513 98528 GATGAATAGCTAAGAA 30 2089 1076270 N/A N/A 101571 101586 TAACAATAGTAGACGA 28 2090 1076302 N/A N/A 104337 104352 AATAAGCCTCACCTTT 74 2091 1076334 N/A N/A 107288 107303 ACCTATAAGGAATGGC 108 2092 1076366 N/A N/A 110167 110182 ATTTACATGAGAGGAG 4 2093 1076398 N/A N/A 111707 111722 CTTGAAGGGCTATGGA 62 2094 1076430 N/A N/A 114752 114767 CGTTATAAGATGTGCT 4 2095 1076462 N/A N/A 117971 117986 TCAGAAGGATATGCAG 6 2096 1076494 N/A N/A 120254 120269 CTAATTGAAGCTGGCA 3 2097 1076526 N/A N/A 102684 102699 GTAGAAAGATGGCTCA 3 2098 1076558 N/A N/A 82852 82867 GCCAAATATTTAACTC 30 2099
TABLE-US-00029 TABLE 29 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compund Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5' to 3') UTC) ID NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 2 810 1074127 171 186 3631 3646 CCACTGGTCTGGCGGC 57 2100 1074159 335 350 3795 3810 CGAGCGAGGGCTACGC 77 2101 1074191 464 479 3924 3939 ACGGCGGGCCCTGCCC 80 2102 1074223 786 801 7220 7235 GAAACAGCTCCCAACT 48 2103 1074255 1004 1019 55499 55514 TCATCTGGGACAGCAT 16 2104 1074287 1195 1210 98897 98912 ACTGATTCTCTGGTTC 11 2105 1074319 1425 1440 N/A N/A GCTAACTCCTGACATT 47 2106 1074351 1596 1611 120501 120516 ATGCTTAGTCCACTGT 7 2107 1074383 1722 1737 122747 122762 TCAAGGTAGTCTGGGA 40 2108 1074415 2101 2116 123126 123141 GCCAACTGTGAAAGAG 10 2109 1074447 2473 2488 123498 123513 AATGATAGCACTAGGA 4 2110 1074479 2697 2712 123722 123737 CATTTGCCTAGGTTCC 2 2111 1074511 2879 2894 123904 123919 GATACATTCCACTACC 9 2112 1074543 3059 3074 124084 124099 CCTAGGCACTATCCAC 57 2113 1074575 3197 3212 124222 124237 ACATTATGAACCTACT 14 2114 1074607 3502 3517 124527 124542 AAGGTATAATCATGAT 4 2115 1074639 3817 3832 124842 124857 TAGATTTTGTAATTGG 3 2116 1074671 4142 4157 125167 125182 CAAGTAGCTTTGATCT 8 2117 1074703 4324 4339 125349 125364 CGGTGTAAGACAAGTC 16 2118 1074735 4483 4498 125508 125523 GATCAAAGCACTGTGC 117 2119 1074767 4640 4655 125665 125680 TTATCCCAATGCTACC 12 2120 1074799 4801 4816 125826 125841 TGCTTTGGAAGATCTG 8 2121 1074831 5098 5113 126123 126138 CGAGGATAAAATCCAC 35 2122 1074863 5288 5303 126313 126328 ATATGAGCATGCTCTT 41 2123 1074895 N/A N/A 5465 5480 TCCTATGCTGAAGTTT 60 2124 1074927 N/A N/A 5594 5609 TACAACAGGCCTGCAA 74 2125 1074959 N/A N/A 5670 5685 TTAACCCGGGTTTTTG 128 2126 1074991 N/A N/A 4727 4742 AATTATTTGACTCCCC 60 2127 1075023 N/A N/A 6249 6264 GTATTTACAACCTAGA 18 2128 1075055 N/A N/A 8271 8286 CTATTAAGTGAGCTTT 4 2129 1075087 N/A N/A 10400 10415 TCTCAATAAGTTATAG 39 2130 1075119 N/A N/A 12305 12320 AGGGAATATGTTAATC 8 2131 1075151 N/A N/A 16014 16029 TTTAAAAGTACCAGCG 60 2132 1075183 N/A N/A 18905 18920 ATTACTAAGACAGTGG 15 2133 1075215 N/A N/A 22672 22687 AAACAATAAAGGGTCC 44 2134 1075247 N/A N/A 26764 26779 CTAAGATAACTAGTAA 101 2135 1075279 N/A N/A 28867 28882 CTATACTAACATTCAC 52 2136 1075311 N/A N/A 31628 31643 AGTAATTAAACGAAAC 100 2137 1075343 N/A N/A 32637 32652 AACTAAAAGGGAGTAG 89 2138 1075375 N/A N/A 35237 35252 CTAAATATCAACTCCC 35 2139 1075407 N/A N/A 37273 37288 GAACTATATAACCTGA 32 2140 1075439 N/A N/A 39815 39830 AATTAGAGATATGGAC 77 2141 1075471 N/A N/A 41861 41876 AGCCAATAAGTTATCA 55 2142 1075503 N/A N/A 44248 44263 GCTGAAAAAGGGCTTA 66 2143 1075535 N/A N/A 45791 45806 AATTACCCAAGGACAG 53 2144 1075567 N/A N/A 48031 48046 GATATATAACAGGCCA 65 2145 1075599 N/A N/A 49979 49994 ACCCTATAGCTTTAGG 90 2146 1075631 N/A N/A 52055 52070 CCCTATAACCAAATGC 104 2147 1075663 N/A N/A 53926 53941 CTAAATAGGTGGTTAT 80 2148 1075695 N/A N/A 56025 56040 GAATAACACCACATTA 30 2149 1075727 N/A N/A 58798 58813 TTATCGGAGGCTTCGC 31 2150 1075759 N/A N/A 60742 60757 CCTTATAAATTATGAC 44 2151 1075791 N/A N/A 63059 63074 CTTTATCAGCCATCAC 10 2152 1075823 N/A N/A 66222 66237 TATTAGAGGTTCCAGG 30 2153 1075855 N/A N/A 68937 68952 GATTTTTAGGCAGACG 7 2154 1075887 N/A N/A 71602 71617 TATTACTTGATTGACA 10 2155 1075919 N/A N/A 75511 75526 TCTTAAACTAACTGTT 78 2156 1075951 N/A N/A 78699 78714 CACGGAAGAGCTTGCA 34 2157 1075983 N/A N/A 81249 81264 ATCGAAAAGCAAACTC 5 2158 1076015 N/A N/A 82981 82996 ATTTAGTTGGTTGTTA 8 2159 1076047 N/A N/A 85785 85800 ACTTAAATGGTGCAAT 34 2160 1076079 N/A N/A 89467 89482 AAGCAATATATGGCCT 37 2161 1076111 N/A N/A 91203 91218 AATTAGTTAGGATATC 67 2162 1076143 N/A N/A 92420 92435 GATACGAAAAAAGCCA 8 2163 1076175 N/A N/A 94392 94407 CAATAGGTAACAGGTA 15 2164 1076207 N/A N/A 96838 96853 AGTCAATAAACTTACC 58 2165 1076239 N/A N/A 98583 98598 GTTTAAAAAAAACGGG 75 2166 1076271 N/A N/A 101685 101700 CGGCAACAACAAAATG 18 2167 1076303 N/A N/A 104339 104354 CTAATAAGCCTCACCT 34 2168 1076335 N/A N/A 107289 107304 CACCTATAAGGAATGG 80 2169 1076367 N/A N/A 110169 110184 CTATTTACATGAGAGG 3 2170 1076399 N/A N/A 111771 111786 GATAACTTAGAGATGT 4 2171 1076431 N/A N/A 114853 114868 CACCAATAGAACATAT 31 2172 1076463 N/A N/A 118082 118097 GATTAGTAACACTGAT 38 2173 1076495 N/A N/A 120353 120368 GATTAGTGAAAATTCC 30 2174 1076527 N/A N/A 117218 117233 GCACAACCTTACATTT 6 2175 1076559 N/A N/A 111532 111547 AACAAATATAGTTAGC 74 2176
TABLE-US-00030 TABLE 30 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compund Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5' to 3') UTC) ID NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 1 810 1074128 173 188 3633 3648 CTCCACTGGTCTGGCG 76 2177 1074160 336 351 3796 3811 GCGAGCGAGGGCTACG 86 2178 1074192 465 480 3925 3940 GACGGCGGGCCCTGCC 108 2179 1074224 821 836 7255 7270 CAGAGACTACTCCAGT 16 2180 1074256 1033 1048 55528 55543 CACTGGTGGACTGGTG 64 2181 1074288 1196 1211 98898 98913 GACTGATTCTCTGGTT 48 2182 1074320 1426 1441 N/A N/A GGCTAACTCCTGACAT 80 2183 1074352 1597 1612 120502 120517 CATGCTTAGTCCACTG 69 2184 1074384 1723 1738 122748 122763 TTCAAGGTAGTCTGGG 35 2185 1074416 2108 2123 123133 123148 CTTTAGAGCCAACTGT 9 2186 1074448 2474 2489 123499 123514 TAATGATAGCACTAGG 3 2187 1074480 2698 2713 123723 123738 TCATTTGCCTAGGTTC 3 2188 1074512 2880 2895 123905 123920 GGATACATTCCACTAC 64 2189 1074544 3063 3078 124088 124103 CTCCCCTAGGCACTAT 34 2190 1074576 3201 3216 124226 124241 ATGCACATTATGAACC 7 2191 1074608 3529 3544 124554 124569 GTTACATCATCTCTTC 5 2192 1074640 3828 3843 124853 124868 GCCAAAATACTTAGAT 26 2193 1074672 4143 4158 125168 125183 CCAAGTAGCTTTGATC 6 2194 1074704 4326 4341 125351 125366 CACGGTGTAAGACAAG 16 2195 1074736 4504 4519 125529 125544 TCAGTACAGAGGGCAT 4 2196 1074768 4641 4656 125666 125681 CTTATCCCAATGCTAC 11 2197 1074800 4808 4823 125833 125848 CAAATAGTGCTTTGGA 6 2198 1074832 5099 5114 126124 126139 GCGAGGATAAAATCCA 17 2199 1074864 5289 5304 126314 126329 CATATGAGCATGCTCT 47 2200 1074896 N/A N/A 5472 5487 GCAAAGTTCCTATGCT 99 2201 1074928 N/A N/A 5595 5610 ATACAACAGGCCTGCA 83 2202 1074960 N/A N/A 5671 5686 CTTAACCCGGGTTTTT 81 2203 1074992 N/A N/A 4728 4743 CAATTATTTGACTCCC 63 2204 1075024 N/A N/A 6368 6383 ACTGAACAAGTATCTT 32 2205 1075056 N/A N/A 8297 8312 CTTTATTATCTCAACC 21 2206 1075088 N/A N/A 10433 10448 ATTTATAGTCAGGTTC 2 2207 1075120 N/A N/A 12519 12534 AATTAGCCTACCACCT 42 2208 1075152 N/A N/A 16101 16116 TATAATGGGAGGATTA 99 2209 1075184 N/A N/A 18998 19013 CAAGAACACTGGTATT 67 2210 1075216 N/A N/A 23247 23262 TATTTTACACGAACTA 55 2211 1075248 N/A N/A 26930 26945 GTACAAAAAGCGGTCG 64 2212 1075280 N/A N/A 28870 28885 GAACTATACTAACATT 57 2213 1075312 N/A N/A 31662 31677 TTAATTGAACTCAGGG 37 2214 1075344 N/A N/A 32638 32653 TAACTAAAAGGGAGTA 91 2215 1075376 N/A N/A 35238 35253 CCTAAATATCAACTCC 72 2216 1075408 N/A N/A 37387 37402 CTAAAATGGCATAAGG 23 2217 1075440 N/A N/A 39843 39858 AAATTATTAGTTGTCG 28 2218 1075472 N/A N/A 41890 41905 GATTATAGTTAAACAG 92 2219 1075504 N/A N/A 44291 44306 CTTAAATGAGAGAACC 71 2220 1075536 N/A N/A 45793 45808 TTAATTACCCAAGGAC 55 2221 1075568 N/A N/A 48108 48123 TTATTTAAGTTGGGAG 23 2222 1075600 N/A N/A 49991 50006 CACTATAATCTGACCC 68 2223 1075632 N/A N/A 52056 52071 TCCCTATAACCAAATG 95 2224 1075664 N/A N/A 53927 53942 GCTAAATAGGTGGTTA 87 2225 1075696 N/A N/A 56066 56081 TTACAAAAGTTACTGC 28 2226 1075728 N/A N/A 58800 58815 CTTTATCGGAGGCTTC 15 2227 1075760 N/A N/A 61106 61121 GAGAAAAACTACGGAT 39 2228 1075792 N/A N/A 63072 63087 GATTAGAAAGTGCCTT 6 2229 1075824 N/A N/A 66223 66238 GTATTAGAGGTTCCAG 3 2230 1075856 N/A N/A 68965 68980 CCTAATCAAGTTCTGC 40 2231 1075888 N/A N/A 71648 71663 ACTTAAACTTGAGGGA 22 2232 1075920 N/A N/A 75749 75764 AAAGAAAGCTGCGCAC 108 2233 1075952 N/A N/A 78848 78863 CTATATACCTGCTTCT 41 2234 1075984 N/A N/A 81250 81265 TATCGAAAAGCAAACT 44 2235 1076016 N/A N/A 83002 83017 TAATAGGATGGATTCT 8 2236 1076048 N/A N/A 85859 85874 GATTAAAGGCTGGAAG 32 2237 1076080 N/A N/A 89574 89589 CATTAGCAGTTCACTA 55 2238 1076112 N/A N/A 91226 91241 ATTCAAAACCACGGAA 98 2239 1076144 N/A N/A 92435 92450 TTTTATAGGGCAATGG 7 2240 1076176 N/A N/A 94395 94410 CTCCAATAGGTAACAG 43 2241 1076208 N/A N/A 97037 97052 GAGGAATATTACAGAC 15 2242 1076240 N/A N/A 98611 98626 ATTAAAAGCAAGGTGC 56 2243 1076272 N/A N/A 101702 101717 TTAGAACAACTACTAC 53 2244 1076304 N/A N/A 104340 104355 ACTAATAAGCCTCACC 30 2245 1076336 N/A N/A 107295 107310 CATTACCACCTATAAG 31 2246 1076368 N/A N/A 110251 110266 CATTTTATGTAAGGCC 15 2247 1076400 N/A N/A 111869 111884 GTTAAAAGCCGTGAAA 10 2248 1076432 N/A N/A 114880 114895 CATTAGTATTCACTGT 18 2249 1076464 N/A N/A 118102 118117 CATATACAATTCTGCC 2 2250 1076496 N/A N/A 120437 120452 GTTAAAGACCAACACA 81 2251 1076528 N/A N/A 16102 16117 TTATAATGGGAGGATT 86 2252 1076560 N/A N/A 113259 113274 TCCAAATATGGCATAC 10 2253
TABLE-US-00031 TABLE 31 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compund Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5' to 3') UTC) ID NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 1 810 1074129 178 193 3638 3653 CCCGGCTCCACTGGTC 77 2254 1074161 337 352 3797 3812 GGCGAGCGAGGGCTAC 98 2255 1074193 471 486 3931 3946 GGTCCGGACGGCGGGC 74 2256 1074225 822 837 7256 7271 CCAGAGACTACTCCAG 11 2257 1074257 1034 1049 55529 55544 GCACTGGTGGACTGGT 29 2258 1074289 1197 1212 98899 98914 TGACTGATTCTCTGGT 13 2259 1074321 1427 1442 N/A N/A GGGCTAACTCCTGACA 73 2260 1074353 1612 1627 120517 120532 GACACTGTAGCTGCTC 17 2261 1074385 1724 1739 122749 122764 CTTCAAGGTAGTCTGG 17 2262 1074417 2109 2124 123134 123149 TCTTTAGAGCCAACTG 2 2263 1074449 2475 2490 123500 123515 CTAATGATAGCACTAG 36 2264 1074481 2705 2720 123730 123745 AATATGGTCATTTGCC 14 2265 1074513 2881 2896 123906 123921 AGGATACATTCCACTA 47 2266 1074545 3064 3079 124089 124104 ACTCCCCTAGGCACTA 18 2267 1074577 3211 3226 124236 124251 TATTTCTGTCATGCAC 3 2268 1074609 3532 3547 124557 124572 CTAGTTACATCATCTC 8 2269 1074641 3829 3844 124854 124869 GGCCAAAATACTTAGA 107 2270 1074673 4154 4169 125179 125194 AGGCACTCCTTCCAAG 43 2271 1074705 4327 4342 125352 125367 GCACGGTGTAAGACAA 20 2272 1074737 4510 4525 125535 125550 TTCAGGTCAGTACAGA 7 2273 1074769 4642 4657 125667 125682 TCTTATCCCAATGCTA 12 2274 1074801 4809 4824 125834 125849 ACAAATAGTGCTTTGG 8 2275 1074833 5100 5115 126125 126140 TGCGAGGATAAAATCC 17 2276 1074865 5290 5305 126315 126330 ACATATGAGCATGCTC 46 2277 1074897 N/A N/A 5473 5488 GGCAAAGTTCCTATGC 76 2278 1074929 N/A N/A 5596 5611 TATACAACAGGCCTGC 79 2279 1074961 N/A N/A 5676 5691 TCCTCCTTAACCCGGG 93 2280 1074993 N/A N/A 4755 4770 TCTAATCAACACTGGA 65 2281 1075025 N/A N/A 6468 6483 ACTTAAGAACTCACAC 58 2282 1075057 N/A N/A 8351 8366 CCTTAGGAGTAGACTG 14 2283 1075089 N/A N/A 10434 10449 CATTTATAGTCAGGTT 2 2284 1075121 N/A N/A 12521 12536 AAAATTAGCCTACCAC 40 2285 1075153 N/A N/A 16103 16118 ATTATAATGGGAGGAT 38 2286 1075185 N/A N/A 19001 19016 GCCCAAGAACACTGGT 78 2287 1075217 N/A N/A 23248 23263 TTATTTTACACGAACT 71 2288 1075249 N/A N/A 27029 27044 ATTACGATTAGATCAG 5 2289 1075281 N/A N/A 29105 29120 CAGCAAAAGTACCATG 36 2290 1075313 N/A N/A 31663 31678 CTTAATTGAACTCAGG 28 2291 1075345 N/A N/A 32639 32654 GTAACTAAAAGGGAGT 29 2292 1075377 N/A N/A 35267 35282 CTAGAAAGGTTGGCCC 108 2293 1075409 N/A N/A 37405 37420 CTTTAAATAGCAGAGG 22 2294 1075441 N/A N/A 40002 40017 GAATTAAAGCAGTGCC 24 2295 1075473 N/A N/A 41930 41945 AGTTATAACTGTACTA 89 2296 1075505 N/A N/A 44322 44337 GCTAAATTACAGAGGT 18 2297 1075537 N/A N/A 45795 45810 CTTTAATTACCCAAGG 82 2298 1075569 N/A N/A 48125 48140 GTAGAAAGGCATTAGA 45 2299 1075601 N/A N/A 49992 50007 ACACTATAATCTGACC 50 2300 1075633 N/A N/A 52118 52133 CTATATTGGCTCCTAG 82 2301 1075665 N/A N/A 53953 53968 ATTTAGTTGTGCACAG 87 2302 1075697 N/A N/A 56110 56125 AATAATCCATGCTTGC 16 2303 1075729 N/A N/A 58853 58868 TATTTAAAAATAGCGC 88 2304 1075761 N/A N/A 61107 61122 GGAGAAAAACTACGGA 13 2305 1075793 N/A N/A 63128 63143 CATTAGTTGCCCTGAC 31 2306 1075825 N/A N/A 66353 66368 CCCCTAAAGAAGATTT 44 2307 1075857 N/A N/A 68976 68991 CTTAAACAATCCCTAA 69 2308 1075889 N/A N/A 72204 72219 ATTAAAAGTAGGCCCT 71 2309 1075921 N/A N/A 75750 75765 GAAAGAAAGCTGCGCA 93 2310 1075953 N/A N/A 78851 78866 AACCTATATACCTGCT 36 2311 1075985 N/A N/A 81251 81266 ATATCGAAAAGCAAAC 82 2312 1076017 N/A N/A 83003 83018 CTAATAGGATGGATTC 5 2313 1076049 N/A N/A 85860 85875 AGATTAAAGGCTGGAA 4 2314 1076081 N/A N/A 89730 89745 GATAATTCACCCTTGT 15 2315 1076113 N/A N/A 91298 91313 TGACAATAGCCAATGC 16 2316 1076145 N/A N/A 92457 92472 CCTTATAGGTTATAGT 41 2317 1076177 N/A N/A 94422 94437 CTTTATTTCCCACCCG 37 2318 1076209 N/A N/A 97241 97256 CATTAGCACACCTTTT 12 2319 1076241 N/A N/A 98642 98657 CAATAAGGAACAGTTT 42 2320 1076273 N/A N/A 101849 101864 AAACAAAATGGCGAAT 84 2321 1076305 N/A N/A 104341 104356 TACTAATAAGCCTCAC 37 2322 1076337 N/A N/A 107326 107341 ATTAAACCAGGGACTG 25 2323 1076369 N/A N/A 110591 110606 TATTCGGTATTTTCTA 2 2324 1076401 N/A N/A 112117 112132 TCTAAAGACTCTCATT 31 2325 1076433 N/A N/A 114928 114943 ATTAACTTTCGCTAAA 69 2326 1076465 N/A N/A 118550 118565 GCTTAAGGAATATACA 5 2327 1076497 N/A N/A 120579 120594 AAAGAATACCAACCTG 72 2328 1076529 N/A N/A 40252 40267 CTATAATGAGGATTAC 108 2329 1076561 N/A N/A 11318 11333 GTATACCAAGCTACTC 22 2330
TABLE-US-00032 TABLE 32 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compund Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5' to 3') UTC) ID NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 2 810 1074130 214 229 3674 3689 ATCCCCCGCCCCGGCG 119 2331 1074162 338 353 3798 3813 AGGCGAGCGAGGGCTA 101 2332 1074194 474 489 3934 3949 CCGGGTCCGGACGGCG 57 2333 1074226 859 874 7293 7308 CTGTCGAAGATGCTGA 10 2334 1074258 1044 1059 55539 55554 ATATTCTGCTGCACTG 36 2335 1074290 1198 1213 98900 98915 CTGACTGATTCTCTGG 5 2336 1074322 1428 1443 N/A N/A AGGGCTAACTCCTGAC 94 2337 1074354 1613 1628 120518 120533 GGACACTGTAGCTGCT 24 2338 1074386 1733 1748 122758 122773 CAGGAATGGCTTCAAG 39 2339 1074418 2110 2125 123135 123150 TTCTTTAGAGCCAACT 4 2340 1074450 2476 2491 123501 123516 ACTAATGATAGCACTA 5 2341 1074482 2706 2721 123731 123746 TAATATGGTCATTTGC 12 2342 1074514 2882 2897 123907 123922 AAGGATACATTCCACT 25 2343 1074546 3065 3080 124090 124105 CACTCCCCTAGGCACT 33 2344 1074578 3214 3229 124239 124254 GCTTATTTCTGTCATG 8 2345 1074610 3533 3548 124558 124573 TCTAGTTACATCATCT 5 2346 1074642 3830 3845 124855 124870 GGGCCAAAATACTTAG 78 2347 1074674 4157 4172 125182 125197 TATAGGCACTCCTTCC 22 2348 1074706 4336 4351 125361 125376 TTAATGGCAGCACGGT 48 2349 1074738 4511 4526 125536 125551 CTTCAGGTCAGTACAG 12 2350 1074770 4643 4658 125668 125683 ATCTTATCCCAATGCT 15 2351 1074802 4836 4851 125861 125876 GGCACTACATTTAGAA 37 2352 1074834 5101 5116 126126 126141 TTGCGAGGATAAAATC 14 2353 1074866 5291 5306 126316 126331 AACATATGAGCATGCT 30 2354 1074898 N/A N/A 5481 5496 AACTTTTGGGCAAAGT 101 2355 1074930 N/A N/A 5597 5612 CTATACAACAGGCCTG 84 2356 1074962 N/A N/A 5709 5724 AGGCAAGCAGCTAAAT 78 2357 1074994 N/A N/A 4784 4799 AAACTAAATGGACCGG 94 2358 1075026 N/A N/A 6556 6571 CTTAAAAGCCATCTAC 55 2359 1075058 N/A N/A 8466 8481 ATTACAAAGTAGCAAC 66 2360 1075090 N/A N/A 10590 10605 GCTTATAATCTTTCAG 9 2361 1075122 N/A N/A 12522 12537 GAAAATTAGCCTACCA 16 2362 1075154 N/A N/A 16104 16119 CATTATAATGGGAGGA 13 2363 1075186 N/A N/A 19097 19112 AAATCGATTATTCAGA 73 2364 1075218 N/A N/A 23347 23362 CTTAACACTGGTAAGA 97 2365 1075250 N/A N/A 27030 27045 AATTACGATTAGATCA 55 2366 1075282 N/A N/A 29645 29660 GAAAAATGAGCCCGGT 103 2367 1075314 N/A N/A 31708 31723 AATAAAGTCTAATCCA 54 2368 1075346 N/A N/A 32705 32720 GTAAGTAAAACTGCTG 16 2369 1075378 N/A N/A 35289 35304 AAAACTAATCATCGAT 83 2370 1075410 N/A N/A 37572 37587 GATTAACAGCCCTTTA 36 2371 1075442 N/A N/A 40105 40120 TATTAGTTCTACGATT 71 2372 1075474 N/A N/A 41975 41990 TTTAATAGGCTCTATC 68 2373 1075506 N/A N/A 44427 44442 CATAAAGGTGACAGCC 66 2374 1075538 N/A N/A 46165 46180 GAATTGGAACACCTCA 66 2375 1075570 N/A N/A 48306 48321 GATACTAAGCACAGAG 16 2376 1075602 N/A N/A 50018 50033 TATTATAAGTCTACAA 114 2377 1075634 N/A N/A 52121 52136 AGACTATATTGGCTCC 65 2378 1075666 N/A N/A 53955 53970 AAATTTAGTTGTGCAC 106 2379 1075698 N/A N/A 56114 56129 GTTTAATAATCCATGC 10 2380 1075730 N/A N/A 58854 58869 GTATTTAAAAATAGCG 92 2381 1075762 N/A N/A 61391 61406 GATAAATGGGTTGATT 20 2382 1075794 N/A N/A 63266 63281 CATAATGAATGTGGGT 38 2383 1075826 N/A N/A 66375 66390 TAGGGAAAACCATAGC 23 2384 1075858 N/A N/A 68977 68992 CCTTAAACAATCCCTA 23 2385 1075890 N/A N/A 72205 72220 GATTAAAAGTAGGCCC 92 2386 1075922 N/A N/A 75778 75793 GCCCAAAATAGGATAC 60 2387 1075954 N/A N/A 78881 78896 ATTTAAGGCTGTGTTC 50 2388 1075986 N/A N/A 81253 81268 GAATATCGAAAAGCAA 26 2389 1076018 N/A N/A 83004 83019 ACTAATAGGATGGATT 15 2390 1076050 N/A N/A 85864 85879 CTTTAGATTAAAGGCT 45 2391 1076082 N/A N/A 89791 89806 TCTCAATACACTATAT 38 2392 1076114 N/A N/A 91589 91604 ATTAGTAAGCTGAGGA 3 2393 1076146 N/A N/A 92471 92486 GCTAAAACTTTCATCC 23 2394 1076178 N/A N/A 94474 94489 CCTGAAATACAGGTGT 100 2395 1076210 N/A N/A 97442 97457 ATTTATATGCTCCCTC 20 2396 1076242 N/A N/A 98645 98660 ATGCAATAAGGAACAG 33 2397 1076274 N/A N/A 102073 102088 TGAGAATAGAGCAGGT 9 2398 1076306 N/A N/A 104347 104362 CTTTACTACTAATAAG 99 2399 1076338 N/A N/A 107327 107342 CATTAAACCAGGGACT 33 2400 1076370 N/A N/A 110594 110609 GATTATTCGGTATTTT 2 2401 1076402 N/A N/A 112324 112339 CGTAATTATTTTTGCT 38 2402 1076434 N/A N/A 115047 115062 CTTTAGGTTTATGCCT 25 2403 1076466 N/A N/A 118557 118572 ATTTAGAGCTTAAGGA 5 2404 1076498 N/A N/A 120644 120659 TTACAATACCTTATGA 70 2405 1076530 N/A N/A 64823 64838 AGTATAAAGCAGGGCA 5 2406 1076562 N/A N/A 12922 12937 TATTACAGAGGGTAGC 17 2407
TABLE-US-00033 TABLE 33 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compund Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5' to 3') UTC) ID NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 4 810 1074131 222 237 3682 3697 GGCCCCGCATCCCCCG 72 2408 1074163 339 354 3799 3814 CAGGCGAGCGAGGGCT 118 2409 1074195 475 490 3935 3950 CCCGGGTCCGGACGGC 79 2410 1074227 860 875 7294 7309 ACTGTCGAAGATGCTG 10 2411 1074259 1046 1061 55541 55556 TCATATTCTGCTGCAC 38 2412 1074291 1202 1217 98904 98919 CACTCTGACTGATTCT 11 2413 1074323 1429 1444 N/A N/A CAGGGCTAACTCCTGA 116 2414 1074355 1615 1630 120520 120535 AGGGACACTGTAGCTG 55 2415 1074387 1734 1749 122759 122774 CCAGGAATGGCTTCAA 32 2416 1074419 2111 2126 123136 123151 ATTCTTTAGAGCCAAC 4 2417 1074451 2477 2492 123502 123517 GACTAATGATAGCACT 6 2418 1074483 2709 2724 123734 123749 CACTAATATGGTCATT 15 2419 1074515 2908 2923 123933 123948 TAACTGGAAAGCAGGG 9 2420 1074547 3068 3083 124093 124108 GAGCACTCCCCTAGGC 71 2421 1074579 3224 3239 124249 124264 CCACTATAAAGCTTAT 6 2422 1074611 3621 3636 124646 124661 TAGCTTATATTGAAGA 19 2423 1074643 3835 3850 124860 124875 TTGAAGGGCCAAAATA 68 2424 1074675 4161 4176 125186 125201 AAATTATAGGCACTCC 6 2425 1074707 4337 4352 125362 125377 TTTAATGGCAGCACGG 36 2426 1074739 4525 4540 125550 125565 GACTCTTAGGTCTCCT 24 2427 1074771 4644 4659 125669 125684 AATCTTATCCCAATGC 18 2428 1074803 4837 4852 125862 125877 AGGCACTACATTTAGA 32 2429 1074835 5102 5117 126127 126142 CTTGCGAGGATAAAAT 30 2430 1074867 5292 5307 126317 126332 TAACATATGAGCATGC 40 2431 1074899 N/A N/A 5482 5497 TAACTTTTGGGCAAAG 52 2432 1074931 N/A N/A 5601 5616 GAGACTATACAACAGG 35 2433 1074963 N/A N/A 5710 5725 TAGGCAAGCAGCTAAA 76 2434 1074995 N/A N/A 4785 4800 AAAACTAAATGGACCG 50 2435 1075027 N/A N/A 6578 6593 AAATTTGAACTGCCCA 28 2436 1075059 N/A N/A 8749 8764 ATTTACTTTGGATGTC 11 2437 1075091 N/A N/A 10609 10624 AAACAACGAATGATTG 65 2438 1075123 N/A N/A 12563 12578 CTTTAGGAAAGGGTAT 21 2439 1075155 N/A N/A 16105 16120 TCATTATAATGGGAGG 5 2440 1075187 N/A N/A 19108 19123 GCCCAAGGAGGAAATC 77 2441 1075219 N/A N/A 23348 23363 CCTTAACACTGGTAAG 117 2442 1075251 N/A N/A 27031 27046 TAATTACGATTAGATC 79 2443 1075283 N/A N/A 29653 29668 CGAATATAGAAAAATG 90 2444 1075315 N/A N/A 31772 31787 CATAACTTGATGACTC 27 2445 1075347 N/A N/A 32821 32836 CATAGGTAGGCAACAA 20 2446 1075379 N/A N/A 35306 35321 TACCAAAACTACAACC 75 2447 1075411 N/A N/A 37768 37783 CAAAAAGGGTAAGGCA 39 2448 1075443 N/A N/A 40138 40153 GATTAACAGAGCTAGA 29 2449 1075475 N/A N/A 42037 42052 TAGCAACACATGAAGA 64 2450 1075507 N/A N/A 44455 44470 GTACAACCTAGTGATA 82 2451 1075539 N/A N/A 46198 46213 CTTAAGGGATGGAACA 79 2452 1075571 N/A N/A 48312 48327 CAAATAGATACTAAGC 54 2453 1075603 N/A N/A 50064 50079 TATGAACAAGTATGAG 35 2454 1075635 N/A N/A 52207 52222 AATAAACACCTCGCCA 97 2455 1075667 N/A N/A 53956 53971 CAAATTTAGTTGTGCA 109 2456 1075699 N/A N/A 56158 56173 GATTTATACTCAGGTT 4 2457 1075731 N/A N/A 58878 58893 CCCCAATATTATCTAC 40 2458 1075763 N/A N/A 61435 61450 ATTTAGGCTTTGGGTT 16 2459 1075795 N/A N/A 63289 63304 GTAATTATATACCCAC 66 2460 1075827 N/A N/A 66457 66472 ATACTATACCTAAGGA 60 2461 1075859 N/A N/A 69260 69275 ACTTATCACTCTGCCC 20 2462 1075891 N/A N/A 72206 72221 AGATTAAAAGTAGGCC 89 2463 1075923 N/A N/A 75823 75838 TTTAATACTCTCTGGG 42 2464 1075955 N/A N/A 79005 79020 GACCTATAATACAGAA 85 2465 1075987 N/A N/A 81256 81271 GAAGAATATCGAAAAG 13 2466 1076019 N/A N/A 83005 83020 CACTAATAGGATGGAT 12 2467 1076051 N/A N/A 85945 85960 CTTAACTATTCAGCCC 21 2468 1076083 N/A N/A 89966 89981 CGCTATAAAGTGGCAT 46 2469 1076115 N/A N/A 91590 91605 CATTAGTAAGCTGAGG 7 2470 1076147 N/A N/A 92516 92531 ATTAACTCACGAAGAC 25 2471 1076179 N/A N/A 94487 94502 AATTAGCCAACCACCT 38 2472 1076211 N/A N/A 97443 97458 AATTTATATGCTCCCT 22 2473 1076243 N/A N/A 98790 98805 ATATTCGATGTAACTT 41 2474 1076275 N/A N/A 102220 102235 GTATTAGATAAAGCAG 10 2475 1076307 N/A N/A 104378 104393 GTAATTACCTCTAATC 38 2476 1076339 N/A N/A 107352 107367 CAGCAATACTGTGGGC 13 2477 1076371 N/A N/A 110712 110727 TAAGAACGAACCTCCA 49 2478 1076403 N/A N/A 112457 112472 ATTTAAGACCTGGTGA 26 2479 1076435 N/A N/A 115328 115343 CGTAAACATCATCTCT 12 2480 1076467 N/A N/A 118559 118574 GTATTTAGAGCTTAAG 5 2481 1076499 N/A N/A 121073 121088 GCTAATATATCCAATT 37 2482 1076531 N/A N/A 66739 66754 ACTATAAAGGGTTTAG 66 2483 1076563 N/A N/A 31631 31646 CAAAGTAATTAAACGA 91 2484
TABLE-US-00034 TABLE 34 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compund Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5' to 3') UTC) ID NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 1 810 1074132 223 238 3683 3698 CGGCCCCGCATCCCCC 96 2485 1074164 340 355 3800 3815 CCAGGCGAGCGAGGGC 135 2486 1074196 476 491 3936 3951 GCCCGGGTCCGGACGG 99 2487 1074228 861 876 7295 7310 GACTGTCGAAGATGCT 17 2488 1074260 1051 1066 55546 55561 GTTCATCATATTCTGC 48 2489 1074292 1216 1231 98918 98933 CTGTTTCACTGGAGCA 10 2490 1074324 1430 1445 N/A N/A GCAGGGCTAACTCCTG 116 2491 1074356 1616 1631 120521 120536 GAGGGACACTGTAGCT 43 2492 1074388 1805 1820 122830 122845 GACTTGGCATCAGCTC 16 2493 1074420 2112 2127 123137 123152 GATTCTTTAGAGCCAA 2 2494 1074452 2478 2493 123503 123518 TGACTAATGATAGCAC 3 2495 1074484 2710 2725 123735 123750 TCACTAATATGGTCAT 3 2496 1074516 2909 2924 123934 123949 TTAACTGGAAAGCAGG 22 2497 1074548 3093 3108 124118 124133 ATCTACCGTATGCCCA 4 2498 1074580 3225 3240 124250 124265 ACCACTATAAAGCTTA 5 2499 1074612 3622 3637 124647 124662 ATAGCTTATATTGAAG 12 2500 1074644 3836 3851 124861 124876 ATTGAAGGGCCAAAAT 93 2501 1074676 4162 4177 125187 125202 CAAATTATAGGCACTC 4 2502 1074708 4338 4353 125363 125378 CTTTAATGGCAGCACG 55 2503 1074740 4526 4541 125551 125566 GGACTCTTAGGTCTCC 75 2504 1074772 4650 4665 125675 125690 AGTTAAAATCTTATCC 80 2505 1074804 4874 4889 125899 125914 TAGCAAAGTCACTTCC 15 2506 1074836 5111 5126 126136 126151 AACAACATGCTTGCGA 27 2507 1074868 5297 5312 126322 126337 GTACCTAACATATGAG 74 2508 1074900 N/A N/A 5484 5499 ATTAACTTTTGGGCAA 40 2509 1074932 N/A N/A 5602 5617 GGAGACTATACAACAG 88 2510 1074964 N/A N/A 5711 5726 TTAGGCAAGCAGCTAA 112 2511 1074996 N/A N/A 4843 4858 AATAAATGCTTACGGG 60 2512 1075028 N/A N/A 6670 6685 AAAAATCAAGCCCTCG 103 2513 1075060 N/A N/A 8896 8911 GTTTAACAATCTCCCC 70 2514 1075092 N/A N/A 10612 10627 TTAAAACAACGAATGA 63 2515 1075124 N/A N/A 12652 12667 GTAAAAACCTGGGTTT 58 2516 1075156 N/A N/A 16175 16190 ATTATATGACTCTGCT 22 2517 1075188 N/A N/A 19193 19208 AGTCAACCTGTAATTA 14 2518 1075220 N/A N/A 23362 23377 AATTTTAACTGTGACC 24 2519 1075252 N/A N/A 27032 27047 TTAATTACGATTAGAT 90 2520 1075284 N/A N/A 29658 29673 CTTTTCGAATATAGAA 76 2521 1075316 N/A N/A 31797 31812 GTATATAGATACCCAC 25 2522 1075348 N/A N/A 32855 32870 TCACAAAACCCTACAC 96 2523 1075380 N/A N/A 35609 35624 ACTAAAACTGACTGTC 94 2524 1075412 N/A N/A 37770 37785 TCCAAAAAGGGTAAGG 48 2525 1075444 N/A N/A 40268 40283 ATAAATCCTCATGTGG 112 2526 1075476 N/A N/A 42291 42306 TCTTATCCTACAGCTT 75 2527 1075508 N/A N/A 44490 44505 GAAAAAGGTTTAGGGT 84 2528 1075540 N/A N/A 46199 46214 GCTTAAGGGATGGAAC 78 2529 1075572 N/A N/A 48372 48387 CAATTTAACTGTTACA 84 2530 1075604 N/A N/A 50104 50119 ATAATTAAGCTATCAC 81 2531 1075636 N/A N/A 52208 52223 CAATAAACACCTCGCC 91 2532 1075668 N/A N/A 54032 54047 AATTATTGGTGACACT 80 2533 1075700 N/A N/A 56179 56194 GCCAAATAAGAGGTAG 22 2534 1075732 N/A N/A 58998 59013 AATAACCTCGAGTGCT 36 2535 1075764 N/A N/A 61668 61683 CTTCAAGGAAGGTGCT 103 2536 1075796 N/A N/A 63290 63305 AGTAATTATATACCCA 64 2537 1075828 N/A N/A 66513 66528 TTAGAATAGTTCTACC 59 2538 1075860 N/A N/A 69290 69305 AACTATAAGCTATGTG 73 2539 1075892 N/A N/A 72236 72251 CACCAATACCAAAGTC 54 2540 1075924 N/A N/A 75824 75839 ATTTAATACTCTCTGG 21 2541 1075956 N/A N/A 79218 79233 TATAAAGCAATGCGAT 27 2542 1075988 N/A N/A 81357 81372 AATTAAGCTTCTCTAG 90 2543 1076020 N/A N/A 83011 83026 CCCCAACACTAATAGG 60 2544 1076052 N/A N/A 86023 86038 GCAATAAAGCTGAACT 23 2545 1076084 N/A N/A 89980 89995 CATCAATAGAGAGTCG 7 2546 1076116 N/A N/A 91600 91615 GAAAATAGCCCATTAG 25 2547 1076148 N/A N/A 92517 92532 TATTAACTCACGAAGA 52 2548 1076180 N/A N/A 94489 94504 ATAATTAGCCAACCAC 42 2549 1076212 N/A N/A 97445 97460 CAAATTTATATGCTCC 15 2550 1076244 N/A N/A 98799 98814 CAATTTGGGATATTCG 14 2551 1076276 N/A N/A 102282 102297 CTTTAGGAGTCAGAAC 59 2552 1076308 N/A N/A 104379 104394 AGTAATTACCTCTAAT 32 2553 1076340 N/A N/A 107364 107379 TAATATCCTCATCAGC 8 2554 1076372 N/A N/A 110715 110730 CAATAAGAACGAACCT 76 2555 1076404 N/A N/A 112458 112473 TATTTAAGACCTGGTG 13 2556 1076436 N/A N/A 115413 115428 CATTACTACTCTGTCC 39 2557 1076468 N/A N/A 118602 118617 CATTACTACTAAGAGT 91 2558 1076500 N/A N/A 121129 121144 CAATTAAGATCAACAT 99 2559 1076532 N/A N/A 68936 68951 ATTTTTAGGCAGACGC 12 2560 1076564 N/A N/A 39617 39632 TAAAGTAATGCTACAG 77 2561
TABLE-US-00035 TABLE 35 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compund Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5' to 3') UTC) ID NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 2 810 1074133 224 239 3684 3699 GCGGCCCCGCATCCCC 101 2562 1074165 341 356 3801 3816 CCCAGGCGAGCGAGGG 90 2563 1074197 477 492 3937 3952 TGCCCGGGTCCGGACG 91 2564 1074229 864 879 7298 7313 GAAGACTGTCGAAGAT 5 2565 1074261 1055 1070 55550 55565 CCGAGTTCATCATATT 19 2566 1074293 1217 1232 98919 98934 GCTGTTTCACTGGAGC 54 2567 1074325 1431 1446 116620 116635 CGCAGGGCTAACTCCT 42 2568 1074357 1617 1632 120522 120537 CGAGGGACACTGTAGC 12 2569 1074389 1808 1823 122833 122848 GCAGACTTGGCATCAG 14 2570 1074421 2113 2128 123138 123153 TGATTCTTTAGAGCCA 3 2571 1074453 2479 2494 123504 123519 GTGACTAATGATAGCA 4 2572 1074485 2711 2726 123736 123751 TTCACTAATATGGTCA 4 2573 1074517 2939 2954 123964 123979 AATGCATACAAAGCGC 55 2574 1074549 3094 3109 124119 124134 TATCTACCGTATGCCC 6 2575 1074581 3226 3241 124251 124266 AACCACTATAAAGCTT 18 2576 1074613 3623 3638 124648 124663 CATAGCTTATATTGAA 7 2577 1074645 3837 3852 124862 124877 AATTGAAGGGCCAAAA 81 2578 1074677 4169 4184 125194 125209 CTACTGGCAAATTATA 22 2579 1074709 4352 4367 125377 125392 TCTAGAACAGCTGCCT 71 2580 1074741 4528 4543 125553 125568 AAGGACTCTTAGGTCT 78 2581 1074773 4651 4666 125676 125691 CAGTTAAAATCTTATC 94 2582 1074805 4875 4890 125900 125915 GTAGCAAAGTCACTTC 9 2583 1074837 5112 5127 126137 126152 TAACAACATGCTTGCG 11 2584 1074869 5298 5313 126323 126338 AGTACCTAACATATGA 31 2585 1074901 N/A N/A 5485 5500 TATTAACTTTTGGGCA 61 2586 1074933 N/A N/A 5603 5618 AGGAGACTATACAACA 72 2587 1074965 N/A N/A 5715 5730 GTGTTTAGGCAAGCAG 20 2588 1074997 N/A N/A 4854 4869 GCCGCGAGGAAAATAA 119 2589 1075029 N/A N/A 7004 7019 ATATTCGACACTGGAG 33 2590 1075061 N/A N/A 8954 8969 CCTTATACTTTTAGCC 5 2591 1075093 N/A N/A 10664 10679 CAAAGTAAGGTATGAG 3 2592 1075125 N/A N/A 12777 12792 CTTAAGGTACAAGGCA 84 2593 1075157 N/A N/A 16192 16207 CCAGAAAATCATAGTA 19 2594 1075189 N/A N/A 19238 19253 GCTAATAGTCACTGTT 11 2595 1075221 N/A N/A 23384 23399 CATTATCCGGGAGAGC 10 2596 1075253 N/A N/A 27033 27048 GTTAATTACGATTAGA 20 2597 1075285 N/A N/A 29702 29717 TATACATAGTCAATTC 60 2598 1075317 N/A N/A 31832 31847 GTATTCGCCTCCTGCA 27 2599 1075349 N/A N/A 33000 33015 ATTAAAGCTCATTGAT 81 2600 1075381 N/A N/A 35767 35782 TATTACCCTACTCATA 89 2601 1075413 N/A N/A 37807 37822 CATAACTACATCGACA 34 2602 1075445 N/A N/A 40269 40284 TATAAATCCTCATGTG 84 2603 1075477 N/A N/A 42405 42420 CTTTATCTCACTAGCT 86 2604 1075509 N/A N/A 44622 44637 CATAATCCCTGACTTG 81 2605 1075541 N/A N/A 46250 46265 GCTCAAAACTGACATA 47 2606 1075573 N/A N/A 48504 48519 AAGGAACCTTCTGTGT 72 2607 1075605 N/A N/A 50176 50191 CGTAAACATTTTGCCT 38 2608 1075637 N/A N/A 52219 52234 CCACAACCTGTCAATA 100 2609 1075669 N/A N/A 54033 54048 AAATTATTGGTGACAC 70 2610 1075701 N/A N/A 56296 56311 AATTACTAGAGGCTTC 3 2611 1075733 N/A N/A 58999 59014 CAATAACCTCGAGTGC 28 2612 1075765 N/A N/A 61721 61736 CTTAAGGCAGCTCTAT 58 2613 1075797 N/A N/A 63378 63393 GATAATCATGATACTC 3 2614 1075829 N/A N/A 66603 66618 ACTCAATAGATCATTG 41 2615 1075861 N/A N/A 69291 69306 TAACTATAAGCTATGT 78 2616 1075893 N/A N/A 72284 72299 CGTGAAAAAGATGTGG 7 2617 1075925 N/A N/A 75907 75922 AACCTATATTATTTGC 28 2618 1075957 N/A N/A 79219 79234 CTATAAAGCAATGCGA 28 2619 1075989 N/A N/A 81362 81377 GCTAAAATTAAGCTTC 78 2620 1076021 N/A N/A 83058 83073 CATTAATAAAGTTACC 95 2621 1076053 N/A N/A 86047 86062 TACCAACAAGGCATCA 55 2622 1076085 N/A N/A 90079 90094 ACTAATAGGCCATCTG 7 2623 1076117 N/A N/A 91603 91618 CTAGAAAATAGCCCAT 15 2624 1076149 N/A N/A 92518 92533 TTATTAACTCACGAAG 24 2625 1076181 N/A N/A 94490 94505 TATAATTAGCCAACCA 26 2626 1076213 N/A N/A 97518 97533 TCTCAAGGAATTGCCT 27 2627 1076245 N/A N/A 98849 98864 CCTAAAAAACTAGTGA 101 2628 1076277 N/A N/A 102574 102589 GCTAAAACATCAGATA 24 2629 1076309 N/A N/A 104525 104540 GATAACTTTCCACAAT 9 2630 1076341 N/A N/A 107422 107437 ATTAACTACAACTGTG 18 2631 1076373 N/A N/A 111082 111097 AACGGATATACAATAA 10 2632 1076405 N/A N/A 112459 112474 TTATTTAAGACCTGGT 12 2633 1076437 N/A N/A 115843 115858 GAAGAATAGCATCTGA 19 2634 1076469 N/A N/A 118627 118642 GTAAAAGGGAACTAAG 69 2635 1076501 N/A N/A 121268 121283 CATAACACTTAAGGTG 97 2636 1076533 N/A N/A 75580 75595 ATTTTTAGTCCAGTGG 9 2637 1076565 N/A N/A 55334 55349 CATTAAGTCACAGCAT 74 2638
TABLE-US-00036 TABLE 36 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compund Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5' to 3') UTC) ID NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 1 810 1074134 225 240 3685 3700 CGCGGCCCCGCATCCC 79 2639 1074166 342 357 3802 3817 ACCCAGGCGAGCGAGG 72 2640 1074198 478 493 3938 3953 TTGCCCGGGTCCGGAC 112 2641 1074230 866 881 7300 7315 AAGAAGACTGTCGAAG 4 2642 1074262 1056 1071 55551 55566 GCCGAGTTCATCATAT 48 2643 1074294 1275 1290 98977 98992 TTGGAGTTGCTGCCAC 80 2644 1074326 1432 1447 116621 116636 ACGCAGGGCTAACTCC 36 2645 1074358 1618 1633 120523 120538 TCGAGGGACACTGTAG 17 2646 1074390 1810 1825 122835 122850 CTGCAGACTTGGCATC 64 2647 1074422 2189 2204 123214 123229 AAACAGGCTCACTTCC 9* 2648 1074454 2480 2495 123505 123520 TGTGACTAATGATAGC 1 2649 1074486 2712 2727 123737 123752 ATTCACTAATATGGTC 4 2650 1074518 2940 2955 123965 123980 AAATGCATACAAAGCG 13 2651 1074550 3095 3110 124120 124135 ATATCTACCGTATGCC 23 2652 1074582 3228 3243 124253 124268 TAAACCACTATAAAGC 18 2653 1074614 3624 3639 124649 124664 TCATAGCTTATATTGA 49 2654 1074646 3838 3853 124863 124878 AAATTGAAGGGCCAAA 39 2655 1074678 4179 4194 125204 125219 TAATCTGTGGCTACTG 7 2656 1074710 4353 4368 125378 125393 CTCTAGAACAGCTGCC 42 2657 1074742 4529 4544 125554 125569 AAAGGACTCTTAGGTC 25 2658 1074774 4661 4676 125686 125701 CAAGAATACCCAGTTA 16 2659 1074806 4877 4892 125902 125917 TTGTAGCAAAGTCACT 8 2660 1074838 5113 5128 126138 126153 ATAACAACATGCTTGC 9 2661 1074870 5301 5316 126326 126341 GTAAGTACCTAACATA 20 2662 1074902 N/A N/A 5486 5501 CTATTAACTTTTGGGC 54 2663 1074934 N/A N/A 5604 5619 CAGGAGACTATACAAC 74 2664 1074966 N/A N/A 5721 5736 ATTGAAGTGTTTAGGC 9 2665 1074998 N/A N/A 4998 5013 CACGCGACCTACTAAG 61 2666 1075030 N/A N/A 7007 7022 TTAATATTCGACACTG 37 2667 1075062 N/A N/A 8960 8975 CTTTAACCTTATACTT 58 2668 1075094 N/A N/A 10705 10720 GATAAATGTAACTAGC 10 2669 1075126 N/A N/A 12890 12905 CTTAAATCTTAGCAAC 20 2670 1075158 N/A N/A 16240 16255 CGGCAAAAACAAAATC 76 2671 1075190 N/A N/A 19295 19310 TATCAAGGATTCAGTA 45 2672 1075222 N/A N/A 23766 23781 GTATTTGGACAACTCT 3 2673 1075254 N/A N/A 27099 27114 TCCCAAAAGTCATCGC 28 2674 1075286 N/A N/A 29807 29822 ATTACGGACAGAAGTG 48 2675 1075318 N/A N/A 31850 31865 ATCCTAAAGCCACTGC 72 2676 1075350 N/A N/A 33001 33016 GATTAAAGCTCATTGA 62 2677 1075382 N/A N/A 35769 35784 ATTATTACCCTACTCA 33 2678 1075414 N/A N/A 37990 38005 CATACTAATCCCTCTT 41 2679 1075446 N/A N/A 40270 40285 CTATAAATCCTCATGT 87 2680 1075478 N/A N/A 42416 42431 CATTTTGAACCCTTTA 20 2681 1075510 N/A N/A 44630 44645 GAATAACACATAATCC 83 2682 1075542 N/A N/A 46607 46622 TGAGAAAGGTTCCTGA 66 2683 1075574 N/A N/A 48508 48523 AGTCAAGGAACCTTCT 47 2684 1075606 N/A N/A 50368 50383 GCTAAACCTACACGCT 82 2685 1075638 N/A N/A 52324 52339 ATTAACCAGAAGCCTG 79 2686 1075670 N/A N/A 54501 54516 TATATATGATGGACTG 39 2687 1075702 N/A N/A 56442 56457 GAGGAAGGGCACCTTT 81 2688 1075734 N/A N/A 59002 59017 AGGCAATAACCTCGAG 26 2689 1075766 N/A N/A 61741 61756 GGAGAACACAAGAGGC 5 2690 1075798 N/A N/A 63396 63411 ATTTAGATAGTTACTG 21 2691 1075830 N/A N/A 66610 66625 GATGAACACTCAATAG 12 2692 1075862 N/A N/A 70001 70016 CTAATAACTTGTCTAC 67 2693 1075894 N/A N/A 72305 72320 CTCGAAAGCTGGGCCC 100 2694 1075926 N/A N/A 75911 75926 GTAGAACCTATATTAT 25 2695 1075958 N/A N/A 79351 79366 CATTATGACATTCCCC 12 2696 1075990 N/A N/A 81490 81505 CGTTATTATGCAGCAA 1 2697 1076022 N/A N/A 83093 83108 TAATTAGATGCTGACA 2 2698 1076054 N/A N/A 86104 86119 CATTAGACTTTCTGTC 21 2699 1076086 N/A N/A 90080 90095 AACTAATAGGCCATCT 31 2700 1076118 N/A N/A 91688 91703 CGTAAATTGAGGCCCA 45 2701 1076150 N/A N/A 92520 92535 ATTTATTAACTCACGA 11 2702 1076182 N/A N/A 94491 94506 CTATAATTAGCCAACC 15 2703 1076214 N/A N/A 97543 97558 ATCCTATACATTAAGA 67 2704 1076246 N/A N/A 98850 98865 TCCTAAAAAACTAGTG 75 2705 1076278 N/A N/A 102644 102659 AATAAGGACAGGACCC 29 2706 1076310 N/A N/A 104554 104569 ACCCTATACTTGAATT 36 2707 1076342 N/A N/A 107423 107438 CATTAACTACAACTGT 33 2708 1076374 N/A N/A 111084 111099 ATAACGGATATACAAT 15 2709 1076406 N/A N/A 112460 112475 ATTATTTAAGACCTGG 4 2710 1076438 N/A N/A 115846 115861 TAGGAAGAATAGCATC 13 2711 1076470 N/A N/A 118843 118858 GATAAAGAGGTTAACA 34 2712 1076502 N/A N/A 121320 121335 CAAAGTAAGTGAGCCC 17 2713 1076534 N/A N/A 79220 79235 ACTATAAAGCAATGCG 4 2714 1076566 N/A N/A 55576 55591 AATTACAGTGTCTCAC 63 2715
TABLE-US-00037 TABLE 37 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1, and 2 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 YAP1 Compund Start Stop Start Stop (% SEQ Number Site Site Site Site Sequence (5' to 3') UTC) ID NO 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA 2 810 1074135 226 241 3686 3701 CCGCGGCCCCGCATCC 91 2716 1074167 353 368 3813 3828 CGCACCCCCTGACCCA 58 2717 1074199 483 498 3943 3958 GCCGGTTGCCCGGGTC 101 2718 1074231 867 882 7301 7316 AAAGAAGACTGTCGAA 8 2719 1074263 1057 1072 55552 55567 AGCCGAGTTCATCATA 34 2720 1074295 1278 1293 98980 98995 TGGTTGGAGTTGCTGC 15 2721 1074327 1433 1448 116622 116637 TACGCAGGGCTAACTC 39 2722 1074359 1619 1634 120524 120539 TTCGAGGGACACTGTA 18 2723 1074391 1828 1843 122853 122868 GTCAGAACTCAAAGCT 14 2724 1074423 2190 2205 123215 123230 CAAACAGGCTCACTTC 4* 2725 1074455 2485 2500 123510 123525 CATTATGTGACTAATG 67 2726 1074487 2714 2729 123739 123754 AGATTCACTAATATGG 7 2727 1074519 2959 2974 123984 123999 ACTACTAGTCATGTAT 45 2728 1074551 3096 3111 124121 124136 AATATCTACCGTATGC 58 2729 1074583 3229 3244 124254 124269 GTAAACCACTATAAAG 30 2730 1074615 3625 3640 124650 124665 TTCATAGCTTATATTG 8 2731 1074647 3839 3854 124864 124879 CAAATTGAAGGGCCAA 27 2732 1074679 4182 4197 125207 125222 TCTTAATCTGTGGCTA 5 2733 1074711 4354 4369 125379 125394 ACTCTAGAACAGCTGC 28 2734 1074743 4530 4545 125555 125570 GAAAGGACTCTTAGGT 16 2735 1074775 4681 4696 125706 125721 GGTTTATTGTAAAAGC 3 2736 1074807 4927 4942 125952 125967 CCATATAGAAGGCATG 75 2737 1074839 5114 5129 126139 126154 TATAACAACATGCTTG 33 2738 1074871 5302 5317 126327 126342 TGTAAGTACCTAACAT 70 2739 1074903 N/A N/A 5487 5502 CCTATTAACTTTTGGG 87 2740 1074935 N/A N/A 5605 5620 ACAGGAGACTATACAA 80 2741 1074967 N/A N/A 5726 5741 GACAAATTGAAGTGTT 116 2742 1074999 N/A N/A 5004 5019 AACCAACACGCGACCT 77 2743 1075031 N/A N/A 7009 7024 ATTTAATATTCGACAC 52 2744 1075063 N/A N/A 9104 9119 TACGGAAGGCCAACTG 16 2745 1075095 N/A N/A 10722 10737 CTTGAAAACAAGCCAC 63 2746 1075127 N/A N/A 12934 12949 GCTAAATTATGCTATT 79 2747 1075159 N/A N/A 16250 16265 CAAAAAATCACGGCAA 63 2748 1075191 N/A N/A 19412 19427 ACGGGAAAGAAAGGCC 83 2749 1075223 N/A N/A 23854 23869 GTTAAAAGTGAACCCA 19 2750 1075255 N/A N/A 27113 27128 AAATATCCGTGTCCTC 16 2751 1075287 N/A N/A 29808 29823 TATTACGGACAGAAGT 58 2752 1075319 N/A N/A 31860 31875 TATAACAATCATCCTA 59 2753 1075351 N/A N/A 33002 33017 AGATTAAAGCTCATTG 38 2754 1075383 N/A N/A 35770 35785 AATTATTACCCTACTC 45 2755 1075415 N/A N/A 38069 38084 CATTAAATGACAGCCT 52 2756 1075447 N/A N/A 40272 40287 CACTATAAATCCTCAT 96 2757 1075479 N/A N/A 42463 42478 GACAATAAATCTGCCT 77 2758 1075511 N/A N/A 44708 44723 CAATATTATCTGAGCT 106 2759 1075543 N/A N/A 46674 46689 ATATATTAGGAGTTTC 22 2760 1075575 N/A N/A 48710 48725 TTACAACACAAGTCTA 55 2761 1075607 N/A N/A 50539 50554 AAAACGGTGTGAAGAA 45 2762 1075639 N/A N/A 52325 52340 AATTAACCAGAAGCCT 101 2763 1075671 N/A N/A 54503 54518 GATATATATGATGGAC 37 2764 1075703 N/A N/A 56609 56624 GGAGAAAGCCATCAAG 10 2765 1075735 N/A N/A 59100 59115 GAATCGATGTGTTGCG 17 2766 1075767 N/A N/A 61758 61773 TATTACACAGGCAGGC 12 2767 1075799 N/A N/A 63412 63427 CCTCAACACATTTGAG 85 2768 1075831 N/A N/A 66680 66695 TATTAGCCTTCTAACC 59 2769 1075863 N/A N/A 70002 70017 CCTAATAACTTGTCTA 71 2770 1075895 N/A N/A 72306 72321 ACTCGAAAGCTGGGCC 38 2771 1075927 N/A N/A 75923 75938 GCTTAAAATCATGTAG 32 2772 1075959 N/A N/A 79446 79461 GATTATTATTGCAGCT 15 2773 1075991 N/A N/A 81533 81548 ATATAGGACCACGACT 62 2774 1076023 N/A N/A 83094 83109 ATAATTAGATGCTGAC 4 2775 1076055 N/A N/A 86186 86201 AATTACTAACAATCTC 45 2776 1076087 N/A N/A 90082 90097 CAAACTAATAGGCCAT 10 2777 1076119 N/A N/A 91742 91757 GTTAAATATGAATTGG 7 2778 1076151 N/A N/A 92521 92536 TATTTATTAACTCACG 14 2779 1076183 N/A N/A 94494 94509 CTTCTATAATTAGCCA 7 2780 1076215 N/A N/A 97620 97635 TTATAACAGACTGGCT 47 2781 1076247 N/A N/A 99297 99312 GACCAAAACAGCTCTT 11 2782 1076279 N/A N/A 102645 102660 CAATAAGGACAGGACC 71 2783 1076311 N/A N/A 104558 104573 TATAACCCTATACTTG 56 2784 1076343 N/A N/A 107707 107722 AGACTAAATCTTCCCT 8 2785 1076375 N/A N/A 111085 111100 TATAACGGATATACAA 22 2786 1076407 N/A N/A 112462 112477 GTATTATTTAAGACCT 22 2787 1076439 N/A N/A 115906 115921 CTTATATGGTTTTGTG 4 2788 1076471 N/A N/A 118862 118877 CATTAGACTAGGCTTT 5 2789 1076503 N/A N/A 121702 121717 AATTACCCCTGTGAGG 77 2790 1076535 N/A N/A 83322 83337 ATTTTTAGCTCGCAAT 28 2791 1076567 N/A N/A 59365 59380 GATTACAGTGACATTC 10 2792
TABLE-US-00038 TABLE 32 Inhibition of Yap1 mRNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 3 SEQ ID SEQ ID NO: 3 NO: 3 YAP1 Compund Start Stop % SEQ Number Site Site Sequence (5' to 3') UTC) ID NO 1074880 1246 1261 CTCCTGCCGAAGCAGT 101 2793 1074881 1250 1265 CTAACTCCTGCCGAAG 76 2794 1074882 1251 1266 GCTAACTCCTGCCGAA 73 2795 1074883 1252 1267 GGCTAACTCCTGCCGA 107 2796 1074884 1253 1268 GGGCTAACTCCTGCCG 110 2797 1074885 1254 1269 AGGGCTAACTCCTGCC 115 2798 1074886 1255 1270 CAGGGCTAACTCCTGC 104 2799
Example 5
Antisense Inhibition of Human Yap1 in SNU-449 Cells by Modified Oligonucleotides
[0566] Modified oligonucleotides with additional chemistry modifications were designed to target a Yap1 nucleic acid and were tested for their effect on Yap1 mRNA level in SNU-449 cells. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured SNU-449 cells at a density of 10,000 cells per well were treated using free uptake with 2,000 nM of modified oligonucleotide. After a treatment period of approximately 48 hours, RNA was isolated from the cells and Yap1 mRNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS36584 was used to measure mRNA levels. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). The modified oligonucleotides with percent control values marked with an asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides targeting the amplicon region.
[0567] Several different chemistry modifications were tested, which are specified in the Chemistry Notation column of the tables below, wherein the notation “d” refers to a 2′-deoxyribose sugar, the notation “s” refers to a phosphorothioate (P═S) internucleoside linkage, the notation “k” refers to a cEt modified sugar, the notation “y” refers to a 2′-O-methyl ribose sugar, the notation “e” refers to a MOE modified sugar, and the notation “.sup.mC” refers to a 5-methylcytosine.
[0568] “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either SEQ ID NO.: 1 or SEQ ID NO.: 2. ‘N/A’ indicates that the modified oligonucleotide does not target that particular gene sequence with 100% complementarity. ‘N.D.’ indicates that the %UTC is not defined for that particular modified oligonucleotide in that particular experiment. Activity of the modified oligonucleotide may be defined in a different experiment.
TABLE-US-00039 TABLE 39 Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2 SEQ SEQ ID ID SEQ SEQ NO: 1 NO: 1 ID NO: ID NO: YAP1 SEQ Compound Start Stop 2 Start 2 Stop (% ID Number Site Site Site Site Sequence (5' to 3') CHEMISTRY NOTATION UTC) NO 715487 3630 3645 124655 124670 ATTACTTCATAGCTTA A.sub.ksT.sub.ksT.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 12 52 T.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.ksA.sub.k 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 8 810 G.sub.dsT.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC G.sub.ksA.sub.ksA.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 7 2800 T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 1095379 4443 4458 125468 125483 ACTGAGGTATAACTGG A.sub.ks.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.ds 52 392 T.sub.dsA.sub.dsA.sub.ks.sup.mC.sub.esT.sub.ksG.sub.esG.sub.k 1095397 4441 4456 125466 125481 TGAGGTATAACTGGGC T.sub.ksG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.m 53 1580 C.sub.dsT.sub.ksG.sub.esG.sub.ksG.sub.es.sup.mC.sub.k 1095398 4442 4457 125467 125482 CTGAGGTATAACTGGG .sup.mC.sub.ksT.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 38 2801 A.sub.dsA.sub.ds.sup.mC.sub.ksT.sub.esG.sub.ksG.sub.esG.sub.k 1095399 4444 4459 125469 125484 CACTGAGGTATAACTG .sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds 46 2802 A.sub.dsT.sub.dsA.sub.ksA.sub.es.sup.mC.sub.ksT.sub.esG.sub.k 1198370 2524 2539 123549 123564 TGTCTCATGCCTTATA T.sub.ksG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m 20 2803 C.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.esA.sub.ksT.sub.esA.sub.k 1198371 2526 2541 123551 123566 ATTGTCTCATGCCTTA A.sub.ksT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 15 2804 T.sub.dsG.sub.ds.sup.mC.sub.ks.sup.mC.sub.esT.sub.ksT.sub.esA.sub.k 1198372 2527 2542 123552 123567 AATTGTCTCATGCCTT A.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds 21 2805 A.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.es.sup.mC.sub.ksT.sub.esT.sub.k 1198373 2528 2543 123553 123568 AAATTGTCTCATGCCT A.sub.ksA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 40 443 C.sub.dsA.sub.dsT.sub.ksG.sub.es.sup.mC.sub.ks.sup.mC.sub.esT.sub.k 1198374 2529 2544 123554 123569 GAAATTGTCTCATGCC G.sub.ksA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 24 2800 T.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.esG.sub.ks.sup.mC.sub.es.sup.mC.sub.k 1198375 2530 2545 123555 123570 GGAAATTGTCTCATGC G.sub.ksG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 22 2806 C.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.esT.sub.ksG.sub.es.sup.mC.sub.k 1198376 2531 2546 123556 123571 TGGAAATTGTCTCATG T.sub.ksG.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 36 2807 C.sub.dsT.sub.ks.sup.mC.sub.esA.sub.ksT.sub.esG.sub.k 1198377 2532 2547 123557 123572 ATGGAAATTGTCTCAT A.sub.ksT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds 30 2808 T.sub.ds.sup.mC.sub.ksT.sub.es.sup.mC.sub.ksA.sub.esT.sub.k 1198378 2534 2549 123559 123574 ATATGGAAATTGTCTC A.sub.ksT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.ds 39 656 T.sub.dsG.sub.ksT.sub.es.sup.mC.sub.ksT.sub.es.sup.mC.sub.k 1198379 2560 2575 123585 123600 AGTATGTGGCAATAAT A.sub.ksG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.m 45 2809 C.sub.dsA.sub.dsA.sub.ksT.sub.esA.sub.ksA.sub.esT.sub.k 1198380 2562 2577 123587 123602 AGAGTATGTGGCAATA A.sub.ksG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.ds 18 2810 G.sub.ds.sup.mC.sub.ksA.sub.esA.sub.ksT.sub.esA.sub.k 1198381 2563 2578 123588 123603 TAGAGTATGTGGCAAT T.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds 19 2811 G.sub.dsG.sub.ks.sup.mC.sub.esA.sub.ksA.sub.esT.sub.k 1198382 2564 2579 123589 123604 TTAGAGTATGTGGCAA T.sub.ksT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ds 19 963 T.sub.dsG.sub.ksG.sub.es.sup.mC.sub.ksA.sub.esA.sub.k 1198383 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 31 810 G.sub.dsT.sub.ksG.sub.esG.sub.ks.sup.mC.sub.esA.sub.k 1198384 2566 2581 123591 123606 TATTAGAGTATGTGGC T.sub.ksA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds 6 2812 T.sub.dsG.sub.ksT.sub.esG.sub.ksG.sub.es.sup.mC.sub.k 1198385 2567 2582 123592 123607 ATATTAGAGTATGTGG A.sub.ksT.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds 30 2813 A.sub.dsT.sub.ksG.sub.esT.sub.ksG.sub.esG.sub.k 1198386 2568 2583 123593 123608 TATATTAGAGTATGTG T.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds 77 2814 T.sub.dsA.sub.ksT.sub.esG.sub.ksT.sub.esG.sub.k 1198387 2570 2585 123595 123610 TCTATATTAGAGTATG T.sub.ks.sup.mC.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 84 887 A.sub.dsG.sub.ksT.sub.esA.sub.ksT.sub.esG.sub.k 1198388 4436 4451 125461 125476 TATAACTGGGCAAATT T.sub.ksA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.ds 90 2815 G.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.esA.sub.ksT.sub.esT.sub.k 1198389 4438 4453 125463 125478 GGTATAACTGGGCAAA G.sub.ksG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds 28 1427 G.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.esA.sub.ksA.sub.esA.sub.k 1198390 4439 4454 125464 125479 AGGTATAACTGGGCAA A.sub.ksG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds 37 905 T.sub.dsG.sub.dsG.sub.ksG.sub.es.sup.mC.sub.ksA.sub.esA.sub.k 1198391 4440 4455 125465 125480 GAGGTATAACTGGGCA G.sub.ksA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.m 29 1503 C.sub.dsT.sub.dsG.sub.ksG.sub.esG.sub.ks.sup.mC.sub.esA.sub.k 1198392 4446 4461 125471 125486 AACACTGAGGTATAAC A.sub.ksA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.ds 48 2816 G.sub.dsT.sub.dsA.sub.ksT.sub.esA.sub.ksA.sub.es.sup.mC.sub.k 1198393 4595 4610 125620 125635 TTACATTAGGAACAAG T.sub.ksT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 58 2817 G.sub.dsA.sub.dsA.sub.ks.sup.mC.sub.esA.sub.ksA.sub.esG.sub.k 1198394 4597 4612 125622 125637 TTTTACATTAGGAACA T.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.ds 63 2818 G.sub.dsG.sub.ksA.sub.esA.sub.ks.sup.mC.sub.esA.sub.k 1198395 4598 4613 125623 125638 CTTTTACATTAGGAAC .sup.mC.sub.ksT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds 35 1124 T.sub.dsA.sub.dsG.sub.ksG.sub.esA.sub.ksA.sub.es.sup.mC.sub.k 1198396 4599 4614 125624 125639 ACTTTTACATTAGGAA A.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds 25 2819 T.sub.dsT.sub.dsA.sub.ksG.sub.esG.sub.ksA.sub.esA.sub.k 1198397 4600 4615 125625 125640 CACTTTTACATTAGGA .sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds 17 1200 A.sub.dsT.sub.dsT.sub.ksA.sub.esG.sub.ksG.sub.esA.sub.k 1198398 4601 4616 125626 125641 GCACTTTTACATTAGG G.sub.ks.sup.mC.sub.dsA.sub.dsC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.m 18 1276 C.sub.dsA.sub.dsT.sub.ksT.sub.esA.sub.ksG.sub.esG.sub.k 1198399 4602 4617 125627 125642 AGCACTTTTACATTAG A.sub.ksG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds 35 2820 A.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.esT.sub.ksA.sub.esG.sub.k 1198400 4603 4618 125628 125643 AAGCACTTTTACATTA A.sub.ksA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 62 2821 T.sub.dsA.sub.ds.sup.mC.sub.ksA.sub.esT.sub.ksT.sub.esA.sub.k 1198401 4605 4620 125630 125645 TTAAGCACTTTTACAT T.sub.ksT.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds 63 2822 T.sub.dsT.sub.dsT.sub.ksA.sub.es.sup.mC.sub.ksA.sub.esT.sub.k 1198402 4795 4810 125820 125835 GGAAGATCTGAAACTC G.sub.ksG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds 32 2823 G.sub.dsA.sub.dsA.sub.ksA.sub.es.sup.mC.sub.ksT.sub.es.sup.mC.sub.k 1198403 4797 4812 125822 125837 TTGGAAGATCTGAAAC T.sub.ksT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.m 54 2824 C.sub.dsT.sub.dsG.sub.ksA.sub.esA.sub.ksA.sub.es.sup.mC.sub.k 1198404 4798 4813 125823 125838 TTTGGAAGATCTGAAA T.sub.ksT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.m 55 2825 C.sub.dsT.sub.ksG.sub.esA.sub.ksA.sub.esA.sub.k 1198405 4799 4814 125824 125839 CTTTGGAAGATCTGAA .sup.mC.sub.ksT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ds 36 2826 A.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.esG.sub.ksA.sub.esA.sub.k 1198406 4800 4815 125825 125840 GCTTTGGAAGATCTGA G.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.ds 17 2044 G.sub.dsA.sub.dsT.sub.ks.sup.mC.sub.esT.sub.ksG.sub.esA.sub.k 1198407 4801 4816 125826 125841 TGCTTTGGAAGATCTG T.sub.ksG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.ds 23 2121 A.sub.dsG.sub.dsA.sub.ksT.sub.es.sup.mC.sub.ksT.sub.esG.sub.k 1198408 4802 4817 125827 125842 GTGCTTTGGAAGATCT G.sub.ksT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds 41 2827 A.sub.dsA.sub.dsG.sub.ksA.sub.esT.sub.ks.sup.mC.sub.esT.sub.k 1198409 4803 4818 125828 125843 AGTGCTTTGGAAGATC A.sub.ksG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.ds 19 2828 G.sub.dsA.sub.dsA.sub.ksG.sub.esA.sub.ksT.sub.es.sup.mC.sub.k 1198410 4805 4820 125830 125845 ATAGTGCTTTGGAAGA A.sub.ksT.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 48 2829 G.sub.dsG.sub.ksA.sub.esA.sub.ksG.sub.esA.sub.k 1198411 N/A N/A 94729 94744 AGGATGCATGGTTTTT A.sub.ksG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds 33 2830 G.sub.dsG.sub.dsT.sub.ksT.sub.esT.sub.ksT.sub.esT.sub.k 1198412 N/A N/A 94731 94746 TTAGGATGCATGGTTT T.sub.ksT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 17 2831 A.sub.dsT.sub.dsG.sub.ksG.sub.esT.sub.ksT.sub.esT.sub.k 1198413 N/A N/A 94732 94747 TTTAGGATGCATGGTT T.sub.ksT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m 29 2832 C.sub.dsA.sub.dsT.sub.ksG.sub.esG.sub.ksT.sub.esT.sub.k 1198414 N/A N/A 94733 94748 ATTTAGGATGCATGGT A.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m 20 2833 C.sub.dsA.sub.ksT.sub.esG.sub.ksG.sub.esT.sub.k 1198415 N/A N/A 94734 94749 GATTTAGGATGCATGG G.sub.ksA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.ds 29 2834 G.sub.ds.sup.mC.sub.ksA.sub.esT.sub.ksG.sub.esG.sub.k 1198416 N/A N/A 94735 94750 AGATTTAGGATGCATG A.sub.ksG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds 29 2835 T.sub.dsG.sub.ks.sup.mC.sub.esA.sub.ksT.sub.esG.sub.k 1198417 N/A N/A 94736 94751 CAGATTTAGGATGCAT .sup.mC.sub.ksA.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 40 2836 G.sub.dsA.sub.dsT.sub.ksG.sub.es.sup.mC.sub.ksA.sub.esT.sub.k 1198418 N/A N/A 94737 94752 TCAGATTTAGGATGCA T.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds 67 2837 G.sub.dsG.sub.dsA.sub.ksT.sub.esG.sub.ks.sup.mC.sub.esA.sub.k 1198419 N/A N/A 94739 94754 ATTCAGATTTAGGATG A.sub.ksT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.ds 78 2838 A.sub.dsG.sub.ksG.sub.esA.sub.ksT.sub.esG.sub.k 1198420 N/A N/A 115903 115918 ATATGGTTTTGTGTGT A.sub.ksT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds 41 2839 G.sub.dsT.sub.ksG.sub.esT.sub.ksG.sub.esT.sub.k 1198421 N/A N/A 115905 115920 TTATATGGTTTTGTGT T.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds 36 2840 T.sub.dsT.sub.ksG.sub.esT.sub.ksG.sub.esT.sub.k 1198422 N/A N/A 115906 115921 CTTATATGGTTTTGTG .sup.mC.sub.ksT.sub.dsT.sub.dsA.sub.dsT.sub.sA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.ds 18 2788 T.sub.dsT.sub.ksT.sub.esG.sub.ksT.sub.esG.sub.k 1198423 N/A N/A 115907 115922 TCTTATATGGTTTTGT T.sub.ks.sup.mC.sub.dsT.sub.ds+lTsA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.ds 10 2841 T.sub.dsT.sub.ksT.sub.esT.sub.ksG.sub.esT.sub.k 1198424 N/A N/A 115908 115923 CTCTTATATGGTTTTG .sup.mC.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ds 15 2842 G.sub.dsG.sub.dsT.sub.ksT.sub.esT.sub.ksT.sub.esG.sub.k 1198429 N/A N/A 117325 117340 ATTGCAATCTGTCTGA A.sub.ksT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds 48 2843 T.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.esT.sub.ksG.sub.esA.sub.k 1198430 N/A N/A 117327 117342 ATATTGCAATCTGTCT A.sub.ksT.sub.dsA.sub.dsT.sub.dsT.sub.dsC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds 49 2844 T.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.esT.sub.ks.sup.mC.sub.esT.sub.k 1198431 N/A N/A 117328 117343 AATATTGCAATCTGTC A.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds 35 2845 A.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.esG.sub.ksT.sub.es.sup.mC.sub.k 1198432 N/A N/A 117329 117344 TAATATTGCAATCTGT T.sub.ksA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 70 2846 A.sub.dsA.sub.dsT.sub.ks.sup.mC.sub.esT.sub.ksG.sub.esT.sub.k 1198433 N/A N/A 117330 117345 GTAATATTGCAATCTG G.sub.ksT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.m 36 1404 C.sub.dsA.sub.dsA.sub.ksT.sub.es.sup.mC.sub.ksT.sub.esG.sub.k 1198434 N/A N/A 117331 117346 TGTAATATTGCAATCT T.sub.ksG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.m 78 2847 C.sub.dsA.sub.ksA.sub.esT.sub.ks.sup.mC.sub.esT.sub.k 1198435 N/A N/A 117332 117347 ATGTAATATTGCAATC A.sub.ksT.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.ds 57 2848 G.sub.ds.sup.mC.sub.ksA.sub.esA.sub.ksT.sub.es.sup.mC.sub.k 1198436 N/A N/A 117333 117348 TATGTAATATTGCAAT T.sub.ksA.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ds 69 2849 T.sub.dsG.sub.ks.sup.mC.sub.esA.sub.ksA.sub.esT.sub.k 1198437 N/A N/A 117335 117350 TTTATGTAATATTGCA T.sub.ksT.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.ds 63 2850 A.sub.dsT.sub.ksT.sub.esG.sub.ks.sup.mC.sub.esA.sub.k 1198447 N/A N/A 119667 119682 TAAGGTTTCCCAGATT T.sub.ksA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.s.sup.mC.sub.ds.sup.m 63 2851 C.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.esA.sub.ksT.sub.esT.sub.k 1198448 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA A.sub.ksG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.m 36 2852 C.sub.ds.sup.mC.sub.ks.sup.mC.sub.esA.sub.ksG.sub.esA.sub.k 1198449 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG A.sub.ksA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds 37 2853 T.sub.ds.sup.mC.sub.ks.sup.mC.sub.es.sup.mC.sub.ksA.sub.esG.sub.k 1198450 N/A N/A 119671 119686 TAAGTAAGGTTTCCCA T.sub.ksA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds 42 2854 T.sub.dsT.sub.ks.sup.mC.sub.es.sup.mC.sub.ks.sup.mC.sub.esA.sub.k 1198451 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC .sup.mC.sub.ksT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.ds 48 1101 G.sub.dsT.sub.dsT.sub.ksT.sub.es.sup.mC.sub.ks.sup.mC.sub.es.sup.mC.sub.k 1198452 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC A.sub.ks.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.ds 38 2855 G.sub.dsG.sub.dsT.sub.ksT.sub.esT.sub.ks.sup.mC.sub.es.sup.mC.sub.k 1198453 N/A N/A 119674 119689 GACTAAGTAAGGTTTC G.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds 48 2856 A.sub.dsG.sub.dsG.sub.ksT.sub.esT.sub.ksT.sub.es.sup.mC.sub.k 1198454 N/A N/A 119675 119690 AGACTAAGTAAGGTTT A.sub.ksG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.ds 39 2857 A.sub.dsA.sub.dsG.sub.ksG.sub.esT.sub.ksT.sub.esT.sub.k 1198455 N/A N/A 119677 119692 TTAGACTAAGTAAGGT T.sub.ksT.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.ds 42 2858 G.sub.dsT.sub.dsA.sub.ksA.sub.esG.sub.ksG.sub.esT.sub.k
TABLE-US-00040 TABLE 40 Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2 SEQ SEQ ID ID SEQ SEQ NO: 1 NO: 1 ID NO: ID NO: YAP1 SEQ Compound Start Stop 2 Start 2 Stop (% ID Number Site Site Site Site Sequence (5' to 3') CHEMISTRY NOTATION UTC) NO 715487 3630 3645 124655 124670 ATTACTTCATAGCTTA A.sub.ksT.sub.ksT.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 28 52 T.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.ksA.sub.k 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 15 810 G.sub.dsT.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC G.sub.ksA.sub.ksA.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 9 2800 C.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 1198425 N/A N/A 115909 115924 ACTCTTATATGGTTTT A.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.ds 35 2859 T.sub.dsG.sub.dsG.sub.ksT.sub.esT.sub.ksT.sub.esT.sub.k 1198426 N/A N/A 115910 115925 AACTCTTATATGGTTT A.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.ds 111 2860 A.sub.dsT.sub.dsG.sub.ksG.sub.esT.sub.ksT.sub.esT.sub.k 1198427 N/A N/A 115911 115926 CAACTCTTATATGGTT .sup.mC.sub.ksA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ds 62 2861 T.sub.dsA.sub.dsT.sub.ksG.sub.esG.sub.ksT.sub.esT.sub.k 1198428 N/A N/A 115913 115928 GACAACTCTTATATGG G.sub.ksA.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds 62 2862 T.sub.dsA.sub.dsT.sub.ksA.sub.esT.sub.ksG.sub.esG.sub.k 1198438 N/A N/A 117755 117770 TGTATGTCAGAAGAGT T.sub.ksG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds 7 2863 A.sub.dsA.sub.ksG.sub.esA.sub.ksG.sub.esT.sub.k 1198439 N/A N/A 117757 117772 AGTGTATGTCAGAAGA A.sub.ksG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 6 2864 A.sub.dsG.sub.ksA.sub.esA.sub.ksG.sub.esA.sub.k 1198440 N/A N/A 117758 117773 AAGTGTATGTCAGAAG A.sub.ksA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 5 2865 C.sub.dsA.sub.ksG.sub.esA.sub.ksA.sub.esG.sub.k 1198441 N/A N/A 117759 117774 AAAGTGTATGTCAGAA A.sub.ksA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ds 19 2866 T.sub.ds.sup.mC.sub.ksA.sub.esG.sub.ksA.sub.esA.sub.k 1198442 N/A N/A 117760 117775 TAAAGTGTATGTCAGA T.sub.ksA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 44 2867 G.sub.dsT.sub.ks.sup.mC.sub.esA.sub.ksG.sub.esA.sub.k 1198443 N/A N/A 117761 117776 TTAAAGTGTATGTCAG T.sub.ksT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.ds 39 2868 T.sub.dsG.sub.ksT.sub.es.sup.mC.sub.ksA.sub.esG.sub.k 1198444 N/A N/A 117762 117777 TTTAAAGTGTATGTCA T.sub.ksT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.ds 70 2869 A.sub.dsT.sub.ksG.sub.esT.sub.ks.sup.mC.sub.esA.sub.k 1198445 N/A N/A 117763 117778 CTTTAAAGTGTATGTC .sup.mC.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.ds 61 1634 T.sub.dsA.sub.ksT.sub.esG.sub.ksT.sub.es.sup.mC.sub.k 1198446 N/A N/A 117765 117780 AACTTTAAAGTGTATG A.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ds 83 2870 T.sub.dsG.sub.ksT.sub.esA.sub.ksT.sub.esG.sub.k 1198714 2524 2539 123549 123564 TGTCTCATGCCTTATA T.sub.ksG.sub.esT.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m 20 2803 C.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.esA.sub.esT.sub.ksA.sub.k 1198715 2526 2541 123551 123566 ATTGTCTCATGCCTTA A.sub.ksT.sub.esT.sub.ksG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 33 2804 T.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.esT.sub.esT.sub.ksA.sub.k 1198716 2527 2542 123552 123567 AATTGTCTCATGCCTT A.sub.ksA.sub.esT.sub.ksT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds 27 2805 A.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.es.sup.mC.sub.esT.sub.ksT.sub.k 1198717 2528 2543 123553 123568 AAATTGTCTCATGCCT A.sub.ksA.sub.esA.sub.ksT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 41 443 C.sub.dsA.sub.dsT.sub.dsG.sub.es.sup.mC.sub.es.sup.mC.sub.ksT.sub.k 1198718 2529 2544 123554 123569 GAAATTGTCTCATGCC G.sub.ksA.sub.esA.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 9 2800 C.sub.dsA.sub.dsT.sub.esG.sub.es.sup.mC.sub.ks.sup.mC.sub.k 1198719 2530 2545 123555 123570 GGAAATTGTCTCATGC G.sub.ksG.sub.esA.sub.ksA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 14 2806 T.sub.ds.sup.mC.sub.dsA.sub.esT.sub.esG.sub.ks.sup.mC.sub.k 1198720 2531 2546 123556 123571 TGGAAATTGTCTCATG T.sub.ksG.sub.esG.sub.ksA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 21 2807 C.sub.dsT.sub.ds.sup.mC.sub.esA.sub.esT.sub.ksG.sub.k 1198721 2532 2547 123557 123572 ATGGAAATTGTCTCAT A.sub.ksT.sub.esG.sub.ksG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds 48 2808 T.sub.ds.sup.mC.sub.dsT.sub.es.sup.mC.sub.esA.sub.ksT.sub.k 1198722 2534 2549 123559 123574 ATATGGAAATTGTCTC A.sub.ksT.sub.esA.sub.ksT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.ds 48 656 T.sub.dsG.sub.dsT.sub.es.sup.mC.sub.esT.sub.ks.sup.mC.sub.k 1198723 2560 2575 123585 123600 AGTATGTGGCAATAAT A.sub.ksG.sub.esT.sub.ksA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds 57 2809 A.sub.dsA.sub.dsT.sub.esA.sub.esA.sub.ksT.sub.k 1198724 2562 2577 123587 123602 AGAGTATGTGGCAATA A.sub.ksG.sub.esA.sub.ksG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.ds 16 2810 G.sub.ds.sup.mC.sub.dsA.sub.esA.sub.esT.sub.ksA.sub.k 1198725 2563 2578 123588 123603 TAGAGTATGTGGCAAT T.sub.ksA.sub.esG.sub.ksA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds 23 2811 G.sub.dsG.sub.ds.sup.mC.sub.esA.sub.esA.sub.ksT.sub.k 1198726 2564 2579 123589 123604 TTAGAGTATGTGGCAA T.sub.ksT.sub.esA.sub.ksG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ds 28 963 T.sub.dsG.sub.dsG.sub.es.sup.mC.sub.esA.sub.ksA.sub.k 1198727 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.esT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 19 810 G.sub.dsT.sub.dsG.sub.esG.sub.es.sup.mC.sub.ksA.sub.k 1198728 2566 2581 123591 123606 TATTAGAGTATGTGGC T.sub.ksA.sub.esT.sub.ksT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds 17 2812 T.sub.dsG.sub.dsT.sub.esG.sub.esG.sub.ks.sup.mC.sub.k 1198729 2567 2582 123592 123607 ATATTAGAGTATGTGG A.sub.ksT.sub.esA.sub.ksT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds 21 2813 A.sub.dsT.sub.dsG.sub.esT.sub.esG.sub.ksG.sub.k 1198730 2568 2583 123593 123608 TATATTAGAGTATGTG T.sub.ksA.sub.esT.sub.ksA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds 57 2814 T.sub.dsA.sub.dsT.sub.esG.sub.esT.sub.ksG.sub.k 1198731 2570 2585 123595 123610 TCTATATTAGAGTATG T.sub.ks.sup.mC.sub.esT.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 59 887 A.sub.dsG.sub.dsT.sub.esA.sub.esT.sub.ksG.sub.k 1198732 4436 4451 125461 125476 TATAACTGGGCAAATT T.sub.ksA.sub.esT.sub.ksA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.m 86 2815 C.sub.dsA.sub.dsA.sub.esA.sub.esT.sub.ksT.sub.k 1198741 4595 4610 125620 125635 TTACATTAGGAACAAG T.sub.ksT.sub.esA.sub.ks.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.ds 60 2817 A.sub.dsA.sub.ds.sup.mC.sub.esA.sub.esA.sub.ksG.sub.k 1198742 4597 4612 125622 125637 TTTTACATTAGGAACA T.sub.ksT.sub.esT.sub.ksT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.ds 143 2818 G.sub.dsG.sub.dsA.sub.esA.sub.es.sup.mC.sub.ksA.sub.k 1198743 4598 4613 125623 125638 CTTTTACATTAGGAAC .sup.mC.sub.ksT.sub.esT.sub.ksT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds 86 1124 T.sub.dsA.sub.dsG.sub.dsG.sub.esA.sub.esA.sub.ks.sup.mC.sub.k 1198744 4599 4614 125624 125639 ACTTTTACATTAGGAA A.sub.ks.sup.mC.sub.esT.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds 66 2819 T.sub.dsT.sub.dsA.sub.dsG.sub.esG.sub.esA.sub.ksA.sub.k 1198745 4600 4615 125625 125640 CACTTTTACATTAGGA .sup.mC.sub.ksA.sub.es.sup.mC.sub.ksT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds 57 1200 A.sub.dsT.sub.dsT.sub.dsA.sub.esG.sub.esG.sub.ksA.sub.k 1198746 4601 4616 125626 125641 GCACTTTTACATTAGG G.sub.ks.sup.mC.sub.esA.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.m 7 1276 .sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.esA.sub.esG.sub.ksG.sub.k 1198747 4602 4617 125627 125642 AGCACTTTTACATTAG A.sub.ksG.sub.es.sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds 38 2820 A.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.esT.sub.esA.sub.ksG.sub.k 1198748 4603 4618 125628 125643 AAGCACTTTTACATTA A.sub.ksA.sub.esG.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 81 2821 T.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.esT.sub.esT.sub.ksA.sub.k 1198749 4605 4620 125630 125645 TTAAGCACTTTTACAT T.sub.ksT.sub.esA.sub.ksA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds 73 2822 T.sub.dsT.sub.dsT.sub.dsA.sub.es.sup.mC.sub.esA.sub.ksT.sub.k 1198750 4795 4810 125820 125835 GGAAGATCTGAAACTC G.sub.ksG.sub.esA.sub.ksA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds 32 2823 G.sub.dsA.sub.dsA.sub.dsA.sub.es.sup.mC.sub.esT.sub.ks.sup.mC.sub.k 1198751 4797 4812 125822 125837 TTGGAAGATCTGAAAC T.sub.ksT.sub.esG.sub.ksG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds 76 2824 T.sub.dsG.sub.dsA.sub.esA.sub.esA.sub.ks.sup.mC.sub.k 1198752 4798 4813 125823 125838 TTTGGAAGATCTGAAA T.sub.ksT.sub.esT.sub.ksG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.m 111 2825 C.sub.dsT.sub.dsG.sub.esA.sub.esA.sub.ksA.sub.k 1198753 4799 4814 125824 125839 CTTTGGAAGATCTGAA .sup.mC.sub.ksT.sub.esT.sub.ksT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ds 58 2826 T.sub.ds.sup.mC.sub.dsT.sub.esG.sub.esA.sub.ksA.sub.k 1198754 4800 4815 125825 125840 GCTTTGGAAGATCTGA G.sub.ks.sup.mC.sub.esT.sub.ksT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ds 23 2044 A.sub.dsT.sub.ds.sup.mC.sub.esT.sub.esG.sub.ksA.sub.k 1198755 4801 4816 125826 125841 TGCTTTGGAAGATCTG T.sub.ksG.sub.es.sup.mC.sub.ksT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.ds 32 2121 G.sub.dsA.sub.dsT.sub.es.sup.mC.sub.esT.sub.ksG.sub.k 1198756 4802 4817 125827 125842 GTGCTTTGGAAGATCT G.sub.ksT.sub.esG.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.ds 50 2827 A.sub.dsG.sub.dsA.sub.esT.sub.es.sup.mC.sub.ksT.sub.k 1198757 4803 4818 125828 125843 AGTGCTTTGGAAGATC A.sub.ksG.sub.esT.sub.ksG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds 4 2828 A.sub.dsA.sub.dsG.sub.esA.sub.esT.sub.ks.sup.mC.sub.k 1198758 4805 4820 125830 125845 ATAGTGCTTTGGAAGA A.sub.ksT.sub.esA.sub.ksG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 47 2829 G.sub.dsG.sub.dsA.sub.esA.sub.esG.sub.ksA.sub.k 1198759 N/A N/A 94729 94744 AGGATGCATGGTTTTT A.sub.ksG.sub.esG.sub.ksA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds 27 2830 G.sub.dsG.sub.dsT.sub.dsT.sub.esT.sub.esT.sub.ksT.sub.k 1198760 N/A N/A 94731 94746 TTAGGATGCATGGTTT T.sub.ksT.sub.esA.sub.ksG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds 91 2831 T.sub.dsG.sub.dsG.sub.esT.sub.esT.sub.ksT.sub.k 1198761 N/A N/A 94732 94747 TTTAGGATGCATGGTT T.sub.ksT.sub.esT.sub.ksA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 42 2832 A.sub.dsT.sub.dsG.sub.esG.sub.esT.sub.ksT.sub.k 1198762 N/A N/A 94733 94748 ATTTAGGATGCATGGT A.sub.ksT.sub.esT.sub.ksT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m30 2833 C.sub.dsA.sub.dsT.sub.esG.sub.esG.sub.ksT.sub.k 1198763 N/A N/A 94734 94749 GATTTAGGATGCATGG G.sub.ksA.sub.esT.sub.ksT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.ds 26 2834 G.sub.ds.sup.mC.sub.dsA.sub.esT.sub.esG.sub.ksG.sub.k 1198764 N/A N/A 94735 94750 AGATTTAGGATGCATG A.sub.ksG.sub.esA.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds 28 2835 T.sub.dsG.sub.ds.sup.mC.sub.esA.sub.esT.sub.ksG.sub.k 1198765 N/A N/A 94736 94751 CAGATTTAGGATGCAT .sup.mC.sub.ksA.sub.esA.sub.ksA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.ds 23 2836 A.sub.dsT.sub.dsG.sub.es.sup.mC.sub.esA.sub.ksT.sub.k 1198766 N/A N/A 94737 94752 TCAGATTTAGGATGCA T.sub.ks.sup.mC.sub.esA.sub.ksG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 19 2837 G.sub.dsA.sub.dsT.sub.esG.sub.es.sup.mC.sub.ksA.sub.k 1198767 N/A N/A 94739 94754 ATTCAGATTTAGGATG A.sub.ksT.sub.esT.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.ds 65 2838 A.sub.dsG.sub.dsG.sub.esA.sub.esT.sub.ksG.sub.k 1198777 N/A N/A 117325 117340 ATTGCAATCTGTCTGA A.sub.ksT.sub.esT.sub.ksG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds 84 2843 T.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.esT.sub.esG.sub.ksA.sub.k 1198778 N/A N/A 117327 117342 ATATTGCAATCTGTCT A.sub.ksT.sub.esA.sub.ksT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.m 55 2844 C.sub.dsT.sub.dsG.sub.esT.sub.es.sup.mC.sub.ksT.sub.k 1198779 N/A N/A 117328 117343 AATATTGCAATCTGTC A.sub.ksA.sub.esT.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds 49 2845 T.sub.ds.sup.mC.sub.dsT.sub.esG.sub.esT.sub.ks.sup.mC.sub.k 1198780 N/A N/A 117329 117344 TAATATTGCAATCTGT T.sub.ksA.sub.esA.sub.ksT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds 80 2846 A.sub.dsT.sub.ds.sup.mC.sub.esT.sub.esG.sub.ksT.sub.k 1198781 N/A N/A 117330 117345 GTAATATTGCAATCTG G.sub.ksT.sub.esA.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 25 1404 A.sub.dsA.sub.dsT.sub.es.sup.mC.sub.esT.sub.ksG.sub.k 1198782 N/A N/A 117331 117346 TGTAATATTGCAATCT T.sub.ksG.sub.esT.sub.ksA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.m 61 2847 C.sub.dsA.sub.dsA.sub.esT.sub.es.sup.mC.sub.ksT.sub.k 1198783 N/A N/A 117332 117347 ATGTAATATTGCAATC A.sub.ksT.sub.esG.sub.ksT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.ds 78 2848 G.sub.ds.sup.mC.sub.dsA.sub.esA.sub.esT.sub.ks.sup.mC.sub.k 1198784 N/A N/A 117333 117348 TATGTAATATTGCAAT T.sub.ksA.sub.esT.sub.ksG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ds 94 2849 T.sub.dsG.sub.ds.sup.mC.sub.esA.sub.esA.sub.ksT.sub.k 1198785 N/A N/A 117335 117350 TTTATGTAATATTGCA T.sub.ksT.sub.esT.sub.ksA.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.ds 86 2850 A.sub.dsT.sub.dsT.sub.esG.sub.es.sup.mC.sub.ksA.sub.k 1198795 N/A N/A 119667 119682 TAAGGTTTCCCAGATT T.sub.ksA.sub.esA.sub.ksG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.m 43 2851 C.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.esA.sub.esT.sub.ksT.sub.k 1198796 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA A.sub.ksG.sub.esT.sub.ksA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.m 32 2852 C.sub.ds.sup.mC.sub.ds.sup.mC.sub.esA.sub.esG.sub.ksA.sub.k 1198797 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG A.sub.ksA.sub.esG.sub.ksT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds 31 2853 T.sub.ds.sup.mC.sub.ds.sup.mC.sub.es.sup.mC.sub.esA.sub.ksG.sub.k 1198798 N/A N/A 119671 119686 TAAGTAAGGTTTCCCA T.sub.ksA.sub.esA.sub.ksG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds 38 2854 T.sub.dsT.sub.ds.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.ksA.sub.k 1198799 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC .sup.mC.sub.ksT.sub.esA.sub.ksA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.ds 18 1101 G.sub.dsT.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.ks.sup.mC.sub.k 1198800 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC A.sub.ks.sup.mC.sub.esT.sub.ksA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.ds 47 2855 G.sub.dsG.sub.dsT.sub.dsT.sub.esT.sub.es.sup.mC.sub.ks.sup.mC.sub.k 1198801 N/A N/A 119674 119689 GACTAAGTAAGGTTTC G.sub.ksA.sub.es.sup.mC.sub.ksT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds 47 2856 A.sub.dsG.sub.dsG.sub.dsT.sub.esT.sub.esT.sub.ks.sup.mC.sub.k 1198802 N/A N/A 119675 119690 AGACTAAGTAAGGTTT A.sub.ksG.sub.esA.sub.ks.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.ds 83 2857 A.sub.dsA.sub.dsG.sub.dsG.sub.esT.sub.esT.sub.ksT.sub.k 1198803 N/A N/A 119677 119692 TTAGACTAAGTAAGGT T.sub.ksT.sub.esA.sub.ksG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.ds 62 2858 T.sub.dsA.sub.dsA.sub.esG.sub.esG.sub.ksT.sub.k
TABLE-US-00041 TABLE 41 Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2 SEQ SEQ ID ID SEQ SEQ NO: 1 NO: 1 ID NO: ID NO: YAP1 SEQ Compound Start Stop 2 Start 2 Stop (% ID Number Site Site Site Site Sequence (5' to 3') CHEMISTRY NOTATION UTC) NO 715487 3630 3645 124655 124670 ATTACTTCATAGCTTA A.sub.ksT.sub.ksT.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 28 52 T.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.ksA.sub.k 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 14 810 G.sub.dsT.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC G.sub.ksA.sub.ksA.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 12 2800 C.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 1198628 2524 2539 123549 123564 TGTCTCATGCCTTATA T.sub.ksG 27 2803 C.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ksA.sub.esT.sub.ksA.sub.e 1198629 2526 2541 123551 123566 ATTGTCTCATGCCTTA A.sub.ksT.sub.ksT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 22 2804 T.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.esT.sub.ksA.sub.e 1198630 2527 2542 123552 123567 AATTGTCTCATGCCTT A.sub.ksA.sub.ksT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds 37 2805 A.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ks.sup.mC.sub.esT.sub.ksT.sub.e 1198631 2528 2543 123553 123568 AAATTGTCTCATGCCT A.sub.ksA.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 53 443 C.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.es.sup.mC.sub.ksT.sub.e 1198632 2529 2544 123554 123569 GAAATTGTCTCATGCC G.sub.ksA.sub.ksA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 21 2800 C.sub.dsA.sub.dsT.sub.ksG.sub.es.sup.mC.sub.ks.sup.mC.sub.e 1198633 2530 2545 123555 123570 GGAAATTGTCTCATGC G.sub.ksG.sub.ksA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 46 2806 C.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.esG.sub.ks.sup.mC.sub.e 1198634 2531 2546 123556 123571 TGGAAATTGTCTCATG T.sub.ksG.sub.ksG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 34 2807 C.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.esT.sub.ksG.sub.e 1198635 2532 2547 123557 123572 ATGGAAATTGTCTCAT A.sub.ksT.sub.ksG.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds 57 2808 T.sub.ds.sup.mC.sub.dsT.sub.ks.sup.mC.sub.esA.sub.ksT.sub.e 1198636 2534 2549 123559 123574 ATATGGAAATTGTCTC A.sub.ksT.sub.ksA.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.ds 41 656 T.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.esT.sub.ks.sup.mC.sub.e 1198637 2560 2575 123585 123600 AGTATGTGGCAATAAT A.sub.ksG.sub.ksT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.m 64 2809 C.sub.dsA.sub.dsA.sub.dsT.sub.ksA.sub.esA.sub.ksT.sub.e 1198638 2562 2577 123587 123602 AGAGTATGTGGCAATA A.sub.ksG.sub.ksA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.ds 18 2810 G.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.esT.sub.ksA.sub.e 1198639 2563 2578 123588 123603 TAGAGTATGTGGCAAT T.sub.ksA.sub.ksG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds 32 2811 G.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.esA.sub.ksT.sub.e 1198640 2564 2579 123589 123604 TTAGAGTATGTGGCAA T.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ds 26 963 T.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.esA.sub.ksA.sub.e 1198641 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 15 810 G.sub.dsT.sub.dsG.sub.ksG.sub.es.sup.mC.sub.ksA.sub.e 1198642 2566 2581 123591 123606 TATTAGAGTATGTGGC T.sub.ksA.sub.ksT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds 19 2812 T.sub.dsG.sub.dsT.sub.ksG.sub.esG.sub.ks.sup.mC.sub.e 1198643 2567 2582 123592 123607 ATATTAGAGTATGTGG A.sub.ksT.sub.ksA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds 25 2813 A.sub.dsT.sub.dsG.sub.ksT.sub.esG.sub.ksG.sub.e 1198644 2568 2583 123593 123608 TATATTAGAGTATGTG T.sub.ksA.sub.ksT.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds 73 2814 T.sub.dsA.sub.dsT.sub.ksG.sub.esT.sub.ksG.sub.e 1198645 2570 2585 123595 123610 TCTATATTAGAGTATG T.sub.ks.sup.mC.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 73 887 A.sub.dsG.sub.dsT.sub.ksA.sub.esT.sub.ksG.sub.e 1198651 4595 4610 125620 125635 TTACATTAGGAACAAG T.sub.ksT.sub.ksA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.ds 94 2817 A.sub.dsA.sub.ds.sup.mC.sub.ksA.sub.esA.sub.ksG.sub.e 1198652 4597 4612 125622 125637 TTTTACATTAGGAACA T.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.ds 68 2818 G.sub.dsG.sub.dsA.sub.ksA.sub.es.sup.mC.sub.ksA.sub.e 1198653 4598 4613 125623 125638 CTTTTACATTAGGAAC .sup.mC.sub.ksT.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds 64 1124 T.sub.dsA.sub.dsG.sub.dsG.sub.ksA.sub.esA.sub.ks.sup.mC.sub.e 1198654 4599 4614 125624 125639 ACTTTTACATTAGGAA A.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds 91 2819 T.sub.dsT.sub.dsA.sub.dsG.sub.ksG.sub.esA.sub.ksA.sub.e 1198655 4600 4615 125625 125640 CACTTTTACATTAGGA .sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds 30 1200 A.sub.dsT.sub.dsT.sub.dsA.sub.ksG.sub.esG.sub.ksA.sub.e 1198656 4601 4616 125626 125641 GCACTTTTACATTAGG G.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.m 11 1276 C.sub.dsA.sub.dsT.sub.dsT.sub.ksA.sub.esG.sub.ksG.sub.e 1198657 4602 4617 125627 125642 AGCACTTTTACATTAG A.sub.ksG.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds 95 2820 A.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ksT.sub.esA.sub.ksG.sub.e 1198658 4603 4618 125628 125643 AAGCACTTTTACATTA A.sub.ksA.sub.ksG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 62 2821 T.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.esT.sub.ksA.sub.e 1198659 4605 4620 125630 125645 TTAAGCACTTTTACAT T.sub.ksT.sub.ksA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds 58 2822 T.sub.dsT.sub.dsT.sub.dsA.sub.ks.sup.mC.sub.esA.sub.ksT.sub.e 1198660 4795 4810 125820 125835 GGAAGATCTGAAACTC G.sub.ksG.sub.ksA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds 66 2823 G.sub.dsA.sub.dsA.sub.dsA.sub.ks.sup.mC.sub.esT.sub.ks.sup.mC.sub.e 1198661 4797 4812 125822 125837 TTGGAAGATCTGAAAC T.sub.ksT.sub.ksG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.m 111 2824 C.sub.dsT.sub.dsG.sub.dsA.sub.ksA.sub.esA.sub.ks.sup.mC.sub.e 1198662 4798 4813 125823 125838 TTTGGAAGATCTGAAA T.sub.ksT.sub.ksT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.m 83 2825 C.sub.dsT.sub.dsG.sub.ksA.sub.esA.sub.ksA.sub.e 1198663 4799 4814 125824 125839 CTTTGGAAGATCTGAA .sup.mC.sub.ksT.sub.ksT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ds 76 2826 A.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.esA.sub.ksA.sub.e 1198664 4800 4815 125825 125840 GCTTTGGAAGATCTGA G.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.ds 18 2044 G.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.esG.sub.ksA.sub.e 1198665 4801 4816 125826 125841 TGCTTTGGAAGATCTG T.sub.ksG.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.ds 38 2121 G.sub.dsA.sub.dsT.sub.ks.sup.mC.sub.esT.sub.ksG.sub.e 1198666 4802 4817 125827 125842 GTGCTTTGGAAGATCT G.sub.ksT.sub.ksG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.d sG.sub.dsA.sub.ds 44 2827 A.sub.dsG.sub.dsA.sub.ksT.sub.es.sup.mC.sub.ksT.sub.e 1198667 4803 4818 125828 125843 AGTGCTTTGGAAGATC A.sub.ksG.sub.ksT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds 40 2828 A.sub.dsA.sub.dsG.sub.ksA.sub.esT.sub.ks.sup.mC.sub.e 1198668 4805 4820 125830 125845 ATAGTGCTTTGGAAGA A.sub.ksT.sub.ksA.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 72 2829 G.sub.dsG.sub.dsA.sub.ksA.sub.esG.sub.ksA.sub.e 1198669 N/A N/A 94729 94744 AGGATGCATGGTTTTT A.sub.ksG.sub.ksG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds 61 2830 G.sub.dsG.sub.dsT.sub.dsT.sub.ksT.sub.esT.sub.ksT.sub.e 1198670 N/A N/A 94731 94746 TTAGGATGCATGGTTT T.sub.ksT.sub.ksA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 55 2831 A.sub.dsT.sub.dsG.sub.dsG.sub.ksT.sub.esT.sub.ksT.sub.e 1198671 N/A N/A 94732 94747 TTTAGGATGCATGGTT T.sub.ksT.sub.ksT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 26 2832 A.sub.dsT.sub.dsG.sub.ksG.sub.esT.sub.ksT.sub.e 1198672 N/A N/A 94733 94748 ATTTAGGATGCATGGT A.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m 41 2833 C.sub.dsA.sub.dsT.sub.ksG.sub.esG.sub.ksT.sub.e 1198673 N/A N/A 94734 94749 GATTTAGGATGCATGG G.sub.ksA.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.ds 10 2834 G.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.esG.sub.ksG.sub.e 1198674 N/A N/A 94735 94750 AGATTTAGGATGCATG A.sub.ksG.sub.ksA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds 21 2835 T.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.esT.sub.ksG.sub.e 1198675 N/A N/A 94736 94751 CAGATTTAGGATGCAT .sup.mC.sub.ksA.sub.ksG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 35 2836 G.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.esA.sub.ksT.sub.e 1198676 N/A N/A 94737 94752 TCAGATTTAGGATGCA T.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 52 2837 G.sub.dsA.sub.dsT.sub.ksG.sub.es.sup.mC.sub.ksA.sub.e 1198677 N/A N/A 94739 94754 ATTCAGATTTAGGATG A.sub.ksT.sub.ksT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.ds 87 2838 A.sub.dsG.sub.dsG.sub.ksA.sub.esT.sub.ksG.sub.e 1198687 N/A N/A 117325 117340 ATTGCAATCTGTCTGA A.sub.ksT.sub.ksT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds 55 2843 T.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.esG.sub.ksA.sub.e 1198688 N/A N/A 117327 117342 ATATTGCAATCTGTCT A.sub.ksT.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.m 48 2844 C.sub.dsT.sub.dsG.sub.ksT.sub.es.sup.mC.sub.ksT.sub.e 1198689 N/A N/A 117328 117343 AATATTGCAATCTGTC A.sub.ksA.sub.ksT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds 91 2845 A.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.esT.sub.ks.sup.mC.sub.e 1198690 N/A N/A 117329 117344 TAATATTGCAATCTGT T.sub.ksA.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds 64 2846 A.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.esG.sub.ksT.sub.e 1198691 N/A N/A 117330 117345 GTAATATTGCAATCTG G.sub.ksT.sub.ksA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 38 1404 A.sub.dsA.sub.dsT.sub.ks.sup.mC.sub.esT.sub.ksG.sub.e 1198692 N/A N/A 117331 117346 TGTAATATTGCAATCT T.sub.ksG.sub.ksT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.m 120 2847 C.sub.dsA.sub.dsA.sub.ksT.sub.es.sup.mC.sub.ksT.sub.e 1198733 4438 4453 125463 125478 GGTATAACTGGGCAAA G.sub.ksG.sub.esT.sub.ksA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds 47 1427 G.sub.dsG.sub.ds.sup.mC.sub.esA.sub.esA.sub.ksA.sub.k 1198734 4439 4454 125464 125479 AGGTATAACTGGGCAA A.sub.ksG.sub.esG.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds 29 905 G.sub.dsG.sub.dsG.sub.es.sup.mC.sub.esA.sub.ksA.sub.k 1198735 4440 4455 125465 125480 GAGGTATAACTGGGCA G.sub.ksA.sub.esG.sub.ksG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.m 34 1503 C.sub.dsT.sub.dsG.sub.dsG.sub.esG.sub.es.sup.mC.sub.ksA.sub.k 1198736 4441 4456 125466 125481 TGAGGTATAACTGGGC T.sub.ksG.sub.esA.sub.ksG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.m 20 1580 C.sub.dsT.sub.dsG.sub.esG.sub.esG.sub.ks.sup.mC.sub.k 1198737 4442 4457 125467 125482 CTGAGGTATAACTGGG .sup.mC.sub.ksT.sub.esG.sub.ksA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 24 2801 A.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.esG.sub.esG.sub.ksG.sub.k 1198738 4443 4458 125468 125483 ACTGAGGTATAACTGG A.sub.ks.sup.mC.sub.esT.sub.ksG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 38 392 A.sub.dsA.sub.ds.sup.mC.sub.esT.sub.esG.sub.ksG.sub.k 1198739 4444 4459 125469 125484 CACTGAGGTATAACTG .sup.mC.sub.ksA.sub.es.sup.mC.sub.ksT.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds 94 2802 A.sub.dsT.sub.dsA.sub.dsA.sub.es.sup.mC.sub.esT.sub.ksG.sub.k 1198740 4446 4461 125471 125486 AACACTGAGGTATAAC A.sub.ksAmC.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.ds 39 2816 G.sub.dsT.sub.dsA.sub.dsT.sub.esA.sub.esA.sub.ks.sup.mC.sub.k 1198768 N/A N/A 115903 115918 ATATGGTTTTGTGTGT A.sub.ksT.sub.esA.sub.ksT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds 61 2839 G.sub.dsT.sub.dsG.sub.esT.sub.esG.sub.ksT.sub.k 1198769 N/A N/A 115905 115920 TTATATGGTTTTGTGT T.sub.ksT.sub.esA.sub.ksT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds 77 2840 T.sub.dsT.sub.dsG.sub.esT.sub.esG.sub.ksT.sub.k 1198770 N/A N/A 115906 115921 CTTATATGGTTTTGTG .sup.mC.sub.ksT.sub.esT.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.ds 40 2788 T.sub.dsT.sub.dsT.sub.dsT.sub.esG.sub.esT.sub.ksG.sub.k 1198771 N/A N/A 115907 115922 TCTTATATGGTTTTGT T.sub.ks.sup.mC.sub.esT.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.ds 85 2841 T.sub.dsT.sub.dsT.sub.esT.sub.esG.sub.ksT.sub.k 1198772 N/A N/A 115908 115923 CTCTTATATGGTTTTG .sup.mC.sub.ksT.sub.es.sup.mC.sub.ksT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ds 41 2842 G.sub.dsG.sub.dsT.sub.dsT.sub.esT.sub.esT.sub.ksG.sub.k 1198773 N/A N/A 115909 115924 ACTCTTATATGGTTTT A.sub.ks.sup.mC.sub.esT.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.ds 58 2859 T.sub.dsG.sub.dsG.sub.dsT.sub.esT.sub.esT.sub.ksT.sub.k 1198774 N/A N/A 115910 115925 AACTCTTATATGGTTT A.sub.ksA.sub.es.sup.mC.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.ds 106 2860 A.sub.dsT.sub.dsG.sub.dsG.sub.esT.sub.esT.sub.ksT.sub.k 1198775 N/A N/A 115911 115926 CAACTCTTATATGGTT .sup.mC.sub.ksA.sub.esA.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ds 113 2861 T.sub.dsA.sub.dsT.sub.dsG.sub.esG.sub.esT.sub.ksT.sub.k 1198776 N/A N/A 115913 115928 GACAACTCTTATATGG G.sub.ksA.sub.es.sup.m+lC.sub.ksA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds 57 2862 T.sub.dsA.sub.dsT.sub.dsA.sub.esT.sub.esG.sub.ksG.sub.k 1198786 N/A N/A 117755 117770 TGTATGTCAGAAGAGT T.sub.ksG.sub.esT.sub.ksA.sub.dsT.sub.dsG.sub.dsT.sub.dshu mC.sub.dsA.sub.dsG.sub.ds 16 2863 A.sub.dsA.sub.dsG.sub.esA.sub.esG.sub.ksT.sub.k 1198787 N/A N/A 117757 117772 AGTGTATGTCAGAAGA A.sub.ksG.sub.esT.sub.ksG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 9 2864 A.sub.dsG.sub.dsA.sub.esA.sub.esG.sub.ksA.sub.k 1198788 N/A N/A 117758 117773 AAGTGTATGTCAGAAG A.sub.ksA.sub.esG.sub.ksT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 17 2865 C.sub.dsA.sub.dsG.sub.esA.sub.esA.sub.ksG.sub.k 1198789 N/A N/A 117759 117774 AAAGTGTATGTCAGAA A.sub.ksA.sub.esA.sub.ksG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ds 22 2866 T.sub.ds.sup.mC.sub.dsA.sub.esG.sub.esA.sub.ksA.sub.k 1198790 N/A N/A 117760 117775 TAAAGTGTATGTCAGA T.sub.ksA.sub.esA.sub.ksA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 27 2867 G.sub.dsT.sub.ds.sup.mC.sub.esA.sub.esG.sub.ksA.sub.k 1198791 N/A N/A 117761 117776 TTAAAGTGTATGTCAG T.sub.ksA T.sub.esA.sub.ksA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.ds 39 2868 T.sub.dsG.sub.dsT.sub.es.sup.mC.sub.esA.sub.ksG.sub.k 1198792 N/A N/A 117762 117777 TTTAAAGTGTATGTCA T.sub.ksT.sub.esT.sub.ksA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.ds 48 2869 A.sub.dsT.sub.dsG.sub.esT.sub.es.sup.mC.sub.ksA.sub.k 1198793 N/A N/A 117763 117778 CTTTAAAGTGTATGTC .sup.mC.sub.ksT.sub.esT.sub.ksT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.ds 34 1634 G.sub.dsT.sub.dsA.sub.dsT.sub.esG.sub.esT.sub.ks.sup.mC.sub.k 1198794 N/A N/A 117765 117780 AACTTTAAAGTGTATG A.sub.ksA.sub.es.sup.mC.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ds 74 2870 T.sub.dsG.sub.dsT.sub.esA.sub.esT.sub.ksG.sub.k
TABLE-US-00042 TABLE 42 Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2 SEQ SEQ ID ID SEQ SEQ NO: 1 NO: 1 ID NO: ID NO: YAP1 SEQ Compound Start Stop 2 Start 2 Stop (% ID Number Site Site Site Site Sequence (5' to 3') CHEMISTRY NOTATION UTC) NO 715487 3630 3645 124655 124670 ATTACTTCATAGCTTA A.sub.ksT.sub.ksT.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 29 52 T.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.ksA.sub.k 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 15 810 G.sub.dsT.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC G.sub.ksA.sub.ksA.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 11 2800 C.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 1095463 4443 4458 125468 125483 ACTGAGGTATAACTGG A.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.ds 37 392 T.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ksT.sub.esG.sub.ksG.sub.e 1095481 4441 4456 125466 125481 TGAGGTATAACTGGGC T.sub.ksG.sub.ksA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.m 21 1580 C.sub.dsT.sub.dsG.sub.ksG.sub.esG.sub.ks.sup.mC.sub.e 1095482 4442 4457 125467 125482 CTGAGGTATAACTGGG .sup.mC.sub.ksT.sub.ksG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 72 2801 A.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.esG.sub.ksG.sub.e 1095483 4444 4459 125469 125484 CACTGAGGTATAACTG .sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds 101 2802 A.sub.dsT.sub.dsA.sub.dsA.sub.ks.sup.mC.sub.esT.sub.ksG.sub.e 1198198 2524 2539 123549 123564 TGTCTCATGCCTTATA T.sub.ksG.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m 29 2803 C.sub.ds.sup.mC.sub.dsT.sub.esT.sub.esA.sub.esT.sub.ksA.sub.k 1198199 2526 2541 123551 123566 ATTGTCTCATGCCTTA A.sub.ksT.sub.ksT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 38 2804 T.sub.dsG.sub.ds.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.ksA.sub.k 1198200 2527 2542 123552 123567 AATTGTCTCATGCCTT A.sub.ksA.sub.ksT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds 49 2805 A.sub.dsT.sub.dsG.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.ksT.sub.k 1198201 2528 2543 123553 123568 AAATTGTCTCATGCCT A.sub.ksA.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 34 443 C.sub.dsA.sub.dsT.sub.esG.sub.es.sup.mC.sub.es.sup.mC.sub.ksT.sub.k 1198202 2529 2544 123554 123569 GAAATTGTCTCATGCC G.sub.ksA.sub.ksA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 14 2800 C.sub.dsA.sub.esT.sub.esG.sub.es.sup.mC.sub.ks.sup.mC.sub.k 1198203 2530 2545 123555 123570 GGAAATTGTCTCATGC G.sub.ksG.sub.ksA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 19 2806 C.sub.dsT.sub.ds.sup.mC.sub.esA.sub.esT.sub.esG.sub.ks.sup.mC.sub.k 1198204 2531 2546 123556 123571 TGGAAATTGTCTCATG T.sub.ksG.sub.ksG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 31 2807 C.sub.dsT.sub.es.sup.mC.sub.esA.sub.esT.sub.ksG.sub.k 1198205 2532 2547 123557 123572 ATGGAAATTGTCTCAT A.sub.ksT.sub.ksG.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds 64 2808 T.sub.ds.sup.mC.sub.esT.sub.es.sup.mC.sub.esA.sub.ksT.sub.k 1198206 2534 2549 123559 123574 ATATGGAAATTGTCTC A.sub.ksT.sub.ksA.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.ds 43 656 T.sub.dsG.sub.esT.sub.es.sup.mC.sub.esT.sub.ks.sup.mC.sub.k 1198207 2560 2575 123585 123600 AGTATGTGGCAATAAT A.sub.ksG.sub.ksT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.m 91 2809 C.sub.dsA.sub.dsA.sub.esT.sub.esA.sub.esA.sub.ksT.sub.k 1198208 2562 2577 123587 123602 AGAGTATGTGGCAATA A.sub.ksG.sub.ksA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.ds 25 2810 G.sub.ds.sup.mC.sub.esA.sub.esA.sub.esT.sub.ksA.sub.k 1198209 2563 2578 123588 123603 TAGAGTATGTGGCAAT T.sub.ksA.sub.ksG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds 45 2811 G.sub.dsG.sub.es.sup.mC.sub.esA.sub.esA.sub.ksT.sub.k 1198210 2564 2579 123589 123604 TTAGAGTATGTGGCAA T.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ds 28 963 T.sub.dsG.sub.esG.sub.es.sup.mC.sub.esA.sub.ksA.sub.k 1198211 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 19 810 G.sub.dsT.sub.esG.sub.esG.sub.es.sup.mC.sub.ksA.sub.k 1198212 2566 2581 123591 123606 TATTAGAGTATGTGGC T.sub.ksA.sub.ksT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds 17 2812 T.sub.dsG.sub.esT.sub.esG.sub.esG.sub.ks.sup.mC.sub.k 1198213 2567 2582 123592 123607 ATATTAGAGTATGTGG A.sub.ksT.sub.ksA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds 16 2813 A.sub.dsT.sub.esG.sub.esT.sub.esG.sub.ksG.sub.k 1198214 2568 2583 123593 123608 TATATTAGAGTATGTG T.sub.ksA.sub.ksT.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds 91 2814 T.sub.dsA.sub.esT.sub.esG.sub.esT.sub.ksG.sub.k 1198215 2570 2585 123595 123610 TCTATATTAGAGTATG T.sub.ks.sup.mC.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 120 887 A.sub.dsG.sub.esT.sub.esA.sub.esT.sub.ksG.sub.k 1198221 4595 4610 125620 125635 TTACATTAGGAACAAG T.sub.ksT.sub.ksA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.ds 95 2817 A.sub.dsA.sub.es.sup.mC.sub.esA.sub.esA.sub.ksG.sub.k 1198222 4597 4612 125622 125637 TTTTACATTAGGAACA T.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.ds 87 2818 G.sub.dsG.sub.esA.sub.esA.sub.es.sup.mC.sub.ksA.sub.k 1198223 4598 4613 125623 125638 CTTTTACATTAGGAAC .sup.mC.sub.ksT.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds 94 1124 T.sub.dsA.sub.dsG.sub.esG.sub.esA.sub.esA.sub.ks.sup.mC.sub.k 1198224 4599 4614 125624 125639 ACTTTTACATTAGGAA A.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds 74 2819 T.sub.dsT.sub.dsA.sub.esG.sub.esG.sub.esA.sub.ksA.sub.k 1198225 4600 4615 125625 125640 CACTTTTACATTAGGA .sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds 67 1200 A.sub.dsT.sub.dsT.sub.esA.sub.esG.sub.esG.sub.ksA.sub.k 1198226 4601 4616 125626 125641 GCACTTTTACATTAGG G.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.m 23 1276 C.sub.dsA.sub.dsT.sub.esT.sub.esA.sub.esG.sub.ksG.sub.k 1198227 4602 4617 125627 125642 AGCACTTTTACATTAG A.sub.ksG.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds 104 2820 A.sub.ds.sup.mC.sub.dsA.sub.esT.sub.esT.sub.esA.sub.ksG.sub.k 1198228 4603 4618 125628 125643 AAGCACTTTTACATTA A.sub.ksA.sub.ksG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 54 2821 T.sub.dsA.sub.ds.sup.mC.sub.esA.sub.esT.sub.esT.sub.ksA.sub.k 1198229 4605 4620 125630 125645 TTAAGCACTTTTACAT T.sub.ksT.sub.ksA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds 80 2822 T.sub.dsT.sub.dsT.sub.esA.sub.es.sup.mC.sub.esA.sub.ksT.sub.k 1198230 4795 4810 125820 125835 GGAAGATCTGAAACTC G.sub.ksG.sub.ksA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds 81 2823 G.sub.dsA.sub.dsA.sub.esA.sub.es.sup.mC.sub.esT.sub.ks.sup.mC.sub.k 1198231 4797 4812 125822 125837 TTGGAAGATCTGAAAC T.sub.ksT.sub.ksG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.m 73 2824 C.sub.dsT.sub.dsG.sub.esA.sub.esA.sub.esA.sub.ks.sup.mC.sub.k 1198232 4798 4813 125823 125838 TTTGGAAGATCTGAAA T.sub.ksT.sub.ksT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.m 92 2825 C.sub.dsT.sub.esG.sub.esA.sub.esA.sub.ksA.sub.k 1198233 4799 4814 125824 125839 CTTTGGAAGATCTGAA .sup.mC.sub.ksT.sub.ksT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ds 49 2826 A.sub.dsT.sub.ds.sup.mC.sub.esT.sub.esG.sub.esA.sub.ksA.sub.k 1198234 4800 4815 125825 125840 GCTTTGGAAGATCTGA G.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.ds 45 2044 G.sub.dsA.sub.dsT.sub.es.sup.mC.sub.esT.sub.esG.sub.ksA.sub.k 1198235 4801 4816 125826 125841 TGCTTTGGAAGATCTG T.sub.ksG.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.ds 49 2121 G.sub.dsA.sub.esT.sub.es.sup.mC.sub.esT.sub.ksG.sub.k 1198236 4802 4817 125827 125842 GTGCTTTGGAAGATCT G.sub.ksT.sub.ksG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.ds 24 2827 A.sub.dsG.sub.esA.sub.esT.sub.es.sup.mC.sub.ksT.sub.k 1198237 4803 4818 125828 125843 AGTGCTTTGGAAGATC A.sub.ksG.sub.ksT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds 51 2828 G.sub.dsA.sub.dsA.sub.esG.sub.esT.sub.ks.sup.mC.sub.k 1198238 4805 4820 125830 125845 ATAGTGCTTTGGAAGA A.sub.ksT.sub.ksA.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 88 2829 G.sub.dsG.sub.esA.sub.esA.sub.esG.sub.ksA.sub.k 1198239 N/A N/A 94729 94744 AGGATGCATGGTTTTT A.sub.ksG.sub.ksG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds 39 2830 G.sub.dsG.sub.dsT.sub.esT.sub.esT.sub.esT.sub.ksT.sub.k 1198240 N/A N/A 94731 94746 TTAGGATGCATGGTTT T.sub.ksT.sub.ksA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 43 2831 A.sub.dsT.sub.dsG.sub.esG.sub.esT.sub.esT.sub.ksT.sub.k 1198646 4436 4451 125461 125476 TATAACTGGGCAAATT T.sub.ksA.sub.ksT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.ds 80 2815 G.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ksA.sub.esT.sub.ksT.sub.e 1198647 4438 4453 125463 125478 GGTATAACTGGGCAAA G.sub.ksG.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds 47 1427 G.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.esA.sub.ksA.sub.e 1198648 4439 4454 125464 125479 AGGTATAACTGGGCAA A.sub.ksG.sub.ksG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds 43 905 T.sub.dsG.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.esA.sub.ksA.sub.e 1198649 4440 4455 125465 125480 GAGGTATAACTGGGCA G.sub.ksA.sub.ksG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.m 27 1503 C.sub.dsT.sub.dsG.sub.dsG.sub.ksG.sub.es.sup.mC.sub.ksA.sub.e 1198650 4446 4461 125471 125486 AACACTGAGGTATAAC A.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.ds 88 2816 G.sub.dsT.sub.dsA.sub.dsT.sub.Tks+lAesA.sub.ks.sup.mC.sub.e 1198678 N/A N/A 115903 115918 ATATGGTTTTGTGTGT A.sub.ksT.sub.ksA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds 58 2839 G.sub.dsT.sub.dsG.sub.ksT.sub.esG.sub.ksT.sub.e 1198679 N/A N/A 115905 115920 TTATATGGTTTTGTGT T.sub.ksT.sub.ksA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds 54 2840 T.sub.dsT.sub.dsG.sub.ksT.sub.esG.sub.ksT.sub.e 1198680 N/A N/A 115906 115921 CTTATATGGTTTTGTG .sup.mC.sub.ksT.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.ds 28 2788 T.sub.dsT.sub.dsT.sub.ksG.sub.esT.sub.ksG.sub.e 1198681 N/A N/A 115907 115922 TCTTATATGGTTTTGT T.sub.ksC.sub.ksT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.ds 54 2841 T.sub.dsT.sub.dsT.sub.ksT.sub.esG.sub.ksT.sub.e 1198682 N/A N/A 115908 115923 CTCTTATATGGTTTTG .sup.mC.sub.ksT.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ds 25 2842 G.sub.dsG.sub.dsT.sub.dsT.sub.ksT.sub.esT.sub.ksG.sub.e 1198683 N/A N/A 115909 115924 ACTCTTATATGGTTTT A.sub.ks.sup.mC.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.ds 27 2859 T.sub.dsG.sub.dsG.sub.dsT.sub.ksT.sub.esT.sub.ksT.sub.e 1198684 N/A N/A 115910 115925 AACTCTTATATGGTTT A.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.ds 75 2860 A.sub.dsT.sub.dsG.sub.dsG.sub.ksT.sub.esT.sub.ksT.sub.e 1198685 N/A N/A 115911 115926 CAACTCTTATATGGTT .sup.mC.sub.ksA.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ds 70 2861 T.sub.dsA.sub.dsT.sub.dsG.sub.ksG.sub.esT.sub.ksT.sub.e 1198686 N/A N/A 115913 115928 GACAACTCTTATATGG G.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds 78 2862 T.sub.dsA.sub.dsT.sub.dsA.sub.ksT.sub.esG.sub.ksG.sub.e 1198693 N/A N/A 117332 117347 ATGTAATATTGCAATC A.sub.ksT.sub.ksG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.ds 92 2848 G.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.esT.sub.ks.sup.mC.sub.e 1198694 N/A N/A 117333 117348 TATGTAATATTGCAAT T.sub.ksA.sub.ksT.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ds 110 2849 T.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.esA.sub.ksT.sub.e 1198695 N/A N/A 117335 117350 TTTATGTAATATTGCA T.sub.ksT.sub.ksT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.ds 75 2850 A.sub.dsT.sub.dsT.sub.ksG.sub.es.sup.mC.sub.ksA.sub.e 1198696 N/A N/A 117755 117770 TGTATGTCAGAAGAGT T.sub.ksG.sub.ksT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds 12 2863 A.sub.dsA.sub.dsG.sub.ksA.sub.esG.sub.ksT.sub.e 1198697 N/A N/A 117757 117772 AGTGTATGTCAGAAGA A.sub.ksG.sub.ksT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 12 2864 A.sub.dsG.sub.dsA.sub.ksA.sub.esG.sub.ksA.sub.e 1198698 N/A N/A 117758 117773 AAGTGTATGTCAGAAG A.sub.ksA.sub.ksG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 12 2865 C.sub.dsA.sub.dsG.sub.ksA.sub.esA.sub.ksG.sub.e 1198699 N/A N/A 117759 117774 AAAGTGTATGTCAGAA A.sub.ksA.sub.ksA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ds 30 2866 T.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.esA.sub.ksA.sub.e 1198700 N/A N/A 117760 117775 TAAAGTGTATGTCAGA T.sub.ksA.sub.ksA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 26 2867 G.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.esG.sub.ksA.sub.e 1198701 N/A N/A 117761 117776 TTAAAGTGTATGTCAG T.sub.ksT.sub.ksA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.ds 46 2868 T.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.esA.sub.ksG.sub.e 1198702 N/A N/A 117762 117777 TTTAAAGTGTATGTCA T.sub.ksT.sub.ksT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.ds 74 2869 A.sub.dsT.sub.dsG.sub.ksT.sub.es.sup.mC.sub.ksA.sub.e 1198703 N/A N/A 117763 117778 CTTTAAAGTGTATGTC .sup.mC.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.ds 42 1634 T.sub.dsA.sub.dsT.sub.ksG.sub.esT.sub.ks.sup.mC.sub.e 1198704 N/A N/A 117765 117780 AACTTTAAAGTGTATG A.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.ds 72 2870 G.sub.dsT.sub.dsG.sub.dsT.sub.ksA.sub.esT.sub.ksG.sub.e 1198705 N/A N/A 119667 119682 TAAGGTTTCCCAGATT T.sub.ksA.sub.ksA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.m 70 2851 C.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ksA.sub.esT.sub.ksT.sub.e 1198706 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA A.sub.ksG.sub.ksT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.m 39 2852 C.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.esG.sub.ksA.sub.e 1198707 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG A.sub.ksA.sub.ksG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds 31 2853 T.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.esA.sub.ksG.sub.e 1198708 N/A N/A 119671 119686 TAAGTAAGGTTTCCCA T.sub.ksA.sub.ksA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds 34 2854 T.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.es.sup.mC.sub.ksA.sub.e 1198709 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC .sup.mC.sub.ksT.sub.ksA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.ds 29 1101 G.sub.dsT.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.es.sup.mC.sub.ks.sup.mC.sub.e 1198710 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC A.sub.ks.sup.mC.sub.ksT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.ds 51 2855 G.sub.dsG.sub.dsT.sub.dsT.sub.ksT.sub.es.sup.mC.sub.ks.sup.mC.sub.e 1198711 N/A N/A 119674 119689 GACTAAGTAAGGTTTC G.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds 60 2856 A.sub.dsG.sub.dsG.sub.dsT.sub.ksT.sub.esT.sub.ks.sup.mC.sub.e 1198712 N/A N/A 119675 119690 AGACTAAGTAAGGTTT A.sub.ksG.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.ds 110 2857 A.sub.dsA.sub.dsG.sub.dsG.sub.ksT.sub.esT.sub.ksT.sub.e 1198713 N/A N/A 119677 119692 TTAGACTAAGTAAGGT T.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.ds 62 2858 G.sub.dsT.sub.dsA.sub.dsA.sub.ksG.sub.esG.sub.ksT.sub.e
TABLE-US-00043 TABLE 43 Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2 SEQ SEQ ID ID SEQ SEQ NO: 1 NO: 1 ID NO: ID NO: YAP1 SEQ Compound Start Stop 2 Start 2 Stop (% ID Number Site Site Site Site Sequence (5' to 3') CHEMISTRY NOTATION UTC) NO 715487 3630 3645 124655 124670 ATTACTTCATAGCTTA A.sub.ksT.sub.ksT.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 25 52 T.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.ksA.sub.k 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 14 810 G.sub.dsT.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC G.sub.ksA.sub.ksA.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 11 2800 T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 1095575 4443 4458 125468 125483 ACTGAGGTATAACTGG A.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.ds 55 392 T.sub.dsA.sub.dsA.sub.es.sup.mC.sub.esT.sub.esG.sub.ksG.sub.k 1095593 4441 4456 125466 125481 TGAGGTATAACTGGGC T.sub.ksG.sub.ksA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.m 16 1580 C.sub.dsT.sub.esG.sub.esG.sub.esG.sub.ks.sup.mC.sub.k 1095594 4442 4457 125467 125482 CTGAGGTATAACTGGG .sup.mC.sub.ksT.sub.ksG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 27 2801 A.sub.dsA.sub.ds.sup.mC.sub.esT.sub.esG.sub.esG.sub.ksG.sub.k 1095595 4444 4459 125469 125484 CACTGAGGTATAACTG .sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds 63 2802 A.sub.dsT.sub.dsA.sub.esA.sub.es.sup.mC.sub.esT.sub.ksG.sub.k 1198216 4436 4451 125461 125476 TATAACTGGGCAAATT T.sub.ksA.sub.ksT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.ds 89 2815 G.sub.ds.sup.mC.sub.dsA.sub.esA.sub.esA.sub.esT.sub.ksT.sub.k 1198217 4438 4453 125463 125478 GGTATAACTGGGCAAA G.sub.ksG.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds 57 1427 G.sub.dsG.sub.dsG.sub.es.sup.mC.sub.esA.sub.esA.sub.ksA.sub.k 1198218 4439 4454 125464 125479 AGGTATAACTGGGCAA A.sub.ksG.sub.ksG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds 40 905 T.sub.dsG.sub.dsG.sub.esG.sub.es.sup.mC.sub.esA.sub.ksA.sub.k 1198219 4440 4455 125465 125480 GAGGTATAACTGGGCA G.sub.ksA.sub.ksG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.m 22 1503 C.sub.dsT.sub.dsG.sub.esG.sub.esG.sub.es.sup.mC.sub.ksA.sub.k 1198220 4446 4461 125471 125486 AACACTGAGGTATAAC A.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.ds 89 2816 G.sub.dsT.sub.dsA.sub.esT.sub.esA.sub.esA.sub.ks.sup.mC.sub.k 1198241 N/A N/A 94732 94747 TTTAGGATGCATGGTT T.sub.ksT.sub.ksT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m 32 2832 C.sub.dsA.sub.dsT.sub.esG.sub.esG.sub.esT.sub.ksT.sub.k 1198242 N/A N/A 94733 94748 ATTTAGGATGCATGGT A.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m 47 2833 C.sub.dsA.sub.esT.sub.esG.sub.esG.sub.ksT.sub.k 1198243 N/A N/A 94734 94749 GATTTAGGATGCATGG G.sub.ksA.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.ds 8 2834 G.sub.ds.sup.mC.sub.esA.sub.esT.sub.esG.sub.ksG.sub.k 1198244 N/A N/A 94735 94750 AGATTTAGGATGCATG A.sub.ksG.sub.ksA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds 24 2835 T.sub.dsG.sub.es.sup.mC.sub.esA.sub.esT.sub.ksG.sub.k 1198245 N/A N/A 94736 94751 CAGATTTAGGATGCAT .sup.mC.sub.ksA.sub.ksG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 46 2836 G.sub.dsA.sub.dsT.sub.esG.sub.es.sup.mC.sub.esA.sub.ksT.sub.k 1198246 N/A N/A 94737 94752 TCAGATTTAGGATGCA T.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds 30 2837 G.sub.dsG.sub.dsA.sub.esT.sub.esG.sub.es.sup.mC.sub.ksA.sub.k 1198247 N/A N/A 94739 94754 ATTCAGATTTAGGATG A.sub.ksT.sub.ksT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.ds 99 2838 A.sub.dsG.sub.esG.sub.esA.sub.esT.sub.ksG.sub.k 1198248 N/A N/A 115903 115918 ATATGGTTTTGTGTGT A.sub.ksT.sub.ksA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds 64 2839 G.sub.dsT.sub.esG.sub.esT.sub.esG.sub.ksT.sub.k 1198249 N/A N/A 115905 115920 TTATATGGTTTTGTGT T.sub.ksT.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds 42 2840 T.sub.dsT.sub.esG.sub.esT.sub.esG.sub.ksT.sub.k 1198250 N/A N/A 115906 115921 CTTATATGGTTTTGTG .sup.mC.sub.ksT.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.ds 50 2788 T.sub.dsT.sub.esT.sub.esG.sub.esT.sub.ksG.sub.k 1198251 N/A N/A 115907 115922 TCTTATATGGTTTTGT T.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.ds 83 2841 T.sub.dsT.sub.esT.sub.esT.sub.esG.sub.ksT.sub.k 1198252 N/A N/A 115908 115923 CTCTTATATGGTTTTG .sup.mC.sub.ksT.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ds 26 2842 G.sub.dsG.sub.dsT.sub.esT.sub.esT.sub.esT.sub.ksG.sub.k 1198253 N/A N/A 115909 115924 ACTCTTATATGGTTTT A.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.ds 50 2859 T.sub.dsG.sub.dsG.sub.esT.sub.esT.sub.esT.sub.ksT.sub.k 119825 4 N/A N/A 115910 115925 AACTCTTATATGGTTT A.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.ds 95 2860 A.sub.dsT.sub.dsG.sub.esG.sub.esT.sub.esT.sub.ksT.sub.k 1198255 N/A N/A 115911 115926 CAACTCTTATATGGTT .sup.mC.sub.ksA.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ds 84 2861 T.sub.dsA.sub.dsT.sub.esG.sub.esG.sub.esT.sub.ksT.sub.k 1198256 N/A N/A 115913 115928 GACAACTCTTATATGG G.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds 78 2862 T.sub.dsA.sub.dsT.sub.esA.sub.esT.sub.esG.sub.ksG.sub.k 1198257 N/A N/A 117325 117340 ATTGCAATCTGTCTGA A.sub.ksT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds 85 2843 T.sub.dsG.sub.dsT.sub.es.sup.mC.sub.esT.sub.esG.sub.ksA.sub.k 1198258 N/A N/A 117327 117342 ATATTGCAATCTGTCT A.sub.ksT.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds 52 2844 T.sub.ds.sup.mC.sub.dsT.sub.esG.sub.esT.sub.es.sup.mC.sub.ksT.sub.k 1198259 N/A N/A 117328 117343 AATATTGCAATCTGTC A.sub.ksA.sub.ksT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds 51 2845 A.sub.dsT.sub.ds.sup.mC.sub.esT.sub.esG.sub.esT.sub.ks.sup.mC.sub.k 1198260 N/A N/A 117329 117344 TAATATTGCAATCTGT T.sub.ksA.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 106 2846 A.sub.dsA.sub.dsT.sub.es.sup.mC.sub.esT.sub.esG.sub.ksT.sub.k 1198261 N/A N/A 117330 117345 GTAATATTGCAATCTG G.sub.ksT.sub.ksA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.m 54 1404 C.sub.dsA.sub.dsA.sub.esT.sub.es.sup.mC.sub.esT.sub.ksG.sub.k 1198262 N/A N/A 117331 117346 TGTAATATTGCAATCT T.sub.ksG.sub.ksT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.m 114 2847 C.sub.dsA.sub.esA.sub.esT.sub.es.sup.mC.sub.ksT.sub.k 1198263 N/A N/A 117332 117347 ATGTAATATTGCAATC A.sub.ksT.sub.ksG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.ds 114 2848 G.sub.ds.sup.mC.sub.esA.sub.esA.sub.esT.sub.ks.sup.mC.sub.k 1198264 N/A N/A 117333 117348 TATGTAATATTGCAAT T.sub.ksA.sub.ksT.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ds 73 2849 T.sub.dsG.sub.es.sup.mC.sub.esA.sub.esA.sub.ksT.sub.k 1198265 N/A N/A 117335 117350 TTTATGTAATATTGCA T.sub.ksT.sub.ksT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.ds 111 2850 A.sub.dsT.sub.esT.sub.esG.sub.es.sup.mC.sub.ksA.sub.k 1198266 N/A N/A 117755 117770 TGTATGTCAGAAGAGT T.sub.ksG.sub.ksT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 25 2863 G.sub.dsA.sub.dsA.sub.esG.sub.esA.sub.esG.sub.ksT.sub.k 1198267 N/A N/A 117757 117772 AGTGTATGTCAGAAGA A.sub.ksG.sub.ksT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 7 2864 C.sub.dsA.sub.dsG.sub.esA.sub.esA.sub.esG.sub.ksA.sub.k 1198268 N/A N/A 117758 117773 AAGTGTATGTCAGAAG A.sub.ksA.sub.ksG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 11 2865 C.sub.dsA.sub.esG.sub.esA.sub.esA.sub.ksG.sub.k 1198269 N/A N/A 117759 117774 AAAGTGTATGTCAGAA A.sub.ksA.sub.ksA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ds 58 2866 T.sub.ds.sup.mC.sub.esA.sub.esG.sub.esA.sub.ksA.sub.k 1198270 N/A N/A 117760 117775 TAAAGTGTATGTCAGA T.sub.ksA.sub.ksA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 52 2867 G.sub.dsT.sub.es.sup.mC.sub.esA.sub.esG.sub.ksA.sub.k 1198271 N/A N/A 117761 117776 TTAAAGTGTATGTCAG T.sub.ksT.sub.ksA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.ds 44 2868 T.sub.dsG.sub.esT.sub.es.sup.mCesA.sub.ksG.sub.k 1198272 N/A N/A 117762 117777 TTTAAAGTGTATGTCA T.sub.ksT.sub.ksT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.ds 37 2869 A.sub.dsT.sub.esG.sub.esT.sub.es.sup.mC.sub.ksA.sub.k 1198273 N/A N/A 117763 117778 CTTTAAAGTGTATGTC .sup.mC.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.ds 52 1634 G.sub.dsT.sub.dsA.sub.esT.sub.esG.sub.esT.sub.ks.sup.mC.sub.k 1198274 N/A N/A 117765 117780 AACTTTAAAGTGTATG A.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.ds 69 2870 G.sub.dsT.sub.dsG.sub.esT.sub.esA.sub.esT.sub.ksG.sub.k 1198275 N/A N/A 119667 119682 TAAGGTTTCCCAGATT T.sub.ksA.sub.ksA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.m 52 2851 C.sub.ds.sup.mC.sub.dsA.sub.esG.sub.esA.sub.esT.sub.ksT.sub.k 1198276 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA A.sub.ksG.sub.ksT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.m 52 2852 C.sub.ds.sup.mC.sub.es.sup.mC.sub.esA.sub.esG.sub.ksA.sub.k 1198277 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG A.sub.ksA.sub.ksG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds 32 2853 T.sub.ds.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.esA.sub.ksG.sub.k 1198278 N/A N/A 119671 119686 TAAGTAAGGTTTCCCA T.sub.ksA.sub.ksA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds 43 2854 T.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.ksA.sub.k 1198279 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC .sup.mC.sub.ksT.sub.ksA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.ds 43 1101 G.sub.dsT.sub.dsT.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub.ks.sup.mC.sub.k 1198280 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC A.sub.ks.sup.mC.sub.ksT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.ds 40 2855 G.sub.dsG.sub.dsT.sub.esT.sub.esT.sub.es.sup.mC.sub.ks.sup.mC.sub.k 1198281 N/A N/A 119674 119689 GACTAAGTAAGGTTTC G.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds 71 2856 A.sub.dsG.sub.dsG.sub.esT.sub.esT.sub.esT.sub.ks.sup.mC.sub.k 1198282 N/A N/A 119675 119690 AGACTAAGTAAGGTTT A.sub.ksG.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.ds 58 2857 A.sub.dsA.sub.dsG.sub.esG.sub.esT.sub.esT.sub.ksT.sub.k 1198283 N/A N/A 119677 119692 TTAGACTAAGTAAGGT T.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.ds 99 2858 G.sub.dsT.sub.dsA.sub.esA.sub.esG.sub.esG.sub.ksT.sub.k 1198456 2524 2539 123549 123564 TGTCTCATGCCTTATA T.sub.ksG.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m 21 2803 C.sub.ds.sup.mC.sub.dsT.sub.esT.sub.ksA.sub.esT.sub.ksA.sub.e 1198457 2526 2541 123551 123566 ATTGTCTCATGCCTTA A.sub.ksT.sub.ksT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 18 2804 T.sub.dsG.sub.ds.sup.mC.sub.es.sup.mC.sub.ksT.sub.esT.sub.ksA.sub.e 1198458 2527 2542 123552 123567 AATTGTCTCATGCCTT A.sub.ksA.sub.ksT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds 30 2805 A.sub.dsT.sub.dsG.sub.es.sup.mC.sub.ks.sup.mC.sub.esT.sub.ksT.sub.e 1198459 2528 2543 123553 123568 AAATTGTCTCATGCCT A.sub.ksA.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 28 443 C.sub.dsA.sub.dsT.sub.esG.sub.ks.sup.mC.sub.es.sup.mC.sub.ksT.sub.e 1198460 2529 2544 123554 123569 GAAATTGTCTCATGCC G.sub.ksA.sub.ksA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 17 2800 T.sub.ds.sup.mC.sub.dsA.sub.esT.sub.ksG.sub.es.sup.mC.sub.ks.sup.mC.sub.e 1198461 2530 2545 123555 123570 GGAAATTGTCTCATGC G.sub.ksG.sub.ksA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 24 2806 C.sub.dsT.sub.ds.sup.mC.sub.esA.sub.ksT.sub.esG.sub.ks.sup.mC.sub.e 1198462 2531 2546 123556 123571 TGGAAATTGTCTCATG T.sub.ksG.sub.ksG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 27 2807 C.sub.dsT.sub.es.sup.mC.sub.ksA.sub.esT.sub.ksG.sub.e 1198463 2532 2547 123557 123572 ATGGAAATTGTCTCAT A.sub.ksT.sub.ksG.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds 59 2808 T.sub.ds.sup.mC.sub.esT.sub.ks.sup.mC.sub.esA.sub.ksT.sub.e 1198464 2534 2549 123559 123574 ATATGGAAATTGTCTC A.sub.ksT.sub.ksA.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.ds 41 656 T.sub.dsG.sub.esT.sub.ks.sup.mC.sub.esT.sub.ks.sup.mC.sub.e 1198465 2560 2575 123585 123600 AGTATGTGGCAATAAT A.sub.ksG.sub.ksT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.m 68 2809 C.sub.dsA.sub.dsA.sub.esT.sub.ksA.sub.esA.sub.ksT.sub.e 1198466 2562 2577 123587 123602 AGAGTATGTGGCAATA A.sub.ksG.sub.ksA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.ds 12 2810 G.sub.ds.sup.mC.sub.esA.sub.ksA.sub.esT.sub.ksA.sub.e 1198467 2563 2578 123588 123603 TAGAGTATGTGGCAAT T.sub.ksA.sub.ksG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds 27 2811 G.sub.dsG.sub.es.sup.mC.sub.ksA.sub.esA.sub.ksT.sub.e 1198468 2564 2579 123589 123604 TTAGAGTATGTGGCAA T.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ds 22 963 T.sub.dsG.sub.esG.sub.ks.sup.mC.sub.esAlcsA.sub.e 1198469 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 23 810 G.sub.dsT.sub.esG.sub.ksG.sub.es.sup.mC.sub.ksA.sub.e 1198470 2566 2581 123591 123606 TATTAGAGTATGTGGC T.sub.ksA.sub.ksT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds 17 2812 T.sub.dsG.sub.esT.sub.ksG.sub.esG.sub.ks.sup.mC.sub.e 1198471 2567 2582 123592 123607 ATATTAGAGTATGTGG A.sub.ksT.sub.ksA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds 21 2813 A.sub.dsT.sub.esG.sub.ksT.sub.esG.sub.ksG.sub.e 1198472 2568 2583 123593 123608 TATATTAGAGTATGTG T.sub.ksA.sub.ksT.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds 60 2814 T.sub.dsA.sub.esT.sub.ksG.sub.esT.sub.ksG.sub.e 1198473 2570 2585 123595 123610 TCTATATTAGAGTATG T.sub.kshu mC.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 66 887 A.sub.dsG.sub.esT.sub.ksA.sub.esT.sub.ksG.sub.e 1198479 4595 4610 125620 125635 TTACATTAGGAACAAG T.sub.ksT.sub.ksA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 65 2817 G.sub.dsA.sub.dsA.sub.es.sup.mC.sub.ksA.sub.esA.sub.ksG.sub.e 1198480 4597 4612 125622 125637 TTTTACATTAGGAACA T.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.ds 75 2818 G.sub.dsG.sub.esA.sub.ksA.sub.es.sup.mC.sub.ksA.sub.e 1198481 4598 4613 125623 125638 CTTTTACATTAGGAAC .sup.mC.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds 72 1124 T.sub.dsA.sub.dsG.sub.esG.sub.ksA.sub.esA.sub.ks.sup.mC.sub.e 1198482 4599 4614 125624 125639 ACTTTTACATTAGGAA A.sub.ks.sup.mX.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds 63 2819 T.sub.dsT.sub.dsA.sub.esG.sub.ksG.sub.esA.sub.ksA.sub.e 1198483 4600 4615 125625 125640 CACTTTTACATTAGGA .sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds 31 1200 A.sub.dsT.sub.dsT.sub.esA.sub.ksG.sub.esG.sub.ksA.sub.e 1198484 4601 4616 125626 125641 GCACTTTTACATTAGG G.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.m 18 1276 C.sub.dsA.sub.dsT.sub.esT.sub.ksA.sub.esG.sub.ksG.sub.e 1198485 4602 4617 125627 125642 AGCACTTTTACATTAG A.sub.ksG.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds 64 2820 A.sub.ds.sup.mC.sub.dsA.sub.esT.sub.ksT.sub.esA.sub.ksG.sub.e
TABLE-US-00044 TABLE 44 Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2 SEQ SEQ ID ID SEQ SEQ NO: 1 NO: 1 ID NO: ID NO: YAP1 SEQ Compound Start Stop 2 Start 2 Stop (% ID Number Site Site Site Site Sequence (5' to 3') CHEMISTRY NOTATION UTC) NO 715487 3630 3645 124655 124670 ATTACTTCATAGCTTA A.sub.ksT.sub.ksT.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds 18 52 A.sub.dsT.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.ksA.sub.k 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds 9 810 T.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC G.sub.ksA.sub.ksA.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 7 2800 T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 1095603 4443 4458 125468 125483 ACTGAGGTATAACTGG A.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds 29 2872 A.sub.dsT.sub.dsA.sub.dsA.sub.es.sup.mC.sub.ksT.sub.esG.sub.ksG.sub.e 1095621 4441 4456 125466 125481 TGAGGTATAACTGGGC T.sub.ksG.sub.ksA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.ds 22 1580 A.sub.ds.sup.mC.sub.dsT.sub.esG.sub.ksG.sub.esG.sub.ks.sup.mC.sub.e 1095622 4442 4457 125467 125482 CTGAGGTATAACTGGG .sup.mC.sub.ksT.sub.ksG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 44 2801 A.sub.dsA.sub.ds.sup.mC.sub.esT.sub.ksG.sub.esG.sub.ksG.sub.e 1095623 4444 4459 125469 125484 CACTGAGGTATAACTG .sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.ds 57 2802 T.sub.dsA.sub.dsT.sub.dsA.sub.esA.sub.ks.sup.mC.sub.esT.sub.ksG.sub.e 1198474 4436 4451 125461 125476 TATAACTGGGCAAATT T.sub.ksA.sub.ksT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.ds 68 2815 G.sub.ds.sup.mC.sub.dsA.sub.esA.sub.ksA.sub.esT.sub.ksT.sub.e 1198475 4438 4453 125463 125478 GGTATAACTGGGCAAA G.sub.ksG.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds 25 1427 G.sub.dsG.sub.dsG.sub.es.sup.mC.sub.ksA.sub.esA.sub.ksA.sub.e 1198476 4439 4454 125464 125479 AGGTATAACTGGGCAA A.sub.ksG.sub.ksG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.m 31 905 C.sub.dsT.sub.dsG.sub.dsG.sub.esG.sub.ks.sup.mC.sub.esA.sub.ksA.sub.e 1198477 4440 4455 125465 125480 GAGGTATAACTGGGCA G.sub.ksA.sub.ksG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.m 47 1503 C.sub.dsT.sub.dsG.sub.esG.sub.ksG.sub.es.sup.mC.sub.ksA.sub.e 1198478 4446 4461 125471 125486 AACACTGAGGTATAAC A.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.ds 60 2816 G.sub.dsG.sub.dsT.sub.dsA.sub.esT.sub.ksA.sub.esA.sub.ks.sup.mC.sub.e 1198486 4603 4618 125628 125643 AAGCACTTTTACATTA A.sub.ksA.sub.ksG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds 39 2821 T.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.esA.sub.ksT.sub.esT.sub.ksA.sub.e 1198487 4605 4620 125630 125645 TTAAGCACTTTTACAT T.sub.ksT.sub.ksA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds 62 2822 T.sub.dsT.sub.dsT.sub.dsT.sub.esA.sub.ks.sup.mC.sub.esA.sub.ksT.sub.e 1198488 4795 4810 125820 125835 GGAAGATCTGAAACTC G.sub.ksG.sub.ksA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds 66 2823 T.sub.dsG.sub.dsA.sub.dsA.sub.esA.sub.ks.sup.mC.sub.esT.sub.ks.sup.mC.sub.e 1198489 4797 4812 125822 125837 TTGGAAGATCTGAAAC T.sub.ksT.sub.ksG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.m 50 2824 C.sub.dsT.sub.dsG.sub.esA.sub.ksA.sub.esA.sub.ks.sup.mC.sub.e 1198490 4798 4813 125823 125838 TTTGGAAGATCTGAAA T.sub.ksT.sub.ksT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ds 53 2825 T.sub.ds.sup.mC.sub.dsT.sub.esG.sub.ksA.sub.esA.sub.ksA.sub.e 1198491 4799 4814 125824 125839 CTTTGGAAGATCTGAA .sup.mC.sub.ksT.sub.ksT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ds 22 2826 A.sub.dsT.sub.ds.sup.mC.sub.esT.sub.ksG.sub.esA.sub.ksA.sub.e 1198492 4800 4815 125825 125840 GCTTTGGAAGATCTGA G.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.ds 15 2044 G.sub.dsA.sub.dsT.sub.es.sup.mC.sub.ksT.sub.esG.sub.ksA.sub.e 1198493 4801 4816 125826 125841 TGCTTTGGAAGATCTG T.sub.ksG.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.ds 28 2121 A.sub.dsG.sub.dsA.sub.esT.sub.ks.sup.mC.sub.esT.sub.ksG.sub.e 1198494 4802 4817 125827 125842 GTGCTTTGGAAGATCT G.sub.ksT.sub.ksG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds 15 2827 A.sub.dsA.sub.dsG.sub.esA.sub.ksT.sub.es.sup.mC.sub.ksT.sub.e 1198495 4803 4818 125828 125843 AGTGCTTTGGAAGATC A.sub.ksG.sub.ksT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.ds 22 2828 G.sub.dsA.sub.dsA.sub.esG.sub.ksA.sub.esT.sub.ks.sup.mC.sub.e 1198496 4805 4820 125830 125845 ATAGTGCTTTGGAAGA A.sub.ksT.sub.ksA.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds 46 2891 T.sub.dsG.sub.dsG.sub.esA.sub.ksA.sub.esG.sub.ksA.sub.e 1198497 N/A N/A 94729 94744 AGGATGCATGGTTTTT A.sub.ksG.sub.ksG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds 22 2830 T.sub.dsG.sub.dsG.sub.dsT.sub.esT.sub.ksT.sub.esT.sub.ksT.sub.e 1198498 N/A N/A 94731 94746 TTAGGATGCATGGTTT T.sub.ksT.sub.ksA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 39 2831 A.sub.dsT.sub.dsG.sub.esG.sub.ksT.sub.esT.sub.ksT.sub.e 1198499 N/A N/A 94732 94747 TTTAGGATGCATGGTT T.sub.ksT.sub.ksT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m 13 2832 C.sub.dsA.sub.dsT.sub.esG.sub.ksG.sub.esT.sub.ksT.sub.e 1198500 N/A N/A 94733 94748 ATTTAGGATGCATGGT A.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.ds 17 2833 G.sub.ds.sup.mC.sub.dsA.sub.esT.sub.ksG.sub.esG.sub.ksT.sub.e 1198501 N/A N/A 94734 94749 GATTTAGGATGCATGG G.sub.ksA.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds 5 2834 T.sub.dsG.sub.ds.sup.mC.sub.esA.sub.ksT.sub.esG.sub.ksG.sub.e 1198502 N/A N/A 94735 94750 AGATTTAGGATGCATG A.sub.ksG.sub.ksA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.ds 16 2835 A.sub.dsT.sub.dsG.sub.es.sup.mC.sub.ksA.sub.esT.sub.ksG.sub.e 1198503 N/A N/A 94736 94751 CAGATTTAGGATGCAT .sup.mC.sub.ksA.sub.ksG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 31 2836 G.sub.dsA.sub.dsT.sub.esG.sub.ks.sup.mC.sub.esA.sub.ksT.sub.e 1198504 N/A N/A 94737 94752 TCAGATTTAGGATGCA T.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds 15 2837 G.sub.dsG.sub.dsA.sub.esT.sub.ksG.sub.es.sup.mC.sub.ksA.sub.e 1198505 N/A N/A 94739 94754 ATTCAGATTTAGGATG A.sub.ksT.sub.ksT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.ds 73 2838 T.sub.dsA.sub.dsG.sub.esG.sub.ksA.sub.esT.sub.ksG.sub.e 1198506 N/A N/A 115903 115918 ATATGGTTTTGTGTGT A.sub.ksT.sub.ksA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ds 47 2839 T.sub.dsG.sub.dsT.sub.esG.sub.ksT.sub.esG.sub.ksT.sub.e 1198507 N/A N/A 115905 115920 TTATATGGTTTTGTGT T.sub.ksT.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.ds 17 2840 T.sub.dsT.sub.dsT.sub.esG.sub.ksT.sub.esG.sub.ksT.sub.e 1198508 N/A N/A 115906 115921 CTTATATGGTTTTGTG .sup.mC.sub.ksT.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.ds 22 2788 T.sub.dsT.sub.dsT.sub.esT.sub.ksG.sub.esT.sub.ksG.sub.e 1198509 N/A N/A 115907 115922 TCTTATATGGTTTTGT T.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ds 20 2841 G.sub.dsT.sub.dsT.sub.esT.sub.ksT.sub.esG.sub.ksT.sub.e 1198510 N/A N/A 115908 115923 CTCTTATATGGTTTTG .sup.mC.sub.ksT.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.ds 8 2842 T.sub.dsG.sub.dsG.sub.dsT.sub.esT.sub.ksT.sub.esT.sub.ksG.sub.e 1198511 N/A N/A 115909 115924 ACTCTTATATGGTTTT A.sub.ks.sup.mC.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.ds 53 2859 A.sub.dsT.sub.dsG.sub.dsG.sub.esT.sub.ksT.sub.esT.sub.ksT.sub.e 1198512 N/A N/A 115910 115925 AACTCTTATATGGTTT A.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ds 62 2860 T.sub.dsA.sub.dsT.sub.dsG.sub.esG.sub.ksT.sub.esT.sub.ksT.sub.e 1198513 N/A N/A 115911 115926 CAACTCTTATATGGTT .sup.mC.sub.ksA.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds 63 2861 A.sub.dsT.sub.dsA.sub.dsT.sub.esG.sub.ksG.sub.esT.sub.ksT.sub.e 1198514 N/A N/A 115913 115928 GACAACTCTTATATGG G.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds 53 2862 T.sub.dsT.sub.dsA.sub.dsT.sub.esA.sub.ksT.sub.esG.sub.ksG.sub.e 1198515 N/A N/A 117325 117340 ATTGCAATCTGTCTGA A.sub.ksT.sub.ksT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.m 44 2843 C.sub.dsT.sub.dsG.sub.dsT.sub.es.sup.mC.sub.ksT.sub.esG.sub.ksA.sub.e 1198516 N/A N/A 117327 117342 ATATTGCAATCTGTCT A.sub.ksT.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds 50 2844 T.sub.ds.sup.mC.sub.dsT.sub.esG.sub.ksT.sub.es.sup.mC.sub.ksT.sub.e 1198517 N/A N/A 117328 117343 AATATTGCAATCTGTC A.sub.ksA.sub.ksT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds 36 2845 A.sub.dsT.sub.ds.sup.mC.sub.esT.sub.ksG.sub.esT.sub.ks.sup.mC.sub.e 1198518 N/A N/A 117329 117344 TAATATTGCAATCTGT T.sub.ksA.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 71 2846 A.sub.dsA.sub.dsT.sub.es.sup.mC.sub.ksT.sub.esG.sub.ksT.sub.e 1198519 N/A N/A 117330 117345 GTAATATTGCAATCTG G.sub.ksT.sub.ksA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.m 20 1404 C.sub.dsA.sub.dsA.sub.esT.sub.ks.sup.mC.sub.esT.sub.ksG.sub.e 1198520 N/A N/A 117331 117346 TGTAATATTGCAATCT T.sub.ksG.sub.ksT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.ds 51 2847 G.sub.ds.sup.mC.sub.dsA.sub.esA.sub.ksT.sub.es.sup.mC.sub.ksT.sub.e 1198521 N/A N/A 117332 117347 ATGTAATATTGCAATC A.sub.ksT.sub.ksG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ds 44 2848 T.sub.dsG.sub.ds.sup.mC.sub.esA.sub.ksA.sub.esT.sub.ks.sup.mC.sub.e 1198522 N/A N/A 117333 117348 TATGTAATATTGCAAT T.sub.ksA.sub.ksT.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.ds 37 2849 T.sub.dsT.sub.dsG.sub.es.sup.mC.sub.ksA.sub.esA.sub.ksT.sub.e 1198523 N/A N/A 117335 117350 TTTATGTAATATTGCA T.sub.ksT.sub.ksT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.ds 93 2850 T.sub.dsA.sub.dsT.sub.esT.sub.ksG.sub.es.sup.mC.sub.ksA.sub.e 1198524 N/A N/A 117755 117770 TGTATGTCAGAAGAGT T.sub.ksG.sub.ksT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 3 2863 G.sub.dsA.sub.dsA.sub.esG.sub.ksA.sub.esG.sub.ksT.sub.e 1198525 N/A N/A 117757 117772 AGTGTATGTCAGAAGA A.sub.ksG.sub.ksT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 2 2864 C.sub.dsA.sub.dsG.sub.esA.sub.ksA.sub.esG.sub.ksA.sub.e 1198526 N/A N/A 117758 117773 AAGTGTATGTCAGAAG A.sub.ksA.sub.ksG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ds 2 2865 T.sub.ds.sup.mC.sub.dsA.sub.esG.sub.ksA.sub.esA.sub.ksG.sub.e 1198527 N/A N/A 117759 117774 AAAGTGTATGTCAGAA A.sub.ksA.sub.ksA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 5 2866 G.sub.dsT.sub.ds.sup.mC.sub.esA.sub.ksG.sub.esA.sub.ksA.sub.e 1198528 N/A N/A 117760 117775 TAAAGTGTATGTCAGA T.sub.ksA.sub.ksA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.ds 14 2867 T.sub.dsG.sub.dsT.sub.es.sup.mC.sub.ksA.sub.esG.sub.ksA.sub.e 1198529 N/A N/A 117761 117776 TTAAAGTGTATGTCAG T.sub.ksT.sub.ksA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.ds 17 2868 A.sub.dsT.sub.dsG.sub.esT.sub.ks.sup.mC.sub.esA.sub.ksG.sub.e 1198530 N/A N/A 117762 117777 TTTAAAGTGTATGTCA T.sub.ksT.sub.ksT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.ds 29 2869 T.sub.dsA.sub.dsT.sub.esG.sub.ksT.sub.es.sup.mC.sub.ksA.sub.e 1198531 N/A N/A 117763 117778 CTTTAAAGTGTATGTC .sup.mC.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.ds 21 1634 G.sub.dsT.sub.dsA.sub.esT.sub.ksG.sub.esT.sub.ks.sup.mC.sub.e 1198532 N/A N/A 117765 117780 AACTTTAAAGTGTATG A.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.ds 36 2870 G.sub.dsT.sub.dsG.sub.esT.sub.ksA.sub.esT.sub.ksG.sub.e 1198533 N/A N/A 119667 119682 TAAGGTTTCCCAGATT T.sub.ksA.sub.ksA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.m 35 2851 C.sub.ds.sup.mC.sub.dsA.sub.esG.sub.ksA.sub.esT.sub.ksT.sub.e 1198534 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA A.sub.ksG.sub.ksT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds 30 2852 T.sub.ds.sup.mC.sub.ds.sup.mC.sub.es.sup.mC.sub.ksA.sub.esG.sub.ksA.sub.e 1198535 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG A.sub.ksA.sub.ksG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds 35 2853 T.sub.dsT.sub.ds.sup.mC.sub.es.sup.mC.sub.ks.sup.mC.sub.esA.sub.ksG.sub.e 1198536 N/A N/A 119671 119686 TAAGTAAGGTTTCCCA T.sub.ksA.sub.ksA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.ds 20 2854 T.sub.dsT.sub.dsT.sub.es.sup.mC.sub.ks.sup.mC.sub.es.sup.mC.sub.ksA.sub.e 1198537 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC .sup.mC.sub.ksT.sub.ksA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.ds 24 1101 G.sub.dsG.sub.dsT.sub.dsT.sub.esT.sub.ks.sup.mC.sub.es.sup.mC.sub.ks.sup.mC.sub.e 1198538 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC A.sub.ks.sup.mC.sub.ksT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds 29 2855 A.sub.dsG.sub.dsG.sub.dsT.sub.esT.sub.ksT.sub.es.sup.mC.sub.ks.sup.mC.sub.e 1198539 N/A N/A 119674 119689 GACTAAGTAAGGTTTC G.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.ds 54 2856 A.sub.dsA.sub.dsG.sub.dsG.sub.esT.sub.ksT.sub.esT.sub.ks.sup.mC.sub.e 1198540 N/A N/A 119675 119690 AGACTAAGTAAGGTTT A.sub.ksG.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.ds 51 2857 T.sub.dsA.sub.dsA.sub.dsG.sub.esG.sub.ksT.sub.esT.sub.ksT.sub.e 1198541 N/A N/A 119677 119692 TTAGACTAAGTAAGGT T.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.ds 34 2858 G.sub.dsT.sub.dsA.sub.esA.sub.ksG.sub.esG.sub.ksT.sub.e 1198890 2524 2539 123549 123564 TGTCTCATGCCTTATA T.sub.ksG.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds 19 2803 G.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.dsA.sub.ksT.sub.dsA.sub.k 1198891 2526 2541 123551 123566 ATTGTCTCATGCCTTA A.sub.ksT.sub.ksT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds 18 2804 A.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ks.sup.mC.sub.dsT.sub.ksT.sub.dsA.sub.k 1198892 2527 2542 123552 123567 AATTGTCTCATGCCTT A.sub.ksA.sub.ksT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 24 2805 C.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ds.sup.mC.sub.ksT.sub.dsT.sub.k 1198899 2560 2575 123585 123600 AGTATGTGGCAATAAT A.sub.ksG.sub.ksT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.m 75 2809 C.sub.dsA.sub.dsA.sub.ksT.sub.dsA.sub.ksA.sub.dsT.sub.k 1198900 2562 2577 123587 123602 AGAGTATGTGGCAATA A.sub.ksG.sub.ksA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds 11 2810 G.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.dsA.sub.ksT.sub.dsA.sub.k 1198901 2563 2578 123588 123603 TAGAGTATGTGGCAAT T.sub.ksA.sub.ksG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ds 28 2811 T.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.dsA.sub.ksA.sub.dsT.sub.k 1198902 2564 2579 123589 123604 TTAGAGTATGTGGCAA T.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 13 963 G.sub.dsT.sub.dsG.sub.ksG.sub.ds.sup.mC.sub.ksA.sub.dsA.sub.k 1198903 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds 24 810 T.sub.dsG.sub.dsT.sub.ksG.sub.dsG.sub.ks.sup.mC.sub.dsA.sub.k 1198904 2566 2581 123591 123606 TATTAGAGTATGTGGC T.sub.ksA.sub.ksT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds 12 2812 A.sub.dsT.sub.dsG.sub.ksT.sub.dsG.sub.ksG.sub.ds.sup.mC.sub.k 1198905 2567 2582 123592 123607 ATATTAGAGTATGTGG A.sub.ksT.sub.ksA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds 5 2813 T.sub.dsA.sub.dsT.sub.ksG.sub.dsT.sub.ksG.sub.dsG.sub.k 1198906 2568 2583 123593 123608 TATATTAGAGTATGTG T.sub.ksA.sub.ksT.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.ds 56 2814 G.sub.dsT.sub.dsA.sub.ksT.sub.dsG.sub.ksT.sub.dsG.sub.k 1198907 2570 2585 123595 123610 TCTATATTAGAGTATG T.sub.ks.sup.mC.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.ds 74 887 G.sub.dsA.sub.dsG.sub.ksT.sub.dsA.sub.ksT.sub.dsG.sub.k
TABLE-US-00045 TABLE 45 Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2 SEQ SEQ ID ID SEQ SEQ NO: 1 NO: 1 ID NO: ID NO: YAP1 SEQ Compound Start Stop 2 Start 2 Stop (% ID Number Site Site Site Site Sequence (5' to 3') CHEMISTRY NOTATION UTC) NO 715487 3630 3645 124655 124670 ATTACTTCATAGCTTA A.sub.ksT.sub.ksT.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 28 52 T.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.ksA.sub.k 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 15 810 G.sub.dsT.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC G.sub.ksA.sub.ksA.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 9 2800 T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 1095491 4443 4458 125468 125483 ACTGAGGTATAACTGG A.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.ds 65 392 T.sub.dsA.sub.dsA.sub.ks.sup.mC.sub.dsT.sub.ksG.sub.dsG.sub.k 1095509 4441 4456 125466 125481 TGAGGTATAACTGGGC T.sub.ksG.sub.ksA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.m 29 1580 C.sub.dsT.sub.ksG.sub.dsG.sub.ksG.sub.ds.sup.mC.sub.k 1095510 4442 4457 125467 125482 CTGAGGTATAACTGGG .sup.mC.sub.ksT.sub.ksG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 35 2801 A.sub.dsA.sub.ds.sup.mC.sub.ksT.sub.dsG.sub.ksG.sub.dsG.sub.k 1095511 4444 4459 125469 125484 CACTGAGGTATAACTG .sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds 46 2802 A.sub.dsT.sub.dsA.sub.ksA.sub.ds.sup.mC.sub.ksT.sub.dsG.sub.k 1198893 2528 2543 123553 123568 AAATTGTCTCATGCCT A.sub.ksA.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 58 443 C.sub.dsA.sub.dsT.sub.ksG.sub.ds.sup.mC.sub.ks.sup.mC.sub.dsT.sub.k 1198894 2529 2544 123554 123569 GAAATTGTCTCATGCC G.sub.ksA.sub.ksA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 57 2800 T.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.dsG.sub.ks.sup.mC.sub.ds.sup.mC.sub.k 1198895 2530 2545 123555 123570 GGAAATTGTCTCATGC G.sub.ksG.sub.ksA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 22 2806 C.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.dsT.sub.ksG.sub.ds.sup.mC.sub.k 1198896 2531 2546 123556 123571 TGGAAATTGTCTCATG T.sub.ksG.sub.ksG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 59 2807 C.sub.dsT.sub.ks.sup.mC.sub.dsA.sub.ksT.sub.dsG.sub.k 1198897 2532 2547 123557 123572 ATGGAAATTGTCTCAT A.sub.ksT.sub.ksG.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds 61 2808 T.sub.ds.sup.mC.sub.ksT.sub.ds.sup.mC.sub.ksA.sub.dsT.sub.k 1198898 2534 2549 123559 123574 ATATGGAAATTGTCTC A.sub.ksT.sub.ksA.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.ds 53 656 T.sub.dsG.sub.ksT.sub.ds.sup.mC.sub.ksT.sub.ds.sup.mC.sub.k 1198908 4436 4451 125461 125476 TATAACTGGGCAAATT T.sub.ksA.sub.ksT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.ds 124 2815 G.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.dsA.sub.ksT.sub.dsT.sub.k 1198909 4438 4453 125463 125478 GGTATAACTGGGCAAA G.sub.ksG.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds 56 1427 G.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.dsA.sub.ksA.sub.dsA.sub.k 1198910 4439 4454 125464 125479 AGGTATAACTGGGCAA A.sub.ksG.sub.ksG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds 40 905 T.sub.dsG.sub.dsG.sub.ksG.sub.ds.sup.mC.sub.ksA.sub.dsA.sub.k 1198911 4440 4455 125465 125480 GAGGTATAACTGGGCA G.sub.ksA.sub.ksG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.m 26 1503 C.sub.dsT.sub.dsG.sub.ksG.sub.dsG.sub.ks.sup.mC.sub.dsA.sub.k 1198912 4446 4461 125471 125486 AACACTGAGGTATAAC A.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.ds 78 2816 G.sub.dsT.sub.dsA.sub.ksT.sub.dsA.sub.ksA.sub.ds.sup.mC.sub.k 1198913 4595 4610 125620 125635 TTACATTAGGAACAAG T.sub.ksT.sub.ksA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 86 2817 G.sub.dsA.sub.dsA.sub.ks.sup.mC.sub.dsA.sub.ksA.sub.dsG.sub.k 1198914 4597 4612 125622 125637 TTTTACATTAGGAACA T.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.ds 68 2818 G.sub.dsG.sub.ksA.sub.dsA.sub.ks.sup.mC.sub.dsA.sub.k 1198915 4598 4613 125623 125638 CTTTTACATTAGGAAC .sup.mC.sub.ksT.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds 37 1124 T.sub.dsA.sub.dsG.sub.ksG.sub.dsA.sub.ksA.sub.ds.sup.mC.sub.k 1198916 4599 4614 125624 125639 ACTTTTACATTAGGAA A.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds 59 2819 T.sub.dsT.sub.dsA.sub.ksG.sub.dsG.sub.ksA.sub.dsA.sub.k 1198917 4600 4615 125625 125640 CACTTTTACATTAGGA .sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds 21 1200 A.sub.dsT.sub.dsT.sub.ksA.sub.dsG.sub.ksG.sub.dsA.sub.k 1198918 4601 4616 125626 125641 GCACTTTTACATTAGG G.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.m 27 1276 .sup.mC.sub.dsA.sub.dsT.sub.ksT.sub.dsA.sub.ksG.sub.dsG.sub.k 1198919 4602 4617 125627 125642 AGCACTTTTACATTAG A.sub.ksG.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds 60 2820 A.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.dsT.sub.ksA.sub.dsG.sub.k 1198920 4603 4618 125628 125643 AAGCACTTTTACATTA A.sub.ksA.sub.ksG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 54 2821 T.sub.dsA.sub.ds.sup.mC.sub.ksA.sub.dsT.sub.ksT.sub.dsA.sub.k 1198921 4605 4620 125630 125645 TTAAGCACTTTTACAT T.sub.ksT.sub.ksA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds 89 2822 T.sub.dsT.sub.dsT.sub.ksA.sub.ds.sup.mC.sub.ksA.sub.dsT.sub.k 1198922 4795 4810 125820 125835 GGAAGATCTGAAACTC G.sub.ksG.sub.ksA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds 59 2823 G.sub.dsA.sub.dsA.sub.ksA.sub.ds.sup.mC.sub.ksT.sub.ds.sup.mC.sub.k 1198923 4797 4812 125822 125837 TTGGAAGATCTGAAAC T.sub.ksT.sub.ksG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.m 73 2824 C.sub.dsT.sub.dsG.sub.ksA.sub.dsA.sub.ksA.sub.ds.sup.mC.sub.k 1198924 4798 4813 125823 125838 TTTGGAAGATCTGAAA T.sub.ksT.sub.ksT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.m 75 2825 C.sub.dsT.sub.ksG.sub.dsA.sub.ksA.sub.dsA.sub.k 1198925 4799 4814 125824 125839 CTTTGGAAGATCTGAA .sup.mC.sub.ksT.sub.ksT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ds 52 2826 A.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.dsG.sub.ksA.sub.dsA.sub.k 1198926 4800 4815 125825 125840 GCTTTGGAAGATCTGA G.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.ds 45 2044 G.sub.dsA.sub.dsT.sub.ks.sup.mC.sub.dsT.sub.ksG.sub.dsA.sub.k 1198927 4801 4816 125826 125841 TGCTTTGGAAGATCTG T.sub.ksG.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.ds 50 2121 A.sub.dsG.sub.dsA.sub.ksT.sub.ds.sup.mC.sub.ksT.sub.dsG.sub.k 1198928 4802 4817 125827 125842 GTGCTTTGGAAGATCT G.sub.ksT.sub.ksG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds 28 2827 A.sub.dsA.sub.dsG.sub.ksA.sub.dsT.sub.ks.sup.mC.sub.dsT.sub.k 1198929 4803 4818 125828 125843 AGTGCTTTGGAAGATC A.sub.ksG.sub.ksT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.ds 43 2828 G.sub.dsG.sub.dsA.sub.ksG.sub.dsA.sub.ksT.sub.ds.sup.mC.sub.k 1198930 4805 4820 125830 125845 ATAGTGCTTTGGAAGA A.sub.ksT.sub.ksA.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 68 2829 G.sub.dsG.sub.ksA.sub.dsA.sub.ksG.sub.dsA.sub.k 1198931 N/A N/A 94729 94744 AGGATGCATGGTTTTT A.sub.ksG.sub.ksG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds 47 2830 G.sub.dsG.sub.dsT.sub.ksT.sub.dsT.sub.ksT.sub.dsT.sub.k 1198932 N/A N/A 94731 94746 TTAGGATGCATGGTTT T.sub.ksT.sub.ksA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 35 2831 A.sub.dsT.sub.dsG.sub.ksG.sub.dsT.sub.ksT.sub.dsT.sub.k 1198933 N/A N/A 94732 94747 TTTAGGATGCATGGTT T.sub.ksT.sub.ksT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m 69 2832 C.sub.dsA.sub.dsT.sub.ksG.sub.dsG.sub.ksT.sub.dsT.sub.k 1198934 N/A N/A 94733 94748 ATTTAGGATGCATGGT A.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m 56 2833 C.sub.dsA.sub.ksT.sub.dsG.sub.ksG.sub.dsT.sub.k 1198935 N/A N/A 94734 94749 GATTTAGGATGCATGG G.sub.ksA.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.ds 18 2834 G.sub.ds.sup.mC.sub.ksA.sub.dsT.sub.ksG.sub.dsG.sub.k 1198936 N/A N/A 94735 94750 AGATTTAGGATGCATG A.sub.ksG.sub.ksA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds 38 2835 T.sub.dsG.sub.ks.sup.mC.sub.dsA.sub.ksT.sub.dsG.sub.k 1198937 N/A N/A 94736 94751 CAGATTTAGGATGCAT .sup.mC.sub.ksA.sub.ksG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 48 2836 G.sub.dsA.sub.dsT.sub.ksG.sub.ds.sup.mC.sub.ksA.sub.dsT.sub.k 1198938 N/A N/A 94737 94752 TCAGATTTAGGATGCA T.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds 59 2837 G.sub.dsG.sub.dsA.sub.ksT.sub.dsG.sub.ks.sup.mC.sub.dsA.sub.k 1198939 N/A N/A 94739 94754 ATTCAGATTTAGGATG A.sub.ksT.sub.ksT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.ds 102 28388 A.sub.dsG.sub.ksG.sub.dsA.sub.ksT.sub.dsG.sub.k 1198940 N/A N/A 115903 115918 ATATGGTTTTGTGTGT A.sub.ksT.sub.ksA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds 51 2881 G.sub.dsT.sub.ksG.sub.dsT.sub.ksG.sub.dsT.sub.k 1198941 N/A N/A 115905 115920 TTATATGGTTTTGTGT T.sub.ksT.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds 35 2840 T.sub.dsT.sub.ksG.sub.dsT.sub.ksG.sub.dsT.sub.k 1198942 N/A N/A 115906 115921 CTTATATGGTTTTGTG .sup.mC.sub.ksT.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.ds 42 2788 T.sub.dsT.sub.ksT.sub.dsG.sub.ksT.sub.dsG.sub.k 1198943 N/A N/A 115907 115922 TCTTATATGGTTTTGT T.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.ds 31 2841 T.sub.dsT.sub.ksT.sub.dsT.sub.ksG.sub.dsT.sub.k 1198944 N/A N/A 115908 115923 CTCTTATATGGTTTTG .sup.mC.sub.ksT.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ds 34 2842 G.sub.dsG.sub.dsT.sub.ksT.sub.dsT.sub.ksT.sub.dsG.sub.k 1198945 N/A N/A 115909 115924 ACTCTTATATGGTTTT A.sub.ks.sup.mC.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.ds 48 2859 T.sub.dsG.sub.dsG.sub.ksT.sub.dsT.sub.ksT.sub.dsT.sub.k 1198946 N/A N/A 115910 115925 AACTCTTATATGGTTT A.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.ds 72 2860 A.sub.dsT.sub.dsG.sub.ksG.sub.dsT.sub.ksT.sub.dsT.sub.k 1198947 N/A N/A 115911 115926 CAACTCTTATATGGTT .sup.mC.sub.ksA.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ds 88 2861 T.sub.dsA.sub.dsT.sub.ksG.sub.dsG.sub.ksT.sub.dsT.sub.k 1198948 N/A N/A 115913 115928 GACAACTCTTATATGG G.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds 96 2862 T.sub.dsA.sub.dsT.sub.ksA.sub.dsT.sub.ksG.sub.dsG.sub.k 1198949 N/A N/A 117325 117340 ATTGCAATCTGTCTGA A.sub.ksT.sub.ksT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds 61 2843 T.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.dsT.sub.ksG.sub.dsA.sub.k 1198950 N/A N/A 117327 117342 ATATTGCAATCTGTCT A.sub.ksT.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds 85 2844 T.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.dsT.sub.ks.sup.mC.sub.dsT.sub.k 1198951 N/A N/A 117328 117343 AATATTGCAATCTGTC A.sub.ksA.sub.ksT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds 81 2845 A.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.dsG.sub.ksT.sub.ds.sup.mC.sub.k 1198952 N/A N/A 117329 117344 TAATATTGCAATCTGT T.sub.ksA.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 77 2846 A.sub.dsA.sub.ksT.sub.ks.sup.mC.sub.dsT.sub.ksG.sub.dsT.sub.k 1198953 N/A N/A 117330 117345 GTAATATTGCAATCTG G.sub.ksT.sub.ksA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.m 58 1404 C.sub.dsA.sub.dsA.sub.ksT.sub.ds.sup.mC.sub.ksT.sub.dsG.sub.k 1198954 N/A N/A 117331 117346 TGTAATATTGCAATCT T.sub.ksG.sub.ksT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.m 94 2847 C.sub.dsA.sub.ksA.sub.dsT.sub.ks.sup.mC.sub.dsT.sub.k 1198955 N/A N/A 117332 117347 ATGTAATATTGCAATC A.sub.ksT.sub.ksG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.ds 92 2848 G.sub.ds.sup.mC.sub.ksA.sub.dsA.sub.ksT.sub.ds.sup.mC.sub.k 1198956 N/A N/A 117333 117348 TATGTAATATTGCAAT T.sub.ksA.sub.ksT.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ds 76 2849 T.sub.dsG.sub.ks.sup.mC.sub.dsA.sub.ksA.sub.dsT.sub.k 1198957 N/A N/A 117335 117350 TTTATGTAATATTGCA T.sub.ksT.sub.ksT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.ds 81 2850 A.sub.dsT.sub.ksT.sub.dsG.sub.ks.sup.mC.sub.dsA.sub.k 1198958 N/A N/A 117755 117770 TGTATGTCAGAAGAGT T.sub.ksG.sub.ksT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 12 2863 G.sub.dsA.sub.dsA.sub.ksG.sub.dsA.sub.ksG.sub.dsT.sub.k 1198959 N/A N/A 117757 117772 AGTGTATGTCAGAAGA A.sub.ksG.sub.ksT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 8 2864 C.sub.dsA.sub.dsG.sub.ksA.sub.dsA.sub.ksG.sub.dsA.sub.k 1198960 N/A N/A 117758 117773 AAGTGTATGTCAGAAG A.sub.ksA.sub.ksG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 6 2865 C.sub.dsA.sub.ksG.sub.dsA.sub.ksA.sub.dsG.sub.k 1198961 N/A N/A 117759 117774 AAAGTGTATGTCAGAA A.sub.ksA.sub.ksA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ds 12 2866 T.sub.ds.sup.mC.sub.ksA.sub.dsG.sub.ksA.sub.dsA.sub.k 1198962 N/A N/A 117760 117775 TAAAGTGTATGTCAGA T.sub.ksA.sub.ksA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 52 2867 G.sub.dsT.sub.ks.sup.mC.sub.dsA.sub.ksG.sub.dsA.sub.k 1198963 N/A N/A 117761 117776 TTAAAGTGTATGTCAG T.sub.ksT.sub.ksA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.ds 27 2868 T.sub.dsG.sub.ksT.sub.ds.sup.mC.sub.ksA.sub.dsG.sub.k 1198964 N/A N/A 117762 117777 TTTAAAGTGTATGTCA T.sub.ksT.sub.ksT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.ds 59 2869 A.sub.dsT.sub.ksG.sub.dsT.sub.ks.sup.mC.sub.dsA.sub.k 1198965 N/A N/A 117763 117778 CTTTAAAGTGTATGTC .sup.mC.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.ds 95 1634 G.sub.dsT.sub.dsA.sub.ksT.sub.dsG.sub.ksT.sub.ds.sup.mC.sub.k 1198967 N/A N/A 119667 119682 TAAGGTTTCCCAGATT T.sub.ksA.sub.ksA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.m 65 2851 C.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.dsA.sub.ksT.sub.dsT.sub.k 1198968 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA A.sub.ksG.sub.ksT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.m 57 2852 C.sub.ds.sup.mC.sub.ks.sup.mC.sub.dsA.sub.ksG.sub.dsA.sub.k 1198969 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG A.sub.ksA.sub.ksG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds 31 2853 T.sub.ds.sup.mC.sub.ks.sup.mC.sub.ds.sup.mC.sub.ksA.sub.dsG.sub.k 1198970 N/A N/A 119671 119686 TAAGTAAGGTTTCCCA T.sub.ksA.sub.ksA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds 29 2854 T.sub.dsT.sub.ks.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.dsA.sub.k 1198971 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC .sup.mC.sub.ksT.sub.ksA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.ds 31 1101 G.sub.dsT.sub.dsT.sub.ksT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ds.sup.mC.sub.k 1198972 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC A.sub.ks.sup.mC.sub.ksT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.ds 46 2855 G.sub.dsG.sub.dsT.sub.ksT.sub.dsT.sub.ks.sup.mC.sub.ds.sup.mC.sub.k 1198973 N/A N/A 119674 119689 GACTAAGTAAGGTTTC G.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds 53 2856 A.sub.dsG.sub.dsG.sub.ksT.sub.dsT.sub.ksT.sub.ds.sup.mC.sub.k 1198974 N/A N/A 119675 119690 AGACTAAGTAAGGTTT A.sub.ksG.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.ds 73 2857 A.sub.dsA.sub.dsG.sub.ksG.sub.dsT.sub.ksT.sub.dsT.sub.k 1198975 N/A N/A 119677 119692 TTAGACTAAGTAAGGT T.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.ds 52 2858 G.sub.dsT.sub.dsA.sub.ksA.sub.dsG.sub.ksG.sub.dsT.sub.k
TABLE-US-00046 Table 46 Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2 SEQ SEQ ID ID SEQ ID SEQ ID YAP1 NO: 1 NO: 1 NO: 2 NO: 2 SEQ SEQ Compound Start Stop Start Stop Sequence YAP1 ID Number Site Site Site Site (5' to 3') CHEMSITRY NOTATION (% UT) NO 715487 3630 3645 124655 124670 ATTACTTCATAGCTTA A.sub.ksT.sub.ksT.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds 25 52 A.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.ksA.sub.k 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 16 810 G.sub.dsT.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC G.sub.ksA.sub.ksA.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 14 2800 C.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 1095407 4443 4458 125468 125483 ACTGAGGTATAACTGG A.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 54 392 A.sub.dsA.sub.ks.sup.mC.sub.esT.sub.ksG.sub.esG.sub.k 1095425 4441 4456 125466 125481 TGAGGTATAACTGGGC T.sub.ksG.sub.ksA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.m 57 1580 C.sub.dsT.sub.ksG.sub.esG.sub.ksG.sub.es.sup.mC.sub.k 1095426 4442 4457 125467 125482 CTGAGGTATAACTGGG .sup.mC.sub.ksT.sub.ksG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.ds 54 2801 A.sub.ds.sup.mC.sub.ksT.sub.esG.sub.ksG.sub.esG.sub.k 1095427 4444 4459 125469 125484 CACTGAGGTATAACTG .sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds 45 2802 A.sub.dsT.sub.dsA.sub.ksA.sub.es.sup.mC.sub.ksT.sub.esG.sub.k 1198804 2524 2539 123549 123564 TGTCTCATGCCTTATA T.sub.ksG.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m 22 2803 C.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.esA.sub.ksT.sub.esA.sub.k 1198805 2526 2541 123551 123566 ATTGTCTCATGCCTTA A.sub.ksT.sub.ksT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds 23 2804 G.sub.ds.sup.mC.sub.ks.sup.mC.sub.esT.sub.ksT.sub.esA.sub.k 1198806 2527 2542 123552 123567 AATTGTCTCATGCCTT A.sub.ksA.sub.ksT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds 33 2805 A.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.es.sup.mC.sub.ksT.sub.esT.sub.k 1198807 2528 2543 123553 123568 AAATTGTCTCATGCCT A.sub.ksA.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 44 433 C.sub.dsA.sub.dsT.sub.ksG.sub.es.sup.mC.sub.ks.sup.mC.sub.esT.sub.k 1198808 2529 2544 123554 123569 GAAATTGTCTCATGCC G.sub.ksA.sub.ksA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 40 2800 C.sub.dsA.sub.ksT.sub.esG.sub.ks.sup.mC.sub.es.sup.mC.sub.k 1198809 2530 2545 123555 123570 GGAAATTGTCTCATGC G.sub.ksG.sub.ksA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 27 2806 T.sub.ds.sup.mC.sub.ksA.sub.esT.sub.ksG.sub.es.sup.mC.sub.k 1198810 2531 2546 123556 123571 TGGAAATTGTCTCATG T.sub.ksG.sub.ksG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 50 2807 C.sub.dsT.sub.ks.sup.mC.sub.esA.sub.ksT.sub.esG.sub.k 1198811 2532 2547 123557 123572 ATGGAAATTGTCTCAT A.sub.ksT.sub.ksG.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds 38 2808 T.sub.ds.sup.mC.sub.ksT.sub.es.sup.mC.sub.ksA.sub.esT.sub.k 1198812 2534 2549 123559 123574 ATATGGAAATTGTCTC A.sub.ksT.sub.ksA.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.ds 26 656 T.sub.dsG.sub.ksT.sub.es.sup.mC.sub.ksT.sub.es.sup.mC.sub.k 1198813 2560 2575 123585 123600 AGTATGTGGCAATAAT A.sub.ksG.sub.ksT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds 55 2809 A.sub.dsA.sub.ksT.sub.esA.sub.ksA.sub.esT.sub.k 1198814 2562 2577 123587 123602 AGAGTATGTGGCAATA A.sub.ksG.sub.ksA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.ds 13 2810 G.sub.ds.sup.mC.sub.ksA.sub.esA.sub.ksT.sub.esA.sub.K 1198815 2563 2578 123588 123603 TAGAGTATGTGGCAAT T.sub.ksA.sub.ksG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds 24 2811 G.sub.dsG.sub.ks.sup.mC.sub.esA.sub.ksA.sub.esT.sub.k 1198816 2564 2579 123589 123604 TTAGAGTATGTGGCAA T.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ds 27 963 T.sub.dsG.sub.ksG.sub.es.sup.mC.sub.ksA.sub.esA.sub.k 1198817 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds43 810 G.sub.dsT.sub.ksG.sub.esG.sub.ks.sup.mC.sub.esA.sub.k 1198818 2566 2581 123591 123606 TATTAGAGTATGTGGC T.sub.ksA.sub.ksT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds 15 2812 T.sub.dsG.sub.ksT.sub.esG.sub.ksG.sub.es.sup.mC.sub.k 1198819 2567 2582 123592 123607 ATATTAGAGTATGTGG A.sub.ksT.sub.ksA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds 44 2813 A.sub.dsT.sub.ksG.sub.esT.sub.ksG.sub.esG.sub.k 1198820 2568 2583 123593 123608 TATATTAGAGTATGTG T.sub.ksA.sub.ksT.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds 62 2814 T.sub.dsA.sub.ksT.sub.esG.sub.ksT.sub.esG.sub.k 1198821 2570 2585 123595 123610 TCTATATTAGAGTATG T.sub.ks.sup.mC.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 62 887 A.sub.dsG.sub.ksT.sub.esA.sub.ksT.sub.esG.sub.k 1198822 4436 4451 125461 125476 TATAACTGGGCAAATT T.sub.ksA.sub.ksT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.m 97 2815 C.sub.dsA.sub.ksA.sub.esA.sub.ksT.sub.esT.sub.k 1198823 4438 4453 125463 125478 GGTATAACTGGGCAAA G.sub.ksG.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds 65 1427 G.sub.dsG.sub.ks.sup.mC.sub.esA.sub.ksA.sub.esA.sub.k 1198824 4439 4454 125464 125479 AGGTATAACTGGGCAA A.sub.ksG.sub.ksG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds 72 905 G.sub.dsG.sub.ksG.sub.es.sup.mC.sub.ksA.sub.esA.sub.k 1198825 4440 4455 125465 125480 GAGGTATAACTGGGCA G.sub.ksA.sub.ksG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds 64 1503 T.sub.dsG.sub.ksG.sub.esG.sub.ks.sup.mC.sub.esA.sub.k 1198826 4446 4461 125471 125486 AACACTGAGGTATAAC A.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.ds 64 2816 G.sub.dsT.sub.dsA.sub.ksT.sub.esA.sub.ksA.sub.es.sup.mC.sub.k 1198827 4595 4610 125620 125635 TTACATTAGGAACAAG T.sub.ksT.sub.ksA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.ds 60 2817 A.sub.dsA.sub.ks.sup.mC.sub.esA.sub.ksA.sub.esG.sub.k 1198828 4597 4612 125622 125637 TTTTACATTAGGAACA T.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.ds 59 2818 G.sub.dsG.sub.ksA.sub.esA.sub.ks.sup.mC.sub.esA.sub.k 1198829 4598 4613 125623 125638 CTTTTACATTAGGAAC .sup.mC.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.ds 36 1124 A.sub.dsG.sub.ksG.sub.esA.sub.ksA.sub.es.sup.mC.sub.k 1198830 4599 4614 125624 125639 ACTTTTACATTAGGAA .sup.mA.sub.ksC.sub.ksT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds 37 2819 T.sub.dsA.sub.ksG.sub.esG.sub.ksA.sub.esA.sub.k 1198831 4600 4615 125625 125640 CACTTTTACATTAGGA .sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds 12 1200 A.sub.dsT.sub.dsT.sub.ksA.sub.esG.sub.ksG.sub.esA.sub.k 1198832 4601 4616 125626 125641 GCACTTTTACATTAGG G.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.m 20 1276 C.sub.dsA.sub.dsT.sub.ksT.sub.esA.sub.ksG.sub.esG.sub.k 1198833 4602 4617 125627 125642 AGCACTTTTACATTAG A.sub.ksG.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds 54 2820 A.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.esT.sub.ksA.sub.esG.sub.k 1198834 4603 4618 125628 125643 AAGCACTTTTACATTA A.sub.ksA.sub.ksG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 54 2821 T.sub.dsA.sub.ds.sup.mC.sub.ksA.sub.esT.sub.ksT.sub.esA.sub.k 1198835 4605 4620 125630 125645 TTAAGCACTTTTACAT T.sub.ksT.sub.ksA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds 85 2822 T.sub.dsT.sub.dsT.sub.ksA.sub.es.sup.mC.sub.ksA.sub.esT.sub.k 1198836 4795 4810 125820 125835 GGAAGATCTGAAACTC G.sub.ksG.sub.ksA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds 43 2823 A.sub.dsA.sub.ksA.sub.es.sup.mC.sub.ksT.sub.es.sup.mC.sub.k 1198837 4797 4812 125822 125837 TTGGAAGATCTGAAAC T.sub.ksT.sub.ksG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds 66 2824 T.sub.dsG.sub.ksA.sub.esA.sub.ksA.sub.es.sup.mC.sub.k 1198838 4798 4813 125823 125838 TTTGGAAGATCTGAAA T.sub.ksT.sub.ksT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.m 66 2825 C.sub.dsT.sub.ksG.sub.esA.sub.ksA.sub.esA.sub.k 1198839 4799 4814 125824 125839 CTTTGGAAGATCTGAA mC.sub.ksT.sub.ksT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ds 36 2826 T.sub.ds.sup.mC.sub.ksT.sub.esG.sub.ksA.sub.esA.sub.k 1198840 4800 4815 125825 125840 GCTTTGGAAGATCTGA G.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ds 26 2044 A.sub.dsT.sub.ks.sup.mC.sub.esT.sub.ksG.sub.esA.sub.k 1198841 4801 4816 125826 125841 TGCTTTGGAAGATCTG T.sub.ksG.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.ds 116 2121 G.sub.dsA.sub.ksT.sub.es.sup.mC.sub.ksT.sub.esG.sub.k 1198842 4802 4817 125827 125842 GTGCTTTGGAAGATCT G.sub.ksT.sub.ksG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.ds 37 2827 A.sub.dsG.sub.ksA.sub.esT.sub.ks.sup.mC.sub.esT.sub.k 1198843 4803 4818 125828 125843 AGTGCTTTGGAAGATC A.sub.ksG.sub.ksT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds 45 2828 A.sub.dsA.sub.ksG.sub.esA.sub.ksT.sub.es.sup.mC.sub.k 1198844 4805 4820 125830 125845 ATAGTGCTTTGGAAGA A.sub.ksT.sub.ksA.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 56 2829 G.sub.dsG.sub.ksA.sub.esA.sub.ksG.sub.esA.sub.k 1198845 N/A N/A 94729 94744 AGGATGCATGGTTTTT A.sub.ksG.sub.ksG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.ds 43 2830 G.sub.dsT.sub.ksT.sub.esT.sub.ksT.sub.esT.sub.k 1198846 N/A N/A 94731 94746 TTAGGATGCATGGTTT T.sub.ksT.sub.ksA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds 34 2831 T.sub.dsG.sub.ksG.sub.esT.sub.ksT.sub.esT.sub.k 1198847 N/A N/A 94732 94747 TTTAGGATGCATGGTT T.sub.ksT.sub.ksT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 51 2832 A.sub.dsT.sub.ksG.sub.esG.sub.ksT.sub.esT.sub.k 1198848 N/A N/A 94733 94748 ATTTAGGATGCATGGT A.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m 47 2833 C.sub.dsA.sub.ksT.sub.esG.sub.ksG.sub.esT.sub.k 1198849 N/A N/A 94734 94749 GATTTAGGATGCATGG G.sub.ksA.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.ds 42 2834 G.sub.ds.sup.mC.sub.ksA.sub.esT.sub.ksG.sub.esG.sub.k 1198850 N/A N/A 94735 94750 AGATTTAGGATGCATG A.sub.ksG.sub.ksA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds 33 2835 T.sub.dsG.sub.ks.sup.mC.sub.esA.sub.ksT.sub.esG.sub.k 1198851 N/A N/A 94736 94751 CAGATTTAGGATGCAT .sup.mC.sub.ksG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.ds 82 2836 A.sub.dsT.sub.ksG.sub.es.sup.mC.sub.ksA.sub.esT.sub.k 1198852 N/A N/A 94737 94752 TCAGATTTAGGATGCA T.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 41 2837 G.sub.dsA.sub.ksT.sub.esG.sub.ks.sup.mC.sub.esA.sub.k 1198853 N/A N/A 94739 94754 ATTCAGATTTAGGATG A.sub.ksT.sub.ksT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.ds 105 2838 A.sub.dsG.sub.ksG.sub.esA.sub.ksT.sub.esG.sub.k 1198854 N/A N/A 115903 115918 ATATGGTTTTGTGTGT A.sub.ksT.sub.ksA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds 56 2839 G.sub.dsT.sub.ksG.sub.esT.sub.ksG.sub.esT.sub.k 1198855 N/A N/A 115905 115920 TTATATGGTTTTGTGT T.sub.ksT.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds 30 2840 T.sub.dsT.sub.ksG.sub.esT.sub.ksG.sub.esT.sub.k 1198856 N/A N/A 115906 115921 CTTATATGGTTTTGTG mC.sub.ksT.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.ds 20 2788 T.sub.dsT.sub.ksT.sub.esG.sub.ksT.sub.esG.sub.k 1198857 N/A N/A 115907 115922 TCTTATATGGTTTTGT T.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.ds 19 2841 T.sub.dsT.sub.ksT.sub.esT.sub.ksG.sub.esT.sub.k 1198863 N/A N/A 117325 117340 ATTGCAATCTGTCTGA A.sub.ksT.sub.ksT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds 65 2843 T.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.esT.sub.ksG.sub.esA.sub.k 1198864 N/A N/A 117327 117342 ATATTGCAATCTGTCT A.sub.ksT.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.m 56 2844 C.sub.dsT.sub.ksG.sub.esT.sub.ks.sup.mC.sub.esT.sub.k 1198865 N/A N/A 117328 117343 AATATTGCAATCTGTC A.sub.ksA.sub.ksT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds 38 2845 T.sub.ds.sup.mC.sub.ksT.sub.esG.sub.ksT.sub.es.sup.mC.sub.k 1198866 N/A N/A 117329 117344 TAATATTGCAATCTGT T.sub.ksA.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds 60 2846 A.sub.dsT.sub.ks.sup.mC.sub.esT.sub.ksG.sub.esT.sub.k 1198867 N/A N/A 117330 117345 GTAATATTGCAATCTG G.sub.ksT.sub.ksA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 25 1404 A.sub.dsA.sub.ksT.sub.es.sup.mC.sub.ksT.sub.esG.sub.k 1198868 N/A N/A 117331 117346 TGTAATATTGCAATCT T.sub.ksG.sub.ksT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.m 49 2847 C.sub.dsA.sub.ksA.sub.esT.sub.ks.sup.mC.sub.esT.sub.k 1198869 N/A N/A 117332 117347 ATGTAATATTGCAATC A.sub.ksT.sub.ksG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.ds 49 2848 G.sub.ds.sup.mC.sub.ksA.sub.esA.sub.ksT.sub.es.sup.mC.sub.k 1198870 N/A N/A 117333 117348 TATGTAATATTGCAAT T.sub.ksA.sub.ksT.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ds 86 2849 T.sub.dsG.sub.ks.sup.mC.sub.esA.sub.ksA.sub.esT.sub.k 1198871 N/A N/A 117335 117350 TTTATGTAATATTGCA T.sub.ksT.sub.ksT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.ds 77 2850 A.sub.dsT.sub.ksT.sub.esG.sub.ks.sup.mC.sub.esA.sub.k 1198881 N/A N/A 119667 119682 TAAGGTTTCCCAGATT T.sub.ksA.sub.ksA.sub.dsG.sub.dsG.sub.dsTdsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.m 36 2851 C.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.esA.sub.ksT.sub.esT.sub.k 1198882 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA A.sub.ksG.sub.ksT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.m 56 2852 C.sub.ds.sup.mC.sub.ks.sup.mC.sub.esA.sub.ksG.sub.esA.sub.k 1198883 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG A.sub.ksA.sub.ksG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds 47 2853 T.sub.ds.sup.mC.sub.ks.sup.mC.sub.es.sup.mC.sub.ksA.sub.esG.sub.k 1198884 N/A N/A 119671 119686 TAAGTAAGGTTTCCCA T.sub.ksA.sub.ksA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds 28 2854 T.sub.dsT.sub.ks.sup.mC.sub.es.sup.mC.sub.ks.sup.mC.sub.esA.sub.k 1198885 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC .sup.mC.sub.ksT.sub.ksA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.ds 41 1101 T.sub.dsT.sub.ksT.sub.es.sup.mC.sub.ks.sup.mC.sub.es.sup.mC.sub.k 1198886 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC A.sub.ks.sup.mC.sub.ksT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.ds 45 2855 G.sub.dsT.sub.ksT.sub.esT.sub.ks.sup.mC.sub.es.sup.mC.sub.k 1198887 N/A N/A 119674 119689 GACTAAGTAAGGTTTC G.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.ds 71 2856 G.sub.dsG.sub.ksT.sub.esT.sub.ksT.sub.es.sup.mC.sub.k 1198888 N/A N/A 119675 119690 AGACTAAGTAAGGTTT A.sub.ksG.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds 51 2857 A.sub.dsG.sub.ksG.sub.esT.sub.ksT.sub.esT.sub.k 1198889 N/A N/A 119677 119692 TTAGACTAAGTAAGGT T.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.ds 27 2858 T.sub.dsA.sub.ksA.sub.esG.sub.ksG.sub.esT.sub.k 1198966 N/A N/A 117765 117780 AACTTTAAAGTGTATG A.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ds 78 2870 T.sub.dsG.sub.ksT.sub.dsA.sub.ksT.sub.dsG.sub.k
TABLE-US-00047 Table 47 Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2 SEQ SEQ ID ID SEQ ID SEQ ID YAP1 NO: 1 NO: 1 NO: 2 NO: 2 SEQ SEQ Compound Start Stop Start Stop YAP1 ID Number Site Site Site Site Sequence (5' to 3') CHEMSITRY NOTATION (% UT) NO 715487 3630 3645 124655 124670 ATTACTTCATAGCTTA A.sub.ksT.sub.ksT.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 39 52 T.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.ksA.sub.k 716444 2528 2543 123553 123568 AAATTGTCTCATGCCT A.sub.ksA.sub.ksA.sub.ksT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 46 443 C.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksT.sub.k 958497 2534 2549 123559 123574 ATATGGAAATTGTCTC A.sub.ksT.sub.ksA.sub.ksT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.ds 20 656 T.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.sT.sub.dsA.sub.dsT.sub.ds 17 810 G.sub.dsT.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 10 810 G.sub.dsT.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 958500 2570 2585 123595 123610 TCTATATTAGAGTATG T.sub.ks.sup.mC.sub.ksT.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 53 887 A.sub.dsG.sub.dsT.sub.dsA.sub.ksT.sub.ksG.sub.k 1009324 2560 2575 36419 36434 AGTATGTGGCAATAAT A.sub.ksG.sub.ksT.sub.ksA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds 27 2809 63341 63356 A.sub.dsA.sub.dsT.sub.dsA.sub.ksA.sub.ksT.sub.k 123585 123600 1009325 2562 2577 63343 63358 AGAGTATGTGGCAATA A.sub.ksG.sub.ksA.sub.ksG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.ds 16 2810 71690 71705 G.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ksT.sub.ksA.sub.k 123587 123602 1009326 2566 2581 123591 123606 TATTAGAGTATGTGGC T.sub.ksA.sub.ksT.sub.ksT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds 10 2812 T.sub.dsG.sub.dsT.sub.dsG.sub.ksG.sub.ks.sup.mC.sub.k 1009327 2567 2582 123592 123607 ATATTAGAGTATGTGG A.sub.ksT.sub.ksA.sub.ksT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds 27 2813 A.sub.dsT.sub.dsG.sub.dsT.sub.ksG.sub.ksG.sub.k 1009328 2568 2583 123593 123608 TATATTAGAGTATGTG T.sub.ksA.sub.ksT.sub.ksA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds 67 2814 T.sub.dsA.sub.dsT.sub.dsG.sub.ksT.sub.ksG.sub.k 1009394 2223 2238 123248 123263 TATAACTGGGCAAATT T.sub.ksA.sub.ksT.sub.ksA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.m 73 2815 4436 4451 125461 125476 C.sub.dsA.sub.dsA.sub.dsA.sub.ksT.sub.ksT.sub.k 1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC G.sub.ksA.sub.ksA.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 5 2800 C.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 1074462 2530 2545 123555 123570 GGAAATTGTCTCATGC G.sub.ksG.sub.ksA.sub.ksA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 7 2806 T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ksG.sub.ks.sup.mC.sub.k 1074463 2563 2578 123588 123603 TAGAGTATGTGGCAAT T.sub.ksA.sub.ksG.sub.ksA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds 20 2811 G.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ksT.sub.k 1074464 2564 2579 123589 123604 TTAGAGTATGTGGCAA T.sub.ksT.sub.ksA.sub.ksG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ds 5 963 T.sub.dsG.sub.sG.sub.ds.sup.mC.sub.ksA.sub.ksA.sub.k 1074754 4598 4613 125623 125638 CTTTTACATTAGGAAC .sup.mC.sub.ksT.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.ds 69 1124 A.sub.dsG.sub.dsG.sub.dsA.sub.ksA.sub.ks.sup.mC.sub.k 1074755 4600 4615 125625 125640 CACTTTTACATTAGGA .sup.mC.sub.ksA.sub.ks.sup.mT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds 23 1200 A.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ksG.sub.ksA.sub.k 1074756 4601 4616 125626 125641 GCACTTTTACATTAGG G.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.m 8 1276 C.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.ksG.sub.ksG.sub.k 1074798 4800 4815 125825 125840 GCTTTGGAAGATCTGA G.sub.ks.sup.mC.sub.ksT.sub.ksT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ds 19 2044 A.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksA.sub.k 1074799 4801 4816 125826 125841 TGCTTTGGAAGATCTG T.sub.ksG.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.ds 21 2121 G.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k 1076186 N/A N/A 94733 94748 ATTTAGGATGCATGGT A.sub.ksT.sub.ksT.sub.ksT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m 31 2833 C.sub.dsA.sub.dsT.sub.dsG.sub.ksG.sub.ksT.sub.k 1076187 N/A N/A 94734 94749 GATTTAGGATGCATGG G.sub.ksA.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.ds 17 2834 G.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ksG.sub.ksG.sub.k 1076453 N/A N/A 117330 117345 GTAATATTGCAATCTG G.sub.ksT.sub.ksA.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 7 1404 A.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k 1076481 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC .sup.mC.sub.ksT.sub.ksA.sub.ksA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.ds13 1101 T.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 1096369 4802 4817 125827 125842 GTGCTTTGGAAGATCT G.sub.ksT.sub.ksG.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.ds 45 2827 A.sub.dsG.sub.dsA.sub.dsT.sub.ks.sup.mC.sub.ksT.sub.k 1097037 N/A N/A 94735 94750 AGATTTAGGATGCATG A.sub.ksG.sub.ksA.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds 38 2835 T.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.ksG.sub.k 1097238 N/A N/A 117325 117340 ATTGCAATCTGTCTGA A.sub.ksT.sub.ksT.sub.ksG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds 77 2843 T.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksA.sub.k 1197176 2524 2539 123549 123564 TGTCTCATGCCTTATA T.sub.ksG.sub.ksT.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m 17 2803 C.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ksT.sub.ksA.sub.k 1197177 2526 2541 123551 123566 ATTGTCTCATGCCTTA A.sub.ksT.sub.ksT.sub.ksG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 15 2804 T.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.ksA.sub.k 1197178 2527 2542 123552 123567 AATTGTCTCATGCCTT A.sub.ksA.sub.ksT.sub.ksT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds 12 2805 A.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ksT.sub.k 1197179 2531 2546 123556 123571 TGGAAATTGTCTCATG T.sub.ksG.sub.ksG.sub.ksA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 16 2807 C.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.ksG.sub.k 1197180 2532 2547 123557 123572 ATGGAAATTGTCTCAT A.sub.ksT.sub.ksG.sub.ksG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds 47 2808 T.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.ksT.sub.k 1197181 4595 4610 125620 125635 TTACATTAGGAACAAG T.sub.ksT.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.ds 87 2817 A.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ksG.sub.k 1197182 4597 4612 125622 125637 TTTTACATTAGGAACA T.sub.ksT.sub.ksT.sub.ksT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.ds 115 2818 G.sub.dsG.sub.dsA.sub.dsA.sub.ks.sup.mC.sub.ksA.sub.k 1197183 4599 4614 125624 125639 ACTTTTACATTAGGAA A.sub.ks.sup.mC.sub.ksT.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds 41 2819 T.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.ksA.sub.ksA.sub.k 1197184 4602 4617 125627 125642 AGCACTTTTACATTAG A.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds 20 2820 A.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.ksA.sub.ksG.sub.k 1197185 4603 4618 125628 125643 AAGCACTTTTACATTA A.sub.ksA.sub.ksG.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 55 2821 T.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ksT.sub.ksA.sub.k 1197186 4605 4620 125630 125645 TTAAGCACTTTTACAT T.sub.ksT.sub.ksA.sub.ksA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds 65 2822 T.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ksA.sub.ksT.sub.k 1197187 4795 4810 125820 125835 GGAAGATCTGAAACTC G.sub.ksG.sub.ksA.sub.ksA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds 24 2823 A.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k 1197188 4797 4812 125822 125837 TTGGAAGATCTGAAAC T.sub.ksT.sub.ksG.sub.ksG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds 96 2824 T.sub.dsG.sub.dsA.sub.dsA.sub.ksA.sub.ks.sup.mC.sub.k 1197189 4798 4813 125823 125838 TTTGGAAGATCTGAAA T.sub.ksT.sub.ksT.sub.ksG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.m 71 2825 C.sub.dsT.sub.dsG.sub.dsA.sub.ksA.sub.ksA.sub.k 1197190 4799 4814 125824 125839 CTTTGGAAGATCTGAA .sup.mC.sub.ksT.sub.ks+lTksT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ds 57 2826 T.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ksA.sub.ksA.sub.k 1197191 4803 4818 125828 125843 AGTGCTTTGGAAGATC A.sub.ksG.sub.ksT.sub.ksG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds 40 2828 A.sub.dsA.sub.dsG.sub.dsA.sub.ksT.sub.ks.sup.mC.sub.k 1197192 4805 4820 125830 125845 ATAGTGCTTTGGAAGA A.sub.ksT.sub.ksA.sub.ksG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 39 2829 G.sub.dsG.sub.dsA.sub.dsA.sub.ksG.sub.ksA.sub.k 1197193 N/A N/A 94729 94744 AGGATGCATGGTTTTT A.sub.ksG.sub.ksA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.ds 15 2830 G.sub.dsT.sub.dsT.sub.dsT.sub.ksT.sub.ksT.sub.k 1197194 N/A N/A 94731 94746 TTAGGATGCATGGTTT T.sub.ksT.sub.ksA.sub.ksG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds 37 2831 T.sub.dsG.sub.dsG.sub.dsT.sub.ksT.sub.ksT.sub.k 1197195 N/A N/A 94732 94747 TTTAGGATGCATGGTT T.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 38 2832 A.sub.dsT.sub.dsG.sub.dsG.sub.ksT.sub.ksT.sub.k 1197196 N/A N/A 94736 94751 CAGATTTAGGATGCAT .sup.mC.sub.ksA.sub.ksG.sub.ksA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsC.sub.ds 27 2836 A.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.ksT.sub.k 1197197 N/A N/A 94737 94752 TCAGATTTAGGATGCA T.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 20 2837 G.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 1197198 N/A N/A 94739 94754 ATTCAGATTTAGGATG A.sub.ksT.sub.ksT.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.ds+l 139 2838 A.sub.dsG.sub.dsG.sub.dsA.sub.ksT.sub.ksG.sub.k 1197206 N/A N/A 117327 117342 ATATTGCAATCTGTCT A.sub.ksT.sub.ksA.sub.ksT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.m 63 2844 C.sub.dsT.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ksT.sub.k 1197207 N/A N/A 117328 117343 AATATTGCAATCTGTC A.sub.ksA.sub.ksT.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds 51 2845 T.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ksT.sub.ks.sup.mC.sub.k 1197208 N/A N/A 117329 117344 TAATATTGCAATCTGT T.sub.ksA.sub.ksA.sub.ksT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds 66 2846 A.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksT.sub.k 1197209 N/A N/A 117331 117346 TGTAATATTGCAATCT T.sub.ksG.sub.ksT.sub.ksA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.m 33 2847 C.sub.dsA.sub.dsA.sub.dsT.sub.ks.sup.mC.sub.ksT.sub.k 1197210 N/A N/A 117332 117347 ATGTAATATTGCAATC A.sub.ksT.sub.ksG.sub.ksT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.ds 105 2848 G.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ksT.sub.ks.sup.mC.sub.k 1197211 N/A N/A 117333 117348 TATGTAATATTGCAAT T.sub.ksA.sub.ksT.sub.ksG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ds 80 2849 T.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ksT.sub.k 1197212 N/A N/A 117335 117350 TTTATGTAATATTGCA T.sub.ksT.sub.ksT.sub.ksA.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.ds 55 2850 A.sub.dsT.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 1197220 N/A N/A 119667 119682 TAAGGTTTCCCAGATT T.sub.ksA.sub.ksA.sub.ksG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.m 32 2851 C.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.ksT.sub.ksT.sub.k 1197221 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA A.sub.ksG.sub.ksT.sub.ksA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.m 42 2852 C.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksA.sub.k 1197222 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG A.sub.ksA.sub.ksG.sub.ksT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds 40 2853 T.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k 1197223 N/A N/A 119671 119686 TAAGTAAGGTTTCCCA T.sub.ksA.sub.ksA.sub.ksG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds 11 2854 T.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k 1197224 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC A.sub.ks.sup.mC.sub.ksT.sub.ksA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.ds 24 2855 G.sub.dsT.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 1197225 N/A N/A 119674 119689 GACTAAGTAAGGTTTC G.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.ds 46 2856 G.sub.dsG.sub.dsT.sub.dsT.sub.ksT.sub.ks.sup.mC.sub.k 1197226 N/A N/A 119675 119690 AGACTAAGTAAGGTTT A.sub.ksG.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds 67 2857 A.sub.dsG.sub.dsG.sub.dsT.sub.ksT.sub.ksT.sub.k 1197227 N/A N/A 119677 119692 TTAGACTAAGTAAGGT T.sub.ksT.sub.ksA.sub.ksG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.ds 64 2858 T.sub.dsA.sub.dsA.sub.dsG.sub.ksG.sub.ksT.sub.k 1198858 N/A N/A 115908 115923 CTCTTATATGGTTTTG .sup.mC.sub.ksT.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ds 29 2842 G.sub.dsG.sub.dsT.sub.ksT.sub.esT.sub.ksT.sub.esG.sub.k 1198859 N/A N/A 115909 115924 ACTCTTATATGGTTTT A.sub.ks.sup.mC.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.ds 33 2859 T.sub.dsG.sub.dsG.sub.ksT.sub.esT.sub.ksT.sub.esT.sub.k 1198860 N/A N/A 115910 115925 AACTCTTATATGGTTT A.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.ds 82 2860 A.sub.dsT.sub.dsG.sub.ksG.sub.esT.sub.ksT.sub.esT.sub.k 1198861 N/A N/A 115911 115926 CAACTCTTATATGGTT .sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ds 100 2861 T.sub.dsA.sub.dsT.sub.ksG.sub.esG.sub.ksT.sub.esT.sub.k 1198862 N/A N/A 115913 115928 GACAACTCTTATATGG G.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds 72 2862 T.sub.dsA.sub.dsT.sub.ksA.sub.esT.sub.ksG.sub.esG.sub.k 1198872 N/A N/A 117755 117770 TGTATGTCAGAAGAGT T.sub.ksG.sub.ksT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds 8 2863 A.sub.dsA.sub.ksG.sub.esA.sub.ksG.sub.esT.sub.k 1198873 N/A N/A 117757 117772 AGTGTATGTCAGAAGA A.sub.ksG.sub.ksT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 4 2864 A.sub.dsG.sub.ksA.sub.esA.sub.ksG.sub.esA.sub.k 1198874 N/A N/A 117758 117773 AAGTGTATGTCAGAAG A.sub.ksA.sub.ksG.sub.dsT.sub.dsG.sub.dsT.sub.daA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 2 2865 C.sub.dsA.sub.ksG.sub.esA.sub.ksA.sub.esG.sub.k 1198875 N/A N/A 117759 117774 AAAGTGTATGTCAGAA A.sub.ksA.sub.ksA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ds 5 2866 T.sub.ds.sup.mC.sub.ksA.sub.esG.sub.ksA.sub.esA.sub.k 1198876 N/A N/A 117760 117775 TAAAGTGTATGTCAGA T.sub.ksA.sub.ksA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 31 2867 G.sub.dsT.sub.ks.sup.mC.sub.esA.sub.ksG.sub.esA.sub.k 1198877 N/A N/A 117761 117776 TTAAAGTGTATGTCAG T.sub.ksT.sub.ksA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.ds 11 2868 T.sub.dsG.sub.ksT.sub.es.sup.mC.sub.ksA.sub.esG.sub.k 1198878 N/A N/A 117762 117777 TTTAAAGTGTATGTCA T.sub.ksT.sub.ksT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.ds 42 2869 A.sub.dsT.sub.ksG.sub.esT.sub.ks.sup.mC.sub.esA.sub.k 1198879 N/A N/A 117763 117778 CTTTAAAGTGTATGTC .sup.mC.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.ds 29 1634 T.sub.dsA.sub.ksT.sub.esG.sub.ksT.sub.es.sup.mC.sub.k 1198880 N/A N/A 117765 117780 AACTTTAAAGTGTATG A.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ds 98 2870 T.sub.dsG.sub.ksT.sub.esA.sub.ksT.sub.esG.sub.k
TABLE-US-00048 Table 48 Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2 SEQ SEQ ID ID SEQ ID SEQ ID YAP1 NO: 1 NO: 1 NO: 2 NO: 2 SEQ SEQ Compound Start Stop Start Stop YAP1 ID Number Site Site Site Site Sequence (5' to 3') CHEMSITRY NOTATION (% UT) NO 715487 3630 3645 124655 124670 ATTACTTCATAGCTTA A.sub.ksT.sub.ksT.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 34 52 T.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.ksA.sub.k 716524 4443 4458 125468 125483 ACTGAGGTATAACTGG A.sub.ks.sup.mC.sub.ksT.sub.ksG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 59 392 A.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksG.sub.k 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 15 810 G.sub.dsT.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 958590 4439 4454 125464 125479 AGGTATAACTGGGCAA A.sub.ksG.sub.ksG.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds 18 905 G.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.ksA.sub.k 1009395 4442 4457 125467 125482 CTGAGGTATAACTGGG .sup.mC.sub.ksT.sub.ksG.sub.ksA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.ds 43 2801 A.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ksG.sub.ksG.sub.k 1009396 4444 4459 106028 106043 CACTGAGGTATAACTG .sup.mC.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds 41 2802 125469 125484 A.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k 1009397 4446 4461 106030 106045 AACACTGAGGTATAAC A.sub.ksA.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.ds 44 2816 125471 125486 G.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.ksA.sub.ks.sup.mC.sub.k 1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC G.sub.ksA.sub.ksA.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 20 2800 C.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 1074726 4438 4453 125463 125478 GGTATAACTGGGCAAA G.sub.ksG.sub.ksT.sub.ksA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds 23 1427 G.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ksA.sub.k 1074727 4440 4455 125465 125480 GAGGTATAACTGGGCA G.sub.ksA.sub.ksG.sub.ksG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds 51 1503 T.sub.dsG.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 1074728 4441 4456 125466 125481 TGAGGTATAACTGGGC T.sub.ksG.sub.ksA.sub.ksG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.m 14 1580 C.sub.dsT.sub.dsG.sub.dsG.sub.ksG.sub.ks.sup.mC.sub.k 1076439 N/A N/A 115906 115921 CTTATATGGTTTTGTG .sup.mC.sub.ksT.sub.ksT.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.ds 31 2788 T.sub.dsT.sub.dsT.sub.dsG.sub.ksT.sub.ksG.sub.k 1076456 N/A N/A 117763 117778 CTTTAAAGTGTATGTC .sup.mC.sub.ksT.sub.ksT.sub.ksT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.ds 44 1634 T.sub.dsA.sub.dsT.sub.dsG.sub.ksT.sub.ks.sup.mC.sub.k 1097224 N/A N/A 115908 115923 CTCTTATATGGTTTTG .sup.mC.sub.ksT.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ds 22 2842 G.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ksT.sub.ksG.sub.k 1097247 N/A N/A 117760 117775 TAAAGTGTATGTCAGA T.sub.ksA.sub.ksA.sub.ksA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 9 2867 G.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksA.sub.k 1197199 N/A N/A 115903 115918 ATATGGTTTTGTGTGT A.sub.ksT.sub.ksA.sub.ksT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds 75 2839 G.sub.dsT.sub.dsG.sub.dsT.sub.ksG.sub.ksT.sub.k 1197200 N/A N/A 115905 115920 TTATATGGTTTTGTGT T.sub.ksT.sub.ksA.sub.ksT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds 49 2840 T.sub.dsT.sub.dsG.sub.dsT.sub.ksG.sub.ksT.sub.k 1197201 N/A N/A 115907 115922 TCTTATATGGTTTTGT T.sub.ks.sup.mC.sub.ksT.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.ds 46 2841 T.sub.dsT.sub.dsT.sub.dsT.sub.ksG.sub.ksT.sub.k 1197202 N/A N/A 115909 115924 ACTCTTATATGGTTTT A.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.ds 27 2859 T.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ksT.sub.ksT.sub.k 1197203 N/A N/A 115910 115925 AACTCTTATATGGTTT A.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.ds 68 2860 A.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.ksT.sub.ksT.sub.k 1197204 N/A N/A 115911 115926 CAACTCTTATATGGTT .sup.mC.sub.ksA.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ds 89 2861 T.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.ksT.sub.ksT.sub.k 1197205 N/A N/A 115913 115928 GACAACTCTTATATGG G.sub.ksA.sub.ks.sup.mC.sub.ksA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds 67 2862 T.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ksG.sub.ksG.sub.k 1197213 N/A N/A 117755 117770 TGTATGTCAGAAGAGT T.sub.ksG.sub.ksT.sub.ksA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds 5 2863 A.sub.dsA.sub.dsG.sub.dsA.sub.ksG.sub.ksT.sub.k 1197214 N/A N/A 117757 117772 AGTGTATGTCAGAAGA A.sub.ksG.sub.ksT.sub.ksG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 5 2864 A.sub.dsG.sub.dsA.sub.dsA.sub.ksG.sub.ksA.sub.k 1197215 N/A N/A 117758 117773 AAGTGTATGTCAGAAG A.sub.ksA.sub.ksG.sub.ksT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 13 2865 C.sub.dsA.sub.dsG.sub.dsA.sub.ksA.sub.ksG.sub.k 1197216 N/A N/A 117759 117774 AAAGTGTATGTCAGAA A.sub.ksA.sub.ksA.sub.ksG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ds 12 2866 T.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ksA.sub.ksA.sub.k 1197217 N/A N/A 117761 117776 TTAAAGTGTATGTCAG T.sub.ksT.sub.ksA.sub.ksA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.ds 8 2868 T.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k 1197218 N/A N/A 117762 117777 TTTAAAGTGTATGTCA T.sub.ksT.sub.ksT.sub.ksA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.ds 29 2869 A.sub.dsT.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ksA.sub.k 1197219 N/A N/A 117765 117780 AACTTTAAAGTGTATG A.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ds 71 2870 T.sub.dsG.sub.dsT.sub.dsA.sub.ksT.sub.ksG.sub.k 1198284 2524 2539 123549 123564 TGTCTCATGCCTTATA T.sub.ksG.sub.ksT.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m 27 2803 C.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ksA.sub.esT.sub.ksA.sub.e 1198285 2526 2541 123551 123566 ATTGTCTCATGCCTTA A.sub.ksT.sub.ksT.sub.ksG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 13 2804 T.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.esT.sub.ksA.sub.e 1198286 2527 2542 123552 123567 AATTGTCTCATGCCTT A.sub.ksA.sub.ksT.sub.ksT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds 17 2805 A.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ks.sup.mC.sub.esT.sub.ksT.sub.e 1198287 2528 2543 123553 123568 AAATTGTCTCATGCCT A.sub.ksA.sub.ksA.sub.ksT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 13 443 C.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.es.sup.mC.sub.ksT.sub.e 1198288 2529 2544 123554 123569 GAAATTGTCTCATGCC G.sub.ksA.sub.ksA.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 10 2800 C.sub.dsA.sub.dsT.sub.ksG.sub.es.sup.mC.sub.ks.sup.mC.sub.e 1198289 2530 2545 123555 123570 GGAAATTGTCTCATGC G.sub.ksG.sub.ksA.sub.ksA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 12 2806 T.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.esG.sub.ks.sup.mC.sub.e 1198290 2531 2546 123556 123571 TGGAAATTGTCTCATG T.sub.ksG.sub.ksG.sub.ksA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 15 2807 C.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.esT.sub.ksG.sub.e 1198291 2532 2547 123557 123572 ATGGAAATTGTCTCAT A.sub.ksT.sub.ksG.sub.ksG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds 58 2808 T.sub.ds.sup.mC.sub.dsT.sub.ks.sup.mC.sub.esA.sub.ksT.sub.e 1198292 2534 2549 123559 123574 ATATGGAAATTGTCTC A.sub.ksT.sub.ksA.sub.ksT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.ds 58 656 T.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.esT.sub.ks.sup.mC.sub.e 1198293 2560 2575 123585 123600 AGTATGTGGCAATAAT A.sub.ksG.sub.ksT.sub.ksA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds 25 2809 A.sub.dsA.sub.dsT.sub.ksA.sub.esA.sub.ksT.sub.e 1198294 2562 2577 123587 123602 AGAGTATGTGGCAATA A.sub.ksG.sub.ksA.sub.ksG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.ds 13 2810 G.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.esT.sub.ksA.sub.e 1198295 2563 2578 123588 123603 TAGAGTATGTGGCAAT T.sub.ksA.sub.ksG.sub.ksA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds 15 2811 G.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.esA.sub.ksT.sub.e 1198296 2564 2579 123589 123604 TTAGAGTATGTGGCAA T.sub.ksT.sub.ksA.sub.ksG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ds 29 963 T.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.esA.sub.ksA.sub.e 1198297 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 8 810 G.sub.dsT.sub.dsG.sub.ksG.sub.es.sup.mC.sub.ksA.sub.e 1198298 2566 2581 123591 123606 TATTAGAGTATGTGGC T.sub.ksA.sub.ksT.sub.ksT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds 23 2812 T.sub.dsG.sub.dsT.sub.ksG.sub.esG.sub.ks.sup.mC.sub.e 1198299 2567 2582 123592 123607 ATATTAGAGTATGTGG A.sub.ksA.sub.ksT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds 27 2813 A.sub.dsT.sub.dsG.sub.ksT.sub.esG.sub.ksG.sub.e 1198300 2568 2583 123593 123608 TATATTAGAGTATGTG T.sub.ksA.sub.ksT.sub.ksA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds 60 2814 T.sub.dsA.sub.dsT.sub.ksG.sub.esT.sub.ksG.sub.e 1198301 2570 2585 123595 123610 TCTATATTAGAGTATG T.sub.ks.sup.mC.sub.ksT.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 43 887 A.sub.dsG.sub.dsT.sub.ksA.sub.esT.sub.ksG.sub.e 1198307 4595 4610 125620 125635 TTACATTAGGAACAAG T.sub.ksT.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.ds 49 2817 A.sub.dsA.sub.ds.sup.mC.sub.ksA.sub.esA.sub.ksG.sub.e 1198308 4597 4612 125622 125637 TTTTACATTAGGAACA T.sub.ksT.sub.ksT.sub.ksT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.ds 68 2818 G.sub.dsG.sub.dsA.sub.ksA.sub.es.sup.mC.sub.ksA.sub.e 1198309 4598 4613 125623 125638 CTTTTACATTAGGAAC .sup.mC.sub.ksT.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.ds 85 1124 A.sub.dsG.sub.dsG.sub.ksA.sub.esA.sub.ks.sup.mC.sub.e 1198310 4599 4614 125624 125639 ACTTTTACATTAGGAA A.sub.ks.sup.mC.sub.ksT.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds 28 2819 T.sub.dsT.sub.dsA.sub.dsG.sub.ksG.sub.esA.sub.ksA.sub.e 1198311 4600 4615 125625 125640 CACTTTTACATTAGGA .sup.mC.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds 39 1200 A.sub.dsT.sub.dsT.sub.dsA.sub.ksG.sub.esG.sub.ksA.sub.e 1198312 4601 4616 125626 125641 GCACTTTTACATTAGG G.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.m 7 1276 C.sub.dsA.sub.dsT.sub.dsT.sub.ksA.sub.esG.sub.ksG.sub.e 1198313 4602 4617 125627 125642 AGCACTTTTACATTAG A.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds 31 2820 A.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ksT.sub.esA.sub.ksG.sub.e 1198314 4603 4618 125628 125643 AAGCACTTTTACATTA A.sub.ksA.sub.ksG.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 82 2821 T.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.esT.sub.ksA.sub.e 1198315 4605 4620 125630 125645 TTAAGCACTTTTACAT T.sub.ksT.sub.ksA.sub.ksA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds 85 2822 T.sub.dsT.sub.dsT.sub.dsA.sub.ks.sup.mC.sub.esA.sub.ksT.sub.e 1198316 4795 4810 125820 125835 GGAAGATCTGAAACTC G.sub.ksG.sub.ksA.sub.ksA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds 49 2823 A.sub.dsA.sub.dsA.sub.ks.sup.mC.sub.esT.sub.ks.sup.mC.sub.e 1198317 4797 4812 125822 125837 TTGGAAGATCTGAAAC T.sub.ksT.sub.ksG.sub.ksG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds 74 2824 T.sub.dsG.sub.dsA.sub.ksA.sub.esA.sub.ks.sup.mC.sub.e 1198318 4798 4813 125823 125838 TTTGGAAGATCTGAAA T.sub.ksT.sub.ksT.sub.ksG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.m 120 2825 C.sub.dsT.sub.dsG.sub.ksA.sub.esA.sub.ksA.sub.e 1198319 4799 4814 125824 125839 CTTTGGAAGATCTGAA .sup.mC.sub.ksT.sub.ksT.sub.ksT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ds 47 2826 T.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.esA.sub.ksA.sub.e 1198320 4800 4815 125825 125840 GCTTTGGAAGATCTGA G.sub.ks.sup.mC.sub.ksT.sub.ksT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ds 26 2044 A.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.esG.sub.ksA.sub.e 1198321 4801 4816 125826 125841 TGCTTTGGAAGATCTG T.sub.ksG.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.ds 45 2121 G.sub.dsA.sub.dsT.sub.ks.sup.mC.sub.esT.sub.ksG.sub.e 1198322 4802 4817 125827 125842 GTGCTTTGGAAGATCT G.sub.ksT.sub.ksG.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.ds 48 2827 A.sub.dsG.sub.dsA.sub.ksT.sub.es.sup.mC.sub.ksT.sub.e 1198323 4803 4818 125828 125843 AGTGCTTTGGAAGATC A.sub.ksG.sub.ksT.sub.ksG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds 32 2828 A.sub.dsA.sub.dsG.sub.ksA.sub.esT.sub.ks.sup.mC.sub.e 1198324 4805 4820 125830 125845 ATAGTGCTTTGGAAGA A.sub.ksT.sub.ksA.sub.ksG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 53 2829 G.sub.dsG.sub.dsA.sub.ksA.sub.esG.sub.ksA.sub.e 1198325 N/A N/A 94729 94744 AGGATGCATGGTTTTT A.sub.ksG.sub.ksG.sub.ksA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.ds 34 2830 G.sub.dsT.sub.dsT.sub.ksT.sub.esT.sub.ksT.sub.e 1198326 N/A N/A 94731 94746 TTAGGATGCATGGTTT T.sub.ksT.sub.ksA.sub.ksG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds 84 2831 T.sub.dsG.sub.dsG.sub.ksT.sub.esT.sub.ksT.sub.e 1198327 N/A N/A 94732 94747 TTTAGGATGCATGGTT T.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 29 2832 A.sub.dsT.sub.dsG.sub.ksG.sub.esT.sub.ksT.sub.e 1198328 N/A N/A 94733 94748 ATTTAGGATGCATGGT A.sub.ksT.sub.ksT.sub.ksT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m 42 2833 C.sub.dsA.sub.dsT.sub.ksG.sub.esG.sub.ksT.sub.e 1198329 N/A N/A 94734 94749 GATTTAGGATGCATGG G.sub.ksA.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.ds 36 2834 G.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.esG.sub.ksG.sub.e 1198330 N/A N/A 94735 94750 AGATTTAGGATGCATG A.sub.ksG.sub.ksA.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds 27 2934 T.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.esT.sub.ksG.sub.e 1198331 N/A N/A 94736 94751 CAGATTTAGGATGCAT .sup.mC.sub.ksA.sub.ksG.sub.ksA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.ds 26 2836 A.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.esA.sub.ksT.sub.e 1198332 N/A N/A 94737 94752 TCAGATTTAGGATGCA T.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 58 2837 G.sub.dsA.sub.dsT.sub.ksG.sub.es.sup.mC.sub.ksA.sub.e 1198333 N/A N/A 94739 94754 ATTCAGATTTAGGATG A.sub.ksT.sub.ksT.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.ds 77 2838 A.sub.dsG.sub.dsG.sub.ksA.sub.esT.sub.ksG.sub.e 1198343 N/A N/A 117325 117340 ATTGCAATCTGTCTGA A.sub.ksT.sub.ksT.sub.ksG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds 39 2843 T.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.esG.sub.ksA.sub.e 1198344 N/A N/A 117327 117342 ATATTGCAATCTGTCT A.sub.ksT.sub.ksA.sub.ksT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.m 55 2844 C.sub.dsT.sub.dsG.sub.ksT.sub.es.sup.mC.sub.ksT.sub.e 1198345 N/A N/A 117328 117343 AATATTGCAATCTGTC A.sub.ksA.sub.ksT.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds 75 2845 T.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.esT.sub.ks.sup.mC.sub.e 1198346 N/A N/A 117329 117344 TAATATTGCAATCTGT T.sub.ksA.sub.ksA.sub.ksT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds 40 2846 A.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.esG.sub.ksT.sub.e 1198347 N/A N/A 117330 117345 GTAATATTGCAATCTG G.sub.ksT.sub.ksA.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 14 1404 A.sub.dsA.sub.dsT.sub.ks.sup.mC.sub.esT.sub.ksG.sub.e 1198348 N/A N/A 117331 117346 TGTAATATTGCAATCT T.sub.ksG.sub.ksT.sub.ksA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.m 40 2847 C.sub.dsA.sub.dsA.sub.ksT.sub.es.sup.mC.sub.ksT.sub.e
TABLE-US-00049 TABLE 49 Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2 SEQ SEQ ID ID SEQ ID SEQ ID YAP1 NO: 1 NO: 1 NO: 2 NO: 2 SEQ SEQ Compound Start Stop Start Stop YAP1 ID Number Site Site Site Site Sequence (5' to 3') CHEMSITRY NOTATION (% UT) NO 715487 3630 3645 124655 124670 ATTACTTCATAGCTTA A.sub.ksT.sub.ksT.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 30 52 T.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.ksA.sub.ks 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 13 810 G.sub.dsT.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC G.sub.ksA.sub.ksA.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 10 2800 C.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 1095547 4443 4458 125468 125483 ACTGAGGTATAACTGG A.sub.ks.sup.mC.sub.ksT.sub.ksG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 42 392 A.sub.dsA.sub.ds.sup.mC.sub.ksT.sub.esG.sub.ksG.sub.e 1095565 4441 4456 125466 125481 TGAGGTATAACTGGGC T.sub.ksG.sub.ksA.sub.ksG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.m 25 1580 C.sub.dsT.sub.dsG.sub.ksG.sub.esG.sub.ks.sup.mC.sub.e 1095566 4442 4457 125467 125482 CTGAGGTATAACTGGG .sup.mC.sub.ksT.sub.ksG.sub.ksA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.m 47 2801 A.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.esG.sub.ksG.sub.e 1095567 4444 4459 125469 125484 CACTGAGGTATAACTG .sup.mC.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds 92 2802 A.sub.dsT.sub.dsA.sub.dsA.sub.ks.sup.mC.sub.esT.sub.ksG.sub.e 1198302 4436 4451 125461 125476 TATAACTGGGCAAATT T.sub.ksA.sub.ksT.sub.ksA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.m 67 2815 C.sub.dsA.sub.dsA.sub.ksA.sub.esT.sub.ksT.sub.e 1198303 4438 4453 125463 125478 GGTATAACTGGGCAAA G.sub.ksG.sub.ksT.sub.ksA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds 27 1427 G.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.esA.sub.ksA.sub.e 1198304 4439 4454 125464 125479 AGGTATAACTGGGCAA A.sub.ksG.sub.ksG.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds 33 905 G.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.esA.sub.ksA.sub.e 1198305 4440 4455 125465 125480 GAGGTATAACTGGGCA G.sub.ksA.sub.ksG.sub.ksG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds 78 1503 T.sub.dsG.sub.dsG.sub.ksG.sub.es.sup.mC.sub.ksA.sub.e 1198306 4446 4461 125471 125486 AACACTGAGGTATAAC A.sub.ksA.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.ds 64 2816 G.sub.dsT.sub.dsA.sub.dsT.sub.ksA.sub.esA.sub.ks.sup.mC.sub.e 1198334 N/A N/A 115903 115918 ATATGGTTTTGTGTGT A.sub.ksT.sub.ksA.sub.ksT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds 57 2839 G.sub.dsT.sub.dsG.sub.ksT.sub.esG.sub.ksT.sub.e 1198335 N/A N/A 115905 115920 TTATATGGTTTTGTGT T.sub.ksT.sub.ksA.sub.ksT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds 26 2840 T.sub.dsT.sub.dsG.sub.ksT.sub.esG.sub.ksT.sub.e 1198336 N/A N/A 115906 115921 CTTATATGGTTTTGTG .sup.mC.sub.ksT.sub.ksT.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.ds 31 2788 T.sub.dsT.sub.dsT.sub.ksG.sub.esT.sub.ksG.sub.e 1198337 N/A N/A 115907 115922 TCTTATATGGTTTTGT T.sub.ks.sup.mC.sub.ksT.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.ds 26 2841 T.sub.dsT.sub.dsT.sub.ksT.sub.esG.sub.ksT.sub.e 1198338 N/A N/A 115908 115923 CTCTTATATGGTTTTG .sup.mC.sub.ksT.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ds 24 2842 G.sub.dsG.sub.dsT.sub.dsT.sub.ksT.sub.esT.sub.ksG.sub.e 1198339 N/A N/A 115909 115924 ACTCTTATATGGTTTT A.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.ds 25 2859 T.sub.dsG.sub.dsG.sub.dsT.sub.ksT.sub.esT.sub.ksT.sub.e 1198340 N/A N/A 115910 115925 AACTCTTATATGGTTT A.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.ds 123 2860 A.sub.dsT.sub.dsG.sub.dsG.sub.ksT.sub.esT.sub.ksT.sub.e 1198341 N/A N/A 115911 115926 CAACTCTTATATGGTT .sup.mC.sub.ksA.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ds 90 2861 T.sub.dsA.sub.dsT.sub.dsG.sub.ksG.sub.esT.sub.ksT.sub.e 1198342 N/A N/A 115913 115928 GACAACTCTTATATGG G.sub.ksA.sub.ks.sup.mC.sub.ksA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds 101 2862 T.sub.dsA.sub.dsT.sub.dsA.sub.ksT.sub.esG.sub.ksG.sub.e 1198349 N/A N/A 117332 117347 ATGTAATATTGCAATC A.sub.ksT.sub.ksG.sub.ksT.sub.dsA.sub.dsA.sub.dsT.sub.ds+ AdsT.sub.dsT.sub.ds 85 2848 G.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.esT.sub.ks.sup.mC.sub.e 1198350 N/A N/A 117333 117348 TATGTAATATTGCAAT T.sub.ksA.sub.ksT.sub.ksG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ds 83 2849 T.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.esA.sub.ksT.sub.e 1198351 N/A N/A 117335 117350 TTTATGTAATATTGCA T.sub.ksT.sub.ksT.sub.ksA.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.ds 40 2850 A.sub.dsT.sub.dsT.sub.ksG.sub.es.sup.mC.sub.ksA.sub.e 1198352 N/A N/A 117755 117770 TGTATGTCAGAAGAGT T.sub.ksG.sub.ksT.sub.ksA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds 7 2863 A.sub.dsA.sub.dsG.sub.ksA.sub.esG.sub.ksT.sub.e 1198353 N/A N/A 117757 117772 AGTGTATGTCAGAAGA A.sub.ksG.sub.ksT.sub.ksG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 8 2864 A.sub.dsG.sub.dsA.sub.ksA.sub.esG.sub.ksA.sub.e 1198354 N/A N/A 117758 117773 AAGTGTATGTCAGAAG A.sub.ksA.sub.ksG.sub.ksT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 6 2865 C.sub.dsA.sub.dsG.sub.ksA.sub.esA.sub.ksG.sub.e 1198355 N/A N/A 117759 117774 AAAGTGTATGTCAGAA A.sub.ksA.sub.ksA.sub.ksG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ds 6 2866 T.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.esA.sub.ksA.sub.e 1198356 N/A N/A 117760 117775 TAAAGTGTATGTCAGA T.sub.ksA.sub.ksA.sub.ksA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 5 2867 G.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.esG.sub.ksA.sub.e 1198357 N/A N/A 117761 117776 TTAAAGTGTATGTCAG T.sub.ksT.sub.ksA.sub.ksA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.ds 21 2868 T.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.esA.sub.ksG.sub.e 1198358 N/A N/A 117762 117777 TTTAAAGTGTATGTCA T.sub.ksT.sub.ksT.sub.ksA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.ds 15 2869 A.sub.dsT.sub.dsG.sub.ksT.sub.es.sup.mC.sub.ksA.sub.e 1198359 N/A N/A 117763 117778 CTTTAAAGTGTATGTC .sup.mC.sub.ksT.sub.ksT.sub.ksT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.ds 28 1634 T.sub.dsA.sub.dsT.sub.ksG.sub.esT.sub.ks.sup.mC.sub.e 1198360 N/A N/A 117765 117780 AACTTTAAAGTGTATG A.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ds 74 2870 T.sub.dsG.sub.dsT.sub.ksA.sub.esT.sub.ksG.sub.e 1198361 N/A N/A 119667 119682 TAAGGTTTCCCAGATT T.sub.ksA.sub.ksA.sub.ksG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.m 39 2851 C.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ksA.sub.esT.sub.ksT.sub.e 1198362 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA A.sub.ksG.sub.ksT.sub.ksA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.m 24 2852 C.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.esG.sub.ksA.sub.e 1198363 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG A.sub.ksA.sub.ksG.sub.ksT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds 55 2853 T.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.esA.sub.ksG.sub.e 1198364 N/A N/A 119671 119686 TAAGTAAGGTTTCCCA T.sub.ksA.sub.ksA.sub.ksG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds 29 2854 T.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.es.sup.mC.sub.ksA.sub.e 1198365 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC .sup.mC.sub.ksT.sub.ksA.sub.ksA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.ds 13 1101 T.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.es.sup.mC.sub.ks.sup.mC.sub.e 1198366 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC A.sub.ks.sup.mC.sub.ksT.sub.ksA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.ds 45 2855 G.sub.dsT.sub.dsT.sub.ksT.sub.es.sup.mC.sub.ks.sup.mC.sub.e 1198367 N/A N/A 119674 119689 GACTAAGTAAGGTTTC G.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.ds 58 2856 G.sub.dsG.sub.dsT.sub.ksT.sub.esT.sub.ks.sup.mC.sub.e 1198368 N/A N/A 119675 119690 AGACTAAGTAAGGTTT A.sub.ksG.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds 79 2857 A.sub.dsG.sub.dsG.sub.ksT.sub.esT.sub.ksT.sub.e 1198369 N/A N/A 119677 119692 TTAGACTAAGTAAGGT T.sub.ksT.sub.ksA.sub.ksG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.ds 51 2858 T.sub.dsA.sub.dsA.sub.ksG.sub.esG.sub.ksT.sub.e 1198542 2524 2539 123549 123564 TGTCTCATGCCTTATA T.sub.ksG.sub.ksT.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m 23 2803 C.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ksA.sub.ksT.sub.ksA.sub.e 1198543 2526 2541 123551 123566 ATTGTCTCATGCCTTA A.sub.ksT.sub.ksT.sub.ksG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 15 2804 T.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ksT.sub.ksA.sub.e 1198544 2527 2542 123552 123567 AATTGTCTCATGCCTT A.sub.ksA.sub.ksT.sub.ksT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds 21 2805 A.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksT.sub.ksT.sub.e 1198545 2528 2543 123553 123568 AAATTGTCTCATGCCT A.sub.ksA.sub.ksA.sub.ksT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 32 443 C.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksT.sub.e 1198546 2529 2544 123554 123569 GAAATTGTCTCATGCC G.sub.ksA.sub.ksA.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 11 2800 C.sub.dsA.sub.dsT.sub.ksG.sub.ks.sup.mC.sub.ks.sup.mC.sub.e 1198547 2530 2545 123555 123570 GGAAATTGTCTCATGC G.sub.ksG.sub.ksA.sub.ksA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 27 2806 T.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.ksG.sub.ks.sup.mC.sub.e 1198548 2531 2546 123556 123571 TGGAAATTGTCTCATG T.sub.ksG.sub.ksG.sub.ksA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 26 2807 C.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.ksT.sub.ksG.sub.e 1198549 2532 2547 123557 123572 ATGGAAATTGTCTCAT A.sub.ksT.sub.ksG.sub.ksG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds 84 2808 T.sub.ds.sup.mC.sub.dsT.sub.ks.sup.mC.sub.ksA.sub.ksT.sub.e 1198550 2534 2549 123559 123574 ATATGGAAATTGTCTC A.sub.ksT.sub.ksA.sub.ksTasG.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.ds 17 656 T.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.e 1198551 2560 2575 123585 123600 AGTATGTGGCAATAAT A.sub.ksG.sub.ksT.sub.ksA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds 34 2809 A.sub.dsA.sub.dsT.sub.ksA.sub.ksA.sub.ksT.sub.e 1198552 2562 2577 123587 123602 AGAGTATGTGGCAATA A.sub.ksG.sub.ksA.sub.ksG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.ds 17 2810 G.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ksT.sub.ksA.sub.e 1198553 2563 2578 123588 123603 TAGAGTATGTGGCAAT T.sub.ksA.sub.ksG.sub.ksA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds 13 2811 G.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.ksA.sub.ksT.sub.e 1198554 2564 2579 123589 123604 TTAGAGTATGTGGCAA T.sub.ksT.sub.ksA.sub.ksG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ds 16 963 T.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.ksA.sub.e 1198555 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 11 810 G.sub.dsT.sub.dsG.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.e 1198556 2566 2581 123591 123606 TATTAGAGTATGTGGC T.sub.ksA.sub.ksT.sub.ksT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds 25 2812 T.sub.dsG.sub.dsT.sub.ksG.sub.ksG.sub.ks.sup.mC.sub.e 1198557 2567 2582 123592 123607 ATATTAGAGTATGTGG A.sub.ksT.sub.ksA.sub.ksT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds 16 2813 A.sub.dsT.sub.dsG.sub.ksT.sub.ksG.sub.ksG.sub.e 1198558 2568 2583 123593 123608 TATATTAGAGTATGTG T.sub.ksA.sub.ksT.sub.ksA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds 46 2814 T.sub.dsA.sub.dsT.sub.ksG.sub.ksT.sub.ksG.sub.e 1198559 2570 2585 123595 123610 TCTATATTAGAGTATG T.sub.ks.sup.mC.sub.ksT.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 55 887 A.sub.dsG.sub.dsT.sub.ksA.sub.ksT.sub.ksG.sub.e 1198565 4595 4610 125620 125635 TTACATTAGGAACAAG T.sub.ksT.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.ds 53 2817 A.sub.dsA.sub.ds.sup.mC.sub.ksA.sub.ksA.sub.ksG.sub.e 1198566 4597 4612 125622 125637 TTTTACATTAGGAACA T.sub.ksT.sub.ksT.sub.ksT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.ds 83 2818 G.sub.dsG.sub.dsA.sub.ksA.sub.ks.sup.mC.sub.ksA.sub.e 1198567 4598 4613 125623 125638 CTTTTACATTAGGAAC .sup.mC.sub.ksT.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.ds 54 1124 A.sub.dsG.sub.dsG.sub.ksA.sub.ksA.sub.ks.sup.mC.sub.e 1198568 4599 4614 125624 125639 ACTTTTACATTAGGAA A.sub.ks.sup.mC.sub.ksT.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds 31 2819 T.sub.dsT.sub.dsA.sub.dsG.sub.ksG.sub.ksA.sub.ksA.sub.e 1198569 4600 4615 125625 125640 CACTTTTACATTAGGA .sup.mC.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds 14 1200 A.sub.dsT.sub.dsT.sub.dsA.sub.ksG.sub.ksG.sub.ksA.sub.e 1198570 4601 4616 125626 125641 GCACTTTTACATTAGG G.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.m 15 1276 C.sub.dsA.sub.dsT.sub.dsT.sub.ksA.sub.ksG.sub.ksG.sub.e 1198571 4602 4617 125627 125642 AGCACTTTTACATTAG A.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds 32 2820 A.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ksT.sub.ksA.sub.ksG.sub.e 1198572 4603 4618 125628 125643 AAGCACTTTTACATTA A.sub.ksA.sub.ksG.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 53 2821 T.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.ksT.sub.ksA.sub.e 1198573 4605 4620 125630 125645 TTAAGCACTTTTACAT T.sub.ksT.sub.ksA.sub.ksA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds 76 2822 T.sub.dsT.sub.dsT.sub.dsA.sub.ks.sup.mC.sub.ksA.sub.ksT.sub.e 1198574 4795 4810 125820 125835 GGAAGATCTGAAACTC G.sub.ksG.sub.ksA.sub.ksA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds 37 2823 A.sub.dsA.sub.dsA.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.e 1198575 4797 4812 125822 125837 TTGGAAGATCTGAAAC T.sub.ksT.sub.ksG.sub.ksG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds 94 2824 T.sub.dsG.sub.dsA.sub.ksA.sub.ksA.sub.ks.sup.mC.sub.e 1198576 4798 4813 125823 125838 TTTGGAAGATCTGAAA T.sub.ksT.sub.ksT.sub.ksG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.m 92 2825 C.sub.dsT.sub.dsG.sub.ksA.sub.ksA.sub.ksA.sub.e 1198577 4799 4814 125824 125839 CTTTGGAAGATCTGAA .sup.mC.sub.ksT.sub.ksT.sub.ksT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ds 40 2826 T.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksA.sub.ksA.sub.e 1198578 4800 4815 125825 125840 GCTTTGGAAGATCTGA .sup.mC.sub.ksT.sub.ksT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ds 18 2044 A.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.ksA.sub.e 1198579 4801 4816 125826 125841 TGCTTTGGAAGATCTG T.sub.ksG.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.ds 34 2121 G.sub.dsA.sub.dsT.sub.ks.sup.mC.sub.ksT.sub.ksG.sub.e 1198580 4802 4817 125827 125842 GTGCTTTGGAAGATCT G.sub.ksT.sub.ksG.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.ds 43 2827 A.sub.dsG.sub.dsA.sub.ksT.sub.ks.sup.mC.sub.ksT.sub.e 1198581 4803 4818 125828 125843 AGTGCTTTGGAAGATC A.sub.ksG.sub.ksT.sub.ksG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds 42 2828 A.sub.dsA.sub.dsG.sub.ksA.sub.ksT.sub.ks.sup.mC.sub.e 1198582 4805 4820 125830 125845 ATAGTGCTTTGGAAGA A.sub.ksT.sub.ksA.sub.ksG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 63 2829 G.sub.dsG.sub.dsA.sub.ksA.sub.ksG.sub.ksA.sub.e 1198583 N/A N/A 94729 94744 AGGATGCATGGTTTTT A.sub.ksG.sub.ksG.sub.ksA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.ds 27 2830 G.sub.dsT.sub.dsT.sub.ksT.sub.ksT.sub.ksT.sub.e 1198584 N/A N/A 94731 94746 TTAGGATGCATGGTTT T.sub.ksT.sub.ksA.sub.ksG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 37 2831 T.sub.dsG.sub.dsG.sub.ksT.sub.ksT.sub.ksT.sub.e
TABLE-US-00050 TABLE 50 Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2 SEQ SEQ ID ID SEQ ID SEQ ID YAP1 NO: 1 NO: 1 NO: 2 NO: 2 SEQ SEQ Compound Start Stop Start Stop YAP1 ID Number Site Site Site Site Sequence (5' to 3') CHEMSITRY NOTATION (% UT) NO 715487 3630 3645 124655 124670 ATTACTTCATAGCTTA A.sub.ksT.sub.ksT.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 31 52 T.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.ksA.sub.k 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 12 810 G.sub.dsT.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC G.sub.ksA.sub.ksA.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 16 2800 C.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 1095435 4443 4458 125468 125483 ACTGAGGTATAACTGG A.sub.ks.sup.mC.sub.ksT.sub.ksG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 39 392 A.sub.dsA.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.ksG.sub.e 1095453 4441 4456 125466 125481 TGAGGTATAACTGGGC T.sub.ksG.sub.ksA.sub.ksG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.m 32 1580 C.sub.dsT.sub.dsG.sub.ksG.sub.ksG.sub.ks.sup.mC.sub.e 1095454 4442 4457 125467 125482 CTGAGGTATAACTGGG .sup.mC.sub.ksT.sub.ksG.sub.ksA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.ds 47 2801 A.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksG.sub.ksG.sub.e 1197228 2527 2542 123552 123567 AATTGTCTCATGCCTT A.sub.ksA.sub.ksT.sub.ksT.sub.dsG.sub.ysT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds 25 2805 A.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ksT.sub.k 1197229 2530 2545 123555 123570 GGAAATTGTCTCATGC G.sub.ksG.sub.ksA.sub.ksA.sub.dsA.sub.ysT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 21 2806 T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ksG.sub.ks.sup.mC.sub.k 1197230 2531 2546 123556 123571 TGGAAATTGTCTCATG T.sub.ksG.sub.ksG.sub.ksA.sub.dsA.sub.ysA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 29 2807 C.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.ksG.sub.k 1197231 2532 2547 123557 123572 ATGGAAATTGTCTCAT A.sub.ksT.sub.ksG.sub.ksG.sub.dsA.sub.ysA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds 50 2808 T.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.ksT.sub.k 1197232 2534 2549 123559 123574 ATATGGAAATTGTCTC A.sub.ksT.sub.ksA.sub.ksT.sub.dsG.sub.ysG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.ds 55 656 T.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k 1197233 2563 2578 123588 123603 TAGAGTATGTGGCAAT T.sub.ksA.sub.ksG.sub.ksA.sub.dsG.sub.ysT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds 36 2811 G.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ksT.sub.k 1197234 2564 2579 123589 123604 TTAGAGTATGTGGCAA T.sub.ksT.sub.ksA.sub.ksG.sub.dsA.sub.ysG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ds 24 963 T.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.ksA.sub.k 1197235 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.ysA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 16 810 G.sub.dsT.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 1197236 2566 2581 123591 123606 TATTAGAGTATGTGGC T.sub.ksA.sub.ksT.sub.ksT.sub.dsA.sub.ysG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds 17 2812 T.sub.dsG.sub.dsT.sub.dsG.sub.ksG.sub.ks.sup.mC.sub.k 1197244 4595 4610 125620 125635 TTACATTAGGAACAAG T.sub.ksT.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.ysT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.ds 60 2817 A.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ksG.sub.k 1197245 4597 4612 125622 125637 TTTTACATTAGGAACA T.sub.ksT.sub.ksT.sub.ksT.sub.dsA.sub.ys.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.ds 60 2818 G.sub.dsG.sub.dsA.sub.dsA.sub.ks.sup.mC.sub.ksA.sub.k 1197246 4602 4617 125627 125642 AGCACTTTTACATTAG A.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.dsC.sub.ysT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.m 33 2820 C.sub.dsA.sub.dsT.sub.dsT.sub.ksA.sub.ksG.sub.k 1197247 4603 4618 125628 125643 AAGCACTTTTACATTA A.sub.ksA.sub.ksG.sub.ks.sup.mC.sub.dsA.sub.ys.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 47 2821 T.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ksT.sub.ksA.sub.k 1197280 2524 2539 123549 123564 TGTCUCATGCCTTATA T.sub.ksG.sub.ksT.sub.ks.sup.mC.sub.dsU.sub.ys.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m 53 2871 C.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ksT.sub.ksA.sub.k 1197281 2526 2541 123551 123566 ATTGUCTCATGCCTTA A.sub.ksT.sub.ksT.sub.ksG.sub.dsU.sub.ys.sup.mC.sub.dsT.sub.dsC.sub.dsA.sub.ds 42 2872 T.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.ksA.sub.k 1197282 2528 2543 123553 123568 AAATUGTCTCATGCCT A.sub.ksA.sub.ksA.sub.ksT.sub.dsU.sub.ysG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 40 2873 C.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksT.sub.k 1197283 2529 2544 123554 123569 GAAAUTGTCTCATGCC G.sub.ksA.sub.ksA.sub.ksA.sub.dsU.sub.ysT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 29 2874 C.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 1197284 2560 2575 123585 123600 AGTAUGTGGCAATAAT A.sub.ksG.sub.ksT.sub.ksA.sub.dsU.sub.ysG.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds 35 2875 A.sub.dsA.sub.dsT.sub.dsA.sub.ksA.sub.ksT.sub.k 1197285 2562 2577 123587 123602 AGAGUATGTGGCAATA A.sub.ksG.sub.ksA.sub.ksG.sub.dsU.sub.ysA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.ds 28 2876 G.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ksT.sub.ksA.sub.k 1197286 2567 2582 123592 123607 ATATUAGAGTATGTGG A.sub.ksT.sub.ksA.sub.ksT.sub.dsU.sub.ysA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds 43 2877 A.sub.dsT.sub.dsG.sub.dsT.sub.ksG.sub.ksG.sub.k 1197287 2568 2583 123593 123608 TATAUTAGAGTATGTG T.sub.ksA.sub.ksT.sub.ksA.sub.dsU.sub.ysT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds 108 2878 T.sub.dsA.sub.dsT.sub.dsG.sub.ksT.sub.ksG.sub.k 1197288 2570 2585 123595 123610 TCTAUATTAGAGTATG T.sub.ks.sup.mC.sub.ksT.sub.ksA.sub.dsU.sub.ysA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 94 2879 A.sub.dsG.sub.dsT.sub.dsA.sub.ksT.sub.ksG.sub.k 1197291 4598 4613 125623 125638 CTTTUACATTAGGAAC .sup.mC.sub.ksT.sub.ksT.sub.ksT.sub.dsU.sub.ysA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds 83 2880 T.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ksA.sub.ks.sup.mC.sub.k 1197292 4599 4614 125624 125639 ACTTUTACATTAGGAA A.sub.ks.sup.mC.sub.ksT.sub.ksT.sub.dsU.sub.ysT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds 84 2881 T.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.ksA.sub.ksA.sub.k 1197293 4600 4615 125625 125640 CACTUTTACATTAGGA .sup.mC.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.dsU.sub.ysT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds 94 2882 A.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ksG.sub.ksA.sub.k 1197294 4601 4616 125626 125641 GCACUTTTACATTAGG G.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsU.sub.ysT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.m 25 2883 C.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.ksG.sub.ksG.sub.k 1198560 4436 4451 125461 125476 TATAACTGGGCAAATT T.sub.ksA.sub.ksT.sub.ksA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.m 53 2815 C.sub.dsA.sub.dsA.sub.ksA.sub.ksT.sub.ksT.sub.e 1198561 4438 4453 125463 125478 GGTATAACTGGGCAAA G.sub.ksG.sub.ksT.sub.ksA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds 29 1427 G.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.ksA.sub.ksA.sub.e 1198562 4439 4454 125464 125479 AGGTATAACTGGGCAA A.sub.ksG.sub.ksG.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds 30 905 G.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.ksA.sub.e 1198563 4440 4455 125465 125480 GAGGTATAACTGGGCA G.sub.ksA.sub.ksG.sub.ksG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds 53 1503 T.sub.dsG.sub.dsG.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.e 1198564 4446 4461 125471 125486 AACACTGAGGTATAAC A.sub.ksA.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsG 44 2816 G.sub.dsT.sub.dsA.sub.dsT.sub.ksA.sub.ksA.sub.ks.sup.mC.sub.e 1198585 N/A N/A 94732 94747 TTTAGGATGCATGGTT T.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 22 2832 A.sub.dsT.sub.dsG.sub.ksG.sub.ksT.sub.ksT.sub.e 1198586 N/A N/A 94733 94748 ATTTAGGATGCATGGT A.sub.ksT.sub.ksT.sub.ksT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m 96 2833 C.sub.dsA.sub.dsT.sub.ksG.sub.ksG.sub.ksT.sub.e 1198587 N/A N/A 94734 94749 GATTTAGGATGCATGG G.sub.ksA.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.ds 41 2834 G.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.ksG.sub.ksG.sub.e 1198588 N/A N/A 94735 94750 AGATTTAGGATGCATG A.sub.ksG.sub.ksA.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds 32 2835 T.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.ksT.sub.ksG.sub.e 1198589 N/A N/A 94736 94751 CAGATTTAGGATGCAT .sup.mC.sub.ksA.sub.ksG.sub.ksA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.ds 24 2836 A.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.ksT.sub.e 1198590 N/A N/A 94737 94752 TCAGATTTAGGATGCA T.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 46 2837 G.sub.dsA.sub.dsT.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.e 1198591 N/A N/A 94739 94754 ATTCAGATTTAGGATG A.sub.ksT.sub.ksT.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.ds 106 2838 A.sub.dsG.sub.dsG.sub.ksA.sub.ksT.sub.ksG.sub.e 1198592 N/A N/A 115903 115918 ATATGGTTTTGTGTGT A.sub.ksT.sub.ksA.sub.ksT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds 50 2839 G.sub.dsT.sub.dsG.sub.ksT.sub.ksG.sub.ksT.sub.e 1198593 N/A N/A 115905 115920 TTATATGGTTTTGTGT T.sub.ksT.sub.ksA.sub.ksT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds 45 2840 T.sub.dsT.sub.dsG.sub.ksT.sub.ksG.sub.ksT.sub.e 1198594 N/A N/A 115906 115921 CTTATATGGTTTTGTG .sup.mC.sub.ksT.sub.ksT.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.ds 23 2788 T.sub.dsT.sub.dsT.sub.ksG.sub.ksT.sub.ksG.sub.e 1198595 N/A N/A 115907 115922 TCTTATATGGTTTTGT T.sub.ks.sup.mC.sub.ksT.sub.ksT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.ds 27 2841 T.sub.dsT.sub.dsT.sub.ksT.sub.ksG.sub.ksT.sub.e 1198596 N/A N/A 115908 115923 CTCTTATATGGTTTTG .sup.mC.sub.ksT.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ds 16 2842 G.sub.dsG.sub.dsT.sub.dsT.sub.ksT.sub.ksT.sub.ksG.sub.e 1198597 N/A N/A 115909 115924 ACTCTTATATGGTTTT A.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.ds 27 2859 T.sub.dsG.sub.dsG.sub.dsT.sub.ksT.sub.ksT.sub.ksT.sub.e 1198598 N/A N/A 115910 115925 AACTCTTATATGGTTT A.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.ds 76 2860 A.sub.dsT.sub.dsG.sub.dsG.sub.ksT.sub.ksT.sub.ksT.sub.e 1198599 N/A N/A 115911 115926 CAACTCTTATATGGTT .sup.mC.sub.ksA.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ds 90 2861 T.sub.dsA.sub.dsT.sub.dsG.sub.ksG.sub.ksT.sub.ksT.sub.e 1198600 N/A N/A 115913 115928 GACAACTCTTATATGG G.sub.ksA.sub.ks.sup.mC.sub.ksA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds 72 2862 T.sub.dsA.sub.dsT.sub.dsA.sub.ksT.sub.ksG.sub.ksG.sub.e 1198601 N/A N/A 117325 117340 ATTGCAATCTGTCTGA A.sub.ksT.sub.ksT.sub.ksG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds 50 2843 T.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.ksA.sub.e 1198602 N/A N/A 117327 117342 ATATTGCAATCTGTCT A.sub.ksT.sub.ksA.sub.ksT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.m 29 2844 C.sub.dsT.sub.dsG.sub.ksT.sub.ks.sup.mC.sub.ksT.sub.e 1198603 N/A N/A 117328 117343 AATATTGCAATCTGTC A.sub.ksA.sub.ksT.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds 51 2845 T.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksT.sub.ks.sup.mC.sub.e 1198604 N/A N/A 117329 117344 TAATATTGCAATCTGT T.sub.ksA.sub.ksA.sub.ksT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds 48 2846 A.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.ksT.sub.e 1198605 N/A N/A 117330 117345 GTAATATTGCAATCTG G.sub.ksT.sub.ksA.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 7 1404 A.sub.dsA.sub.dsT.sub.ks.sup.mC.sub.ksT.sub.ksG.sub.e 1198606 N/A N/A 117331 117346 TGTAATATTGCAATCT T.sub.ksG.sub.ksT.sub.ksA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.m 25 2847 C.sub.dsA.sub.dsA.sub.ksT.sub.ks.sup.mC.sub.ksT.sub.e 1198607 N/A N/A 117332 117347 ATGTAATATTGCAATC A.sub.ksT.sub.ksG.sub.ksT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.ds 77 2848 G.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ksT.sub.ksmC.sub.e 1198608 N/A N/A 117333 117348 TATGTAATATTGCAAT T.sub.ksA.sub.ksT.sub.ksG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ds 83 2849 T.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.ksA.sub.ksT.sub.e 1198609 N/A N/A 117335 117350 TTTATGTAATATTGCA T.sub.ksT.sub.ksT.sub.ksA.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.ds 52 2850 A.sub.dsT.sub.dsT.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.e 1198610 N/A N/A 117755 117770 TGTATGTCAGAAGAGT T.sub.ksG.sub.ksT.sub.ksA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds4 2863 A.sub.dsA.sub.dsG.sub.ksA.sub.ksG.sub.ksT.sub.e 1198611 N/A N/A 117757 117772 AGTGTATGTCAGAAGA A.sub.ksG.sub.ksT.sub.ksG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 7 2864 A.sub.dsG.sub.dsA.sub.ksA.sub.ksG.sub.ksA.sub.e 1198612 N/A N/A 117758 117773 AAGTGTATGTCAGAAG A.sub.ksA.sub.ksG.sub.ksT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 5 2865 C.sub.dsA.sub.dsG.sub.ksA.sub.ksA.sub.ksG.sub.e 1198613 N/A N/A 117759 117774 AAAGTGTATGTCAGAA A.sub.ksA.sub.ksA.sub.ksG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ds 3 2866 T.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksA.sub.ksA.sub.e 1198614 N/A N/A 117760 117775 TAAAGTGTATGTCAGA T.sub.ksA.sub.ksA.sub.ksA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 4 2867 G.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.ksA.sub.e 1198615 N/A N/A 117761 117776 TTAAAGTGTATGTCAG T.sub.ks+lTksA.sub.ksA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.ds 10 2868 T.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.e 1198616 N/A N/A 117762 117777 TTTAAAGTGTATGTCA T.sub.ksT.sub.ksT.sub.ksA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.ds 16 2869 A.sub.dsT.sub.dsG.sub.ksT.sub.ks.sup.mC.sub.ksA.sub.e 1198617 N/A N/A 117763 117778 CTTTAAAGTGTATGTC .sup.mC.sub.ksT.sub.ksT.sub.ksT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.ds 34 1634 T.sub.dsA.sub.dsT.sub.ksG.sub.ksT.sub.ks.sup.mC.sub.e 1198618 N/A N/A 117765 117780 AACTTTAAAGTGTATG A.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ds 74 2870 T.sub.dsG.sub.dsT.sub.ksA.sub.ksT.sub.ksG.sub.e 1198619 N/A N/A 119667 119682 TAAGGTTTCCCAGATT T.sub.ksA.sub.ksA.sub.ksG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.m 53 2851 C.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ksA.sub.ksT.sub.ksT.sub.e 1198620 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA A.sub.ksG.sub.ksT.sub.ksA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.m 26 2852 C.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.ksA.sub.e 1198621 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG A.sub.ksA.sub.ksG.sub.ksT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds 80 2853 T.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.e 1198622 N/A N/A 119671 119686 TAAGTAAGGTTTCCCA T.sub.ksA.sub.ksA.sub.ksG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds 26 2854 T.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksA.sub.e 1198623 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC .sup.mC.sub.ksT.sub.ksA.sub.ksA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.ds 9 1101 T.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.e 1198624 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC A.sub.ks.sup.mC.sub.ksT.sub.ksA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.ds 20 2855 G.sub.dsT.sub.dsT.sub.ksT.sub.ks.sup.mC.sub.ks.sup.mC.sub.e 1198625 N/A N/A 119674 119689 GACTAAGTAAGGTTTC G.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.ds 64 2856 G.sub.dsG.sub.dsT.sub.ksT.sub.ksT.sub.ks.sup.mC.sub.e 1198626 N/A N/A 119675 119690 AGACTAAGTAAGGTTT A.sub.ksG.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds 99 2857 A.sub.dsG.sub.dsG.sub.ksT.sub.ksT.sub.ksT.sub.e 1198627 N/A N/A 119677 119692 TTAGACTAAGTAAGGT T.sub.ksT.sub.ksA.sub.ksG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.ds 39 2858 T.sub.dsA.sub.dsA.sub.ksG.sub.ksG.sub.ksT.sub.e
TABLE-US-00051 TABLE 51 Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2 SEQ SEQ ID ID SEQ ID SEQ ID YAP1 NO: 1 NO: 1 NO: 2 NO: 2 SEQ SEQ Compound Start Stop Start Stop YAP1 ID Number Site Site Site Site Sequence (5' to 3') CHEMSITRY NOTATION (% UT) NO 715487 3630 3645 124655 124670 ATTACTTCATAGCTTA A.sub.ksT.sub.ksT.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 24 52 T.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.ksA.sub.k 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 9 810 G.sub.dsT.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC G.sub.ksA.sub.ksA.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 5 2800 C.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 1197237 4436 4451 125461 125476 TATAACTGGGCAAATT T.sub.ksA.sub.ksT.sub.ksA.sub.dsA.sub.ys.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.m 74 2815 C.sub.dsA.sub.dsA.sub.dsA.sub.ksT.sub.ksT.sub.k 1197238 4439 4454 125464 125479 AGGTATAACTGGGCAA A.sub.ksG.sub.ksG.sub.ksT.sub.dsA.sub.ysT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds 43 905 G.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.ksA.sub.k 1197239 4441 4456 125466 125481 TGAGGTATAACTGGGC T.sub.ksG.sub.ksA.sub.ksG.sub.dsG.sub.ysT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.m 47 1580 C.sub.dsT.sub.dsG.sub.dsG.sub.ksG.sub.ks.sup.mC.sub.k 1197240 4442 4457 125467 125482 CTGAGGTATAACTGGG .sup.mC.sub.ksT.sub.ksG.sub.ksA.sub.dsG.sub.ysG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.ds 58 2801 A.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ksG.sub.ksG.sub.k 1197241 4443 4458 125468 125483 ACTGAGGTATAACTGG A.sub.ks.sup.mC.sub.ksT.sub.ksG.sub.dsA.sub.ysG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds+l 19 392 A.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksG.sub.k 1197242 4444 4459 125469 125484 CACTGAGGTATAACTG .sup.mC.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.ysA.sub.dsG.sub.dsG.sub.dsT.sub.ds 46 2802 A.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k 1197243 4446 4461 125471 125486 AACACTGAGGTATAAC A.sub.ksA.sub.ks.sup.mC.sub.ksA.sub.dsC.sub.ysT.sub.dsG.sub.dsA.sub.dsG.sub.ds 81 2816 G.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.ksA.sub.ks.sup.mC.sub.k 1197248 4605 4620 125630 125645 TTAAGCACTTTTACAT T.sub.ksT.sub.ksA.sub.ksA.sub.dsG.sub.ys.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds 75 2822 T.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ksA.sub.ksT.sub.k 1197249 4795 4810 125820 125835 GGAAGATCTGAAACTC G.sub.ksG.sub.ksA.sub.ksA.sub.dsG.sub.ysA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds28 2823 A.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k 1197250 4797 4812 125822 125837 TTGGAAGATCTGAAAC T.sub.ksT.sub.ksG.sub.ksG.sub.dsA.sub.ysA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds 60 2824 T.sub.dsG.sub.dsA.sub.dsA.sub.ksA.sub.ks.sup.mC.sub.k 1197251 4798 4813 125823 125838 TTTGGAAGATCTGAAA T.sub.ksT.sub.ksT.sub.ksG.sub.dsG.sub.ysA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.m 74 2825 C.sub.dsT.sub.dsG.sub.dsA.sub.ksA.sub.ksA.sub.k 1197252 4799 4814 125824 125839 CTTTGGAAGATCTGAA .sup.mC.sub.ksT.sub.ksT.sub.ksT.sub.dsG.sub.ysG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ds 53 2826 T.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ksA.sub.ksA.sub.k 1197253 4803 4818 125828 125843 AGTGCTTTGGAAGATC A.sub.ksG.sub.ksT.sub.ksG.sub.dsC.sub.ysT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds 58 2828 A.sub.dsA.sub.dsG.sub.dsA.sub.ksT.sub.ks.sup.mC.sub.k 1197254 N/A N/A 94731 94746 TTAGGATGCATGGTTT T.sub.ksT.sub.ksA.sub.ksG.sub.dsG.sub.ysA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds 51 2831 T.sub.dsG.sub.dsG.sub.dsT.sub.ksT.sub.ksT.sub.k 1197255 N/A N/A 94732 94747 TTTAGGATGCATGGTT T.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.ysG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 38 2832 A.sub.dsT.sub.dsG.sub.dsG.sub.ksT.sub.ksT.sub.k 1197256 N/A N/A 94733 94748 ATTTAGGATGCATGGT A.sub.ksT.sub.ksT.sub.ksT.sub.dsA.sub.ysG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m 31 2833 C.sub.dsA.sub.dsT.sub.dsG.sub.ksG.sub.ksT.sub.k 1197257 N/A N/A 94737 94752 TCAGATTTAGGATGCA T.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.dsA.sub.ysT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds 20 2837 G.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 1197258 N/A N/A 94739 94754 ATTCAGATTTAGGATG A.sub.ks+lTksT.sub.ks.sup.mC.sub.dsA.sub.ysG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.ds 57 2838 A.sub.dsG.sub.dsG.sub.dsA.sub.ksT.sub.ksG.sub.k 1197259 N/A N/A 115903 115918 ATATGGTTTTGTGTGT A.sub.ksT.sub.ksA.sub.ksT.sub.dsG.sub.ysG.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds 59 2839 G.sub.dsT.sub.dsG.sub.dsT.sub.ksG.sub.ksT.sub.k 1197260 N/A N/A 115905 115920 TTATATGGTTTTGTGT T.sub.ksT.sub.ksA.sub.ksT.sub.dsA.sub.ysT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds 65 2840 T.sub.dsT.sub.dsG.sub.dsT.sub.ksG.sub.ksT.sub.k 1197261 N/A N/A 115907 115922 TCTTATATGGTTTTGT T.sub.ks.sup.mC.sub.ksT.sub.ksT.sub.dsA.sub.ysT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.ds 91 2841 T.sub.dsT.sub.dsT.sub.dsT.sub.ksG.sub.ksT.sub.k 1197262 N/A N/A 115910 115925 AACTCTTATATGGTTT A.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.dsC.sub.ysT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.ds 89 2860 T.sub.dsG.sub.dsG.sub.dsT.sub.ksT.sub.ksT.sub.k 1197263 N/A N/A 115913 115928 GACAACTCTTATATGG G.sub.ks.sup.mA.sub.ks.sup.mC.sub.ksA.sub.dsA.sub.ys.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds 91 2862 T.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ksG.sub.ksG.sub.k 1197264 N/A N/A 117325 117340 ATTGCAATCTGTCTGA A.sub.ksT.sub.ksT.sub.ksG.sub.dsC.sub.ysA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds 33 2843 G.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksA.sub.k 1197265 N/A N/A 117329 117344 TAATATTGCAATCTGT T.sub.ksA.sub.ksA.sub.ksT.sub.dsA.sub.ysT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds 103 2846 A.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksT.sub.k 1197266 N/A N/A 117331 117346 TGTAATATTGCAATCT T.sub.ksG.sub.ksT.sub.ksA.sub.dsA.sub.ysT.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.m 31 2847 C.sub.dsA.sub.dsA.sub.dsT.sub.ks.sup.mC.sub.ksT.sub.k 1197267 N/A N/A 117332 117347 ATGTAATATTGCAATC A.sub.ksT.sub.ksG.sub.ksT.sub.dsA.sub.ysA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.ds 62 2848 G.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ksT.sub.ks.sup.mC.sub.k 1197268 N/A N/A 117758 117773 AAGTGTATGTCAGAAG A.sub.ksA.sub.ksG.sub.ksT.sub.dsG.sub.ysT.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 25 2865 C.sub.dsA.sub.dsG.sub.dsA.sub.ksA.sub.ksG.sub.k 1197269 N/A N/A 117760 117775 TAAAGTGTATGTCAGA T.sub.ksA.sub.ksA.sub.ksA.sub.dsG.sub.ysT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 3 2867 G.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksA.sub.k 1197270 N/A N/A 117761 117776 TTAAAGTGTATGTCAG T.sub.ksT.sub.ksA.sub.ksA.sub.dsA.sub.ysG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.ds 2 2868 T.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k 1197271 N/A N/A 117762 117777 TTTAAAGTGTATGTCA T.sub.ksT.sub.ksT.sub.ksA.sub.dsA.sub.ysA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.ds 12 2869 A.sub.dsT.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ksA.sub.k 1197272 N/A N/A 117763 117778 CTTTAAAGTGTATGTC .sup.mC.sub.ksT.sub.ksT.sub.ksT.sub.dsA.sub.ysA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.ds 32 1634 T.sub.dsA.sub.dsT.sub.dsG.sub.ksT.sub.ks.sup.mC.sub.k 1197273 N/A N/A 119667 119682 TAAGGTTTCCCAGATT T.sub.ksA.sub.ksA.sub.ksG.sub.dsG.sub.ysT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.m 68 2851 C.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.ksT.sub.ksT.sub.k 1197274 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA A.sub.ksG.sub.ksT.sub.ksA.sub.dsA.sub.ysG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.m 31 2852 C.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksA.sub.k 1197275 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG A.sub.ksA.sub.ksG.sub.ksT.sub.dsA.sub.ysA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds 30 2853 T.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k 1197276 N/A N/A 119672 119687 CTAAGTAAGGTTTCCC .sup.mC.sub.ksT.sub.ksA.sub.ksA.sub.dsG.sub.ysT.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.ds 44 1101 T.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 1197277 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC A.sub.ks.sup.mC.sub.ksT.sub.ksA.sub.dsA.sub.ysG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.ds 23 2855 G.sub.dsT.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 1197278 N/A N/A 119674 119689 GACTAAGTAAGGTTTC G.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.dsA.sub.ysA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.ds 36 2856 G.sub.dsG.sub.dsT.sub.dsT.sub.ksT.sub.ks.sup.mC.sub.k 1197279 N/A N/A 119677 119692 TTAGACTAAGTAAGGT T.sub.ksT.sub.ksA.sub.ksG.sub.dsA.sub.ys.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.ds 54 2858 T.sub.dsA.sub.dsA.sub.dsG.sub.ksG.sub.ksT.sub.k 1197289 4438 4453 125463 125478 GGTAUAACTGGGCAAA G.sub.ksG.sub.ksT.sub.ksA.sub.dsU.sub.ysA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds 48 2884 G.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ksA.sub.k 1197290 4440 4455 125465 125480 GAGGUATAACTGGGCA G.sub.ksA.sub.ksG.sub.ksG.sub.dsU.sub.ysA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.m 37 2885 C.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 1197295 4800 4815 125825 125840 GCTTUGGAAGATCTGA G.sub.ks.sup.mC.sub.ksT.sub.ksT.sub.dsU.sub.ysG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ds 24 2886 A.sub.dsT.sub.dsC.sub.dsT.sub.ksG.sub.ksA.sub.k 1197296 4801 4816 125826 125841 TGCTUTGGAAGATCTG T.sub.ksG.sub.ks.sup.mC.sub.ksT.sub.dsU.sub.ysT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.ds 36 2887 G.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k 1197297 4802 4817 125827 125842 GTGCUTTGGAAGATCT G.sub.ksT.sub.ksG.sub.ks.sup.mC.sub.dsU.sub.ysT.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.ds 25 2888 A.sub.dsG.sub.dsA.sub.dsT.sub.ks.sup.mC.sub.ksT.sub.k 1197298 4805 4820 125830 125845 ATAGUGCTTTGGAAGA A.sub.ksT.sub.ksA.sub.ksG.sub.dsU.sub.ysG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 46 2889 G.sub.dsG.sub.dsA.sub.dsA.sub.ksG.sub.ksA.sub.k 1197299 N/A N/A 94729 94744 AGGAUGCATGGTTTTT A.sub.ksG.sub.ksG.sub.ksA.sub.dsU.sub.ysG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds 41 2890 G.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ksT.sub.ksT.sub.k 1197300 N/A N/A 94734 94749 GATTUAGGATGCATGG G.sub.ksA.sub.ksT.sub.ksT.sub.dsU.sub.ysA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.ds 42 2891 G.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ksG.sub.ksG.sub.k 1197301 N/A N/A 94735 94750 AGATUTAGGATGCATG A.sub.ksA.sub.ksT.sub.dsU.sub.ysT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds 71 2892 T.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.ksG.sub.k 1197302 N/A N/A 94736 94751 CAGAUTTAGGATGCAT .sup.mC.sub.ksA.sub.ksG.sub.ksA.sub.dsU.sub.ysT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.ds 54 2893 A.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.ksT.sub.k 1197303 N/A N/A 115906 115921 CTTAUATGGTTTTGTG .sup.mC.sub.ksT.sub.ksT.sub.ksA.sub.dsU.sub.ysA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.ds 72 2894 T.sub.dsT.sub.dsT.sub.dsG.sub.ksT.sub.ksG.sub.k 1197304 N/A N/A 115908 115923 CTCTUATATGGTTTTG .sup.mC.sub.ksT.sub.ks.sup.mC.sub.ksT.sub.dsU.sub.ysA.sub.dsT.sub.dsA.sub.dsT.sub.ds 45 2895 G.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ksT.sub.ksG.sub.k 1197305 N/A N/A 115909 115924 ACTCUTATATGGTTTT A.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.dsU.sub.ysT.sub.dsA.sub.dsT.sub.dsA.sub.ds 30 2896 T.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ksT.sub.ksT.sub.k 1197306 N/A N/A 115911 115926 CAACUCTTATATGGTT .sup.mC.sub.ksA.sub.ksA.sub.ks.sup.mC.sub.dsU.sub.ys.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ds 77 2897 T.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.ksT.sub.ksT.sub.k 1197307 N/A N/A 117327 117342 ATATUGCAATCTGTCT A.sub.ksT.sub.ksA.sub.ksT.sub.dsU.sub.ysG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.m 88 2898 C.sub.dsT.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ksT.sub.k 1197308 N/A N/A 117328 117343 AATAUTGCAATCTGTC A.sub.ksA.sub.ksT.sub.ksA.sub.dsU.sub.ysT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds 49 2899 T.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ksT.sub.ks.sup.mC.sub.k 1197309 N/A N/A 117330 117345 GTAAUATTGCAATCTG G.sub.ksT.sub.ksA.sub.ksA.sub.dsU.sub.ysA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 11 2900 A.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k 1197310 N/A N/A 117333 117348 TATGUAATATTGCAAT T.sub.ksA.sub.ksT.sub.ksG.sub.dsU.sub.ysA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ds 109 2901 T.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ksT.sub.k 1197311 N/A N/A 117335 117350 TTTAUGTAATATTGCA T.sub.ksT.sub.ksT.sub.ksA.sub.dsU.sub.ysG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.ds 27 2902 A.sub.dsT.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 1197312 N/A N/A 117755 117770 TGTAUGTCAGAAGAGT T.sub.ksG.sub.ksT.sub.ksA.sub.dsU.sub.ysG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds 10 2903 A.sub.dsA.sub.dsG.sub.dsA.sub.ksG.sub.ksT.sub.k 1197313 N/A N/A 117757 117772 AGTGUATGTCAGAAGA A.sub.ksG.sub.ksT.sub.ksG.sub.dsU.sub.ysA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 8 2904 A.sub.dsG.sub.dsA.sub.dsA.sub.ksG.sub.ksA.sub.k 1197314 N/A N/A 117759 117774 AAAGUGTATGTCAGAA A.sub.ksA.sub.ksA.sub.ksG.sub.dsU.sub.ysG.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ds 22 2905 T.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ksA.sub.ksA.sub.k 1197315 N/A N/A 117765 117780 AACTUTAAAGTGTATG A.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.dsU.sub.ysT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ds 116 2906 T.sub.dsG.sub.dsT.sub.dsA.sub.ksT.sub.ksG.sub.k 1197316 N/A N/A 119671 119686 TAAGUAAGGTTTCCCA T.sub.ksA.sub.ksA.sub.ksG.sub.dsU.sub.ysA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds 46 2907 T.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k 1197317 N/A N/A 119675 119690 AGACUAAGTAAGGTTT A.sub.ksG.sub.ksA.sub.ks.sup.mC.sub.dsU.sub.ysA.sub.dsA.sub.dsG.sub.dsT.sub.ds 78 2908 A.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ksT.sub.ksT.sub.k 1200784 2524 2539 123549 123564 TGTCTCATGCCTTATA T.sub.ksG.sub.ksT.sub.ks.sup.mC.sub.dsT.sub.dsC.sub.ysA.sub.dsT.sub.dsG.sub.ds.sup.m 19 2803 C.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ksT.sub.ksA.sub.k 1200785 2526 2541 123551 123566 ATTGTCTCATGCCTTA A.sub.ksT.sub.ksT.sub.ksG.sub.dsT.sub.dsC.sub.ysT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds 15 2804 G.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.ksA.sub.k 1200786 2527 2542 123552 123567 AATTGUCTCATGCCTT A.sub.ksA.sub.ksT.sub.ksT.sub.dsG.sub.dsU.sub.ys.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds 21 2909 A.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ksT.sub.k 1200787 2528 2543 123553 123568 AAATTGTCTCATGCCT A.sub.ksA.sub.ksA.sub.ksT.sub.dsT.sub.dsG.sub.ysT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 38 443 C.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksT.sub.k 1200793 2560 2575 123585 123600 AGTATGTGGCAATAAT A.sub.ksG.sub.ksT.sub.ksA.sub.dsT.sub.dsG.sub.ysT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds 31 2809 A.sub.dsA.sub.dsT.sub.dsA.sub.ksA.sub.ksT.sub.k 1200794 2562 2577 123587 123602 AGAGTATGTGGCAATA A.sub.ksG.sub.ksA.sub.ksG.sub.dsT.sub.dsA.sub.ysT.sub.dsG.sub.dsT.sub.dsG.sub.ds 18 2810 G.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ksT.sub.ksA.sub.k 1200795 2563 2578 123588 123603 TAGAGUATGTGGCAAT T.sub.ksA.sub.ksG.sub.ksA.sub.dsG.sub.dsU.sub.ysA.sub.dsT.sub.dsG.sub.dsT.sub.ds 30 2910 G.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ksT.sub.k 1200796 2564 2579 123589 123604 TTAGAGTATGTGGCAA T.sub.ksT.sub.ksA.sub.ksG.sub.dsA.sub.dsG.sub.ysT.sub.dsA.sub.dsT.sub.dsG.sub.ds 15 963 T.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.ksA.sub.k 1200797 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.ysG.sub.dsT.sub.dsA.sub.dsT.sub.ds 11 810 G.sub.dsT.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 1200798 2566 2581 123591 123606 TATTAGAGTATGTGGC T.sub.ksA.sub.ksT.sub.ksT.sub.dsA.sub.dsG.sub.ysA.sub.dsG.sub.dsT.sub.dsA.sub.ds 7 2812 T.sub.dsG.sub.dsT.sub.dsG.sub.ksG.sub.ks.sup.mC.sub.k 1200799 2567 2582 123592 123607 ATATTAGAGTATGTGG A.sub.ksT.sub.ksA.sub.ksT.sub.dsT.sub.dsA.sub.ysG.sub.dsA.sub.dsG.sub.dsT.sub.ds 27 2813 A.sub.dsT.sub.dsG.sub.dsT.sub.ksG.sub.ksG.sub.k 1200800 2568 2583 123593 123608 TATATUAGAGTATGTG T.sub.ksA.sub.ksT.sub.ksA.sub.dsT.sub.dsU.sub.ysA.sub.dsG.sub.dsA.sub.dsG.sub.ds 61 2911 T.sub.dsA.sub.dsT.sub.dsG.sub.ksT.sub.ksG.sub.k 1200801 2570 2585 123595 123610 TCTATATTAGAGTATG T.sub.ks.sup.mC.sub.ksT.sub.ksA.sub.dsT.sub.dsA.sub.ysT.sub.dsT.sub.dsA.sub.dsG.sub.ds 77 887 A.sub.dsG.sub.dsT.sub.dsA.sub.ksT.sub.ksG.sub.k
TABLE-US-00052 TABLE 52 Inhibition of Yap1 mRNA by modified oligonucleotides targeting SEQ ID NO.: 1, and 2 SEQ SEQ ID ID SEQ ID SEQ ID YAP1 NO: 1 NO: 1 NO: 2 NO: 2 SEQ SEQ Compound Start Stop Start Stop YAP1 ID Number Site Site Site Site Sequence (5' to 3') CHEMSITRY NOTATION (% UT) NO 715487 3630 3645 124655 124670 ATTACTTCATAGCTTA A.sub.ksT.sub.ksT.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 29 52 T.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.ksA.sub.k 958499 2565 2580 123590 123605 ATTAGAGTATGTGGCA A.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.ds 14 810 G.sub.dsT.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 1074461 2529 2544 123554 123569 GAAATTGTCTCATGCC G.sub.ksA.sub.ksA.sub.ksA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 15 2800 C.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 1200788 2529 2544 123554 123569 GAAATUGTCTCATGCC G.sub.ksA.sub.ksA.sub.ksA.sub.dsT.sub.dsU.sub.ysG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.m 19 2912 C.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 1200789 2530 2545 123555 123570 GGAAAUTGTCTCATGC G.sub.ksG.sub.ksA.sub.ksA.sub.dsA.sub.dsU.sub.ysT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 12 2913 T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ksG.sub.ks.sup.mC.sub.k 1200790 2531 2546 123556 123571 TGGAAATTGTCTCATG T.sub.ksG.sub.ksG.sub.ksA.sub.dsA.sub.dsA.sub.ysT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 33 2807 C.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.ksG.sub.k 1200791 2532 2547 123557 123572 ATGGAAATTGTCTCAT A.sub.ksT.sub.ksG.sub.ksG.sub.dsA.sub.dsA.sub.ysA.sub.dsT.sub.dsT.sub.dsG.sub.ds 46 2808 T.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.ksT.sub.k 1200792 2534 2549 123559 123574 ATATGGAAATTGTCTC A.sub.ksT.sub.ksA.sub.ksT.sub.dsG.sub.dsG.sub.ysA.sub.dsA.sub.dsA.sub.dsT.sub.ds 52 656 T.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k 1200802 4436 4451 125461 125476 TATAACTGGGCAAATT T.sub.ksA.sub.ksT.sub.ksA.sub.dsA.sub.dsC.sub.ysT.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.m 89 2815 C.sub.dsA.sub.dsA.sub.dsA.sub.ksT.sub.k 1200803 4438 4453 125463 125478 GGTATAACTGGGCAAA G.sub.ksG.sub.ksT.sub.ksA.sub.dsT.sub.dsA.sub.ysA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds 22 1427 G.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ksA.sub.k 1200804 4439 4454 125464 125479 AGGTAUAACTGGGCAA A.sub.ksG.sub.ksG.sub.ksT.sub.dsA.sub.dsU.sub.ysA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds 44 2914 G.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.ksA.sub.k 1200805 4440 4455 125465 125480 GAGGTATAACTGGGCA G.sub.ksA.sub.ksG.sub.ksG.sub.dsT.sub.dsA.sub.ysT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds 50 1503 T.sub.dsG.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 1200806 4441 4456 125466 125481 TGAGGUATAACTGGGC T.sub.ksG.sub.ksA.sub.ksG.sub.dsG.sub.dsU.sub.ysA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.m 24 2915 C.sub.dsT.sub.dsG.sub.dsG.sub.ksG.sub.ks.sup.mC.sub.k 1200807 4442 4457 125467 125482 CTGAGGTATAACTGGG .sup.mC.sub.ksT.sub.ksG.sub.ksA.sub.dsG.sub.dsG.sub.ysT.sub.dsA.sub.dsT.sub.ds 69 2801 A.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ksG.sub.ksG.sub.k 1200808 4443 4458 125468 125483 ACTGAGGTATAACTGG A.sub.ks.sup.mC.sub.ksT.sub.ksG.sub.dsA.sub.dsG.sub.ysG.sub.dsT.sub.dsA.sub.dsT.sub.ds 45 392 A.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksG.sub.k 1200809 4444 4459 125469 125484 CACTGAGGTATAACTG .sup.mC.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.dsA.sub.ysG.sub.dsG.sub.dsT.sub.ds 69 2802 A.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k 1200810 4446 4461 125471 125486 AACACUGAGGTATAAC A.sub.ksA.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsU.sub.ysG.sub.dsA.sub.dsG.sub.ds 94 2916 G.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.ksA.sub.ks.sup.mC.sub.k 1200811 4595 4610 125620 125635 TTACAUTAGGAACAAG T.sub.ksT.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.dsU.sub.ysT.sub.dsA.sub.dsG.sub.dsG.sub.ds 62 2917 A.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ksG.sub.k 1200812 4597 4612 125622 125637 TTTTACATTAGGAACA T.sub.ksT.sub.ksT.sub.ksT.sub.dsA.sub.dsC.sub.ysA.sub.dsT.sub.dsT.sub.dsA.sub.ds 59 2928 G.sub.dsG.sub.dsA.sub.dsA.sub.ks.sup.mC.sub.ksA.sub.k 1200813 4598 4613 125623 125638 CTTTTACATTAGGAAC .sup.mC.sub.ksT.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.ys.sup.mC.sub.dsA.sub.dsT.sub.ds 58 1124 T.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ksA.sub.ks.sup.mC.sub.k 1200814 4599 4614 125624 125639 ACTTTUACATTAGGAA A.sub.ks.sup.mC.sub.ksT.sub.ksT.sub.dsT.sub.dsU.sub.ysA.sub.ds.sup.mC.sub.dsA.sub.ds 73 2918 T.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.ksA.sub.ksA.sub.k 1200815 4600 4615 125625 125640 CACTTUTACATTAGGA .sup.mC.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsU.sub.ysT.sub.dsA.sub.ds.sup.mC.sub.ds 55 2919 A.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ksG.sub.ksA.sub.k 1200816 4601 4616 125626 125641 GCACTUTTACATTAGG G.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsU.sub.ysT.sub.dsT.sub.dsA.sub.ds.sup.m 37 2920 C.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.ksG.sub.ksG.sub.k 1200817 4602 4617 125627 125642 AGCACUTTTACATTAG A.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsU.sub.ysT.sub.dsT.sub.dsT.sub.ds 38 2921 A.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.ksA.sub.ksG.sub.k 1200818 4603 4618 125628 125643 AAGCACTTTTACATTA A.sub.ksA.sub.ksG.sub.ks.sup.mC.sub.dsA.sub.dsC.sub.ysT.sub.dsT.sub.dsT.sub.dsT.sub.ds 31 2821 A.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ksT.sub.ksA.sub.k 1200819 4605 4620 125630 125645 TTAAGCACTTTTACAT T.sub.ksT.sub.ksA.sub.ksA.sub.dsG.sub.dsC.sub.ysA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds 101 2822 T.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ksA.sub.ksT.sub.k 1200820 4795 4810 125820 125835 GGAAGATCTGAAACTC G.sub.ksG.sub.ksA.sub.ksA.sub.dsG.sub.dsA.sub.ysT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds 24 2823 A.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k 1200821 4797 4812 125822 125837 TTGGAAGATCTGAAAC T.sub.ksT.sub.ksG.sub.ksG.sub.dsA.sub.dsA.sub.ysG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds 59 2824 T.sub.dsG.sub.dsA.sub.dsA.sub.ksA.sub.ks.sup.mC.sub.k 1200822 4798 4813 125823 125838 TTTGGAAGATCTGAAA T.sub.ksT.sub.ksT.sub.ksG.sub.dsG.sub.dsA.sub.ysA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.m 55 2938 C.sub.dsT.sub.dsG.sub.dsA.sub.ksA.sub.ksA.sub.k 1200823 4799 4814 125824 125839 CTTTGGAAGATCTGAA .sup.mC.sub.ksT.sub.ksT.sub.ksT.sub.dsG.sub.dsG.sub.ysA.sub.dsA.sub.dsG.sub.ds 46 2826 A.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ksA.sub.ksA.sub.k 1200824 4800 4815 125825 125840 GCTTTGGAAGATCTGA G.sub.ks.sup.mC.sub.ksT.sub.ksT.sub.dsT.sub.dsG.sub.ysG.sub.dsA.sub.dsA.sub.dsG.sub.ds 43 2044 A.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksA.sub.k 1200825 4801 4816 125826 125841 TGCTTUGGAAGATCTG T.sub.ksG.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsU.sub.ysG.sub.dsG.sub.dsA.sub.dsA.sub.ds 39 2922 G.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k 1200826 4802 4817 125827 125842 GTGCTUTGGAAGATCT G.sub.ksT.sub.ksG.sub.ks.sup.mC.sub.dsT.sub.dsU.sub.ysT.sub.dsG.sub.dsG.sub.dsA.sub.ds 26 2923 A.sub.dsG.sub.dsA.sub.dsT.sub.ks.sup.mC.sub.ksT.sub.k 1200827 4803 4818 125828 125843 AGTGCUTTGGAAGATC A.sub.ksG.sub.ksT.sub.ksG.sub.ds.sup.mC.sub.dsU.sub.ysT.sub.dsT.sub.dsG.sub.dsG.sub.ds 67 2924 A.sub.dsA.sub.dsG.sub.dsA.sub.ksT.sub.ks.sup.mC.sub.k 1200828 4805 4820 125830 125845 ATAGTGCTTTGGAAGA A.sub.ksT.sub.ksA.sub.ksG.sub.dsT.sub.dsG.sub.ys.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 54 2829 G.sub.dsG.sub.dsA.sub.dsA.sub.ksG.sub.ksA.sub.k 1200829 N/A N/A 94729 94744 AGGATGCATGGTTTTT A.sub.ksG.sub.ksG.sub.ksA.sub.dsT.sub.dsG.sub.ys.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.ds 49 2830 G.sub.dsT.sub.dsT.sub.dsT.sub.ksT.sub.ksT.sub.k 1200830 N/A N/A 94731 94746 TTAGGATGCATGGTTT T.sub.ksT.sub.ksA.sub.ksG.sub.dsG.sub.dsA.sub.ysT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds 50 2831 T.sub.dsG.sub.dsG.sub.dsT.sub.ksT.sub.ksT.sub.k 1200831 N/A N/A 94732 94747 TTTAGGATGCATGGTT T.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.dsG.sub.ysA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 42 2832 A.sub.dsT.sub.dsG.sub.dsG.sub.ksT.sub.ksT.sub.k 1200832 N/A N/A 94733 94748 ATTTAGGATGCATGGT A.sub.ksT.sub.ksT.sub.ksT.sub.dsA.sub.dsG.sub.ysG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.m 61 2833 C.sub.dsA.sub.dsT.sub.dsG.sub.ksG.sub.ksT.sub.k 1200833 N/A N/A 94734 94749 GATTTAGGATGCATGG G.sub.ksA.sub.ksT.sub.ksT.sub.dsT.sub.dsA.sub.ysG.sub.dsG.sub.dsA.sub.dsT.sub.ds 31 2834 G.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ksG.sub.ksG.sub.k 1200834 N/A N/A 94735 94750 AGATTUAGGATGCATG A.sub.ksG.sub.ksA.sub.ksT.sub.dsT.sub.dsU.sub.ysA.sub.dsG.sub.dsG.sub.dsA.sub.ds 37 2925 T.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.ksG.sub.k 1200835 N/A N/A 94736 94751 CAGATUTAGGATGCAT .sup.mC.sub.ksA.sub.ksG.sub.ksA.sub.dsT.sub.dsU.sub.ysT.sub.dsA.sub.dsG.sub.ds 82 2926 G.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.ksT.sub.k 1200836 N/A N/A 94737 94752 TCAGAUTTAGGATGCA T.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.dsA.sub.dsU.sub.ysT.sub.dsT.sub.dsA.sub.dsG.sub.ds 72 2927 G.sub.dsA.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 1200837 N/A N/A 94739 94754 ATTCAGATTTAGGATG A.sub.ksT.sub.ksT.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.ysA.sub.dsT.sub.dsT.sub.dsT.sub.ds 82 2838 A.sub.dsG.sub.dsG.sub.dsA.sub.ksT.sub.ksG.sub.k 1200838 N/A N/A 115903 115918 ATATGGTTTTGTGTGT A.sub.ksT.sub.ksA.sub.ksT.sub.dsG.sub.dsG.sub.ysT.sub.dsT.sub.dsT.sub.dsT.sub.ds 65 2839 G.sub.dsT.sub.dsG.sub.dsT.sub.ksG.sub.ksT.sub.k 1200839 N/A N/A 115905 115920 TTATAUGGTTTTGTGT T.sub.ksT.sub.ksA.sub.ksT.sub.dsA.sub.dsU.sub.ysG.sub.dsG.sub.dsT.sub.dsT.sub.ds 44 2928 T.sub.dsT.sub.dsG.sub.dsT.sub.ksG.sub.ksT.sub.k 1200840 N/A N/A 115906 115921 CTTATATGGTTTTGTG .sup.mC.sub.ksT.sub.ksT.sub.ksA.sub.dsT.sub.dsA.sub.ysT.sub.dsG.sub.dsG.sub.dsT.sub.ds 48 2788 T.sub.dsT.sub.dsT.sub.dsG.sub.ksT.sub.ksG.sub.k 1200841 N/A N/A 115907 115922 TCTTAUATGGTTTTGT T.sub.ks.sup.mC.sub.ksT.sub.ksT.sub.dsA.sub.dsU.sub.ysA.sub.dsT.sub.dsG.sub.dsG.sub.ds 76 2929 T.sub.dsT.sub.dsT.sub.dsT.sub.ksG.sub.ksT.sub.k 1200842 N/A N/A 115908 115923 CTCTTATATGGTTTTG .sup.mC.sub.ksT.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsA.sub.ysT.sub.dsA.sub.dsT.sub.ds 168 2842 G.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ksT.sub.ksG.sub.k 1200843 N/A N/A 115909 115924 ACTCTUATATGGTTTT A.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.dsT.sub.dsU.sub.ysA.sub.dsT.sub.dsA.sub.ds 46 2930 T.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ksT.sub.ksT.sub.k 1200844 N/A N/A 115910 115925 AACTCUTATATGGTTT A.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.ds.sup.mC.sub.dsU.sub.ysT.sub.dsA.sub.dsT.sub.ds 132 2931 A.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.ksT.sub.ksT.sub.k 1200845 N/A N/A 115911 115926 CAACTCTTATATGGTT .sup.mC.sub.ksA.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsC.sub.ysT.sub.dsT.sub.dsA.sub.ds 100 2861 T.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.ksT.sub.ksT.sub.k 1200846 N/A N/A 115913 115928 GACAACTCTTATATGG G.sub.ksA.sub.ks.sup.mC.sub.ksA.sub.dsA.sub.dsC.sub.ysT.sub.ds.sup.mC.sub.dsT.sub.ds 38 2862 T.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ksG.sub.ksG.sub.k 1200847 N/A N/A 117325 117340 ATTGCAATCTGTCTGA A.sub.ksT.sub.ksT.sub.ksG.sub.ds.sup.mC.sub.dsA.sub.ysA.sub.dsT.sub.ds.sup.mC.sub.ds 54 2843 T.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksA.sub.k 1200848 N/A N/A 117327 117342 ATATTGCAATCTGTCT A.sub.ksT.sub.ksA.sub.ksT.sub.dsT.sub.dsG.sub.ys.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.m 58 2844 C.sub.dsT.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ksT.sub.k 1200849 N/A N/A 117328 117343 AATATUGCAATCTGTC A.sub.ksA.sub.ksT.sub.ksA.sub.dsT.sub.dsU.sub.ysG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds 53 2932 T.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ksT.sub.ks.sup.mC.sub.k 1200850 N/A N/A 117329 117344 TAATAUTGCAATCTGT T.sub.ksA.sub.ksA.sub.ksT.sub.dsA.sub.dsU.sub.ysT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds 83 2933 A.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksT.sub.k 1200851 N/A N/A 117330 117345 GTAATATTGCAATCTG G.sub.ksT.sub.ksA.sub.ksA.sub.dsT.sub.dsA.sub.ysT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds 25 1404 A.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k 1200852 N/A N/A 117331 117346 TGTAAUATTGCAATCT T.sub.ksG.sub.ksT.sub.ksA.sub.dsA.sub.dsU.sub.ysA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.m 32 2934 C.sub.dsA.sub.dsA.sub.dsT.sub.ks.sup.mC.sub.ksT.sub.k 1200853 N/A N/A 117332 117347 ATGTAATATTGCAATC A.sub.ksT.sub.ksG.sub.ksT.sub.dsA.sub.dsA.sub.ysT.sub.dsA.sub.dsT.sub.dsT.sub.ds 69 2848 G.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ksT.sub.ks.sup.mC.sub.k 1200854 N/A N/A 117333 117348 TATGTAATATTGCAAT T.sub.ksA.sub.ksT.sub.ksG.sub.dsT.sub.dsA.sub.ysA.sub.dsT.sub.dsA.sub.dsT.sub.ds 91 2849 T.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ksT.sub.k 1200855 N/A N/A 117335 117350 TTTATGTAATATTGCA T.sub.ksT.sub.ksT.sub.ksA.sub.dsT.sub.dsG.sub.ysT.sub.dsA.sub.dsA.sub.dsT.sub.ds 56 2850 A.sub.dsT.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 1200856 N/A N/A 117755 117770 TGTATGTCAGAAGAGT T.sub.ksG.sub.ksT.sub.ksA.sub.dsT.sub.dsG.sub.ysT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds 29 2863 A.sub.dsA.sub.dsG.sub.dsA.sub.ksG.sub.ksT.sub.k 1200857 N/A N/A 117757 117772 AGTGTATGTCAGAAGA A.sub.ksG.sub.ksT.sub.ksG.sub.dsT.sub.dsA.sub.ysT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 4 2864 A.sub.dsG.sub.dsA.sub.dsA.sub.ksG.sub.ksA.sub.k 1200858 N/A N/A 117758 117773 AAGTGUATGTCAGAAG A.sub.ksA.sub.ksG.sub.ksT.sub.dsG.sub.dsU.sub.ysA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.m 10 2935 C.sub.dsA.sub.dsG.sub.dsA.sub.ksA.sub.ksG.sub.k 1200859 N/A N/A 117759 117774 AAAGTGTATGTCAGAA A.sub.ksA.sub.ksA.sub.ksG.sub.dsT.sub.dsG.sub.ysT.sub.dsA.sub.dsT.sub.dsG.sub.ds 28 2866 T.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ksA.sub.ksA.sub.k 1200860 N/A N/A 117760 117775 TAAAGUGTATGTCAGA T.sub.ksA.sub.ksA.sub.ksA.sub.dsG.sub.dsU.sub.ysG.sub.dsT.sub.dsA.sub.dsT.sub.ds 16 2936 G.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksA.sub.k 1200861 N/A N/A 117761 117776 TTAAAGTGTATGTCAG T.sub.ksT.sub.ksA.sub.ksA.sub.dsA.sub.dsG.sub.ysT.sub.dsG.sub.dsT.sub.dsA.sub.ds 10 2868 T.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k 1200862 N/A N/A 117762 117777 TTTAAAGTGTATGTCA T.sub.ksT.sub.ksT.sub.ksA.sub.dsA.sub.dsA.sub.ysG.sub.dsT.sub.dsG.sub.dsT.sub.ds 17 2869 A.sub.dsT.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ksA.sub.k 1200863 N/A N/A 117763 117778 CTTTAAAGTGTATGTC .sup.mC.sub.ksT.sub.ksT.sub.ksT.sub.dsA.sub.dsA.sub.ysA.sub.dsG.sub.dsT.sub.ds 41 1634 G.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.ksT.sub.ks.sup.mC.sub.k 1200864 N/A N/A 117765 117780 AACTTUAAAGTGTATG A.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsU.sub.ysA.sub.dsA.sub.dsA.sub.dsG.sub.ds 84 2937 T.sub.dsG.sub.dsT.sub.dsA.sub.ksT.sub.ksG.sub.k 1200865 N/A N/A 119667 119682 TAAGGUTTCCCAGATT T.sub.ksA.sub.ksA.sub.ksG.sub.dsG.sub.dsU.sub.ysT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.m 54 2938 C.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.ksT.sub.ksT.sub.k 1200866 N/A N/A 119669 119684 AGTAAGGTTTCCCAGA A.sub.ksG.sub.ksT.sub.ksA.sub.dsA.sub.dsG.sub.ysG.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.m 41 2852 C.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksA.sub.k 1200867 N/A N/A 119670 119685 AAGTAAGGTTTCCCAG A.sub.ksA.sub.ksG.sub.ksT.sub.dsA.sub.dsA.sub.ysG.sub.dsG.sub.dsT.sub.dsT.sub.ds 38 2853 T.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k 1200868 N/A N/A 119671 119686 TAAGTAAGGTTTCCCA T.sub.ksA.sub.ksA.sub.ksG.sub.dsT.sub.dsA.sub.ysA.sub.dsG.sub.dsG.sub.dsT.sub.ds 36 2854 T.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k 1200869 N/A N/A 119672 119687 CTAAGUAAGGTTTCCC .sup.mC.sub.ksT.sub.ksA.sub.ksA.sub.dsG.sub.dsU.sub.ysA.sub.dsA.sub.dsG.sub.ds 25 2939 G.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 1200870 N/A N/A 119673 119688 ACTAAGTAAGGTTTCC A.sub.ks.sup.mC.sub.ksT.sub.ksA.sub.dsA.sub.dsG.sub.ysT.sub.dsA.sub.dsA.sub.dsG.sub.ds 73 2855 G.sub.dsT.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 1200871 N/A N/A 119674 119689 GACTAAGTAAGGTTTC G.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.dsA.sub.dsA.sub.ysG.sub.dsT.sub.dsA.sub.dsA.sub.ds 65 2856 G.sub.dsG.sub.dsT.sub.dsT.sub.ksT.sub.ks.sup.mC.sub.k 1200872 N/A N/A 119675 119690 AGACTAAGTAAGGTTT A.sub.ksG.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsA.sub.ysA.sub.dsG.sub.dsT.sub.dsA.sub.ds 98 2857 A.sub.dsG.sub.dsG.sub.dsT.sub.ksT.sub.ksT.sub.k 1200873 N/A N/A 119677 119692 TTAGACTAAGTAAGGT T.sub.ksT.sub.ksA.sub.ksG.sub.dsA.sub.dsC.sub.ysT.sub.dsA.sub.dsA.sub.dsG.sub.ds 55 2858 T.sub.dsA.sub.dsA.sub.dsG.sub.ksG.sub.ksT.sub.k
Example 6
Dose-Dependent Inhibition of Human Yap1 in A-431 Cells by cEt Gapmers
[0569] Modified oligonucleotides described in the studies above were tested at various doses in A-431 cells. Cultured A-431 cells at a density of 5,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (%UTC). IC50s were calculated using a linear regression on a log/linear plot of the data in excel.
TABLE-US-00053 TABLE 53 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 148 nM 444 nM 1333 nM 4000 nM (μM) 715415 84 59 55 42 1.8 715423 83 91 80 57 >4.0 715433 87 72 65 40 2.5 715434 84 69 64 43 2.8 715473 89 67 50 30 1.3 715478 70 47 29 16 0.4 715479 98 80 77 64 >4.0 715480 91 79 67 59 >4.0 715483 82 58 43 35 1.1 715486 93 89 81 56 >4.0 715487 87 56 48 29 1.0 715490 98 89 76 43 4.1 715500 97 72 67 48 3.6 715501 82 82 68 56 >4.0 715508 78 70 67 43 3.5 715510 88 67 59 45 2.4 715523 100 62 75 44 3.2 715555 93 71 63 42 2.5 715577 87 76 73 45 >4.0
TABLE-US-00054 TABLE 54 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 148 nM 444 nM 1333 nM 4000 nM (μM) 715414 91 91 102 67 >4.0 715435 80 67 61 48 3.4 715471 82 103 105 79 >4.0 715478 72 59 31 18 0.6 715558 94 112 80 66 >4.0 715582 98 63 93 70 >4.0 716370 81 79 69 49 >4.0 716376 103 94 79 50 >4.0 716424 76 69 51 44 2.0 716445 89 82 56 44 2.6 716454 91 71 54 48 2.6 716469 71 78 89 39 >4.0 716481 89 90 58 32 2.0 716484 88 78 80 55 >4.0 716493 95 97 86 72 >4.0 716496 74 87 64 49 >4.0 716502 73 57 45 30 0.8 716505 83 103 82 66 >4.0 716577 109 93 79 60 >4.0
TABLE-US-00055 TABLE 55 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 148 nM 444 nM 1333 nM 4000 nM (μM) 715478 76 56 32 18 0.6 716381 106 90 80 44 4.2 716387 94 94 80 67 >4.0 716407 84 75 72 39 3.0 716419 89 84 49 47 2.5 716438 93 75 62 49 3.4 716455 95 70 49 25 1.2 716479 88 78 55 57 >4.0 716480 80 56 38 39 1.0 716489 84 83 69 61 >4.0 716500 88 96 79 46 >4.0 716501 91 69 66 55 >4.0 716503 91 80 67 64 >4.0 716513 82 73 39 39 1.4 716524 103 92 96 62 >4.0 716537 120 96 88 63 >4.0 716543 62 99 79 64 >4.0 716548 99 89 79 67 >4.0 716554 87 90 76 50 >4.0
Example 7
Dose-Dependent Inhibition of Human Yap1 in A-431 Cells by cEt Gapmers
[0570] Modified oligonucleotides described in the studies above were tested at various doses in A-431 cells. Cultured A-431 cells at a density of 10,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS36584. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). IC50s were calculated using a linear regression on a log/linear plot of the data in excel.
TABLE-US-00056 TABLE 56 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 15.6 nM 62.5 nM 250.0 nM 4000.00 nM (μM) 715483 78 38 15 6 0.05 715491 92 83 48 28 0.27 958356 84 79 39 21 0.18 958361 100 80 42 22 0.22 958369 107 68 34 17 0.17 958370 98 74 41 22 0.20 958371 89 57 27 11 0.10 958373 72 45 21 17 0.05 958375 74 35 11 5 0.04 958377 90 60 38 17 0.13 958403 94 63 30 12 0.12 958476 71 30 13 6 0.03 958496 86 53 27 9 0.09 958536 94 67 30 16 0.14 958596 69 38 14 7 0.04 958721 72 32 9 3 0.03 958726 99 70 40 16 0.17 958736 83 38 14 7 0.06 958796 91 62 32 15 0.13
TABLE-US-00057 TABLE 57 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 15.6 nM 62.5 nM 250.0 nM 4000.00 nM (μM) 715483 79 45 15 4 0.1 958451 98 74 51 23 0.2 958466 84 81 49 30 0.3 958481 86 62 28 14 0.1 958486 87 73 45 22 0.2 958491 94 65 27 10 0.1 958506 80 55 24 10 0.1 958526 118 83 40 17 0.2 958531 92 63 26 13 0.1 958541 81 51 18 9 0.1 958546 91 72 45 22 0.2 958551 95 73 34 14 0.2 958556 103 95 63 34 0.5 958616 78 49 29 17 0.1 958686 75 69 38 18 0.1 958731 85 64 39 19 0.1 958761 84 73 41 24 0.2 958781 77 45 20 10 0.1 958786 106 84 51 25 0.3
TABLE-US-00058 TABLE 58 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 15.6 nM 62.5 nM 250.0 nM 4000.00 nM (μM) 715483 84 44 15 5 0.1 958457 91 50 24 13 0.1 958472 92 63 39 23 0.2 958477 83 37 14 6 0.1 958497 82 35 11 3 0.1 958527 89 74 35 13 0.1 958532 88 44 16 7 0.1 958537 100 56 21 11 0.1 958542 90 70 35 17 0.1 958547 98 74 43 22 0.2 958567 99 80 44 16 0.2 958577 81 51 22 11 0.1 958587 94 49 18 7 0.1 958622 79 50 18 7 0.1 958727 90 42 25 8 0.1 958742 105 70 39 20 0.2 958752 102 66 26 9 0.1 958757 110 89 43 27 0.3 958807 92 65 30 10 0.1
TABLE-US-00059 TABLE 59 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 15.6 nM 62.5 nM 250.0 nM 4000.00 nM (μM) 715483 83 44 16 4 0.1 958498 70 21 5 2 0.02 958507 93 69 38 19 0.2 958518 95 55 18 4 0.1 958533 99 61 27 12 0.1 958553 68 23 12 5 0.03 958562 105 95 59 28 0.4 958563 94 54 22 10 0.1 958572 83 77 31 22 0.2 958573 81 56 23 8 0.1 958597 104 46 45 20 0.2 958603 70 27 11 4 0.03 958623 100 62 29 10 0.1 958668 81 38 12 5 0.1 958737 104 92 57 29 0.4 958758 83 66 33 12 0.1 958763 98 60 22 8 0.1 958767 101 57 20 10 0.1 958798 101 61 26 12 0.1
TABLE-US-00060 TABLE 60 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 15.6 nM 62.5 nM 250.0 nM 4000.00 nM (μM) 715483 79 40 13 3 0.1 958473 85 60 29 17 0.1 958508 65 64 32 13 0.1 958523 86 64 31 12 0.1 958538 101 77 52 30 0.3 958543 84 63 36 18 0.1 958554 70 34 11 4 0.03 958558 84 83 67 35 0.5 958568 88 65 37 21 0.1 958578 78 52 23 10 0.1 958588 93 73 46 27 0.2 958593 99 60 27 15 0.1 958598 93 58 36 19 0.1 958648 80 65 48 24 0.2 958658 90 88 59 29 0.4 958718 104 80 44 24 0.2 958753 72 48 20 11 0.1 958793 88 61 42 25 0.2 958813 81 79 47 29 0.2
TABLE-US-00061 TABLE 61 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 15.6 nM 62.5 nM 250.0 nM 4000.00 nM (μM) 715483 80 38 13 4 0.1 958454 72 40 12 4 0.04 958474 63 37 18 11 0.03 958484 77 38 10 4 0.05 958499 54 12 3 1 <0.01 958509 66 37 15 7 0.03 958529 103 64 27 11 0.1 958534 85 48 21 9 0.1 958569 82 49 24 7 0.1 958579 85 52 24 12 0.1 958589 75 50 19 8 0.1 958599 100 74 44 16 0.2 958614 84 49 22 13 0.1 958644 97 85 50 24 0.3 958659 91 68 28 9 0.1 958724 89 55 20 6 0.1 958729 73 44 13 4 0.05 958739 77 46 19 7 0.1 958799 88 53 25 10 0.1
TABLE-US-00062 TABLE 62 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 15.6 nM 62.5 nM 250.0 nM 4000.00 nM (μM) 715483 88 40 12 4 0.1 958485 68 38 13 8 0.04 958525 94 57 26 8 0.1 958544 65 77 40 17 0.1 958545 75 50 19 8 0.1 958549 98 78 47 28 0.3 958550 91 60 26 10 0.1 958555 99 73 34 13 0.2 958565 83 62 30 13 0.1 958580 95 59 24 9 0.1 958590 71 33 9 4 0.03 958594 91 70 42 20 0.2 958615 91 60 34 18 0.1 958650 82 51 17 7 0.1 958725 65 36 7 1 0.03 958730 88 48 19 7 0.1 958734 87 65 35 15 0.1 958785 78 52 18 6 0.1 958819 79 63 34 19 0.1
TABLE-US-00063 TABLE 63 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 15.6 nM 62.5 nM 250.0 nM 4000.00 nM (μM) 715483 87 45 15 4 0.1 715483 77 36 10 3 0.04 715487 77 44 13 4 0.1 716454 84 39 12 6 0.1 958490 81 54 26 13 0.1 958500 91 63 32 16 0.1 958505 81 72 53 21 0.2 958535 98 64 38 19 0.2 958540 62 28 14 8 0.02 958570 93 60 33 17 0.1 958575 89 58 34 20 0.1 958585 95 71 40 17 0.2 958595 83 57 37 16 0.1 958600 69 44 23 14 0.05 958605 76 63 34 9 0.1 958625 86 59 35 17 0.1 958735 116 69 37 23 0.2 958795 90 69 38 20 0.2 958805 90 89 56 28 0.3
Example 8
Dose-Dependent Inhibition of Human Yap1 in A-431 Cells by cEt Gapmers
[0571] Modified oligonucleotides described in the studies above were tested at various doses in A-431 cells. Cultured A-431 cells at a density of 10,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). IC50s were calculated using a linear regression on a log/linear plot of the data in excel.
TABLE-US-00064 TABLE 64 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 958499 27 4 3 2 <0.02 1074368 67 34 15 10 0.1 1074464 25 6 3 3 <0.02 1074560 50 16 6 4 <0.02 1074753 42 10 6 4 <0.02 1075137 70 22 8 4 0.1 1075233 45 12 5 3 <0.02 1075712 69 38 13 7 0.1 1075744 55 22 9 7 <0.02 1075808 38 9 4 4 <0.02 1075968 74 37 11 5 0.1 1076000 71 31 10 5 0.1 1076064 68 26 10 5 0.1 1076256 68 33 11 6 0.1 1076288 31 7 3 4 <0.02 1076416 67 33 13 7 0.1 1076448 61 19 4 3 <0.02 1076449 44 8 3 2 <0.02 1076481 21 4 2 3 <0.02
TABLE-US-00065 TABLE 65 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 958499 24 4 2 2 <0.02 1074274 42 14 7 5 <0.02 1074593 50 20 9 8 <0.02 1074594 53 23 10 5 <0.02 1074595 67 21 8 4 0.04 1074626 54 18 8 5 <0.02 1074627 17 5 3 3 <0.02 1074755 28 9 5 3 <0.02 1074817 50 22 13 11 <0.02 1074850 63 20 7 5 0.04 1075041 62 31 11 7 0.05 1075138 66 27 8 5 0.05 1075457 52 21 8 6 <0.02 1075458 74 43 17 6 0.1 1075778 56 29 10 5 0.03 1075810 67 28 12 7 0.1 1075842 27 7 3 3 <0.02 1076067 45 13 5 4 <0.02 1076386 61 30 11 5 0.04
TABLE-US-00066 TABLE 66 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 958499 28 4 2 2 <0.02 1074563 80 31 7 5 0.1 1074564 40 14 7 4 <0.02 1074628 29 13 7 6 <0.02 1074723 56 24 11 8 <0.02 1074756 22 7 4 4 <0.02 1074851 51 19 9 7 <0.02 1074852 36 11 4 4 <0.02 1075395 60 18 7 5 <0.02 1075748 81 36 12 7 0.1 1075876 47 20 7 5 <0.02 1075939 46 19 10 8 <0.02 1076003 60 28 17 11 0.04 1076004 27 7 3 2 <0.02 1076260 61 30 12 5 0.05 1076291 75 26 8 5 0.1 1076323 41 35 13 5 <0.02 1076388 87 40 13 6 0.1 1076483 63 27 11 6 0.04
TABLE-US-00067 TABLE 67 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 958499 23 4 2 2 <0.02 1074245 47 21 8 5 <0.02 1074565 47 20 9 6 <0.02 1074566 41 12 5 3 <0.02 1074597 35 15 8 7 <0.02 1074629 21 5 3 3 <0.02 1074630 57 23 10 6 <0.02 1074726 26 8 4 3 <0.02 1074758 74 23 8 5 0.1 1075078 65 32 12 4 0.1 1075749 46 22 7 4 <0.02 1075781 52 15 4 3 <0.02 1075813 57 31 11 5 0.04 1076293 49 18 6 5 <0.02 1076326 53 20 6 3 <0.02 1076453 11 2 1 2 <0.02 1076486 84 45 16 6 0.1 1076516 64 39 18 13 0.1 1076549 53 24 10 6 <0.02
TABLE-US-00068 TABLE 68 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 958499 31 5 2 2 <0.02 1074407 55 27 13 8 <0.02 1074535 57 21 7 5 <0.02 1074536 64 24 9 6 0.04 1074728 28 7 4 4 <0.02 1074792 48 17 7 5 <0.02 1075047 80 63 27 10 0.2 1075048 76 42 13 5 0.1 1075111 42 11 6 5 <0.02 1075112 87 36 13 7 0.1 1075143 59 21 5 3 <0.02 1075207 82 51 17 7 0.1 1075686 72 44 18 14 0.1 1075784 54 18 5 3 <0.02 1076070 55 17 8 6 <0.02 1076294 76 50 21 11 0.1 1076295 55 17 5 3 <0.02 1076327 73 38 17 9 0.1 1076456 43 14 5 3 <0.02
TABLE-US-00069 TABLE 69 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 958499 36 5 2 2 <0.02 1074250 67 35 15 9 0.1 1074313 56 21 9 5 <0.02 1074409 60 30 13 7 0.04 1074537 47 21 6 4 <0.02 1074762 74 32 14 8 0.1 1074794 56 23 10 6 <0.02 1075081 76 50 22 9 0.1 1075401 62 26 11 7 0.04 1075465 75 35 14 9 0.1 1075689 97 59 19 8 0.2 1075785 29 7 3 3 <0.02 1075816 66 29 12 8 0.1 1076330 57 31 9 4 0.04 1076393 54 20 8 5 <0.02 1076458 88 52 23 10 0.2 1076489 43 13 4 3 <0.02 1076490 36 9 4 3 <0.02 1076552 73 40 17 12 0.1
TABLE-US-00070 TABLE 70 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 958499 27 4 2 2 <0.02 1074251 73 33 16 10 0.1 1074315 57 26 9 5 0.03 1074411 47 20 8 6 <0.02 1074443 69 35 14 8 0.1 1074795 38 14 7 5 <0.02 1075115 57 41 17 9 0.1 1075146 67 38 16 8 0.1 1075242 71 39 18 12 0.1 1075243 50 18 7 5 <0.02 1075498 82 40 21 16 0.1 1075819 48 18 7 5 <0.02 1076298 92 58 29 18 0.2 1076299 68 38 13 5 0.1 1076426 68 46 24 18 0.1 1076427 75 30 9 4 0.1 1076459 67 32 13 7 0.1 1076491 81 45 21 10 0.1 1076523 67 38 18 7 0.1
TABLE-US-00071 TABLE 71 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 958499 29 5 2 2 <0.02 1074221 75 38 14 7 0.1 1074413 50 19 6 3 <0.02 1074444 49 21 7 4 <0.02 1074508 62 30 14 8 0.05 1074509 44 12 6 5 <0.02 1075052 40 10 4 4 <0.02 1075053 61 24 8 5 0.04 1075084 103 72 37 14 0.3 1075757 43 14 5 2 <0.02 1075916 73 34 14 8 0.1 1076077 53 19 9 5 <0.02 1076396 64 22 5 3 0.04 1076397 43 14 5 4 <0.02 1076460 79 53 25 12 0.2 1076461 65 24 7 3 0.04 1076524 71 30 12 7 0.1 1076525 43 14 5 2 <0.02 1076556 72 46 19 11 0.1
TABLE-US-00072 TABLE 72 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 958499 95 89 82 81 >2.0 1074222 59 21 8 5 <0.02 1074318 48 12 6 4 <0.02 1074414 64 34 14 7 0.1 1074445 57 19 8 6 <0.02 1074446 39 11 5 3 <0.02 1074477 77 48 20 12 0.1 1074606 31 10 6 4 <0.02 1074638 14 4 3 3 <0.02 1074766 72 32 14 7 0.1 1074798 34 12 5 6 <0.02 1075118 85 36 8 4 0.1 1075246 70 34 12 6 0.1 1076174 58 21 7 4 <0.02 1076366 63 25 8 4 0.04 1076430 42 14 6 4 <0.02 1076462 61 22 8 5 0.03 1076494 34 7 3 2 <0.02 1076526 44 9 3 2 <0.02
TABLE-US-00073 TABLE 73 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 958499 103 89 85 87 >2.0 1074351 69 33 13 7 0.1 1074447 47 20 8 5 <0.02 1074448 54 13 4 3 <0.02 1074479 23 8 4 4 <0.02 1074480 33 9 5 3 <0.02 1074607 45 22 10 5 <0.02 1074639 46 18 7 5 <0.02 1075055 60 20 6 4 0.03 1075088 37 9 4 2 <0.02 1075824 33 10 5 3 <0.02 1075855 65 30 12 8 0.1 1075983 81 46 17 6 0.1 1076015 70 37 15 9 0.1 1076143 81 48 20 9 0.1 1076367 31 10 4 3 <0.02 1076399 60 29 11 6 0.04 1076464 36 10 3 2 <0.02 1076527 81 41 16 8 0.1
TABLE-US-00074 TABLE 74 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 958499 33 5 3 2 <0.02 1074417 68 26 7 3 0.1 1074576 69 41 14 9 0.1 1074577 33 10 4 3 <0.02 1074608 49 20 9 7 <0.02 1074609 65 29 15 11 0.1 1074672 34 18 10 7 <0.02 1074736 34 12 7 7 <0.02 1074737 50 21 8 6 <0.02 1074800 48 21 10 7 <0.02 1074801 76 41 19 12 0.1 1075089 45 9 3 3 <0.02 1075249 77 37 16 8 0.1 1075792 79 41 15 10 0.1 1076017 59 25 9 5 0.03 1076049 61 16 13 6 <0.02 1076369 60 20 6 3 <0.02 1076370 46 12 4 2 <0.02 1076465 72 32 14 7 0.1
TABLE-US-00075 TABLE 75 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 958499 27 5 2 2 <0.02 1074290 49 17 9 7 <0.02 1074418 55 26 9 4 <0.02 1074419 48 15 5 3 <0.02 1074420 38 8 3 2 <0.02 1074450 54 22 7 5 <0.02 1074451 63 26 8 4 0.04 1074484 43 12 5 3 <0.02 1074578 66 30 18 11 0.1 1074579 54 22 8 5 <0.02 1074610 57 20 10 7 <0.02 1074675 47 18 6 3 <0.02 1075155 51 15 6 4 <0.02 1075699 26 6 3 2 <0.02 1076114 34 11 6 5 <0.02 1076115 47 17 9 6 <0.02 1076466 43 18 8 6 <0.02 1076467 24 6 3 2 <0.02 1076530 53 26 11 7 <0.02
TABLE-US-00076 TABLE 76 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 958499 36 5 2 2 <0.02 1074229 58 24 9 5 <0.02 1074421 61 29 8 5 0.04 1074452 88 28 9 5 0.1 1074453 51 18 9 5 <0.02 1074485 47 14 5 3 <0.02 1074548 50 15 7 8 <0.02 1074549 67 31 12 7 0.1 1074580 55 18 8 5 <0.02 1074613 63 23 9 6 0.04 1074676 54 16 6 5 <0.02 1075061 58 23 9 6 <0.02 1075093 74 26 7 4 0.1 1075701 84 34 11 6 0.1 1075797 43 11 4 3 <0.02 1075893 80 29 11 8 0.1 1076084 69 34 12 8 0.1 1076085 70 34 14 9 0.1 1076340 79 42 17 11 0.1
TABLE-US-00077 TABLE 77 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 958499 37 4 2 2 <0.02 1074230 62 30 12 8 0.05 1074454 39 9 3 3 <0.02 1074486 55 26 10 6 <0.02 1074487 73 28 11 6 0.1 1074678 73 37 16 10 0.1 1074679 52 16 6 5 <0.02 1074775 26 5 2 2 <0.02 1075222 75 30 8 5 0.1 1075766 56 21 11 8 <0.02 1075990 28 6 3 3 <0.02 1076022 63 28 8 5 0.04 1076023 60 18 5 3 <0.02 1076119 82 35 12 6 0.1 1076183 65 22 9 6 0.04 1076406 51 20 9 7 <0.02 1076439 48 13 6 5 <0.02 1076471 64 29 9 5 0.05 1076534 88 48 20 10 0.2
Example 9
Dose-Dependent Inhibition of Human Yap1 in SNU-449 Cells by Modified Oligonucleotides
[0572] Modified oligonucleotides described in the studies above were tested at various doses in SNU-449 cells. Cultured SNU-449 cells at a density of 10,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS36584. Yap1 mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). IC50s were calculated using a linear regression on a log/linear plot of the data in excel.
TABLE-US-00078 TABLE 78 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in SNU-449 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 715487 94 47 23 8 0.2 1198371 85 66 46 21 0.3 1198380 72 55 27 11 0.1 1198382 77 56 36 18 0.2 1198384 76 50 24 17 0.1 1198397 70 53 28 14 0.1 1198398 73 55 33 18 0.2 1198406 70 57 31 16 0.2 1198409 100 68 45 27 0.4 1198412 73 54 33 15 0.2 1198422 88 60 30 19 0.2 1198423 58 35 15 6 0.05 1198424 64 44 24 9 0.1 1198438 62 28 7 2 0.04 1198439 44 21 5 2 <0.03 1198440 55 23 6 2 <0.03 1198718 87 37 14 4 0.1 1198719 67 30 9 3 0.1 1198746 49 24 9 3 <0.03
TABLE-US-00079 TABLE 79 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in SNU-449 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 715487 90 44 15 5 0.1 1198202 83 46 16 5 0.1 1198212 74 35 10 2 0.1 1198213 91 33 11 3 0.1 1198638 70 42 13 4 0.1 1198641 55 29 11 3 0.03 1198642 79 48 15 4 0.1 1198656 55 22 8 3 <0.03 1198664 52 33 14 5 <0.03 1198673 51 26 8 3 <0.03 1198696 58 31 11 2 0.04 1198697 60 29 7 1 0.04 1198698 55 29 8 2 0.03 1198724 56 25 8 3 <0.03 1198728 51 28 9 3 <0.03 1198786 63 32 11 2 0.1 1198787 68 21 6 1 0.05 1198788 64 30 7 2 0.1 1198799 62 35 13 4 0.1
TABLE-US-00080 TABLE 80 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in SNU-449 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 715487 98 56 25 10 0.2 958590 69 52 29 12 0.1 1074728 69 45 19 8 0.1 1097247 58 28 8 2 0.04 1197215 56 31 7 2 0.04 1197216 66 39 15 4 0.1 1197217 66 39 14 4 0.1 1198285 67 41 16 5 0.1 1198286 64 45 22 8 0.1 1198287 95 68 36 16 0.3 1198288 77 43 17 7 0.1 1198289 72 41 18 9 0.1 1198290 60 39 20 10 0.1 1198294 59 33 14 5 0.05 1198295 82 47 19 8 0.1 1198297 67 42 16 7 0.1 1198347 67 54 24 8 0.1 1198354 66 24 5 1 0.05 1198356 85 30 7 1 0.1
TABLE-US-00081 TABLE 81 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in SNU-449 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 715487 109 53 28 12 0.3 1198352 58 29 10 3 0.04 1198353 60 30 10 4 0.04 1198355 63 34 10 4 0.1 1198358 68 39 20 8 0.1 1198365 59 38 15 5 0.1 1198543 75 42 19 6 0.1 1198546 70 42 18 6 0.1 1198550 73 56 30 13 0.2 1198552 72 46 23 9 0.1 1198553 65 38 19 6 0.1 1198554 72 46 22 8 0.1 1198555 73 40 19 9 0.1 1198557 81 52 26 11 0.2 1198569 71 45 22 14 0.1 1198570 58 33 16 9 0.04 1198578 73 45 25 12 0.1 1198610 69 29 7 2 0.1 1198613 80 25 7 2 0.1
TABLE-US-00082 TABLE 82 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in SNU-449 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 715487 125 73 35 15 0.4 1197229 54 32 16 7 0.03 1197235 64 36 16 5 0.1 1197236 64 46 25 14 0.1 1197269 48 21 7 1 <0.03 1197270 43 23 8 2 <0.03 1197312 101 58 34 11 0.3 1197313 71 38 16 6 0.1 1198596 73 40 14 4 0.1 1198605 57 27 7 1 0.03 1198611 37 19 4 1 <0.03 1198612 44 12 2 0 <0.03 1198614 69 26 3 1 0.1 1198615 52 23 5 2 <0.03 1198616 78 46 18 5 0.1 1198623 48 24 5 1 <0.03 1198624 62 37 21 9 0.1 1200797 84 52 23 11 0.2 1200798 77 44 17 7 0.1
TABLE-US-00083 TABLE 83 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in SNU-449 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 715487 136 70 35 10 0.4 958499 93 47 19 7 0.2 1074461 76 37 15 5 0.1 1197271 70 47 19 8 0.1 1197309 91 63 30 9 0.2 1200784 70 51 26 12 0.1 1200785 98 73 42 24 0.4 1200788 61 38 19 9 0.1 1200789 60 32 15 5 0.05 1200794 85 59 31 13 0.2 1200796 69 47 25 12 0.1 1200803 72 52 34 18 0.2 1200806 91 54 34 18 0.2 1200820 104 69 36 17 0.3 1200857 66 30 8 2 0.1 1200858 71 39 14 4 0.1 1200860 59 35 15 5 0.05 1200861 74 43 17 4 0.1 1200862 88 64 35 13 0.2
TABLE-US-00084 TABLE 84 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in SNU-449 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 715487 100 62 29 12 0.3 1074462 90 38 13 3 0.1 1074464 109 50 19 6 0.2 1198804 71 48 19 5 0.1 1198805 61 42 20 7 0.1 1198814 63 25 6 3 0.04 1198815 84 64 34 15 0.2 1198818 68 33 15 5 0.1 1198831 74 33 10 4 0.1 1198832 77 53 23 13 0.1 1198856 72 55 24 7 0.1 1198857 78 44 13 4 0.1 1198873 38 12 2 0 <0.03 1198874 36 8 1 0 <0.03 1198875 61 23 4 1 0.04 1198895 62 37 16 9 0.1 1198911 62 31 12 7 0.05 1198917 81 37 12 6 0.1 1198918 60 33 13 9 0.05
TABLE-US-00085 TABLE 85 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in SNU-449 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 715487 103 56 25 10 0.2 1009325 59 36 16 4 0.1 1009326 59 35 14 4 0.05 1074756 42 20 6 3 <0.03 1074798 62 38 17 8 0.1 1076187 68 46 24 12 0.1 1076453 67 29 8 1 0.1 1076481 86 40 15 3 0.1 1197176 66 37 19 6 0.1 1197177 56 29 8 2 0.03 1197178 64 36 14 4 0.1 1197179 58 38 17 7 0.1 1197193 85 52 24 11 0.2 1197213 87 46 14 2 0.1 1197214 88 31 7 1 0.1 1197223 88 55 25 8 0.2 1198312 76 34 10 5 0.1 1198872 49 21 6 1 <0.03 1198877 62 32 13 5 0.05
TABLE-US-00086 TABLE 86 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in SNU-449 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 715487 92 53 22 12 0.2 1095481 73 47 16 8 0.1 1095593 73 44 27 10 0.1 1198203 71 51 25 11 0.1 1198211 72 37 23 12 0.1 1198243 55 28 10 5 <0.03 1198267 78 44 15 3 0.1 1198268 83 52 17 5 0.1 1198457 82 56 31 12 0.2 1198460 60 49 28 11 0.1 1198466 68 44 18 6 0.1 1198470 73 41 18 9 0.1 1198484 80 45 24 12 0.1 1198501 65 36 17 11 0.1 1198524 50 32 9 3 <0.03 1198525 62 26 8 1 0.04 1198526 61 30 8 2 0.04 1198527 63 35 12 3 0.1 1198905 75 43 21 6 0.1
TABLE-US-00087 TABLE 87 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in SNU-449 cells % UTC IC50 ION No. 31.3 nM 125.0 nM 500.0 nM 2000.00 nM (μM) 715487 89 48 23 10 0.2 1198492 67 39 19 10 0.1 1198494 59 37 24 13 0.1 1198499 89 42 30 12 0.2 1198500 72 51 34 15 0.2 1198502 76 50 29 15 0.2 1198504 77 46 27 24 0.1 1198507 83 57 29 13 0.2 1198510 71 44 18 6 0.1 1198528 87 54 30 11 0.2 1198529 86 69 37 16 0.3 1198900 69 36 18 7 0.1 1198902 74 46 22 10 0.1 1198904 78 36 23 10 0.1 1198935 50 46 23 11 0.04 1198958 68 39 16 5 0.1 1198959 62 28 8 2 0.04 1198960 77 35 8 2 0.1 1198961 77 35 11 3 0.1
Example 10
Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Balb/c Mice
[0573] Balb/c mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.
Treatment
[0574] Groups of male Balb/c mice at 4-6 weeks of age (obtained from Taconic) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male Balb/c mice was injected with PBS. Mice were euthanized on day 26 post start of treatment (24 hours following the final administration).
Plasma Chemistry Markers
[0575] To evaluate the effect of modified oligonucleotides on liver function, plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.
TABLE-US-00088 TABLE 88 Plasma chemistry markers in Balb/c mice ALT AST TBIL ION No. (U/L) (U/L) (mg/dL) PBS 35 56 0.18 715480 791 439 0.15 715484 116 110 0.15 715487 79 96 0.13 715491 33 48 0.11 715557 1755 2377 0.28 715558 65 91 0.16 715582 2460 2320 2.09 715593 628 610 0.11 715609 1120 2941 0.67 715659 332 431 0.23 715744 164 138 0.15 715763 522 316 0.18 715766 182 191 0.12 715784 47 47 0.13 715797 188 222 0.15 715859 306 133 0.17 715863 2090 903 0.54
Body and Organ Weights
[0576] Body weights of Balb/c mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
TABLE-US-00089 TABLE 89 Body and organ weights body weight Liver Kidney Spleen ION No. (g) (g) (g) (g) PBS 22 1.05 0.37 0.09 715480 22 1.64 0.34 0.12 715484 22 1.47 0.37 0.13 715487 23 1.24 0.36 0.14 715491 22 1.03 0.32 0.12 715557 21 1.96 0.31 0.12 715558 22 1.33 0.38 0.12 715582 22 1.46 0.38 0.16 715593 19 1.12 0.30 0.13 715609 21 2.64 0.33 0.10 715659 20 1.21 0.31 0.11 715744 22 1.18 0.32 0.17 715763 23 1.71 0.36 0.13 715766 21 1.40 0.30 0.12 715784 23 1.15 0.39 0.12 715797 22 1.39 0.36 0.16 715859 22 1.32 0.36 0.14 715863 21 1.79 0.33 0.12
Example 11
Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Balb/c Mice
[0577] Balb/c mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.
Treatment
[0578] Groups of male Balb/c mice at 4-6 weeks of age (obtained from Taconic) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male Balb/c mice was injected with PBS. Mice were euthanized on day 26 post start of treatment (24 hours following the final administration).
Plasma Chemistry Markers
[0579] To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.
TABLE-US-00090 TABLE 90 Plasma chemistry markers in Balb/c mice ALT AST BUN TBIL ION No. (U/L) (U/L) (mg/dL) (mg/dL) PBS 18 54 14 0.18 715415 1075 701 17 0.14 715473 3046 2861 20 2.77 715483 62 70 16 0.17 715487 59 81 16 0.18 716424 2077 1422 20 0.22 716454 39 60 14 0.18 716455 1089 1193 22 0.25 716480 2156 844 19 0.14 716481 1935 2248 21 0.46 716502 2920 1329 17 0.27 716513 325 229 17 0.14
Body and Organ Weights
[0580] Body weights of Balb/c mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
TABLE-US-00091 TABLE 91 Body and organ weights body weight Liver Kidney Spleen ION No. (g) (g) (g) (g) PBS 24 1.09 0.40 0.11 715415 25 1.79 0.40 0.17 715473 20 1.46 0.31 0.09 715483 25 1.56 0.43 0.12 715487 27 1.46 0.42 0.15 716424 23 2.08 0.36 0.15 716454 25 1.48 0.42 0.14 716455 21 2.66 0.32 0.14 716480 21 2.58 0.34 0.10 716481 22 1.99 0.36 0.13 716502 23 2.18 0.42 0.10 716513 25 1.59 0.41 0.18
Example 12
Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Balb/c Mice
[0581] Balb/c mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.
Treatment
[0582] Groups of male Balb/c mice at 6-7 weeks of age (obtained from Taconic) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male Balb/c mice was injected with PBS. Mice were euthanized on day 26 post start of treatment (24 hours following the final administration).
Plasma Chemistry Markers
[0583] To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.
TABLE-US-00092 TABLE 92 Plasma chemistry markers in Balb/c mice ALT AST TBIL BUN ION No. (U/L) (U/L) (mg/dL) (mg/dL) PBS 22 63 0.16 22 958375 2736 3013 0.43 22 958454 1183 2162 6.53 45 958498 1441 3197 0.74 12 958499 142 146 0.17 26 958509 1483 1627 0.31 26 958540 4127 3940 0.44 25 958553 174 227 0.20 29 958554 583 1051 0.28 17 958590 374 360 0.16 25 958603 1103 927 0.35 27 958721 57 114 0.17 28 958725 3758 3758 0.91 31 958729 4368 4503 2.15 30 958736 2439 1450 0.31 20
Body and Organ Weights
[0584] Body weights of Balb/c mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
TABLE-US-00093 TABLE 93 Body and organ weights body weight Liver Kidney Spleen ION No. (g) (g) (g) (g) PBS 24 1.28 0.37 0.09 958375 23 2.00 0.39 0.12 958454 14 0.68 0.25 0.03 958498 20 1.51 0.45 0.19 958499 23 1.44 0.32 0.14 958509 20 1.50 0.27 0.13 958540 19 1.53 0.33 0.09 958553 21 1.01 0.29 0.11 958554 22 1.05 0.28 0.15 958590 25 1.76 0.40 0.13 958603 21 1.80 0.36 0.20 958721 24 1.45 0.33 0.12 958725 15 1.23 0.21 0.04 958729 15 1.32 0.24 0.05 958736 24 1.95 0.39 0.18
Example 13
Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Balb/c Mice
[0585] Balb/c mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.
Treatment
[0586] Groups of male Balb/c mice at 4-6 weeks of age (obtained from Taconic) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male Balb/c mice was injected with PBS. Mice were euthanized on day 25 post start of treatment (24 hours following the final administration).
Plasma Chemistry Markers
[0587] To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.
TABLE-US-00094 TABLE 94 Plasma chemistry markers in Balb/c mice ALT AST TBIL BUN ION No. (U/L) (U/L) (mg/dL) (mg/dL) PBS 26* 65* 0.18 22 958371 249 199 0.24 30 958914 1855 1837 0.68 29 958933 63 122 0.22 33 958939 2236 1863 0.38 23 958941 772 500 0.23 30 958961 66 106 0.19 28 958973 93 126 0.20 22 959022 13242 8058 1.12 25 959030 1160 1328 0.21 29 959155 2146 1686 0.22 26 959167 1556 2096 0.56 24 959196 1169 785 0.31 27 959197 753 493 0.29 23 *Average of 3 values
Body and Organ Weights
[0588] Body weights of Balb/c mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
TABLE-US-00095 TABLE 95 Body and organ weights body weight Liver Kidney Spleen ION No. (g) (g) (g) (g) PBS 25 1.29 0.39 0.09 958371 23 1.31 0.32 0.15 958914 19 1.22 0.32 0.12 958933 27 1.86 0.37 0.15 958939 24 1.67 0.40 0.23 958941 26 1.81 0.37 0.15 958961 26 1.47 0.39 0.15 958973 26 1.71 0.40 0.19 959022 19 1.76 0.34 0.11 959030 25 1.73 0.38 0.14 959155 21 1.53 0.34 0.25 959167 22 0.96 0.37 0.10 959196 23 1.22 0.34 0.11 959197 23 1.37 0.34 0.14
Example 14
Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Balb/c Mice
[0589] Balb/c mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.
Treatment
[0590] Groups of male Balb/c mice at 5-6 weeks of age (obtained from Taconic) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male Balb/c mice was injected with PBS. Mice were euthanized on day 27 post start of treatment (24 hours following the final administration).
Plasma Chemistry Markers
[0591] To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.
TABLE-US-00096 TABLE 96 Plasma chemistry markers in Balb/c mice ALT AST TBIL BUN ION No. (U/L) (U/L) (mg/dL) (mg/dL) PBS 33 123 0.25 22 958497 46 151 0.24 26 958534 1962 1617 0.33 26 958589 35 66 0.21 24 958596 207 162 0.23 24 958622 224 254 0.24 23 958739 145 186 0.21 21
Body and Organ Weights
[0592] Body weights of Balb/c mice were measured on day 25, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
TABLE-US-00097 TABLE 97 Body and organ weights body weight Liver Kidney Spleen ION No. (g) (g) (g) (g) PBS 23 1.14 0.35 0.08 958497 23 1.31 0.35 0.11 958534 22 1.81 0.32 0.09 958589 25 1.40 0.37 0.10 958596 25 2.11 0.36 0.13 958622 23 0.92 0.33 0.12 958739 24 1.58 0.36 0.13
Example 15
Tolerability of Modified Oligonucleotides Targeting Human Yap1 in CD-1 Mice
[0593] CD-1 mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.
Treatment
[0594] Groups of four male CD-1 mice at 4-5 weeks of age (obtained from Charles River) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male CD-1 mice was injected with PBS. Mice were euthanized on day 26 post start of treatment (24 hrs following the final administration).
Plasma Chemistry Markers
[0595] To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB) and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.
TABLE-US-00098 TABLE 98 Plasma chemistry markers in CD-1 mice ALT AST TBIL BUN ALB ION No. (U/L) (U/L) (mg/dL) (mg/dL) (g/dL) PBS 32 47 19 0.2 2.5 1074234 81 187 23 0.2 2.3 1074461 1563 865 22 0.6 2.2 1074554 32 49 22 0.2 2.5 1074557 32 65 23 0.2 2.3 1074587 163 131 25 0.2 2.4 1074588 38 67 22 0.2 2.3 1074622 34 59 20 0.2 2.5 1074655 1360 978 19 0.3 2.0 1074680 78 125 19 0.1 2.0 1075067 28 59 23 6.4 2.5 1075068 43 81 19 0.2 2.2 1075741 114 113 20 0.2 2.3 1075768 48 65 19 0.2 2.3 1075769 74 103 18 0.2 2.5 1075774 45 71 20 0.2 2.5 1075838 97 131 22 0.2 2.2 715483 79 125 21 0.2 2.2 715487 66 113 21 0.1 1.9 716454 44 56 20 0.2 2.3
Body and Organ Weights
[0596] Body weights of CD-1 mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
TABLE-US-00099 TABLE 99 Body and organ weights body weight Liver Kidney Spleen ION No. (g) (g) (g) (g) PBS 44 2.51 0.61 0.12 1074234 37 2.26 0.55 0.12 1074554 38 2.09 0.52 0.11 1074557 38 1.87 0.61 0.15 1074587 39 2.33 0.58 0.16 1074588 40 2.40 0.69 0.20 1074622 38 2.16 0.64 0.21 1074655 39 3.40 0.69 0.30 1074680 42 2.52 0.65 0.24 1075067 40 2.12 0.65 0.17 1075068 38 2.15 0.64 0.20 1075741 39 2.21 0.62 0.23 1075768 37 1.86 0.54 0.13 1075769 35 1.76 0.47 0.10 1075774 37 2.23 0.59 0.14 1075838 41 2.28 0.57 0.25 715483 40 2.26 0.64 0.21 715487 41 2.24 0.59 0.21 716454 38 2.31 0.55 0.20
Example 16
Tolerability of Modified Oligonucleotides Targeting Human Yap1 in CD-1 Mice
[0597] CD-1 mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.
Treatment
[0598] Groups of four male CD-1 mice at 4-5 weeks of age (obtained from Charles River) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male CD-1 mice was injected with PBS. Mice were euthanized on day 27 post start of treatment (24hrs following the final administration).
Plasma Chemistry Markers
[0599] To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB) and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.
TABLE-US-00100 TABLE 100 Plasma chemistry markers in CD-1 mice ALT AST TBIL BUN Albumin ION No. (U/L) (U/L) (mg/dL) (mg/dL) (g/dL) PBS 21 45 0.19 22 2.5 1076024 41 88 0.19 19 2.3 1076157 55 105 0.19 19 2.1 1076186 74 97 0.16 23 2.5 1076187 57 90 0.18 20 2.3 1076190 48 63 0.17 20 2.2 1076287 53 98 0.20 21 2.1 1076379 37 89 0.15 20 2.1 1076382 52 87 0.14 19 1.9 1076475 38 62 0.15 18 2.0 1095493 1623 1449 0.69 18 1.8
Body and Organ Weights
[0600] Body weights of CD-1 mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
TABLE-US-00101 TABLE 101 Body and organ weights body weight Liver Kidney Spleen ION No. (g) (g) (g) (g) PBS 35 1.78 0.56 0.12 1076024 40 2.28 0.66 0.15 1076157 38 2.48 0.58 0.23 1076186 37 2.42 0.58 0.16 1076187 34 1.95 0.56 0.14 1076190 38 2.28 0.56 0.15 1076287 36 2.36 0.63 0.36 1076379 38 2.21 0.57 0.18 1076382 36 2.22 0.62 0.21 1076475 37 2.16 0.64 0.17 1095493 28 1.94 0.50 0.17
Example 17
Tolerability of Modified Oligonucleotides Targeting Human Yap1 in CD-1 Mice
[0601] CD-1 mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.
Treatment
[0602] Groups of four male CD-1 mice at 4-5 weeks of age (obtained from Charles River) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male CD-1 mice was injected with PBS. Mice were euthanized on day 27 post start of treatment (24 hrs following the final administration).
Plasma Chemistry Markers
[0603] To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB) and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.
TABLE-US-00102 TABLE 102 Plasma chemistry markers in CD-1 mice ALT AST BUN TBIL ION No. (U/L) (U/L) (mg/dL) (mg/dL) PBS 22 100 24 0.16 1095404 1282 503 22 0.14 1095515 1041 951 19 1.12 1095632 92 126 26 0.15 1096947 46 116 23 0.17 1096450 1104 635 25 2.19 1096973 35 59 20 0.22 1097037 73 97 23 0.12 1096522 652 397 21 0.16 1075395 38 51 21 0.18 1097183 834 738 16 0.39 1097224 39 78 21 0.09 1097231 85 112 21 0.13
Body and Organ Weights
[0604] Body weights of CD-1 mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
TABLE-US-00103 TABLE 103 Body and organ weights body weight Liver Kidney Spleen ION No. (g) (g) (g) (g) PBS 34 1.92 0.55 0.11 1095404 33 2.09 0.58 0.15 1095515 26 1.52 0.47 0.20 1095632 33 2.04 0.48 0.17 1096947 33 1.91 0.51 0.21 1096450 35 2.59 0.42 0.19 1096973 35 2.21 0.48 0.18 1097037 33 2.33 0.52 0.21 1096522 31 2.04 0.45 0.18 1075395 34 2.30 0.49 0.20 1097183 28 1.23 0.46 0.20 1097224 37 1.93 0.54 0.16 1097231 34 2.37 0.47 0.24
Example 18
Tolerability of Modified Oligonucleotides Targeting Human Yap1 in CD-1 Mice
[0605] CD-1 mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.
Treatment
[0606] Groups of four male CD-1 mice at 5-6 weeks of age (obtained from Charles River) were injected subcutaneously twice a week for four weeks (for a total of 9 treatments) with 50 mg/kg of modified oligonucleotides. One group of male CD-1 mice was injected with PBS. Mice were euthanized on day 34 post start of treatment (24hours following the final administration).
Plasma Chemistry Markers
[0607] To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB) and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.
TABLE-US-00104 TABLE 104 Plasma chemistry markers in CD-1 mice ALT AST BUN TBIL ION No. (U/L) (U/L) (mg/dL) (mg/dL) PBS 24 53 20 0.27 958499 79 88 24 0.18 1074755 88 104 22 0.21 1076453 56 113 20 0.24 1076481 71 121 23 0.23
Body and Organ Weights
[0608] Body weights of CD-1 mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
TABLE-US-00105 TABLE 105 Body and organ weights body weight Liver Kidney Spleen ION No. (g) (g) (g) (g) PBS 39 1.84 0.59 0.17 958499 39 2.20 0.57 0.22 1074755 39 2.27 0.61 0.19 1076453 38 1.91 0.56 0.20 1076481 39 2.06 0.57 0.23
Example 19
Tolerability of Modified Oligonucleotides Targeting Human Yap1 in CD-1 Mice
[0609] CD-1 mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.
Treatment
[0610] Groups of four male CD-1 mice at 4-6 weeks of age (obtained from Charles River) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male CD-1 mice was injected with PBS. Mice were euthanized on day 26 post start of treatment (24 hrs following the final administration).
Plasma Chemistry Markers
[0611] To evaluate the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB) and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.
TABLE-US-00106 TABLE 106 Plasma chemistry markers in CD-1 mice ALT AST TBIL BUN ION No. (U/L) (U/L) (mg/dL) (mg/dL) PBS 32 48 0.25 20 1198439 210 219 0.25 18 1198440 121 140 0.22 19 1198872 192 207 0.25 22 1157929 39 50 0.22 19 1157034 210 165 0.19 17 1157111 48 74 0.22 17
Body and Organ Weights
[0612] Body weights of CD-1 mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
TABLE-US-00107 TABLE 107 Body and organ weights body weight Liver Kidney Spleen ION No. (g) (g) (g) (g) PBS 36 2.04 0.59 0.12 1198439 36 2.03 0.51 0.25 1198440 35 1.97 0.46 0.18 1198872 34 1.84 0.40 0.16 1157929 34 1.98 0.43 0.13 1157034 35 2.43 0.53 0.17 1157111 36 2.53 0.50 0.21
Example 20
Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Sprague-Dawley Rats
[0613] Sprague-Dawley rats are a multipurpose model used for safety and efficacy evaluations. The rats were treated with Ionis modified oligonucleotides from the studies described in the Examples above and evaluated for changes in the levels of various plasma chemistry markers.
Treatment
[0614] Male Sprague-Dawley rats were maintained on a 12-hour light/dark cycle and fed ad libitum with Purina normal rat chow. Groups of 4 Sprague-Dawley rats each were weekly injected subcutaneously with 50 mg/kg of Ionis oligonucleotide for 6 weeks (total 7 doses). Forty-eight hours after the last dose, the rats were euthanized; and organs, urine and plasma were harvested for further analysis.
Plasma Chemistry Markers
[0615] To evaluate the effect of Ionis oligonucleotides on hepatic function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in the table below expressed in IU/L. Plasma levels of total bilirubin (TBIL), albumin (ALB), and blood urea nitrogen (BUN) were also measured using the same clinical chemistry analyzer and the results are also presented in the table below. Ionis modified oligonucleotides that caused changes in the levels of any markers of liver function outside the expected range for modified oligonucleotides were excluded in further studies.
TABLE-US-00108 TABLE 108 Plasma chemistry markers in Sprague-Dawley rats Plasma clinical chemistry ALT AST TBIL BUN ALB ASO (U/L) (U/L) (mg/dL) (mg/dL) (g/dL) PBS 31* 67* 0.17* 16 1.61 958499 61 109 0.18 24 2.78 1074755 57 97 0.12 29 2.99 1076187 54 113 0.10 21 2.91 1076453 47 77 0.13 23 3.14 1076481 50 91 0.13 49 2.74 1097224 31 51 0.07 86 1.61 *Refers to groups with only 3 data points
Kidney Function
[0616] To evaluate the effect of Ionis oligonucleotides on kidney function, urinary levels of total protein and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The ratios of total protein to creatinine (P/C ratio) are presented in the Table below. Ionis oligonucleotides that caused changes in the levels of the ratio outside the expected range for modified oligonucleotides were excluded in further studies.
TABLE-US-00109 TABLE 109 Total protein to creatinine ratio in Sprague-Dawley rats URINE P/C ION NO. ratio PBS 1 958499 5 1074755 5 1076187 5 1076453 5 1076481 5 1097224 87
Body and Organ Weights
[0617] Liver, spleen and kidney weights were measured at the end of the study and are presented in the table below. Terminal body weight was measured prior to necropsy. Ionis oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
TABLE-US-00110 TABLE 110 Body and Organ weights body weight Liver Kidney Spleen ION No. (g) (g) (g) (g) PBS 423 16 3.1 0.9 958499 333 14 3.1 2.8 1074755 357 16 3.3 2.1 1076187 344 17 3.0 1.7 1076453 371 16 3.2 2.1 1076481 367 14 2.6 2.1 1097224 316 13 4.5 1.4
Example 21
Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Sprague-Dawley Rats
[0618] Sprague-Dawley rats are a multipurpose model used for safety and efficacy evaluations. The rats were treated with Ionis modified oligonucleotides from the studies described in the Examples above and evaluated for changes in the levels of various plasma chemistry markers.
Treatment
[0619] Male Sprague-Dawley rats were maintained on a 12-hour light/dark cycle and fed ad libitum with Purina normal rat chow. Groups of 4 Sprague-Dawley rats each were weekly injected subcutaneously with 50 mg/kg of Ionis oligonucleotide for 6 weeks (total 7 doses). Forty-eight hours after the last dose, the rats were euthanized; and organs, urine and plasma were harvested for further analysis.
Plasma Chemistry Markers
[0620] To evaluate the effect of Ionis oligonucleotides on hepatic function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in the Table below expressed in IU/L. Plasma levels of total bilirubin (TBIL) and blood urea nitrogen (BUN) were also measured using the same clinical chemistry analyzer and the results are also presented in the Table below. Ionis modified oligonucleotides that caused changes in the levels of any markers of liver function outside the expected range for modified oligonucleotides were excluded in further studies.
TABLE-US-00111 TABLE 111 Plasma chemistry markers in Sprague-Dawley rats Plasma clinical chemistry ALT AST TBIL BUN ASO (U/L) (U/L) (mg/dL) (mg/dL) PBS 64 98 0.19 19 1198874 73 102 0.16 22 1200857 183 318 4.93 56 1074756 114* 79* 0.10* 0.57* 1198873 78* 79* 0.17* 24* 1198439 54* 94* 0.15* 22* 1198615 38 71 0.13 21 1198440 58** 108** 0.17** 20** 1198612 74 91 0.12 31 1198312 132 108 0.14 25 *Refers to groups with 3 samples **Refers to groups with 2 samples
Body and Organ Weights
[0621] Liver, spleen and kidney weights were measured at the end of the study and are presented in the table below. Terminal body weight was measured prior to necropsy. Ionis oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
TABLE-US-00112 TABLE 112 Body and Organ weights body weight Liver Kidney Spleen ION No. (g) (g) (g) (g) PBS 453 17 3.64 0.91 1198874 372 20 3.67 2.61 1200857 307 19 6.97 2.55 1074756 349 21* 4.71* 1.99* 1198873 408 19 3.65 2.42 1198439 319* 17* 3.68* 2.28* 1198615 369 16 3.01 2.35 1198440 373 18 3.29 2.78 1198612 345 17 3.60 2.33 1198312 365 19 4.26 2.19 *Refers to groups with 3 samples
Kidney Function
[0622] To evaluate the effect of Ionis oligonucleotides on kidney function, urinary levels of total protein and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The ratios of total protein to creatinine (P/C ratio) are presented in the Table below. Ionis oligonucleotides that caused changes in the levels of the ratio outside the expected range for modified oligonucleotides were excluded in further studies.
TABLE-US-00113 TABLE 113 Total protein to creatinine ratio in Sprague-Dawley rats URINE P/C ION NO. ratio PBS 1 1198874 9 1200857 52 1074756 167 1198873 9 1198439 8* 1198615 8 1198440 9 1198612 11 1198312 60 *Refers to groups with 3 samples
Example 22
Tolerability of Modified Oligonucleotides Targeting Human Yap1 in Sprague-Dawley Rats
[0623] Sprague-Dawley rats are a multipurpose model used for safety and efficacy evaluations. The rats were treated with Ionis modified oligonucleotides from the studies described in the Examples above and evaluated for changes in the levels of various plasma chemistry markers.
Treatment
[0624] Male Sprague-Dawley rats were maintained on a 12-hour light/dark cycle and fed ad libitum with Purina normal rat chow. Groups of 4 Sprague-Dawley rats each were weekly injected subcutaneously with 50 mg/kg of Ionis oligonucleotide for 6 weeks (total 7 doses). Forty-eight hours after the last dose, the rats were euthanized; and organs, urine and plasma were harvested for further analysis.
Plasma Chemistry Markers
[0625] To evaluate the effect of Ionis oligonucleotides on hepatic function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in the Table below expressed in IU/L. Plasma levels of total bilirubin (TBIL) and blood urea nitrogen (BUN) were also measured using the same clinical chemistry analyzer and the results are also presented in the Table below. Ionis modified oligonucleotides that caused changes in the levels of any markers of liver function outside the expected range for modified oligonucleotides were excluded in further studies.
TABLE-US-00114 TABLE 114 Plasma chemistry markers in Sprague-Dawley rats Plasma clinical chemistry ALT AST TBIL BUN ASO (U/L) (U/L) (mg/dL) (mg/dL) PBS 80 105 0.22 19 1197270 84 120 0.19 24 1198872 109 134 0.20 18 1198728 54 71 0.18 22 1198831 54 69 0.20 23 1198623 96 87 0.24 21 1198605 46 76 0.33 18
Kidney Function
[0626] To evaluate the effect of Ionis oligonucleotides on kidney function, urinary levels of total protein and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, N.Y.). The ratios of total protein to creatinine (P/C ratio) are presented in the Table below. Ionis oligonucleotides that caused changes in the levels of the ratio outside the expected range for modified oligonucleotides were excluded in further studies.
TABLE-US-00115 TABLE 115 Total protein to creatinine ratio in Sprague-Dawley rats URINE P/C ION NO. ratio PBS 1 1197270 14 1198872 8 1198728 7 1198831 17 1198623 5 1198605 28
Body and Organ Weights
[0627] Liver, spleen and kidney weights were measured at the end of the study and are presented in the table below. Terminal body weight was measured prior to necropsy. Ionis oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
TABLE-US-00116 TABLE 116 Body and Organ weights body weight Liver Kidney Spleen ION No. (g) (g) (g) (g) PBS 476 18 3.4 0.9 1197270 374 15 3.6 2.0 1198872 417 17 3.4 1.3 1198728 381 15 2.9 1.4 1198831 426 19 3.3 2.0 1198623 472 20 3.6 1.9 1198605 372 18 3.6 2.1
Example 23
Measurement of Viscosity of Modified Oligonucleotides Targeting Human Yap1
[0628] The viscosity of select modified oligonucleotides from the studies described above was measured with the aim of screening out modified oligonucleotides which have a viscosity of more than 40 centipoise (cP). Modified oligonucleotides having a viscosity greater than 40 cP would have less than optimal viscosity.
[0629] Oligonucleotides (32-38 mg) were weighed into a glass vial; approximately 100 μL of water was added, and the modified oligonucleotide was dissolved into solution by heating the vial to 55° C. Part (75 μL) of the pre-heated sample was pipetted to a micro-viscometer (PAC Cambridge Viscosity Viscometer). The temperature of the micro-viscometer was set to 25° C. and the viscosity of the sample was measured. The entire 75 uL of sample was them combined with the remaining portion of the sample was diluted appropriately for UV reading at 260 nM (Cary UV instrument). Modified oligonucleotides solutions that were not optimal in their viscosity under the criterion stated above were excluded in further studies.
TABLE-US-00117 TABLE 117 Viscosity of modified oligonucleotides Concentration Concentration Compound by weight by UV Viscocity ID (mg/mL) (mg/mL) (cP) 958499 300 220.7 84.5 1074755 300 217.2 7.2 1074756 300 232.8 17.4 1076187 300 237.4 40.6 1076453 300 229.1 46.4 1076481 300 213.0 6.4 1097224 300 230.7 8.1 1197269 300 211.4 10.7 1197270 300 241.6 15.1 1198243 300 234.0 13.4 1198312 300 233.1 17.5 1198439 300 233.8 14 1198440 300 219.7 8.6 1198501 300 220.0 14.5 1198605 300 220.7 59.6 1198611 300 228.3 8.6 1198612 300 230.1 10.2 1198615 300 223.1 23 1198623 300 215.4 20.8 1198641 300 223.2 16.4 1198656 300 227.6 26.1 1198673 300 237.2 15.3 1198728 300 241.8 30.9 1198746 300 232.7 13.4 1198831 300 204.0 5.8 1198872 300 220.7 5.5 1198873 300 229.1 7.6 1198874 300 222.0 12.5 1200857 300 226.4 13.1
Example 24
Dose-Dependent Inhibition of Human Yap1 in A-431 Cells by Modified Oligonucleotides
[0630] Modified oligonucleotides described in the studies above were tested at various doses in A-431 cells. Cultured A-431 cells at a density of 11,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS36584. Yap1 mRNA levels were normalized to GAPDH content, as measured by primer probe set RTS104 (forward sequence GAAGGTGAAGGTCGGAGTC, designated herein as SEQ ID NO.: 17; reverse sequence GAAGATGGTGATGGGATTTC, designated herein as SEQ ID NO.: 18; probe sequence CAAGCTTCCCGTTCTCAGCC, designated herein as SEQ ID NO.: 19). Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC). IC50s were calculated using a linear regression on a log/linear plot of the data in excel.
TABLE-US-00118 TABLE 118 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 cells % UTC IC50 ION No. 0.002 μM 0.008 μM 0.04 μM 0.2 μM 1 μM (μM) 958499 1 3 28 91 117 0.03 1076453 0 1 23 74 89 0.01 1197270 0 2 26 80 99 0.02 1198439 0 1 11 65 93 0.02 1198440 0 1 14 69 96 0.02 1198605 0 2 26 57 96 0.02 1198623 2 5 28 72 96 0.01 1198728 1 4 27 85 87 0.02 1198831 2 6 28 72 83 0.01 1198872 1 3 19 70 94 0.01
Example 25
Activity of Modified Oligonucleotides Targeting Human Yap1 in SCC25 Cells
[0631] Modified oligonucleotides described in the studies above were tested at various doses in squamous cell carcinoma cell SCC25. A control oligonucleotide 792169 (a 3-10-3 cET gapmer with a full phosphorothioate backbone, CGCCGATAAGGTACAC, designated herein as SEQ ID No.: 2940; is not complementary to any known human gene) was also tested.
RNA Analysis
[0632] Cultured SCC25 cells at a density of 5,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002 (forward sequence CGGACTATGACTTAGTTGCGTTACA, designated herein as SEQ ID NO.: 20; reverse sequence GCCATGCCAATCTCATCTTGT, designated herein as SEQ ID NO.: 21; probe sequence CCTTTCTTGACAAAACCTAACTTGCGCAGA, designated herein as SEQ ID NO.: 22). Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).
TABLE-US-00119 TABLE 119 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in SCC25 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 96 89 93 98 958499 47 22 10 4 1076453 59 21 7 3 1197270 48 24 12 7 1198439 35 12 5 3 1198440 39 14 5 3 1198605 48 23 10 5 1198623 61 31 15 10 1198728 71 31 15 7 1198831 63 36 16 14 1198872 54 22 9 7
Cell Proliferation Assay
[0633] Cultured SCC25 cells at a density of 1,000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).
TABLE-US-00120 TABLE 120 Antiproliferative effect of modified oligonucleotides in SCC25 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 103 104 100 88 958499 76 42 25 14 1076453 81 40 23 15 1197270 75 40 22 14 1198439 62 30 22 16 1198440 73 33 22 16 1198605 77 39 23 13 1198623 84 55 36 29 1198728 88 61 30 20 1198831 88 54 25 21 1198872 82 37 22 18
Example 26
Dose Dependent Inhibition of Human Yap1 by Modified Oligonucleotides in a Human Hepatocellular Carcinoma SNU449 Xenograft Tumor Model
[0634] A SNU449 hepatocellular carcinoma xenograft tumor model was used to evaluate activity of modified oligonucleotides targeted to human Yap1. Ten million SNU449 cells in 30% matrigel were implanted subcutaneously into the flanks of female NOD Cg-Prkdcscid ll2rgtm1Wjl/SzJ (NSG) mice (from Jackson Laboratory) at 4-6 weeks of age. When tumors reached an average volume of 100 mm.sup.3, approximately two weeks post-implantation, groups of four mice each were administered at 50 mg/kg twice weekly with modified oligonucleotides for five days. Tumors were collected and tested for Yap1 mRNA knockdown by RT-qPCR. Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to PBS treated animals (% control).
TABLE-US-00121 TABLE 121 Inhibition of human Yap1 mRNA expression by modified oligonucleotides in SNU449 xenografts ION No. % control PBS 100 958499 54 1074755 70 1076453 56 1197269 57 1197270 54 1198439 51 1198440 51 1198501 54 1198605 55 1198615 62 1198623 60 1198641 68 1198673 52 1198728 64 1198831 67 1198872 52 715487 61
Example 27
Dose Dependent Inhibition of Human Yap1 by Modified Oligonucleotides in a Human Epidermoid Carcinoma A-431 Xenograft Tumor Model
[0635] An epidermoid carcinoma A-431 xenograft tumor model was used to evaluate activity of modified oligonucleotides targeted to human Yap1. Five million A-431 cells in 30% matrigel were implanted subcutaneously into the flanks of female NCr-Foxn1nu mice (from Taconic) at 4-6 weeks of age. When tumors reached an average volume of 40 mm.sup.3, approximately two weeks post-implantation, groups of four mice each were administered at either 25 mg/kg or 50 mg/kg daily with modified oligonucleotides for four days (5 doses). Tumors were collected 6-8 hours post final dose and tested for Yap1 mRNA knockdown by RT-qPCR. Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to PBS treated animals (% control).
TABLE-US-00122 TABLE 122 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in A-431 xenografts % control ION No. 25 mpk 50 mpk PBS 100 100 958499 49 29 1076453 55 25 1197270 57 38 1198439 37 19 1198440 32 21 1198605 32 30 1198623 43 36 1198728 47 39 1198831 47 37 1198872 34 26 715487 61 57
Example 28
Dose Dependent Inhibition of Human Yap1 by Modified Oligonucleotides in a Human Squamous Cell Carcinoma CAL27 Xenograft Tumor Model
[0636] A squamous cell carcinoma CAL27 xenograft tumor model was used to evaluate activity of modified oligonucleotides targeted to human Yap1. Five million CAL27 cells in 30% matrigel were implanted subcutaneously into the flanks of female CrTac:NCr-Foxn1nu mice (from Taconic) at 4-6 weeks of age. Groups of four mice each were administered with either 15 mg/kg or 30 mg/kg of modified oligonucleotides daily for five days after tumor size had reached ˜100 mm.sup.3 (about 3 weeks post implantation). Tumors were collected and tested for Yap1 mRNA knockdown by RT-qPCR. Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to PBS treated untreated control cells (% UTC).
TABLE-US-00123 TABLE 123 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in CAL27 xenografts % UTC ION No. 15 mg/kg 30 mg/kg PBS 100 100 958499 68 53 1076453 69 46 1197270 55 38 1198439 66 38 1198440 67 41 1198605 65 48 1198623 52 44 1198728 77 56 1198831 70 48 1198872 55 38
Example 29
Activity of Modified Oligonucleotides Targeting Human Yap1 in a Human Squamous Cell Carcinoma CAL33 Xenograft Tumor Model
[0637] A xenograft tumor model was used to evaluate activity of modified oligonucleotides targeted to human Yap1. One million CAL33 cells in 30% matrigel were implanted subcutaneously into the flanks of female CrTac:NCr-Foxnlnu (Taconic) mice. When tumors reached an average volume of 100 mm.sup.3, approximately two weeks post-implantation, groups of eight mice were administered at 50 mg/kg twice weekly with modified oligonucleotides for two weeks. ION 792169 was administered as a control.
[0638] Tumor samples were collected for measurement of Yap1 mRNA levels by RT-qPCR. Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to PBS treated animals (% control).
[0639] Tumor volume was measured at the indicated days in the table below. Tumor weight was determined at end of study. Mice were sacrificed when tumors from PBS-treated mice reached 2,000 mm3.
TABLE-US-00124 TABLE 124 Yap1 mRNA levels in tumors ION No. % control PBS 102 792169 74 1198728 40 1198440 12
TABLE-US-00125 TABLE 125 Tumor volume (mm.sup.3) Days post-implantation 10 13 17 21 24 27 31 34 38 40 44 ION Number Average Tumor Volume(mm.sup.3) PBS 144 254 382 666 855 974 1180 1342 1458 1472 1377 792169 123 262 367 531 774 805 962 1057 1171 1160 1069 1198728 113 253 423 621 835 988 1123 1233 1239 1277 1277 1198440 115 279 376 574 651 818 888 857 770 746 834
TABLE-US-00126 TABLE 126 Tumor weight (g) Average Tumor ION No. weight (g) PBS 1.02 792169 0.85 1198728 0.88 1198440 0.36
Example 30
Activity of Modified Oligonucleotides Targeting Human Yap1 in a Human Hepatocellular Carcinoma SNU449 Xenograft Tumor Model
[0640] Modified oligonucleotides described in the studies above were tested in a hepatocellular carcinoma SNU449 xenograft tumor model. A control oligonucleotide 792169 was also tested.
[0641] Five million SNU449 cells in 30% matrigel were implanted subcutaneously into the fatpads of female NOD.Cg-Prkdcscid II2rgtmlWjl/SzJ mice (from Jackson Laboratory) at 4-6 weeks of age. 43 days post implantation (when tumors had reached approximately 100 mm.sup.3 in size), groups of eight mice each were administered with 50 mg/kg modified oligonucleotide daily for 10 days (loading dose), following which they were administered with 50 mg/kg modified oligonucleotide four times a week for one week, following which they were dosed with 50 mg/kg modified oligonucleotide thrice weekly until the end of the study. Animals were sacrificed and tumors were collected on day 119 post implantation. Yap1 mRNA knockdown in tumors was measured by RT-qPCR as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to PBS treated animals (% control).
[0642] Tumor volumes were also measured at the indicated days in the table below
TABLE-US-00127 TABLE 127 Yap1 mRNA levels in tumors Ion No. % control PBS 100 792169 90 1198440 34
TABLE-US-00128 TABLE 128 Tumor volume (mm.sup.3) Days Post Average Tumor Volume Tumor (mm.sup.3) Implantation PBS 792169 1198440 43 111 111 111 46 175 162 152 50 208 180 168 53 252 247 201 57 292 280 242 60 362 317 263 64 396 397 338 67 438 466 376 71 463 519 373 75 570 559 401 78 597 634 429 81 657 681 514 85 760 785 606 88 786 889 613 92 955 1170 690 94 1048 1215 773 98 1114 1355 804 101 1175 1417 818 105 1252 1509 894 108 1284 1571 921 119 1431 1697* 978 *Average of 7 samples
Example 31
Activity of Modified Oligonucleotides Targeting Human Yap1 in NCI H747 Cells
[0643] Modified oligonucleotides described in the studies above were tested at various doses in colorectal adenocarcinoma cell line NCI H747. A control oligonucleotide 792169 was also tested.
RNA Analysis
[0644] Cultured NCI H747 cells at a density of 10,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (%UTC).
TABLE-US-00129 TABLE 129 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in NCI H747 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 94 83 87 100 715487 83 70 49 30 1198440 73 53 21 9
Cell Proliferation Assay
[0645] Cultured NCI H747 cells at a density of 3000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After 7 days, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (%UTC).
TABLE-US-00130 TABLE 130 Antiproliferative effect of modified oligonucleotides in NCI H747 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 89 97 91 80 715487 91 86 65 42 1198440 87 66 36 18
Example 32
Activity of Modified Oligonucleotides Targeting Human Yap1 in NCI H292 Cells
[0646] Modified oligonucleotides described in the studies above were tested at various doses in mucoepidermoid pulmonary carcinoma cell line NCI 1-1292. A control oligonucleotide 792169 was also tested.
RNA Analysis
[0647] Cultured NCI H292 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).
TABLE-US-00131 TABLE 131 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in NCI H292 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 98 112 111 106 715487 104 83 40 12 1198440 89 53 18 5
Cell Proliferation Assay
[0648] Cultured NCI H292 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (%UTC).
TABLE-US-00132 TABLE 132 Antiproliferative effect of modified oligonucleotides in NCI H292 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 98 97 99 92 715487 87 90 69 20 1198440 100 83 30 15
Example 33
Activity of Modified Oligonucleotides Targeting Human Yap1 in BICR56 Cells
[0649] Modified oligonucleotides described in the studies above were tested at various doses in squamous cell carcinoma adherent keratinocyte cell line BICR56. A control oligonucleotide 792169 was also tested.
RNA Analysis
[0650] Cultured BICR56 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).
TABLE-US-00133 TABLE 133 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in BICR56 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 99 92 85 97 715487 68 28 16 11 1198440 40 10 7 7
Cell Proliferation Assay
[0651] Cultured BICR56 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).
TABLE-US-00134 TABLE 134 Antiproliferative effect of modified oligonucleotides in BICR56 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 106 100 92 87 715487 70 26 9 4 1198440 28 10 6 4
Example 34
Effect of Modified Oligonucleotides Targeting Human Yap1 in Cynomolgus Monkeys
[0652] Cynomolgus monkeys were treated with Ionis modified oligonucleotides selected from studies described in the Examples above. Modified oligonucleotide tolerability was evaluated.
Treatment
[0653] Prior to the study, the monkeys were kept in quarantine during which the animals were observed daily for general health. The monkeys were 2-4 years old and weighed 2-4 kg. Eleven groups of 4 randomly assigned male cynomolgus monkeys each were injected subcutaneously with Ionis oligonucleotide or saline in a clock-wise rotation between four different sites on the back. Following loading doses on days 1, 3, 5 and 7, the monkeys were dosed once per week (on days 14, 21, 28, 35, and 42) with 35 mg/kg of Ionis oligonucleotide. A control group of 4 cynomolgus monkeys was injected with 0.9% saline in a similar manner and served as the control group.
[0654] During the study period, the monkeys were observed twice daily for signs of illness or distress. Any animal experiencing more than momentary or slight pain or distress due to the treatment, injury or illness was treated by the veterinary staff with approved analgesics or agents to relieve the pain after consultation with the Study Director. Any animal in poor health or in a possible moribund condition was identified for further monitoring and possible euthanasia. Scheduled euthanasia of the animals was conducted on day 86 approximately 48 hours after the last dose by exsanguination while under deep anesthesia. The protocols described in the Example were approved by the Institutional Animal Care and Use Committee (IACUC).
Body and Organ Weight Measurements
[0655] To evaluate the effect of lonis oligonucleotides on the overall health of the animals, body and organ weights were measured. Terminal body weight was measured prior to necropsy. Organ weights were measured as well, and all weight measurements are presented in the Table below. The results indicate that effect of treatment with modified oligonucleotides on body and organ weights was within the expected range for modified oligonucleotides. Specifically, treatment with ION 1198440 was well tolerated in terms of the body and organ weights of the monkeys.
TABLE-US-00135 TABLE 135 Body and Organ weights (g) Terminal Body Liver with ION No. Weight Heart kidney spleen gallbladder Saline 2855 11 14 3 60 958499 2894 10 15 4 68 1076453 2955 11 16 5 72 1197270 2852 10 17 4 73 1198439 2959 10 15 3 67 1198440 2919 11 15 3 65 1198605 2968 11 15 4 67 1198623 2790 9 13 3 62 1198728 2722 10 15 5 65 1198831 2788 11 14 4 65 1198872 3126 12 15 4 63
Kidney and Liver Function
[0656] To evaluate the effect of Ionis oligonucleotides on hepatic and kidney function, blood samples were collected from all the study groups on day 44. The monkeys were fasted overnight prior to blood collection. Blood was collected in tubes without anticoagulant for serum separation. The tubes were kept at room temperature for a minimum of 90 minutes and then centrifuged at 3000 rpm for 10 minutes to obtain serum. Levels of various liver function markers were measured using a Toshiba 200FR NEO chemistry analyzer (Toshiba Co., Japan). Plasma levels of glucose (GLU), blood urea nitrogen (BUN), creatinine (CREA), total protein (TP), albumin (ALB), globulin (GLO), albumin/globulin (A/G) ratio calculated, alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), gamma-glutamyltransferase (GGT), alkaline phosphatase (ALP), triglyceride (TG), high density lipoprotein (HDL), and low density lipoprotein (LDL) were measured and the results are presented in the table below. The results indicate that modified oligonucleotides had no effect on liver function outside the expected range for modified oligonucleotides. Specifically, treatment with ION 1198440 was well tolerated in terms of the liver function in monkeys.
TABLE-US-00136 TABLE 136 Liver/Kidney function markers in cynomolgus monkey plasma ALT AST TBIL GGT ALP TG HDL LDL ION NO. (IU/L) (IU/L) (mg/dL) (IU/L) (IU/L) (mg/dL) (mg/dL) (mg/dL) Saline 60 50 0.3 91 1539 34 96 68 958499 67 73 0.2 67 1449 41 89 46 1076453 53 76 0.2 78 1173 29 98 66 1197270 84 78 0.2 75 1215 31 102 48 1198439 40 65 0.2 63 1298 28 82 59 1198440 45 75 0.2 80 1412 30 104 54 1198605 40 58 0.2 85 1445 25 115 57 1198623 50 47 0.2 59 916 34 87 50 1198728 58 92 0.3 59 1165 24 95 57 1198831 48 63 0.3 65 1096 22 108 63 1198872 48 94 0.3 79 1098 19 114 60
TABLE-US-00137 TABLE 137 Liver/Kidney function markers in cynomolgus monkey plasma GLU BUN CREA TP ALB GLO A/G ION NO. (mg/dL) (mg/dL) (mg/dL) (g/dL) (g/dL) (g/dL) ratio Saline 84 25 1.0 7.2 4.2 3.0 1.4 958499 83 24 0.9 7.2 4.0 3.2 1.3 1076453 89 27 0.9 7.0 3.9 3.1 1.3 1197270 115 27 0.9 6.8 3.7 3.1 1.2 1198439 115 24 0.9 6.8 4.0 2.8 1.4 1198440 91 26 0.9 7.0 4.1 2.9 1.4 1198605 69 22 0.8 6.7 4.0 2.7 1.5 1198623 70 26 0.8 7.2 4.2 3.0 1.4 1198728 95 26 0.9 7.3 4.1 3.2 1.3 1198831 73 26 0.7 6.7 3.9 2.8 1.4 1198872 80 27 0.9 7.1 4.0 3.1 1.3
Pro-Inflammatory Proteins Analysis
[0657] To evaluate any inflammatory effect of Ionis oligonucleotides in cynomolgus monkeys, blood samples were taken for analysis. The monkeys were fasted overnight prior to blood collection. On day 42 (pre-dose and 24 hours post-dose), approximately 0.8 mL of blood was collected from each animal and put into tubes without anticoagulant for serum separation. The tubes were kept at room temperature for a minimum of 90 min and then centrifuged at 3,000 rpm for 10 min at room temperature to obtain serum. Complement C3 were measured using a Toshiba 120 FR NEO chemistry analyzer (Toshiba Co., Japan). The results indicate that treatment with ION 1198440 did not cause any inflammation in monkeys. Another marker of inflammation, C-Reactive Protein (CRP) was tested together with the clinical chemistry parameters tested for liver function above.
TABLE-US-00138 TABLE 138 Pro-inflammatory protein analysis in cynomolgus monkeys Complement C3 (mg/dL) Day 42 day 42 CRP (mg/L) ION No. (pre-dose) (24 hr post-dose) day 44 Saline 117 106 4.1 958499 112 89 9.9 1076453 101 88 1.5 1197270 103 86 9.8 1198439 99 94 2.9 1198440 95 88 4.8 1198605 105 95 4.2 1198623 105 101 2.0 1198728 93 90 4.0 1198831 81 81 1.1 1198872 103 96 1.1
Hematology
[0658] To evaluate any effect of Ionis oligonucleotides in cynomolgus monkeys on hematologic parameters, blood samples of approximately 0.5 mL of blood was collected from each of the available study animals on day 44. The samples were collected in tubes containing K.sub.2-EDTA. Samples were analyzed for red blood cell (RBC) count, Hemoglobin (HGB), Hematocrit (HCT), Mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), RBC Distribution Width (RCDW), reticulocyte count (Retic), platelet count (PLT), mean platelet volume (MPV), white blood cells (WBC) count, individual white blood cell counts, such as that of monocytes (MON), neutrophils (NEU), lymphocytes (LYM), eosinophils (EOS), basophils (BAS), and large unstained cells (LUC) using an ADVIA2120i hematology analyzer (Siemens, USA).
[0659] The data indicate the oligonucleotides did not cause any changes in hematologic parameters outside the expected range for modified oligonucleotides at this dose. Specifically, treatment with ION 1198440 was well tolerated in terms of the hematologic parameters of the monkeys.
TABLE-US-00139 TABLE 139 Blood cell counts in cynomolgus monkeys RBC HGB HCT MCV MCH MCHC RCDW Retic PLT ION NO. (×10{circumflex over ( )}6/μL) (g/dL) (%) (fL) (pg) (g/dL) (%) (%) (10.sup.3/μL) Saline 5.8 13 46 79 23 29 13 1.2 334 958499 5.6 12 43 77 22 29 12 1.5 399 1076453 5.5 13 43 79 23 29 15 1.2 358 1197270 5.6 12 44 79 22 28 12 1.1 452 1198439 6.0 14 48 79 22 28 12 1.2 367 1198440 5.9 14 47 80 23 29 12 1.2 420 1198605 6.1 13 46 75 22 29 13 1.1 385 1198623 5.9 14 46 78 23 30 13 1.0 376 1198728 5.9 14 47 80 23 29 12 1.3 428 1198831 5.6 13 43 76 23 30 12 1.0 377 1198872 5.7 13 44 78 23 30 12 1.2 400
TABLE-US-00140 TABLE 140 Blood cell counts in cynomolgus monkeys WBC NEU LYM MON EOS BAS LUC MPV ION NO. (×10.sup.3/μL) (%) (%) (%) (%) (%) (%) (fL) ine 9.2 41 55 3.2 1.0 0.3 0.5 8.2 958499 12.0 49 44 3.5 1.1 0.4 1.2 7.6 1076453 10.0 39 54 3.9 1.1 0.4 1.2 8.4 1197270 10.6 38 54 3.5 2.7 0.4 1.2 7.1 1198439 10.3 27 68 2.9 1.5 0.3 0.6 7.6 1198440 10.9 28 65 3.2 2.8 0.4 0.7 7.5 1198605 10.5 44 51 2.8 0.8 0.4 0.5 8.1 1198623 11.7 43 53 2.0 0.8 0.4 0.7 7.8 1198728 10.7 29 64 2.9 2.2 0.5 0.9 8.0 1198831 7.6 44 50 3.3 2.0 0.3 0.8 7.3 1198872 10.4 64 32 2.2 0.6 0.3 0.5 7.1
Coagulation
[0660] To evaluate effect of lonis modified oligonucleotides on coagulation in cynomolgus monkeys, blood samples of approximately 0.9 mL were collected from each of the available study animals on day 44. The samples were collected in tubes containing 3.2% sodium citrate. Coagulation parameters tested include Activated partial thromboplastin time (APTT), prothrombin time (PT) and Figrinogen (FIB).
[0661] The data indicate the modified oligonucleotides did not cause any changes in coagulation parameters outside the expected range for modified oligonucleotides at this dose. Specifically, treatment with ION 1198440 was well tolerated in terms of the coagulation parameters of the monkeys.
TABLE-US-00141 TABLE 141 Coagulation Parameters in cynomolgus monkeys PT FIB APTT ION No. (sec) (mg/dL) (sec) Saline 9 229 18 958499 9 275 18 1076453 9 234 20 1197270 10 257 17 1198439 10 246 19 1198440 10 260 20 1198605 9 236 23 1198623 10 229 17 1198728 9 242 18 1198831 10 209 18 1198872 10 206 21
Urine Analysis
[0662] Food was removed overnight the day before fresh urine collection, but water was supplied. Fresh urine samples for urinalysis and urine chemistry were collected from all animals using a clean cage pan on wet ice (first in the morning) on day 44. Urinalysis/Urine Chemistry parameters creatinine (UCRE), microprotein (UTP), urine microalbumin (UALB), and protein/creatinine (P/C) ratio were measured using a Toshiba 120FR automated chemistry analyzer (Toshiba Co., Japan). Specifically, treatment with ION 1198440 was well tolerated in terms urine chemistry markers.
TABLE-US-00142 TABLE 142 Urinalysis and Urine Chemistry Markers UTP UALB UCRE P/C ION NO. (mg/dL) (mg/dL) (mg/dL) ratio Saline 13 0.5 69 0.3 958499 16 0.1 60 0.3 1076453 14 0.1 50 0.3 1197270 18 1.3 56 0.3 1198439 15 0.1 68 0.2 1198440 13 0.2 53 0.3 1198605 12 0.4 69 0.2 1198623 10 0.2 44 0.2 1198728 16 0.3 70 0.2 1198831 13 0.1 46 0.3 1198872 14 0.3 111 0.2
Example 35
Activity of Modified Oligonucleotides Targeting Human Yap1 in BICR-22 Cells
[0663] Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous carcinoma (lymph node metastasis) cell line BICR-22. A control oligonucleotide 792169, described herein above, was also tested.
RNA Analysis
[0664] Cultured BICR-22 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).
TABLE-US-00143 TABLE 144 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in BICR-22 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 99 98 98 98 715487 82 45 23 13 1198440 44 14 4 4
Cell Proliferation Assay
[0665] Cultured BICR-22 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (%UTC).
TABLE-US-00144 TABLE 145 Antiproliferative effect of modified oligonucleotides in BICR-22 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 97 95 82 65 715487 70 56 28 22 1198440 55 37 29 19
Example 36
Activity of Modified Oligonucleotides Targeting Human Yap1 in CAL33 Cells
[0666] Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous cell carcinoma line CAL33. A control oligonucleotide 792169, described herein above, was also tested.
RNA Analysis
[0667] Cultured CAL33 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).
TABLE-US-00145 TABLE 146 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in CAL33 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 106 106 91 85 715487 81 41 12 6 1198440 43 14 5 5
Cell Proliferation Assay
[0668] Cultured CAL33 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (%UTC).
TABLE-US-00146 TABLE 147 Antiproliferative effect of modified oligonucleotides in CAL33 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 92 93 81 67 715487 89 79 61 37 1198440 84 67 58 44
Example 37
Activity of Modified Oligonucleotides Targeting Human Yap1 in CAL27 Cells
[0669] Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous cell carcinoma line CAL27. A control oligonucleotide 792169, described herein above, was also tested.
RNA Analysis
[0670] Cultured CAL27 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).
TABLE-US-00147 TABLE 148 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in CAL27 cells % UTC ION No. 0.08 μM 0.4 μM 2 μM 10 μM 792169 95 90 97 88 715487 35 23 5 3 1198440 23 6 4 4
Cell Proliferation Assay
[0671] Cultured CAL27 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (%UTC).
TABLE-US-00148 TABLE 149 Antiproliferative effect of modified oligonucleotides in CAL27 cells % UTC ION No. 0.08 μM 0.4 μM 2 μM 10 μM 792169 96 102 103 90 715487 95 85 67 33 1198440 86 85 83 51
Example 38
Activity of Modified Oligonucleotides Targeting Human Yap1 in Detroit-562 Cells
[0672] Modified oligonucleotides described in the studies above were tested at various doses in pharynx carcinoma cell line Detroit-562. A control oligonucleotide 792169, described herein above, was also tested.
RNA Analysis
[0673] Cultured Detroit-562 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).
TABLE-US-00149 TABLE 150 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in Detroit-562 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 102 102 94 99 715487 77 29 10 5 1198440 32 8 3 2
Cell Proliferation Assay
[0674] Cultured Detroit-562 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).
TABLE-US-00150 TABLE 151 Antiproliferative effect of modified oligonucleotides in Detroit-562 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 99 106 100 79 715487 92 84 71 52 1198440 84 67 59 45
Example 39
Activity of Modified Oligonucleotides Targeting Human Yap1 in SCC-4 Cells
[0675] Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous cell carcinoma cell line SCC 4. A control oligonucleotide 792169, described herein above, was also tested.
RNA Analysis
[0676] Cultured SCC-4 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).
TABLE-US-00151 TABLE 152 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in SCC-4 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 92 106 105 104 715487 81 46 23 13 1198440 63 27 11 5
Cell Proliferation Assay
[0677] Cultured SCC-4 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).
TABLE-US-00152 TABLE 153 Antiproliferative effect of modified oligonucleotides in SCC-4 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 125 169 142 136 715487 158 121 106 69 1198440 82 60 21 11
Example 40
Activity of Modified Oligonucleotides Targeting Human Yap1 in SCC-9 Cells
[0678] Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous cell carcinoma cell line SCC-9. A control oligonucleotide 792169, described herein above, was also tested.
RNA Analysis
[0679] Cultured SCC-9 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).
TABLE-US-00153 TABLE 154 Dose-dependent inhibition of human Yap 1 mRNA expression by modified oligonucleotides in SCC-9 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 86 94 96 101 715487 74 44 21 11 1198440 53 18 6 2
Cell Proliferation Assay
[0680] Cultured SCC-9 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).
TABLE-US-00154 TABLE 155 Antiproliferative effect of modified oligonucleotides in SCC-9 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 104 111 102 94 715487 97 73 51 34 1198440 88 46 35 31
Example 41
Activity of Modified Oligonucleotides Targeting Human Yap1 in SCC-15 Cells
[0681] Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous cell carcinoma cell line SCC-15. A control oligonucleotide 792169, described herein above, was also tested.
RNA Analysis
[0682] Cultured SCC-15 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).
TABLE-US-00155 TABLE 156 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in SCC-15 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 91 100 102 105 715487 69 33 12 5 1198440 39 10 4 2
Cell Proliferation Assay
[0683] Cultured SCC-15 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).
TABLE-US-00156 TABLE 157 Antiproliferative effect of modified oligonucleotides in SCC-15 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 93 92 89 71 715487 87 66 47 28 1198440 72 54 42 32
Example 42
Activity of Modified Oligonucleotides Targeting Human Yap1 in SCC-25 Cells
[0684] Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous cell carcinoma cell line SCC-25. A control oligonucleotide 792169, described herein above, was also tested.
RNA Analysis
[0685] Cultured SCC-25 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).
TABLE-US-00157 TABLE 158 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in SCC-25 cells % UTC ION No. 0.08 μM 0.4 μM 2 μM 10 μM 792169 87 87 89 86 715487 70 32 16 11 1198440 32 12 8 7
Cell Proliferation Assay
[0686] Cultured SCC-25 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).
TABLE-US-00158 TABLE 159 Antiproliferative effect of modified oligonucleotides in SCC-25 cells % UTC ION No. 0.08 μM 0.4 μM 2 μM 10 μM 792169 97 101 96 92 715487 82 48 25 15 1198440 56 27 20 16
Example 43
Activity of Modified Oligonucleotides Targeting Human Yap1 in SNU-899 Cells
[0687] Modified oligonucleotides described in the studies above were tested at various doses in laryngeal squamous cell carcinoma cell line SNU-899. A control oligonucleotide 792169, described herein above, was also tested.
RNA Analysis
[0688] Cultured SNU-899 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).
TABLE-US-00159 TABLE 160 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in SNU-899 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 106 106 111 102 715487 62 26 9 4 1198440 35 12 3 2
Cell Proliferation Assay
[0689] Cultured SNU-899 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).
TABLE-US-00160 TABLE 161 Antiproliferative effect of modified oligonucleotides in SNU-899 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 90 94 96 86 715487 82 78 71 62 1198440 82 75 69 66
Example 44
Activity of Modified Oligonucleotides Targeting Human Yap1 in SNU-1066 Cells
[0690] Modified oligonucleotides described in the studies above were tested at various doses in laryngeal squamous cell carcinoma line SNU-1066. A control oligonucleotide 792169, described herein above, was also tested.
RNA Analysis
[0691] Cultured SNU-1066 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).
TABLE-US-00161 TABLE 162 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in SNU-1066 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 91 94 93 98 715487 77 49 22 7 1198440 70 28 7 2
Cell Proliferation Assay
[0692] Cultured SNU-1066 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).
TABLE-US-00162 TABLE 163 Antiproliferative effect of modified oligonucleotides in SNU-1066 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 100 104 102 96 715487 97 86 72 47 1198440 89 66 58 43
Example 45
Activity of Modified Oligonucleotides Targeting Human Yap1 in SNU-1076 Cells
[0693] Modified oligonucleotides described in the studies above were tested at various doses in upper aerodigestive tract/laryngeal squamous cell carcinoma line SNU-1076. A control oligonucleotide 792169, described herein above, was also tested.
RNA Analysis
[0694] Cultured SNU-1076 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).
TABLE-US-00163 TABLE 164 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in SNU-1076 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 89 98 102 107 715487 89 67 31 11 1198440 83 43 11 3
Cell Proliferation Assay
[0695] Cultured SNU-1076 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).
TABLE-US-00164 TABLE 165 Antiproliferative effect of modified oligonucleotides in SNU-1076 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 97 104 106 108 715487 91 90 86 79 1198440 99 87 81 81
Example 46
Activity of Modified Oligonucleotides Targeting Human Yap1 in SNU-1214 Cells
[0696] Modified oligonucleotides described in the studies above were tested at various doses in laryngeal squamous cell carcinoma cell line SNU-12 4. A control oligonucleotide 792169, described herein above, was also tested.
RNA Analysis
[0697] Cultured SNU-1214 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (%UTC).
TABLE-US-00165 TABLE 166 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in SNU-1214 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 97 104 106 109 715487 71 36 16 9 1198440 40 11 4 3
Cell Proliferation Assay
[0698] Cultured SNU-1214 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).
TABLE-US-00166 TABLE 167 Antiproliferative effect of modified oligonucleotides in SNU-1214 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 105 90 96 72 715487 93 69 52 38 1198440 84 72 53 49
Example 47
Activity of Modified Oligonucleotides Targeting Human Yap1 in UPCI:SCC090 Cells
[0699] Modified oligonucleotides described in the studies above were tested at various doses in tongue squamous cell carcinoma cell line UPCI:SCC090. A control oligonucleotide 792169, described herein above, was also tested.
RNA Analysis
[0700] Cultured UPCI:SCC090 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to untreated control cells (% UTC).
TABLE-US-00167 TABLE 168 Dose-dependent inhibition of human Yap1 mRNA expression by modified oligonucleotides in UPCI:SCC090 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 100 108 112 84 715487 70 37 26 14 1198440 60 26 10 5
Cell Proliferation Assay
[0701] Cultured UPCI:SCC090 cells at a density of 1000 cells/well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 144 hours, cell proliferation was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).
TABLE-US-00168 TABLE 169 Antiproliferative effect of modified oligonucleotides in UPCI:SCC090 cells % UTC ION No. 0.04 μM 0.2 μM 1 μM 5 μM 792169 100 104 99 93 715487 92 94 72 68 1198440 101 92 75 70
Example 30
Activity of Modified Oligonucleotides Targeting Human Yap1 in a Human Hepatocellular Carcinoma SNU449 Xenograft Tumor Model (Alone and in Combination with Sorafenib)
[0702] Modified oligonucleotides described in the studies above were tested in a hepatocellular carcinoma SNU449 xenograft tumor model. In addition to testing the modified oligonucleotide by itself, combination therapy with sorafenib was also tested. A control oligonucleotide 792169, described herein above, was also tested.
[0703] Five million SNU449 cells in 30% matrigel were implanted subcutaneously into the fatpads of female NOD.Cg-Prkdcscid II2rgtmlWjl/SzJ mice (from Jackson Laboratory) at 4-6 weeks of age. 43 days post implantation (when tumors had reached approximately 100 mm.sup.3 in size), groups of eight mice each were administered with 50 mg/kg modified oligonucleotide daily for 10 days (loading dose), following which they were administered with 50 mg/kg modified oligonucleotide four times a week for one week, following which they were dosed with 50 mg/kg modified oligonucleotide thrice weekly until the end of the study. Another group of 8 animals was treated with 30 mg/kg of sorafenib orally 7 times a week until end of study. A final group of 8 animals were treated with a combination of 30 mg/kg of sorafenib orally 7 times a week for 11 weeks and 50 mg/kg of modified oligonucleotide 1198440 at 50 mg/kg 5 times a week for 3 weeks, 4 times a week for the following week, then 3 times a week for the duration of the study (7 weeks). Animals were sacrificed, and tumors were collected on day 119 post implantation.
Measurement of RNA
[0704] Yap1 mRNA knockdown in tumors was measured by RT-qPCR as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to PBS treated animals (% control).
TABLE-US-00169 TABLE 127 Yap1 mRNA levels in tumors % Ion No. control PBS 100 792169 90 1198440 34 Sorafenib 103 1198440 + 42 Sorafenib
Measurement of Tumor Volume
[0705] Tumor volumes were also measured at the indicated days in the table below. Treatment with ION No. 1198440 led to significant reduction in tumor volume. In addition, combination treatment of ION No. 1198440 with sorafenib led to further reduction in tumor volume.
TABLE-US-00170 TABLE 128 Tumor volume (mm.sup.3) Days Post Average Tumor Volume (mm.sup.3) Tumor 1198440 + Implantation PBS 792169 1198440 sorafenib sorafenib 43 111 111 111 112 111 46 175 162 152 145 162 50 208 180 168 159 162 53 252 247 201 173 210 57 292 280 242 200 224 60 362 317 263 234 258 64 396 397 338 217 210 67 438 466 376 277 250 71 463 519 373 249 241 75 570 559 401 283 279 78 597 634 429 322 296 81 657 681 514 391 400 85 760 785 606 416 380 88 786 889 613 451 413 92 955 1170 690 508 421 94 1048 1215 773 581 495 98 1114 1355 804 625 525 101 1175 1417 818 685 541 105 1252 1509 894 671 495 108 1284 1571 921 663 470 119 1431 1697* 978 747 584 *Average of 7 samples
Measurement of ERK Activation
[0706] Sorafenib is a RAF inhibitor used for treatment of several cancers including hepatocellular carcinoma. However, it leads to ERK activation in HCCs, which impacts therapeutic efficacy (Chen Y., et al., Overcoming sorafenib evasion in hepatocellular carcinoma using CXCR4-targeted nanoparticles to co-deliver MEK-inhibitors, Sci Rep. 2017; 7: 44123).
[0707] The effect of modified oligonucleotide in mitigating the ERK1/2 activation mediated by sorafenib was tested. Protein analysis was carried out using standard procedures. The primary antibody against Erk1/2 was rabbit mAb 4695, Cell Signaling Technology, and against pERK1/2 was rabbit anti-phospho p44/42 antibody 9101, Cell Signaling Technology. ERK protein levels were compared to internal control GAPDH. GAPDH levels were measured using rabbit mAb 5174, Cell Signaling Technology as the primary antibody. The secondary antibody used was donkey anti-rabbit NA934, GE Healthcare. pERK/ERK levels were calculated relative to PBS control to determine % activation of ERK1/2. Combination therapy of ION No. 1198440 with sorafenib led to a significant decrease in ERK1/2 activation mediated by sorafenib treatment alone.
TABLE-US-00171 TABLE 129 Tumor volume (mm.sup.3) % activation Ion No. of ERK1/2 PBS 100 792169 100 1198440 88 Sorafenib 142 1198440 + 68 Sorafenib
EXAMPLE 48
Activity of Modified Oligonucleotides Targeting Human Yap1 in Combination with Sorafenib in SNU449 Cells
[0708] Modified oligonucleotides described in the studies above were tested at various doses in hepatocellular carcinoma cell line SNU449. ION No. 792169, described herein above, was used as a control modified oligonucleotide. ION No. 715487 was used to target Yap1 RNA. Cultured SNU449 cells at a density of 5000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below in combination with sorafenib diluted to concentrations described in the tables below. After approximately 48 hours, Yap1 mRNA levels were measured.
Measurement of RNA
[0709] Yap1 mRNA knockdown in tumors was measured by RT-qPCR as previously described using the Human Yap1 primer-probe set RTS4814. Yap1 mRNA levels were normalized to actin-beta content, as measured by primer probe set RTS5002. Results are presented in the tables below as percent control of the amount of Yap1 mRNA relative to PBS treated cells (% control).
TABLE-US-00172 TABLE 170 Yap1 mRNA levels SORAFENIB YAP1 mRNA (% control) CONCENTRATION 715487 715487 715487 715487 792169 792169 792169 792169 (uM) at 0.04 uM at 0.2 uM at 1 uM at 5 uM at 0.04 uM at 0.2 uM at 1 uM at 5 uM 0 98 54 30 9 115 113 103 103 0.37 97 51 23 8 97 96 99 104 1.11 77 44 22 7 100 97 93 95 3.33 83 45 21 7 99 91 92 97 10 78 46 20 8 102 94 93 97
Cell Proliferation Assay
[0710] SNU449 plated at 1000 cells/well were treated with a combination of modified oligonucleotide and sorafenib at concentrations outlined in the table below. 144 hours post treatment, proliferation of SNU449 cells was measured using the luminescent cell viability CellTiter-Glo® 2.0 Assay (Promega). Results are presented in the tables below as percent control of the amount of luminescence in samples treated with modified oligonucleotides relative to untreated control cells (% UTC).
TABLE-US-00173 TABLE 171 Antiproliferative effect of modified oligonucleotides in SNU449 cells SORAFENIB % UTC CONCENTRATION 715487 715487 715487 715487 792169 792169 792169 792169 (uM) at 0.04 uM at 0.2 uM at 1 uM at 5 uM at 0.04 uM at 0.2 uM at 1 uM at 5 uM 0 98 93 84 64 99 97 97 86 0.37 102 94 83 64 103 100 95 84 1.11 93 77 45 23 97 91 89 68 3.33 27 12 5 3 51 30 27 6 10 2 2 1 1 3 4 3 1
Example 49
Activity of Modified Oligonucleotides Targeting Human Yap1 in Combination with a-PD1 Antibody in DEN-HCC Model
[0711] The DEN model is a chemically induced model of hepatocellular carcinoma (HCC). N-nitrosodiethylamine (DEN) is administered at 25 mg/kg into 15 day old C57/BL6 mice. Carcinomas form 6 months post injection. After formation, carcinomas were then dissected from the liver and passaged subcutaneously into C57BL/6 male mice at 4-6 weeks of age to establish a subcutaneous model. For this experiment, mice were passaged with P8 subcutaneously established DEN carcinomas, rendering P9 for the duration of the experiment. Subcutaneous carcinomas are found to form at 4-6 weeks post implantation. Modified oligonucleotides 792169 (control compound) and 715491 (YAP-1 targeting modified oligonucleotide) were treated subcutaneously into groups of 7-8 mice at 10 mg/kg/week 5 times a week for 11 weeks (total of 55 doses). The PBS-only treated group and the control group were treated 5 times a week for 4 weeks (total of 20 doses). α-PD1 antibody (BioXCell) was treated intraperitoneally at 10 mg/kg/week twice a week for 4 weeks (total of 8 doses). Tumor volume was measured over the time points indicated in the table below. F.D. refers to mice that were sacrificed because their tumor volume became too large. As shown in the table below, mice administered PBS, 792169 (control compound), or α-PD1 antibody were sacrificed before the end of the experiment because their tumor volume became too large.
TABLE-US-00174 TABLE 172 Tumor volume (mm.sup.3) Average Tumor Volume (mm3) Days on 715491 + treatment PBS 792169 715491 α-PD1 α-PD1 1 373 354 356 546 455 5 553 376 417 673 475 8 688 414 463 782 558 11 729 523 461 910 525 15 856 604 523 911 529 18 968 633 526 1127 524 23 1220 773 658 1134 508 25 1337 864 659 1252 513 28 1355 802 661 1412 489 31 F.D. F.D. 740 F.D. 516 35 F.D. F.D. 798 F.D. 519 38 F.D. F.D. 741 F.D. 491 43 F.D. F.D. 723 F.D. 440 45 F.D. F.D. 741 F.D. 457 49 F.D. F.D. 765 F.D. 474 54 F.D. F.D. 780 F.D. 552 58 F.D. F.D. 852 F.D. 544 61 F.D. F.D. 925 F.D. 592 65 F.D. F.D. 896 F.D. 590 68 F.D. F.D. 940 F.D. 604 72 F.D. F.D. 953 F.D. 577 75 F.D. F.D. 985 F.D. 675 79 F.D. F.D. 960 F.D. 590