METHOD FOR PROMOTING DIFFERENTIATION OF PLURIPOTENT STEM CELLS
20210115397 · 2021-04-22
Assignee
Inventors
- Shoen Kume (Tokyo, JP)
- Nobuaki Shiraki (Tokyo, JP)
- Akira Chiba (Tokyo, JP)
- Takayuki ENOMOTO (Tokyo, JP)
Cpc classification
C12N2506/45
CHEMISTRY; METALLURGY
C12N2501/119
CHEMISTRY; METALLURGY
C12N2501/41
CHEMISTRY; METALLURGY
C12N5/0607
CHEMISTRY; METALLURGY
International classification
Abstract
In order to improve the efficiency of inducing differentiation of pluripotent stem cells, provided is a method for promoting differentiation of pluripotent stem cells, the method including a step of culturing pluripotent stem cells in a medium, wherein the medium is a medium containing a) an insulin-like growth factor, b) an insulin analogue preparation containing no zinc, c) an insulin analogue preparation containing a low concentration of zinc, or d) a compound exhibiting an insulin-like action.
Claims
1. A method for promoting differentiation of pluripotent stem cells, comprising: a step of culturing pluripotent stem cells in a medium, wherein the medium is a medium comprising a) an insulin-like growth factor, b) an insulin analogue preparation containing no zinc, c) an insulin analogue preparation containing a low concentration of zinc, or d) a compound exhibiting an insulin-like action.
2. The method for promoting differentiation of pluripotent stem cells according to claim 1, wherein the medium for culturing pluripotent stem cells is a medium comprising no insulin.
3. The method for promoting differentiation of pluripotent stem cells according to claim 1, wherein the medium for culturing pluripotent stem cells is a medium comprising zinc at a concentration of 1 μM or less or a medium comprising no zinc.
4. The method for promoting differentiation of pluripotent stem cells according to claim 1, wherein the medium for culturing pluripotent stem cells is a medium allowing the pluripotent stem cells to differentiate into endoderm cells.
5. The method for promoting differentiation of pluripotent stem cells according to claim 1, comprising: a step of culturing pluripotent stem cells in an undifferentiated maintenance medium, wherein the undifferentiated maintenance medium is a medium comprising no methionine.
6. The method for promoting differentiation of pluripotent stem cells according to claim 1, wherein the medium for culturing pluripotent stem cells is a medium comprising an activin receptor-like kinase-4,7 activator and comprising zinc at a concentration of 1 μM or less or no zinc.
7. The method for promoting differentiation of pluripotent stem cells according to claim 6, wherein the activin receptor-like kinase-4,7 activator is human activin A, and a concentration thereof is 6 to 150 ng/mL.
8. A medium for culturing pluripotent stem cells, comprising: a) an insulin-like growth factor, b) an insulin analogue preparation comprising no zinc, c) an insulin analogue preparation comprising a low concentration of zinc, or d) a compound exhibiting an insulin-like action.
9. The medium according to claim 8, comprising no insulin.
10. The medium according to claim 8, comprising zinc at a concentration of 1 μM or less or no zinc.
11. The medium according to claim 8, wherein the medium is a medium allowing the pluripotent stem cells to differentiate into endoderm cells.
12. The medium according to claim 8, wherein the medium for culturing pluripotent stem cells is a medium comprising an activin receptor-like kinase-4,7 activator and comprises zinc at a concentration of 1 μM or less or no zinc.
13. The medium according to claim 12, wherein the activin receptor-like kinase-4,7 activator is human activin A, and a concentration thereof is 6 to 150 ng/mL.
14. A method for inducing differentiation of pluripotent stem cells into insulin-producing cells, comprising steps (1) to (6) below: (1) a step of culturing pluripotent stem cells in a medium comprising no methionine; (2) a step of culturing the cells obtained in step (1) in the medium according to claim 12; (3) a step of culturing the cells obtained in step (2) in a medium comprising an FGF and a hedgehog signaling inhibitor; (4) a step of culturing the cells obtained in step (3) in a medium comprising a retinoic acid receptor agonist, a hedgehog signaling inhibitor, and a BM′ signaling inhibitor; (5) a step of culturing the cells obtained in step (4) in a medium comprising a TGF-βI type activin receptor-like kinase-4,5,7 inhibitor, a protein kinase C activator, and a BMP signaling inhibitor; and (6) a step of culturing the cells obtained in step (5) in a medium comprising nicotinamide.
15. The method for inducing differentiation into insulin-producing cells according to claim 14, wherein each medium in step (1) to (6) is a xeno-free medium.
16. A method for inducing differentiation of pluripotent stem cells into insulin-producing cells, comprising steps (1) to (9), or (1) to (3) and (5) to (9) below: (1) a step of culturing pluripotent stem cells in a medium comprising no methionine; (2) a step of culturing the cells obtained in step (1) in the medium according to claim 12; (3) a step of culturing the cells obtained in step (2) in a medium comprising an FGF and a hedgehog signaling inhibitor; (4) a step of culturing the cells obtained in step (3) in a medium comprising a KGF; (5) a step of culturing the cells obtained in step (3) or step (4) in a medium comprising a KGF, a hedgehog signaling inhibitor, a protein kinase C activator, and a retinoic acid receptor agonist; (6) a step of culturing the cells obtained in step (5) in a medium comprising a KGF, a hedgehog signaling inhibitor, a retinoic acid receptor agonist, and a BMP signaling inhibitor; (7) a step of culturing the cells obtained in step (6) in a medium comprising a TGF-βI type activin receptor-like kinase-4,5,7 inhibitor, an EGF receptor agonist, a γ-secretase inhibitor, and a retinoic acid receptor agonist; (8) a step of culturing the cells obtained in step (7) in a medium comprising a TGF-βI type activin receptor-like kinase-4,5,7 inhibitor, an EGF receptor agonist, a γ-secretase inhibitor, and a retinoic acid receptor agonist, wherein a concentration of the retinoic acid receptor agonist in the medium is lower than a concentration of the retinoic acid receptor agonist in step (7); and (9) a step of culturing the cells obtained in step (8) in a medium comprising a TGF-βI type activin receptor-like kinase-4,5,7 inhibitor.
17. A method for differentiating pancreatic progenitor cells into pancreatic beta cells, comprising culturing pancreatic progenitor cells in a medium comprising a factor selected from the group consisting of a retinoic acid receptor agonist, a hedgehog signaling inhibitor, a KGF, a γ-secretase inhibitor, a BMP signaling inhibitor, a TGF-βI type activin receptor-like kinase-4,5,7 inhibitor, and an EGF receptor agonist, wherein the pancreatic progenitor cells are PDX1 positive or NKX6.1 positive.
18. A method for inducing differentiation of pluripotent stem cells into insulin-producing cells, comprising steps (1) to (7) below: (1) a step of culturing pluripotent stem cells in a medium comprising no methionine; (2) a step of culturing the cells obtained in step (1) in the medium according to claim 12; (3) a step of culturing the cells obtained in step (2) in a medium comprising a KGF and comprising zinc at a concentration of 1 μM or less or no zinc; (4) a step of culturing the cells obtained in step (3) in a medium comprising a KGF, a hedgehog signaling inhibitor, and a retinoic acid receptor agonist; (5) a step of culturing the cells obtained in step (4) in a medium comprising a KGF, a hedgehog signaling inhibitor, and a retinoic acid receptor agonist, wherein a concentration of the retinoic acid receptor agonist in the medium is lower than a concentration of the retinoic acid receptor agonist in step (4); (6) a step of culturing the cells obtained in step (5) in a medium comprising a TGF-βI type activin receptor-like kinase-4,5,7 inhibitor and a retinoic acid receptor agonist; and (7) a step of culturing the cells obtained in step (6) in a medium comprising a TGF-βI type activin receptor-like kinase-4,5,7 inhibitor and a retinoic acid receptor agonist, wherein a concentration of the retinoic acid receptor agonist in the medium is lower than a concentration of the retinoic acid receptor agonist in step (6).
Description
BRIEF DESCRIPTION OF DRAWINGS
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
DESCRIPTION OF EMBODIMENTS
[0031] Hereinafter, the present invention will be described in detail.
(A) Method for Promoting Differentiation of Pluripotent Stem Cells
[0032] The method for promoting differentiation of pluripotent stem cells of the present invention comprises a step of culturing pluripotent stem cells in a medium, wherein the medium is a medium comprising an insulin-like growth factor (IGF).
[0033] The medium for culturing pluripotent stem cells may be a medium allowing the pluripotent stem cells to differentiate into mesodermal cells or ectodermal cells but preferably is a medium allowing the cells to differentiate into endoderm cells.
[0034] The “pluripotent stem cells” refer to cells that have self-renewal ability and can be cultured in vitro and have pluripotency to be capable of differentiating into cells constituting an individual. Specifically, examples thereof can include embryonic stem cells (ES cells), pluripotent stem cells derived from fetal primordial germ cells (GS cells), induced pluripotent stem cells derived from somatic cells (iPS cells), and somatic stem cells. Among them, iPS cells or ES cells are preferably used in the present invention, and human iPS cells and human ES cells are particularly preferable.
[0035] The ES cells are preferably ES cells derived from mammals. Examples of the mammals can include mouse, rat, guinea pig, hamster, rabbit, cat, dog, sheep, bovine, horse, goat, monkey, or human, preferably mouse or human, further preferably human.
[0036] Generally, the ES cells can be established eventually as a cell line by culturing fertilized eggs in the blastocyst stage together with feeder cells, separating cells derived from inner cell mass proliferated, and further repeating the subculture operation.
[0037] Further, the iPS cells refer to cells that have acquired pluripotency, specifically, cells that have acquired pluripotency equivalent to ES cells by introducing several types of transcription factor (pluripotency factor) genes that impart pluripotency to somatic cells (such as fibroblasts). Many factors have been reported as “pluripotency factors”, and examples thereof can include, but not specifically limited to, Oct family (such as Oct3/4), Sox family (such as Sox2, Sox1, Sox3, Sox15, and Sox17), Klf family (such as Klf4 and Klf2), Myc family (such as c-Myc, N-Myc, and L-Myc), Nanog, and LIN28. There have been many reports on methods for establishing iPS cells, and they can be referred to (such as Takahashi et al., Cell, 2006, 126:663-676; Okita et al., Nature, 2007, 448:313-317: Wernig et al., Nature, 2007, 448:318-324; Maherali et al., Cell Stem Cell, 2007, 1:55-70; Park et al., Nature, 2007, 451:141-146; Nakagawa et al., Nat Biotechnol 2008, 26:101-106; Wernig et al., Cell Stem Cell, 2008, 10:10-12; Yu et al., Science, 2007, 318:1917-1920; Takahashi et al., Cell, 2007, 131:861-872; Stadtfeld et al., Science, 2008, 322:945-949).
[0038] The pluripotent stem cells can be cultured and maintained in a methionine-deprived medium, as described below, but may be cultured and maintained by a method commonly used in this field. The ES cells can be cultured by a conventional method. For example, the cells can be maintained, using mouse fetal fibroblasts (MEF cells) as the feeder cells, in a medium supplemented with a leukemia inhibitory factor, KSR (knockout serum replacement), fetal bovine serum (FBS), a non-essential amino acid, L-glutamine, pyruvic acid, penicillin, streptomycin, or β-mercapto ethanol, such as a DMEM medium. The iPS cells can be cultured also by a conventional method. For example, the cells can be maintained, using MEF cells as the feeder cells, in a medium supplemented with bFGF, KSR (knockout serum replacement), a non-essential amino acid, L-glutamine, penicillin, streptomycin, or β-mercapto ethanol, such as a DMEM/F12 medium.
[0039] The medium for culturing pluripotent stem cells contains IGF. Although IGF1 includes IGF1 and IGF2, IGF1 is preferably used in the present invention. The IGF may be derived from any animal but is preferably derived from the same animal as the pluripotent stem cells. For example, in the case of culturing human pluripotent stem cells, it is preferable to use human IGF. The concentration of IGF in the medium is not particularly limited, as long as it can promote the differentiation of pluripotent stem cells, but is preferably 10 to 200 ng/mL, more preferably 50 to 150 ng/mL, further preferably 80 to 120 ng/mL.
[0040] The medium for culturing pluripotent stem cells may contain an insulin analogue preparation containing no zinc or an insulin analogue preparation containing a low concentration of zinc, instead of IGF. Here, the “insulin analogue” refers to a peptide in which the amino acid sequence of natural insulin is partially modified, and which has a physiological action similar to that of natural insulin. Further, the “insulin analogue preparation” refers to insulin analogue itself or insulin analogue supplemented with another component. The insulin analogue preparation preferably contains no zinc but may contain a low concentration of zinc. Here, the “low concentration” means that the concentration of zinc in the preparation is lower than that in the insulin (natural insulin) preparation. In the insulin preparation, six molecules of insulin form a crystal structure with diatomic zinc. In the case where the ratio of zinc to the insulin analogue is lower than that in this structure (that is, less than 1/3), the concentration can be a “low concentration”. Examples of the insulin analogue preparation containing no zinc can include an insulin glulisine preparation (product name: Apidra). Since the insulin analogue contained in the medium for culturing pluripotent stem cells is considered to exert the same action as insulin, it is considered that the concentration of the insulin analogue in the medium may be the same as the concentration of insulin. The concentration of insulin to be added to the medium for culturing pluripotent stem cells is well known to those skilled in the art, and thus the concentration of the insulin analogue in the medium can be determined accordingly.
[0041] Further, the medium for culturing pluripotent stem cells may contain a compound exhibiting an insulin-like action instead of IGF. Many compounds exhibiting an insulin-like action are known, and such known compounds can be used in the present invention. Examples of the compound exhibiting an insulin-like action can include PTP1B (protein tyrosine phosphatase 1B) inhibitors such as compound M (Compound 2 described in Qureshi S A, et al., J Biol Chem. 2000 Nov. 24; 275 (47): 36590-5), L-783281 (Zhang B, et al., Science. 1999 May 7; 284 (5416): 974-7), TLK-19781 (Cheng M, et al., J Cell Biochem. 2004 Aug. 15; 92 (6): 1234-45 and Lum R T, et al., J Med Chem. 2008 Oct 9; 51 (19): 6173-87), Na.sub.3VO.sub.4 (Green A., Biochem J. 1986 Sep 15; 238 (3): 663-9), and ertiprotafib (International Publication No. WO 1999/061435). Further, the compound described in claim 1 of International Publication No. WO 2017/188082, particularly, compounds 1 to 5 described in Examples can also be used as the compounds exhibiting an insulin-like action.
[0042] Since IGF, the insulin analogue preparation, and the compounds exhibiting an insulin-like action are used instead of insulin, the medium for culturing pluripotent stem cells preferably contains no insulin.
[0043] The medium for culturing pluripotent stem cells preferably contains zinc at a concentration of 1 μM or less or no zinc. The concentration of zinc needs only to be 1 μM or less and may be 0.9 μM or less, 0.8 μM or less, 0.7 μM or less, 0.6 μM or less, or 0.5 μM or less. Since a small amount of zinc is often contained in the medium, the amount of zinc added to the medium is not necessarily the same as the amount of zinc contained in the medium. Therefore, the medium is treated with a zinc chelating agent (such as Chelex 100) to remove zinc, and then zinc may be added to a predetermined concentration, as shown in Examples described below. Further, the medium is treated with a zinc chelating agent, and then the medium with no zinc added may be used as the “medium containing no zinc”. The chelating agent that chelates zinc generally also chelates other metals in addition to zinc (such as cobalt, iron, magnesium, and calcium) and therefore the metals removed are added to the medium after the treatment with the zinc chelating agent.
[0044] The medium that allows the pluripotent stem cells to differentiate into endoderm cells preferably contains an activin receptor-like kinase-4,7 activator.
[0045] The activin receptor-like kinase (ALK)-4,7 activator is selected from substances that have an activating effect on ALK-4 and/or ALK-7. Examples of the activin receptor-like kinase-4,7 activator to be used include activins, Nodal, and Myostatin, preferably activins. Activins A, B, C, D, and AB are known as activins, and any of the activins can be used. The activin to be used is particularly preferably activin A. Further, the activin to be used can be activins derived from any mammal such as human and mouse, but activins derived from the same animal species as the stem cells used for differentiation are preferably used. For example, in the case where human-derived pluripotent stem cells are used as starting materials, a human-derived activin, particularly, human-derived activin A is preferably used. These activins are commercially available. The concentration of the activin receptor-like kinase (ALK)-4,7 activator in the medium is appropriately set depending on the type to be used but is preferably 3 to 500 ng/mL, more preferably 5 to 200 ng/mL, further preferably 6 to 150 ng/mL, in the case of using human activin A. Activins can cause differentiation of pluripotent stem cells into endoderm in the presence of dimethylsulfoxide even at a low concentration (Ogaki S et al. Sci Rep 5: 17297, 2015) but cannot cause differentiation of pluripotent stem cells into endoderm in the absence of dimethylsulfoxide unless the concentration is increased. Accordingly, in the case where the medium contains no dimethylsulfoxide, the concentration of human activin A is preferably set to a high concentration. Specifically, the concentration is preferably 20 to 500 ng/mL, more preferably 50 to 200 ng/mL.
[0046] The medium may contain a GSK3 inhibitor other than the activin receptor-like kinase-4,7 activator. Further, the culture may be divided into two stages, and a medium containing the activin receptor-like kinase-4,7 activator and the GSK3 inhibitor may be used in the first half culture, whereas a medium containing the activin receptor-like kinase-4,7 activator but no GSK3 inhibitor may be used in the latter culture.
[0047] The GSK3 inhibitor is selected from the group consisting of substances having GSK3a inhibitory activity, substances having GSK3P inhibitory activity, and substances having both GSK3a inhibitory activity and GSK3β inhibitory activity. Substances having GSK3β inhibitory activity or substances having both GSK3a inhibitory activity and GSK3β inhibitory activity are preferable as the GSK3 inhibitor. Specifically, examples of the GSK3 inhibitor include CHIR98014, CHIR99021, Kenpaullone, AR-A0144-18, TDZD-8, SB216763, BIO, TWS-119, and SB415286. These can be purchased as commercial products. Further, even if they are not available as commercial products, those skilled in the art can prepare them according to known literatures. Further, antisense oligonucleotides and siRNA against the mRNA of GSK3 can also be used as the GSK3 inhibitor. All of these are commercially available or can be synthesized according to known literatures. The GSK3 inhibitor to be used is preferably selected from the group consisting of CHIR99021 (6-[[2-[[4-(2,4-dichlorophenyl)-5-(4-methyl-1H-imidazole-2-yl)-2-pyrimidinyl]amino]ethyl]amino]nicotinonitrile), SB216763 (3-(2,3-dichlorophenyl)-4-(1-methyl-1H-indole-3-yl)-1H-pyrrole-2,5-dione), and SB415286 (3-[(3-chloro-4-hydroxyphenyl)amino]-4-(2-nitrophenyl)-1H-pyrrole-2,5-dione), particularly preferably CHIR99021. The concentration of the GSK3 inhibitor in the medium is appropriately set depending on the type of the GSK3 inhibitor to be used, but the concentration is preferably 1 to 10 μM, more preferably 2 to 5 μM, in the case of using CHIR99021 as the GSK3 inhibitor.
[0048] The medium that allows the pluripotent stem cells to differentiate into endoderm cells can be produced based on a known basal medium. Examples of the known basal medium can include BME medium, BGjB medium, CMRL 1066 medium, Glasgow MEM medium, Improved MEM medium, IMDM medium, Medium 199 medium, Eagles MEM medium, aMEM medium, DMEM medium, ham medium, RPMI 1640 medium, Fischer's medium, William's E medium, and a mixed medium thereof, but there is no particular limitation as long as it is a medium that can be used for culturing animal cells.
[0049] The medium that allows the pluripotent stem cells to differentiate into endoderm cells may contain a serum replacement. Examples of the serum replacement include albumin, transferrin, fatty acids, collagen precursors, trace elements (such as selenium), B-27 supplement, E5 supplement, E6 supplement, N2 supplement, knockout serum replacement (KSR), 2-mercapto ethanol, 3′-thiol glycerol, or these equivalents. These serum replacements are commercially available. Preferably, examples thereof can include xeno-free B-27 supplement or xeno-free knockout serum replacement (KSR). For example, they can be added to the medium at a concentration of 0.01 to 10 wt %, preferably 0.1 to 2.0 wt %. Further, this medium may contain other additives such as lipids, amino acids (such as non-essential amino acids), vitamins, growth factors, cytokines, antioxidants, 2-mercapto ethanol, pyruvic acid, buffers, inorganic salts, antibiotics (such as penicillin and streptomycin), or antibacterial agents (such as amphotericin B).
[0050] The culture in the medium that allows the pluripotent stem cells to differentiate into endoderm cells is generally performed in a CO.sub.2 incubator at a culture temperature suitable for cell culture (generally 30 to 40° C., preferably about 37° C.). The culture period is generally 1 day to 5 days, preferably 3 days to 4 days. Further, the culture period may be determined by confirming that the pluripotent stem cells in the culture have differentiated into endoderm cells. The differentiation of the pluripotent stem cells into endoderm cells can be confirmed by evaluating changes in expression of proteins and genes (endoderm markers) that are specifically expressed in endoderm cells. The changes in expression of the endoderm markers can be evaluated, for example, by the method for evaluating protein expression using antigen-antibody reaction or the method for evaluating gene expression using quantitative RT-PCR. Examples of the endoderm markers can include SOX17 and FOXA2.
[0051] The pluripotent stem cells may be cultured in an undifferentiated maintenance medium containing no methionine according to a known method (International Publication No. WO 2015/125662) before differentiation into endoderm cells, mesodermal cells, or ectodermal cells. This can further promote the differentiation efficiency of the pluripotent stem cells. Here, “containing no methionine” means to contain 10 μM or less, preferably 5 μM or less, more preferably 1 μM or less, further preferably 0.1 μM or less of methionine, in addition to not containing methionine at all in the medium. The culture time in the medium containing no methionine is not specifically limited but is preferably 3 to 24 hours, more preferably at least 5 to 24 hours, further preferably at least 10 to 24 hours.
[0052] The endoderm cells differentiated from the pluripotent stem cells are further differentiated into endoderm-derived cells, for example, pancreatic cells (such as insulin-producing cells), hepatocytes, and intestinal cells. Such differentiation can be performed according to a known method.
[0053] The mesodermal cells differentiated from the pluripotent stem cells are further differentiated into mesoderm-derived cells, for example, blood vessel cells, hematopoietic cells, and mesenchymal cells. Such differentiation can be performed according to a known method.
[0054] The ectodermal cells differentiated from the pluripotent stem cells are further differentiated into ectoderm-derived cells, for example, nerve cells. Such differentiation can be performed according to a known method.
(B) First Method for Inducing Differentiation into Insulin-Producing Cells
[0055] The first method for inducing differentiation into insulin-producing cells of the present invention is to induce differentiation of pluripotent stem cells into insulin-producing cells, the method comprising steps (1) to (6) below. Generally, steps (1), (2), (3), (4), (5), and (6) are continuously performed in this order, but other steps may be included between the steps.
[0056] In step (1), pluripotent stem cells are cultured in a medium containing no methionine. This step can be performed in the same manner as in the culture method in the undifferentiated maintenance medium containing no methionine described above.
[0057] In step (2), the cells obtained in step (1) are cultured in a medium containing an activin receptor-like kinase-4,7 activator and a) an insulin-like growth factor, b) an insulin analogue preparation containing no zinc, c) an insulin analogue preparation containing a low concentration of zinc, or d) a compound exerting insulin-like action and containing zinc at a concentration of 1 μM or less or no zinc. This step can be performed in the same manner as in the method for promoting differentiation of pluripotent stem cells of the present invention described above.
[0058] In step (3), the cells obtained in step (2) are cultured in a medium containing an FGF and a hedgehog signaling inhibitor.
[0059] Examples of the FGF to be used in this step can include FGF1, FGF2 (b FGF), FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9, FGF10, FGF11, FGF12, FGF13, FGF14, FGF15, FGF16, FGF17, FGF18, FGF19, FGF20, FGF21, FGF22, and FGF23, preferably FGF2 (bFGF), FGF5, FGF7, and FGF10, further preferably FGF10. These may be natural or recombinant proteins.
[0060] The hedgehog signaling inhibitor to be used in this step is not particularly limited, as long as it is a substance having inhibitory activity on hedgehog signaling, and may be a naturally occurring substance or a chemically synthesized substance. Preferable examples of the hedgehog signaling inhibitor include cyclopamine, KAAD-cyclopamine (28-[2-[[6-[(3-phenylpropanoyl)amino]hexanoyl]amino]ethyl]-17β, 23β-epoxyveratraman-3-one), KAAD-cyclopamine analogues, jervine(17,23β-epoxy-3β-hydroxyveratraman-11-one), jervine analogues, SANT-1, and hedgehog pathway blocking antibodies, particularly preferably SANT-1.
[0061] A medium obtained by adding an FGF and a hedgehog signaling inhibitor to a basal medium can be used as the medium of step (3). The concentration of the FGF in the medium is appropriately set depending on the type to be used but is preferably 10 to 100 ng/mL, more preferably 30 to 80 ng/mL, in the case of using FGF10. The concentration of the hedgehog signaling inhibitor in the medium is appropriately set depending on the type to be used but is preferably 0.1 to 0.5 μM, more preferably 0.2 to 0.3 μM, in the case of using SANT-1. The basal medium to be used may be the same as the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention. Further, the medium of step (3) may contain a serum replacement and other additives like the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention.
[0062] The medium of step (3) may contain zinc. The concentration of zinc in the medium is preferably 0.1 to 1 μM, more preferably 0.3 to 0.8 μM.
[0063] The culture in step (3) is generally performed in a CO.sub.2 incubator at a culture temperature suitable for cell culture (generally 30 to 40° C., preferably about 37° C.) The culture period is generally 1 to 5 days, preferably 1 to 3 days.
[0064] In step (4), the cells obtained in step (3) are cultured in a medium containing a retinoic acid receptor agonist, a hedgehog signaling inhibitor, and a BMP signaling inhibitor.
[0065] The retinoic acid receptor (RAR) agonist to be used in this step may be a naturally occurring retinoid, a chemically synthesized retinoid, a retinoic acid receptor agonist compound having no retinoid skeleton, or a natural product having retinoic acid receptor agonist activity. Examples of the natural retinoid having an activity as a RAR agonist can include retinoic acids (including isomers). Examples of the retinoic acids can include, but not limited to, all-trans isomer (tretinoin) and 9-cis-retinoic acid (9-cis RA). Further, chemically synthesized retinoids are known in this technical field. Examples of the retinoic acid receptor agonist compound having no retinoid skeleton include Am80, AM580, TTNPB, and AC55649. Examples of the natural product having retinoic acid receptor agonist activity include honokiol and magnolol. The RAR agonist to be used in this step is preferably a retinoic acid, AM580 (4-[[5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl]carboxyamide]benzoic acid), TTNPB (4-[[E]-2-[5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl]-1-propenyl]benzoic acid), or AC55649 (4′-octyl-[1,1′-biphenyl]-4-carboxylic acid), further preferably a retinoic acid.
[0066] Examples of the hedgehog signaling inhibitor to be used in this step include those described in step (3), particularly preferably SANT-1. The hedgehog signaling inhibitor to be used in this step may be the same as or different from that used in step (3).
[0067] The BMP signaling inhibitor to be used in this step refers to a compound having inhibitory activity on BMP signaling through binding between a BMP and a BMP receptor (type I or type II), and the inhibitor includes proteinaceous inhibitors and low-molecular weight inhibitors. Examples of the proteinaceous inhibitors include natural inhibitors, NOGGIN, CHORDIN, FOLLISTATIN, CERBERUS, and GREMLIN. NOGGIN is known to inhibit BMP signaling by inhibiting binding of BMP4 to the BMP receptor. Further, examples of the low-molecular weight inhibitors can include compounds that inhibit BMP2, BMP4, BMP6, or BMP7 having the ability to activate a transcription factor SMAD1, SMAD5, or SMAD8. Examples thereof can include DORSOMORPHIN (6-[4-(2-piperidine-1-ylethoxy)phenyl]-3-pyridine-4-ylpyrazolo[1,5-a]pyrimidine) and derivatives thereof. Besides this, examples of the BMP signaling inhibitor can include LDN-193189 (4-(6-(4-piperazine-1-yl)phenyl)pyrazolo[1,5-a]pyridine-3-yl)quinoline) and derivatives thereof. These compounds are commercially available, but in the case of being unavailable as commercial products, they can be prepared according to known literatures. Among them, the BMP signaling inhibitor to be used in this step is particularly preferably LDN-193189.
[0068] A medium obtained by adding a retinoic acid receptor agonist, a hedgehog signaling inhibitor, and a BMP signaling inhibitor to a basal medium can be used as the medium of step (4). The concentration of the retinoic acid receptor agonist in the medium is appropriately set depending on the type to be used but is preferably 0.5 to 5 μM, more preferably 1 to 3 μM, in the case of using a retinoic acid. The concentration of the hedgehog signaling inhibitor in the medium is appropriately set depending on the type to be used but is preferably 0.1 to 0.5 μM, more preferably 0.2 to 0.3 μM, in the case of using SANT-1. The concentration of the BMP signaling inhibitor in the medium is appropriately set depending on the type to be used but is preferably 0.01 to 0.5 μM, more preferably 0.05 to 0.3 μM, in the case of using LDN193189. The basal medium to be used may be the same as the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention. Further, the medium of step (4) may contain a serum replacement and other additives like the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention.
[0069] The medium of step (4) may contain vitamin C and/or Y27632. The concentration of vitamin C in the medium is preferably 10 to 100 μg/mL, more preferably 20 to 70 μg/mL. The concentration of Y27632 in the medium is preferably 1 to 50 μM, more preferably 5 to 30 μM.
[0070] The culture in step (4) is generally performed in a CO.sub.2 incubator at a culture temperature suitable for cell culture (generally 30 to 40° C., preferably about 37° C.) The culture period is generally 3 to 10 days, preferably 5 to 7 days.
[0071] In step (5), the cells obtained in step (4) are cultured in a medium containing a TGF-βI type activin receptor-like kinase-4,5,7 inhibitor, a protein kinase C activator, and a BMP signaling inhibitor.
[0072] The TGF-βI type activin receptor-like kinase-4,5,7 inhibitor to be used in this step is selected from compounds having inhibitory activity on at least one ALK selected from the group consisting of TGF-βI type activin receptor-like kinase (ALK)-4, ALK-5, and ALK-7. Examples of the ALK-4, -5, or -7 inhibitor to be used in this step include SB-431542, SB-505124, SB-525334, A-83-01, GW6604, LY580276, TGF-βI type receptor kinase inhibitor II, TGFβRI kinase inhibitor VIII, and SD-208. These are commercially available, but in the case of being unavailable as commercial products, they can be prepared according to known literatures. Further, antisense oligonucleotides and siRNA against mRNA of ALK-4, -5, or -7 can also be used as the ALK-4, -5, or -7 inhibitor. The ALK-4, -5, or -7 inhibitor to be used in this step is preferably SB-431542 (4-[4-(1,3-benzodioxole-5-yl)-5-(2-pyridinyl)-1H-imidazole-2-yl]-benzamide or hydrates thereof), A-83-01 (3-[6-methyl-2-pyridinyl]-N-phenyl-4-[4-quinolinyl]-1H-pyrazol-1-carbothioamide), TGF-βI type receptor kinase inhibitor II (2-[3-[6-methyl pyridine-2-yl]-1H-pyrazol-4-yl]-1, 5-naphthyridine), or TGFβRI kinase inhibitor VIII (6-[2-tert-butyl-5-[6-methyl-pyridine-2-yl]-1H-imidazol-4-yl]-quinoxaline), further preferably TGF-βI type receptor kinase inhibitor II.
[0073] The protein kinase C activator to be used in this step is not specifically limited, as long as it activates protein kinase C signaling and has an activity to direct endoderm cells to pancreatic specialization. Examples thereof can include indolactam V, (2S,5S)-(E,E)-8-(5-(4-(trifluoromethyl)phenyl)-2,4-pentadienoylamino)benzolactam, phorbol-12-myristate-13-acetate, and phorbol-12,13-dibutyrate (PdBU), preferably indolactam V or phorbol-12,13-dibutyrate.
[0074] Examples of the BMP signaling inhibitor to be used in this step include step those described in (4), particularly preferably LDN193189. The BMP signaling inhibitor to be used in this step may be the same as or different from that used in step (4).
[0075] A medium obtained by adding a TGF-βI type activin receptor-like kinase-4,5,7 inhibitor, a protein kinase C activator, and a BMP signaling inhibitor to a basal medium can be used as the medium of step (5). The concentration of the TGF-βI type activin receptor-like kinase-4,5,7 inhibitor in the medium is appropriately set depending on the type to be used but is preferably 1 to 10 μM, more preferably 3 to 8 μM, in the case of using TGF-βI type receptor kinase inhibitor II. The concentration of the protein kinase C activator in the medium is appropriately set depending on the type to be used but is preferably 0.1 to 0.5 μM, more preferably 0.2 to 0.4 μM, in the case of using indolactam V. The concentration of the BMP signaling inhibitor in the medium is appropriately set depending on the type to be used but is preferably 0.01 to 0.5 μM, more preferably 0.05 to 0.3 μM, in the case of using LDN193189. The basal medium to be used may be the same as the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention. Further, the medium of step (5) may contain a serum replacement and other additives like the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention.
[0076] The medium of step (5) may contain at least one selected from the group consisting of vitamin C, an EGF (epidermal growth factor) receptor agonist, nicotinamide, and T3.
[0077] Examples of the EGF receptor agonist to be used in this step can include an EGF, TGF-α, HB-EGF, amphiregulin, betacellulin, and epiregulin. Among these, an EGF or betacellulin is preferable.
[0078] The concentration of vitamin C in the medium is preferably 10 to 100 μg/mL, more preferably 20 to 70 μg/mL. The concentration of the EGF receptor agonist in the medium is appropriately set depending on the type to be used but is preferably 10 to 500 ng/mL, more preferably 30 to 300 ng/mL, in the case of using an EGF. The concentration of nicotinamide in the medium is preferably 1 to 50 mM, more preferably 5 to 30 mM. The concentration of T3 in the medium is preferably 0.1 to 5 μM, more preferably 0.5 to 3 μM.
[0079] The culture in step (5) is generally performed in a CO.sub.2 incubator at a culture temperature suitable for cell culture (generally 30 to 40° C., preferably about 37° C.) The culture period is generally 1 to 5 days, preferably 1 to 3 days.
[0080] In step (6), the cells obtained in step (5) are cultured in a medium containing nicotinamide.
[0081] A medium obtained by adding nicotinamide to a basal medium can be used as the medium of step (6). The concentration of nicotinamide in the medium is preferably 1 to 50 mM, more preferably 5 to 30 mM. The basal medium to be used may be the same as the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention. Further, the medium of step (6) may contain a serum replacement and other additives like the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention.
[0082] The medium of step (6) may contain at least one selected from the group consisting of a GLP-1 receptor agonist, vitamin C, N-acetyl-L-cysteine, zinc, a TGF-βI type activin receptor-like kinase-4,5,7 inhibitor, and T3.
[0083] The GLP-1 receptor agonist to be used in this step is a substance having an activity as an agonist for a GLP-1 (glucagon-like peptide-1) receptor. Examples of the GLP-1 receptor agonist can include GLP-1, a GLP-1MR agent, NN-2211, AC-2993 (exendin-4), BIM-51077, Aib(8,35)hGLP-1(7,37)NH.sub.2, and CJC-1131, particularly preferably exendin-4. These substances are commercially available, but in the case of being unavailable as commercial products, they can be prepared according to known literatures. Besides, many GLP-1 receptor agonists are commercially available, and they can also be used in this step.
[0084] Examples of the TGF-βI type activin receptor-like kinase-4,5,7 inhibitor to be used in this step include those described in step (5), particularly preferably TGF-βI type receptor kinase inhibitor II. The TGF-βI type activin receptor-like kinase-4,5,7 inhibitor to be used in this step may be the same as or different from that used in step (5).
[0085] The concentration of the GLP-1 receptor agonist in the medium is appropriately set depending on the type to be used but is preferably 10 to 100 ng/mL, more preferably 30 to 80 ng/mL, in the case of using exendin-4. The concentration of vitamin C in the medium is preferably 10 to 100 μg/mL, more preferably 20 to 70 μg/mL. The concentration of N-acetyl-L-cysteine in the medium is preferably 0.1 to 5 mM, more preferably 0.5 to 3 mM. The concentration of the TGF-βI type activin receptor-like kinase-4,5,7 inhibitor in the medium is appropriately set depending on the type to be used but is preferably 1 to 50 μM, more preferably 5 to 30 μM, in the case of using TGF-βI type receptor kinase inhibitor II. The concentration of zinc in the medium is preferably 1 to 50 μM, more preferably 5 to 30 μM. The concentration of T3 in the medium is preferably 0.1 to 5 μM, more preferably 0.5 to 3 μM.
[0086] The culture in step (6) is generally performed in a CO.sub.2 incubator at a culture temperature suitable for cell culture (generally 30 to 40° C., preferably about 37° C.) The culture period is generally 5 to 15 days, preferably 7 to 12 days.
[0087] The medium to be used in steps (1) to (6) is preferably a xeno-free medium.
(C) Second Method for Inducing Differentiation into Insulin-Producing Cells
[0088] The second method for inducing differentiation into insulin-producing cells of the present invention is to induce differentiation of pluripotent stem cells into insulin-producing cells, the method comprising steps (1) to (9), or (1) to (3) and (5) to (9). Generally, steps (1), (2), (3), (4), (5), (6), (7), (8), and (9) or steps (1), (2), (3), (5), (6), (7), (8), and (9) are continuously performed in this order, but other steps may be included between the steps.
[0089] In step (1), pluripotent stem cells are cultured in a medium containing no methionine. This step can be performed in the same manner as step (1) in the first method for inducing differentiation into insulin-producing cells.
[0090] In step (2), the cells obtained in step (1) are cultured in a medium containing an activin receptor-like kinase-4,7 activator and a) an insulin-like growth factor, b) an insulin analogue preparation containing no zinc, c) an insulin analogue preparation containing a low concentration of zinc, or d) a compound exerting insulin-like action and containing zinc at a concentration of 1 μM or less or no zinc. This step can be performed in the same manner as step (2) in the first method for inducing differentiation into insulin-producing cells.
[0091] In step (3), the cells obtained in step (2) are cultured in a medium containing an FGF and a hedgehog signaling inhibitor. This step can be performed in the same manner as step (3) in the first method for inducing differentiation into insulin-producing cells.
[0092] In step (4), the cells obtained in step (3) are cultured in a medium containing a KGF (keratinocyte growth factor). This step may be omitted. In the case where the cells obtained in step (1) are cultured in a medium containing an insulin-like growth factor in step (2), it is preferable not to omit this step. Meanwhile, in the case where the cells obtained in step (1) are cultured in a medium containing an insulin analogue preparation with no zinc in step (2), this step may be omitted.
[0093] A medium obtained by adding a KGF to a basal medium can be used as the medium of step (4). The concentration of the KGF in the medium is preferably 10 to 100 ng/mL, more preferably 30 to 80 ng/mL. The basal medium to be used may be the same as the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention. Further, the medium of step (4) may contain a serum replacement and other additives like the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention.
[0094] The medium of step (4) may contain vitamin C. The concentration of vitamin C in the medium is preferably 10 to 100 μg/mL, more preferably 20 to 70 μg/mL.
[0095] The culture in step (4) is generally performed in a CO.sub.2 incubator at a culture temperature suitable for cell culture (generally 30 to 40° C., preferably about 37° C.) The culture period is generally 1 to 5 days, preferably 1 to 3 days.
[0096] In step (5), the cells obtained in step (3) or step (4) are cultured in a medium containing a KGF, a hedgehog signaling inhibitor, a protein kinase C activator, and a retinoic acid receptor agonist.
[0097] Examples of the hedgehog signaling inhibitor to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably SANT-1.
[0098] Examples of the protein kinase C activator to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably indolactam V.
[0099] Examples of the retinoic acid receptor agonist to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably a retinoic acid.
[0100] A medium obtained by adding a KGF, a hedgehog signaling inhibitor, a protein kinase C activator, and a retinoic acid receptor agonist to a basal medium can be used as the medium of step (5). The concentration of the KGF in the medium is preferably 10 to 100 ng/mL, more preferably 30 to 80 ng/mL. The concentration of the hedgehog signaling inhibitor in the medium is appropriately set depending on the type to be used but is preferably 0.1 to 0.5 μM, more preferably 0.2 to 0.3 μM, in the case of using SANT-1. The concentration of the protein kinase C activator in the medium is appropriately set depending on the type to be used but is preferably 10 to 100 nM, more preferably 30 to 80 nM, in the case of using indolactam V. The concentration of the retinoic acid receptor agonist in the medium is appropriately set depending on the type to be used but is preferably 0.5 to 5 μM, more preferably 1 to 3 μM, in the case of using a retinoic acid. The basal medium to be used may be the same as the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention. Further, the medium of step (5) may contain a serum replacement and other additives like the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention.
[0101] The medium of step (5) may contain vitamin C. The concentration of vitamin C in the medium is preferably 10 to 100 μg/mL, more preferably 20 to 70 μg/mL.
[0102] The culture in step (5) is generally performed in a CO.sub.2 incubator at a culture temperature suitable for cell culture (generally 30 to 40° C., preferably about 37° C.) The culture period is generally 1 to 5 days, preferably 1 to 3 days.
[0103] In step (6), the cells are cultured in a medium containing a KGF, a hedgehog signaling inhibitor, a retinoic acid receptor agonist, and a BMP signaling inhibitor.
[0104] Examples of the hedgehog signaling inhibitor to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably SANT-1. The hedgehog signaling inhibitor is used also in step (5), and the hedgehog signaling inhibitor to be used in this step may be the same as or different from that used in step (5).
[0105] Examples of the retinoic acid receptor agonist to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably a retinoic acid. The retinoic acid receptor agonist is used also in step (5), and the retinoic acid receptor agonist to be used in this step may be the same as or different from that used in step (5).
[0106] Examples of the BMP signaling inhibitor to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably LDN193189.
[0107] A medium obtained by adding a KGF, a hedgehog signaling inhibitor, a retinoic acid receptor agonist, and a BMP signaling inhibitor to a basal medium can be used as the medium of step (6). The concentration of the KGF in the medium is preferably 10 to 100 ng/mL, more preferably 30 to 80 ng/mL. The concentration of the hedgehog signaling inhibitor in the medium is appropriately set depending on the type to be used but is preferably 0.1 to 0.5 μM, more preferably 0.2 to 0.3 μM, in the case of using SANT-1. The concentration of the retinoic acid receptor agonist in the medium is appropriately set depending on the type to be used but is preferably 10 to 500 nM, more preferably 50 to 300 nM, in the case of using a retinoic acid. The concentration of the BMP signaling inhibitor in the medium is appropriately set depending on the type to be used but is preferably 10 to 500 nM, more preferably 50 to 300 nM, in the case of using LDN193189. The basal medium to be used may be the same as the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention. Further, the medium of step (6) may contain a serum replacement and other additives like the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention.
[0108] The medium of step (6) may contain vitamin C. The concentration of vitamin C in the medium is preferably 10 to 100 μg/mL, more preferably 30 to 80 μg/mL.
[0109] The culture in step (6) is generally performed in a CO.sub.2 incubator at a culture temperature suitable for cell culture (generally 30 to 40° C., preferably about 37° C.) The culture period is generally 3 to 7 days, preferably 4 to 6 days.
[0110] In step (7), the cells obtained in step (6) are cultured in a medium containing a TGF-βI type activin receptor-like kinase-4,5,7 inhibitor, an EGF receptor agonist, a γ-secretase inhibitor, and a retinoic acid receptor agonist.
[0111] Examples of the TGF-βI type activin receptor-like kinase-4,5,7 inhibitor to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably TGF-βI type receptor-like kinase inhibitor II (ALK5i).
[0112] Examples of the EGF receptor agonist to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably an EGF.
[0113] Examples of the γ-secretase inhibitor to be used in this step can include aryl sulfonamide, dibenzazepine, benzodiazepine, DAPT, L-685458, MK0752, or γ-secretase inhibitor XXI (GSXXi). These can be purchased as commercial products. Further, even if they are not available as commercial products, those skilled in the art can prepare them according to known literatures. Suitable examples of the γ-secretase inhibitor can include DAPT or γ-secretase inhibitor XXI.
[0114] Examples of the retinoic acid receptor agonist to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably a retinoic acid. The retinoic acid receptor agonist is used also in steps (5) and (6), and the hedgehog signaling inhibitor to be used in this step may be the same as or different from that used in steps (5) and (6).
[0115] A medium obtained by adding a TGF-βI type activin receptor-like kinase-4,5,7 inhibitor, an EGF receptor agonist, a γ-secretase inhibitor, and a retinoic acid receptor agonist to a basal medium can be used as the medium of step (7). The concentration of the TGF-βI type activin receptor-like kinase-4,5,7 inhibitor in the medium is appropriately set depending on the type to be used but is preferably 1 to 50 μM, more preferably 5 to 30 μM, in the case of using TGF-βI type receptor-like kinase inhibitor II. The concentration of the EGF receptor agonist in the medium is appropriately set depending on the type to be used but is preferably 10 to 50 ng/mL, more preferably 30 to 40 ng/mL, in the case of using an EGF. The concentration of the γ-secretase inhibitor in the medium is appropriately set depending on the type to be used but is preferably 1 to 50 μM, more preferably 5 to 30 μM, in the case of using DAPT. The concentration of the retinoic acid receptor agonist in the medium is appropriately set depending on the type to be used but is preferably 10 to 500 nM, more preferably 50 to 300 nM, in the case of using a retinoic acid. The basal medium to be used may be the same as the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention. Further, the medium of step (7) may contain a serum replacement and other additives like the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention.
[0116] The medium of step (7) may contain triiodothyronine and/or vitamin C. The concentration of triiodothyronine in the medium is preferably 0.1 to 5 μM, more preferably 0.5 to 3 μM. The concentration of vitamin C in the medium is preferably 10 to 100 μg/mL, more preferably 30 to 80 μg/mL.
[0117] The culture in step (7) is generally performed in a CO.sub.2 incubator at a culture temperature suitable for cell culture (generally 30 to 40° C., preferably about 37° C.) The culture period is generally 1 to 5 days, preferably 2 to 4 days.
[0118] In step (8), the cells obtained in step (7) are cultured in a medium containing a TGF-βI type activin receptor-like kinase-4,5,7 inhibitor, an EGF receptor agonist, a γ-secretase inhibitor, and a retinoic acid receptor agonist. In this step, the concentration of the retinoic acid receptor agonist in the medium is set to a concentration lower than the concentration of the retinoic acid receptor agonist in step (7).
[0119] In step (8), the culture can be performed in the same medium as used in step (7) except the concentration of the retinoic acid receptor agonist. The medium of step (8) may contain no vitamin C.
[0120] The concentration of the retinoic acid receptor agonist in the medium is not specifically limited, as long as it is lower than the concentration of the retinoic acid receptor agonist in step (7), but is preferably 10 to 50 nM, more preferably 20 to 30 nM, for example, in the case of using a retinoic acid.
[0121] The culture in step (8) is generally performed in a CO.sub.2 incubator at a culture temperature suitable for cell culture (generally 30 to 40° C., preferably about 37° C.) The culture period is generally 2 to 6 days, preferably 3 to 5 days.
[0122] In step (9), the cells obtained in step (8) are cultured in a medium containing a TGF-βI type activin receptor-like kinase-4,5,7 inhibitor.
[0123] Examples of the TGF-βI type activin receptor-like kinase-4,5,7 inhibitor to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably TGF-βI type receptor-like kinase inhibitor II (ALK5i). The TGF-βI type activin receptor-like kinase-4,5,7 inhibitor is used also in steps (7) and (8), and the TGF-βI type activin receptor-like kinase-4,5,7 inhibitor to be used in this step may be the same as or different from that used in steps (7) and (8).
[0124] A medium obtained by adding a TGF-βI type activin receptor-like kinase-4,5,7 inhibitor to a basal medium can be used as the medium of step (9). The concentration of the TGF-βI type activin receptor-like kinase-4,5,7 inhibitor in the medium is appropriately set depending on the type to be used but is preferably 1 to 50 μM, more preferably 5 to 30 μM, in the case of using TGF-βI type receptor-like kinase inhibitor II. The basal medium to be used may be the same as the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention. Further, the medium of step (9) may contain a serum replacement and other additives like the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention.
[0125] The medium of step (9) may contain triiodothyronine. The concentration of triiodothyronine in the medium is preferably 0.1 to 5 μM, more preferably 0.5 to 3 μM.
[0126] The culture in step (9) is generally performed in a CO.sub.2 incubator at a culture temperature suitable for cell culture (generally 30 to 40° C., preferably about 37° C.) The culture period is generally 1 to 20 days, preferably 3 to 15 days.
(D) Method for Differentiating Pancreatic Progenitor Cells into Pancreatic Beta Cells
[0127] The method for differentiating pancreatic progenitor cells into pancreatic beta cells of the present invention comprises culturing pancreatic progenitor cells in a medium containing a factor selected from the group consisting of a retinoic acid receptor agonist, a hedgehog signaling inhibitor, a KGF, a γ-secretase inhibitor, a BMP signaling inhibitor, a TGF-βI type activin receptor-like kinase-4,5,7 inhibitor, and an EGF receptor agonist, wherein the pancreatic progenitor cells are PDX1 positive or NKX6.1 positive.
[0128] Examples of the retinoic acid receptor agonist to be used in the differentiation method of the present invention include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably a retinoic acid.
[0129] Examples of the hedgehog signaling inhibitor to be used in the differentiation method of the present invention include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably SANT-1.
[0130] Examples of the γ-secretase inhibitor to be used in the differentiation method of the present invention include those described in the second method for inducing differentiation into insulin-producing cells, particularly preferably DAPT.
[0131] Examples of the BMP signaling inhibitor to be used in the differentiation method of the present invention include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably LDN193189.
[0132] Examples of the TGF-βI type activin receptor-like kinase-4,5,7 inhibitor to be used in the differentiation method of the present invention include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably TGF-βI type receptor-like kinase inhibitor II (ALK5i).
[0133] Examples of the EGF receptor agonist to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably an EGF.
[0134] A medium obtained by adding a factor selected from the group consisting of a retinoic acid receptor agonist, a hedgehog signaling inhibitor, a KGF, a γ-secretase inhibitor, a BMP signaling inhibitor, a TGF-βI type activin receptor-like kinase-4,5,7 inhibitor, and an EGF receptor agonist to a basal medium can be used as the medium for culturing the pancreatic progenitor cells. The concentration of each factor in the medium may be the same as the concentration described in the method for promoting differentiation of pluripotent stem cells, the first method for inducing differentiation into insulin-producing cells, or the second method for inducing differentiation into insulin-producing cells.
(E) Third Method for Inducing Differentiation into Insulin-Producing Cells
[0135] The third method for inducing differentiation into insulin-producing cells of the present invention is to induce differentiation of pluripotent stem cells into insulin-producing cells, the method comprising steps (1) to (7) below. Generally, steps (1), (2), (3), (4), (5), (6), and (7) are continuously performed in this order, but other steps may be included between the steps.
[0136] In step (1), pluripotent stem cells are cultured in a medium containing no methionine. This step can be performed in the same manner as in the culture method in the undifferentiated maintenance medium containing no methionine described above.
[0137] In step (2), the cells obtained in step (1) are cultured in a medium containing an activin receptor-like kinase-4,7 activator and a) an insulin-like growth factor, b) an insulin analogue preparation containing no zinc, c) an insulin analogue preparation containing a low concentration of zinc, or d) a compound exerting insulin-like action and containing zinc at a concentration of 1 μM or less or no zinc. This step can be performed in the same manner as in the method for promoting differentiation of pluripotent stem cells of the present invention.
[0138] In step (3), the cells obtained in step (2) are cultured in a medium containing a KGF and containing zinc at a concentration of 1 μM or less or no zinc.
[0139] A medium obtained by adding a KGF to a basal medium can be used as the medium of step (3). The concentration of the KGF in the medium is preferably 10 to 100 ng/mL, more preferably 30 to 80 ng/mL. The basal medium to be used may be the same as the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention. Further, the medium of step (3) may contain a serum replacement and other additives like the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention.
[0140] The medium of step (3) contains zinc at a concentration of 1 μM or less or no zinc. The concentration of zinc needs only to be 1 μM or less but may be 0.9 μM or less, 0.8 μM or less, 0.7 μM or less, 0.6 μM or less, or 0.5 μM or less. Since a small amount of zinc is often contained in the medium, the amount of zinc added to the medium may not be the same as the amount of zinc contained in the medium. Therefore, zinc may be added to a predetermined concentration after the medium is treated with a zinc chelating agent (such as Chelex 100) to remove zinc, as shown in Examples described below. Further, after the medium is treated with a zinc chelating agent, the medium with no zinc added may be used as the “medium containing no zinc”. Since the chelating agent that chelates zinc generally also chelates metals other than zinc (such as cobalt, iron, magnesium, and calcium), the metals removed are added to the medium after the treatment with the zinc chelating agent.
[0141] The medium of step (3) may contain vitamin C. The concentration of vitamin C in the medium is preferably 10 to 100 μg/mL, more preferably 20 to 70 μg/mL.
[0142] When a hedgehog signaling inhibitor such as SANT-1 is added to the medium of step (3), the glucose-stimulated insulin secretion of the insulin-producing cells to be obtained may possibly decrease. Therefore, the medium preferably contains no hedgehog signaling inhibitor.
[0143] The culture in step (3) is generally performed in a CO.sub.2 incubator at a culture temperature suitable for cell culture (generally 30 to 40° C., preferably about 37° C.) The culture period is generally 1 to 5 days, preferably 2 to 4 days.
[0144] In step (4), the cells obtained in step (3) are cultured in a medium containing a KGF, a hedgehog signaling inhibitor, and a retinoic acid receptor agonist.
[0145] Examples of the hedgehog signaling inhibitor to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably SANT-1.
[0146] Examples of the retinoic acid receptor agonist to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably a retinoic acid.
[0147] A medium obtained by adding a KGF, a hedgehog signaling inhibitor, and a retinoic acid receptor agonist to a basal medium can be used as the medium of step (4). The concentration of the KGF in the medium is preferably 10 to 100 ng/mL, more preferably 30 to 80 ng/mL. The concentration of the hedgehog signaling inhibitor in the medium is appropriately set depending on the type to be used but is preferably 0.1 to 0.5 μM, more preferably 0.2 to 0.3 μM, in the case of using SANT-1. The concentration of the retinoic acid receptor agonist in the medium is appropriately set depending on the type to be used but is preferably 0.5 to 5 μM, more preferably 1 to 3 μM, in the case of using a retinoic acid. The basal medium to be used may be the same as the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention. Further, the medium of step (4) may contain a serum replacement and other additives like the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention.
[0148] The medium of step (4) may contain at least one selected from the group consisting of a BMP signaling inhibitor, a protein kinase C activator, vitamin C, and Y27632.
[0149] Examples of the BMP signaling inhibitor to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably LDN193189.
[0150] Examples of the protein kinase C activator to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably indolactam V or phorbol-12,13-dibutyrate.
[0151] The concentration of the BMP signaling inhibitor in the medium is appropriately set depending on the type to be used but is preferably 10 to 500 nM, more preferably 50 to 300 nM, in the case of using LDN193189. The concentration of the protein kinase C activator in the medium is appropriately set depending on the type to be used but is preferably 10 to 500 nM, more preferably 30 to 200 nM, in the case of using indolactam V, and is preferably 100 to 1000 nM, more preferably 300 to 800 nM, in the case of using phorbol-12,13-dibutyrate. The concentration of vitamin C in the medium is preferably 10 to 100 μg/mL, more preferably 20 to 70 μg/mL. The concentration of Y27632 in the medium is preferably 1 to 50 μM, more preferably 5 to 30 μM.
[0152] The culture in step (4) is generally performed in a CO.sub.2 incubator at a culture temperature suitable for cell culture (generally 30 to 40° C., preferably about 37° C.) The culture period is generally 1 to 3 days, preferably 1 to 2 days.
[0153] In step (5), the cells obtained in step (4) are cultured in a medium containing a KGF, a hedgehog signaling inhibitor, and a retinoic acid receptor agonist. In this step, the concentration of the retinoic acid receptor agonist in the medium is set to a concentration lower than the concentration of the retinoic acid receptor agonist in step (4).
[0154] Examples of the hedgehog signaling inhibitor to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably SANT-1.
[0155] Examples of the retinoic acid receptor agonist to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably a retinoic acid.
[0156] A medium obtained by adding a KGF, a hedgehog signaling inhibitor, and a retinoic acid receptor agonist to a basal medium can be used as the medium of step (5). The concentration of the KGF in the medium is preferably 10 to 100 ng/mL, more preferably 30 to 80 ng/mL. The concentration of the hedgehog signaling inhibitor in the medium is appropriately set depending on the type to be used but is preferably 0.1 to 0.5 μM, more preferably 0.2 to 0.3 μM, in the case of using SANT-1. The concentration of the retinoic acid receptor agonist in the medium is not specifically limited, as long as it is lower than the concentration of the retinoic acid receptor agonist in step (4), but is preferably 10 to 500 nM, more preferably 50 to 300 nM, for example, in the case of using a retinoic acid. The basal medium to be used may be the same as the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention. Further, the medium of step (5) may contain a serum replacement and other additives like the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention.
[0157] The medium of step (5) may contain at least one selected from the group consisting of a BMP signaling inhibitor, vitamin C, Y27632, and an activin receptor-like kinase-4,7 activator.
[0158] Examples of the BMP signaling inhibitor to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably LDN193189.
[0159] Examples of the activin receptor-like kinase-4,7 activator to be used in this step include those described in the method for promoting differentiation of pluripotent stem cells, particularly preferably activin A.
[0160] The concentration of the BMP signaling inhibitor in the medium is appropriately set depending on the type to be used but is preferably 10 to 500 nM, more preferably 50 to 300 nM, in the case of using LDN193189. The concentration of vitamin C in the medium is preferably 10 to 100 μg/mL, more preferably 20 to 70 μg/mL. The concentration of Y27632 in the medium is preferably 1 to 50 μM, more preferably 5 to 30 μM. The concentration of the activin receptor-like kinase-4,7 activator in the medium is appropriately set depending on the type to be used but is preferably 10 to 500 μg/ml, more preferably 50 to 300 μg/ml, in the case of using activin A.
[0161] The culture in step (5) is generally performed in a CO.sub.2 incubator at a culture temperature suitable for cell culture (generally 30 to 40° C., preferably about 37° C.) The culture period is generally 3 to 7 days, preferably 4 to 6 days.
[0162] In step (6), the cells obtained in step (5) are cultured in a medium containing a TGF-βI type activin receptor-like kinase-4,5,7 inhibitor and a retinoic acid receptor agonist.
[0163] Examples of the TGF-βI type activin receptor-like kinase-4,5,7 inhibitor to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably TGF-βI type receptor-like kinase inhibitor II (ALK5i).
[0164] Examples of the retinoic acid receptor agonist to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably a retinoic acid.
[0165] A medium obtained by adding a TGF-βI type activin receptor-like kinase-4,5,7 inhibitor and a retinoic acid receptor agonist to a basal medium can be used as the medium of step (6). The concentration of the TGF-βI type activin receptor-like kinase-4,5,7 inhibitor in the medium is appropriately set depending on the type to be used but is preferably 1 to 50 μM, more preferably 5 to 30 μM, in the case of using TGF-βI type receptor-like kinase inhibitor II. The concentration of the retinoic acid receptor agonist in the medium is appropriately set depending on the type to be used but is preferably 10 to 500 nM, more preferably 50 to 300 nM, in the case of using a retinoic acid. The basal medium to be used may be the same as the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention. Further, the medium of step (6) may contain a serum replacement and other additives like the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention.
[0166] The medium of step (6) may contain at least one selected from the group consisting of an EGF receptor agonist, a γ-secretase inhibitor, triiodothyronine, and vitamin C.
[0167] Examples of the EGF receptor agonist to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably an EGF or betacellulin.
[0168] Examples of the γ-secretase inhibitor to be used in this step include those described in the second method for inducing differentiation into insulin-producing cells, particularly preferably DAPT or γ-secretase inhibitor XXI.
[0169] The concentration of the EGF receptor agonist in the medium is appropriately set depending on the type to be used but is preferably 10 to 50 ng/mL, more preferably 30 to 40 ng/mL, in the case of using an EGF, and is preferably 5 to 100 ng/mL, more preferably 10 to 50 ng/mL, in the case of using betacellulin. The concentration of the γ-secretase inhibitor in the medium is appropriately set depending on the type to be used but is preferably 1 to 50 μM, more preferably 5 to 30 μM, in the case of using DAPT, and is preferably 0.1 to 10 μM, more preferably 0.5 to 5 μM, in the case of using γ-secretase inhibitor XXI. The concentration of triiodothyronine in the medium is preferably 0.1 to 5 μM, more preferably 0.5 to 3 μM. The concentration of vitamin C in the medium is preferably 10 to 100 μg/mL, more preferably 30 to 80 μg/mL.
[0170] The culture in step (6) is generally performed in a CO.sub.2 incubator at a culture temperature suitable for cell culture (generally 30 to 40° C., preferably about 37° C.) The culture period is generally 2 to 6 days, preferably 3 to 5 days.
[0171] In step (7), the cells obtained in step (6) are cultured in a medium containing a TGF-βI type activin receptor-like kinase-4,5,7 inhibitor and a retinoic acid receptor agonist. In this step, the concentration of the retinoic acid receptor agonist in the medium is set to a concentration lower than the concentration of the retinoic acid receptor agonist in step (6).
[0172] Examples of the TGF-βI type activin receptor-like kinase-4,5,7 inhibitor to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably TGF-βI type receptor-like kinase inhibitor II (ALK5i).
[0173] Examples of the retinoic acid receptor agonist to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably a retinoic acid.
[0174] A medium obtained by adding a TGF-βI type activin receptor-like kinase-4,5,7 inhibitor and a retinoic acid receptor agonist to a basal medium can be used as the medium of step (7). The concentration of the TGF-βI type activin receptor-like kinase-4,5,7 inhibitor in the medium is appropriately set depending on the type to be used but is preferably 1 to 50 μM, more preferably 5 to 30 μM, in the case of using TGF-βI type receptor-like kinase inhibitor II. The concentration of the retinoic acid receptor agonist in the medium is not specifically limited, as long as it is lower than the concentration of the retinoic acid receptor agonist in step (6), but is preferably 2 to 100 nM, more preferably 10 to 50 nM, for example, in the case of using a retinoic acid. The basal medium to be used may be the same as the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention. Further, the medium of step (7) may contain a serum replacement and other additives like the medium used in the method for promoting differentiation of pluripotent stem cells of the present invention.
[0175] The medium of step (7) may contain at least one selected from the group consisting of an EGF receptor agonist, a γ-secretase inhibitor, triiodothyronine, and vitamin C.
[0176] Examples of the EGF receptor agonist to be used in this step include those described in the first method for inducing differentiation into insulin-producing cells, particularly preferably EGF or betacellulin.
[0177] Examples of the γ-secretase inhibitor to be used in this step include those described in the second method for inducing differentiation into insulin-producing cells, particularly preferably DAPT or γ-secretase inhibitor XXI.
[0178] The concentration of the EGF receptor agonist in the medium is appropriately set depending on the type to be used but is preferably 10 to 50 ng/mL, more preferably 30 to 40 ng/mL, in the case of using an EGF, and is preferably 5 to 100 ng/mL, more preferably 10 to 50 ng/mL, in the case of using betacellulin. The concentration of the γ-secretase inhibitor in the medium is appropriately set depending on the type to be used but is preferably 1 to 50 μM, more preferably 5 to 30 μM, in the case of using DAPT, and is preferably 0.1 to 10 μM, more preferably 0.5 to 5 μM, in the case of using a γ-secretase inhibitor XXI. The concentration of triiodothyronine in the medium is preferably 0.1 to 5 μM, more preferably 0.5 to 3 μM. The concentration of vitamin C in the medium is preferably 10 to 100 μg/mL, more preferably 30 to 80 μg/mL.
[0179] The culture in step (7) is generally performed in a CO.sub.2 incubator at a culture temperature suitable for cell culture (generally 30 to 40° C., preferably about 37° C.) The culture period is generally 1 to 5 days, preferably 2 to 4 days.
Examples
[0180] Hereinafter, the present invention will be specifically described further in detail by way of examples, but the present invention is not limited to these examples.
(A) Results
[0181] (1) Methionine Deprival Pretreatment Potentiates Late Stage Differentiation of Human iPS Cells into Insulin-Expressing Beta Cells.
[0182] The inventor previously reported that pluripotent stem cells showed a special metabolic state that requires methionine metabolism. Deprival of methionine from media rendered the pluripotent stem cells at a biased state for differentiation, so that if inductive signaling was applied, a potentiated differentiation was observed.
[0183] The inventor then investigated if methionine pretreatment could potentiate late stage differentiation into pancreatic beta cells.
[0184] The inventor differentiated Toe hiPSCs using the previously reported procedure for generating insulin-expressing beta cells with some modifications (Nakashima et al., 2015; Shahjalal et al., 2014). For differentiation into pancreatic endocrine cells, the inventor dissociated undifferentiated hiPSCs and cultured under pluripotent cell maintenance medium to allow the cells to form spheres for 24 h.
[0185] After formation of spheres, hiPSCs were treated 5 h with the same media that was deprived of methionine (ΔMet, or contr), then triggered to differentiate by switching to differentiation media (
[0186] The inventor compared gene expressions between the methionine deprival treated and control groups at different differentiation stages by performing microarray analysis (
[0187] Immunocytochemistry analysis of the differentiated cells revealed that the proportion of OCT3/4-expressing cells were significantly reduced in differentiation day 3 DE cells in ΔMet treated groups (
(2) Methionine Deprival Pretreatment Potentiates Differentiation.
[0188] Next, the molecular mechanism that methionine deprival potentiated differentiation will be revealed. Human RPChiPS771 cells were subjected to amino acids singly deprival and then differentiated into DE under two different protocols (
[0189] To explore into the molecular mechanism of the potentiation of differentiation, the inventor analyzed gene expression profiles of the human iPSCs after treated with short term (5 h) methionine or other amino acid deprival. In this experiment, RPChiPS771 and 201B7 hiPSCs were used. Gene expressions were analyzed by real time PCR and PCA, using a primer set consisting of 88 known genes related to pluripotency and differentiation, together with 8 housekeeping genes (
(3) SLC30A1 Expression is Up-Regulated Under Methionine Deprivation.
[0190] To explore into the gene that are upregulated upon methionine deprival of the pluripotent stem cells for short term (5 h), human khES3 ESCs and 201B7 hiPSCs were cultured in complete or methionine deprived CSTI7 or StemFit serum free medium for 5 h and RNA was extracted and subjected to gene array profiling analysis, using 3 different array sets (
(4) Reduced Protein Bound Zn Under Methionine Deprival Might Explain the Biased State for Differentiation Triggered by Methionine Deprival Treatment of Pluripotent hiPSCs.
[0191] SLC30A1 encodes ZnT1 which is expressed in the plasma membrane, and functions to excrete Zn and decrease intracellular Zn contents. The inventor further measured heavy metals, Zn, Cu and Fe contents (labile or protein bound forms), in the pluripotent stem cells treated with methionine deprival or other amino acid deprival for 5 h (
[0192] The inventor then hypothesized that a reduced intracellular Zn concentration caused by methionine deprival might explain its effects to trigger a differentiation of pluripotent stem cells. To test this possibility, the inventor then attempted to reduce intracellular Zn concentration by culturing pluripotent hiPSCs in Zn deprived media. Maintenance medium StemFit AK medium were deprived of Zn by treating with a chelating reagent, Chelex 100. Since Chelex 100 not only chelates Zn but also other heavy metals, such as copper, iron, magnesium, and calcium from the medium, other heavy metal ions were added back to make Zn deprived medium (ΔZn,
[0193] Under control complete medium, cell numbers increased with time. However, when cultured under ΔZn condition, cell numbers reduced, and showed minimum increase at 72 hr, which is significantly lower than that of the control complete condition (
[0194] To compare the affected genes between iPSCs treated with ΔZn and ΔMet, the expression of genes in pluripotent stem cells cultured under ΔMet condition was also examined using the same primer arrays used in
(5) Roles of Zn in Maintenance of Undifferentiated iPS Cells
[0195] The results by the inventor suggest that SLC30A1 (ZnT1)-mediated reduction of intracellular Zn might be one of the mechanisms that underlies potentiated differentiation through ΔMet treatment. Since ΔMet treatment affected the maintenance of pluripotent stem cells (Shiraki et al, 2014), it was then investigated if reduced Zn concentration in the media might affect the growth or pluripotency of the undifferentiated pluripotent stem cells.
[0196] Insulin solution contains Zn as a stabilizer and is often used as a supplement in the media to sustain self-renewal of undifferentiated iPSCs. The use of insulin as a supplement in the medium resulted Zn at 3 μM final concentration in StemFit AK03N. To allow manipulation of Zn content in the medium, the inventor deprived Zn from StemFit AK03 [Undiff-AKM (INS/Zn0)] and substituted insulin with IGF1 [Undiff-AKM (IGF1/Zn0)]. For maintenance culture of pluripotent hiPSCs, the Zn concentration was adjusted to 3 μM (
[0197] To confirm that IGF1 could sustain pluripotency of hiPSCs, hiPSCs were cultured in medium supplemented with insulin or IGF instead of insulin, and primer array analyses were performed, to compare their expressions using a primer array. The undifferentiated iPSCs cultured in undiff-AKM (INS) (Zn3) (=StemFit AK03N) or undiff-AKM (IGF1) (Zn3) showed similar expression profiles, in contrast to those shown in the differentiated cells of day 1 or day 3 DE cells (
[0198] Using this undiff-AKM (IGF) medium, the effects of Zn concentrations on the growth of iPSCs were then examined. Undifferentiated Ff-I01s01 cells were cultured for 3 days in maintenance media undiff-AKM (IGF1) or containing 6 different Zn concentrations, and then their viabilities were examined. iPSCs cultured under 0 μM Zn showed a sharp decrease of cell numbers (
[0199] For the effects on differentiation markers, most differentiation markers tested were up-regulated, such as GATA4 (an endoderm marker), PECAM (platelet endothelial cell adhesion molecule; a mesoderm marker), EOMES, MNX1, PAX6 (paired box protein; an ectoderm marker) in cells cultured at 0 μM Zn in AKM (IGF1) or AKM (INS*) compared to controls 3 μM Zn in AKM (IGF1) (
[0200] The results therefore suggest that iPS cells cultured at 0 μM Zn in AKM (IGF1) condition showed decreased cell proliferation and potentiated differentiation (
(6) Deprival of Zn from Differentiation Media Potentiated Differentiation into DE Cells.
[0201] For differentiation, in order to determine an appropriate Zn concentration, AKM media deprived of Zn (AKM Zn0) and adjusted Zn concentration at 0, 0.5 or 3 μM were used. The concentrations of Zn in the media used in this study are shown in
[0202] 8 hiPSC lines derived from HLA homozygote donors (Sugita et al., 2016) were then differentiated into the DE cells using the xeno-free StemFit AKM medium as differentiation medium M1, in which insulin is supplemented (M1-AKM (INS)) (
(7) Deprival of Zn and Methionine Potentiated Differentiation into a Pancreatic Fate.
[0203] The inventor further tested Zn concentration dependency in differentiation into a pancreatic fate, in combination with methionine deprival pretreatment.
[0204] The inventor used Ff-I01s01 iPSCs and cultured under methionine deprival for 5 h before differentiation. Zn concentration at 0, 0.5 or 3 μM in M1-AKM (IGF1) medium was tested for differentiation into day 3 DE cells. Under complete media, OCT3/4+DE cells appeared at Zn 0.5 μM and increased at Zn 3 μM, with a reciprocal decrease in SOX17+ cells. Upon ΔMet treatment applied before differentiation, OCT3/4+ cells were eliminated at either Zn 0, 0.5 or 3 μM, and a reciprocal increase in SOX17+ cells was observed (
[0205] Another HLA homozygote-derived iPSC line, Ff-I14s04, was also tested (
[0206] To optimize Zn concentration for endoderm differentiation, HLA homozygote-derived iPSC line Ff-I01s01 cells were differentiated in M1-AKM (IGF1), M1-AKM (IGF2), M1-AKM (INS*), or control M1-AKM (INS) [Basic03 (INS_3)], and added with a graded dose of Zn concentration (0, 0.5, 1, 3 μM) for each day during the 3 day time (
[0207] Expression of genes associated with pluripotency, such as POU5F1, SOX2, NANOG or GBX2, a gene associated with cell growth, were down-regulated when M1-AKM (IGF1) or M1-AKM (IGF2) were used compared to control M1-AKM (INS) [Basic03 (INS_3)] (
[0208] By contrast, expressions of differentiation markers such as CD34 (mesoderm), PAX6 (neural ectoderm) and GATA6 (definitive endoderm) were up-regulated when M1-AKM [IGF1 (3_3_3)] was used compared to control M1-AKM (INS) [Basic03 (INS_3)]. Lowering Zn concentration itself did not upregulated these differentiation markers when INS* was used. Down-regulation of CD34 or PAX6 expression was observed with increased Zn concentrations in M1-AKM (IGF1, IGF2) compared to M1-AKM [IGF1 (0_0_0)].
[0209] Taken together, it was found that INS exhibit a strong pluripotency maintenance activity, and Zn concentration also acts to sustain the pluripotency. With the use of INS and increased Zn concentration, the pluripotency maintenance and the growth of iPS cells is sustained.
[0210] Then, using a spinner flask for a large scale culture of iPSC-derived pancreatic cells, the effects of ΔMet treatment in combination with culturing under M1-AKM (IGF1/Zn 0.5) condition were tested to yield differentiation day 11 pancreatic PP and then differentiation day 22 EC cells, following the procedure shown in
[0211] Taken together, the results by the inventor indicate that ΔMet treatment potentiated differentiation, and one of the downstream targets is up-regulation of Zn transporter ZnT1, which then decreases intracellular Zn contents. Decreased Zn content during initial differentiation potentiated differentiation into DE cells and mimicked ΔMet. However, a decreased Zn is not sufficient for an efficient differentiation into a pancreatic fate, and application in combination with ΔMet treatment potentiated pancreatic differentiation.
(8) Deprival of Zn and Methionine Potentiated Differentiation into Beta Cells.
[0212] The inventor then attempted to adapt the ΔMet ΔZn novel condition to previously described protocols (Pagliuca et al, 2014; Ve). The experimental scheme is shown in
[0213] Glucose-stimulatory insulin secretion assay was then performed to test the functionality of the differentiated cells. The results revealed that conditions a and b showed GSIS activity. Of note is that condition a showed a clear biphasic GSIS activity with fast responding phase 1 of insulin secretion on day 26. Immunocytochemical analysis on day 33 revealed that the cells are positive for insulin, NKX6.1 and MAFA in conditions a and b in insulin staining.
[0214] The results by the inventor revealed that the methionine deprival and low Zn procedure are applicable for the generation of pancreatic endocrine beta like cells that are capable of GSIS activity. Studies on the 2 conditions confirmed that low RA and vitamin seem to be required for the survival of the differentiated cells, and therefore help to optimize the condition for differentiation into functional beta like cells.
[0215] The inventor then attempted to adapt the ΔMet ΔZn novel condition to previously described protocols (Pagliuca et al, 2014; (Velazco-Cruz et al., 2018). The experimental scheme is shown in
[0216] Then the yielded cells were cultured in 8 or 6 different conditions in S6. At the end of S6, glucose-stimulatory insulin secretion assay was then performed to test the functionality of the differentiated cells, under condition #1 (
[0217] Immunocytochemical analysis on day 30 revealed that the cells are positive for insulin, NKX6.1 and MAFA. Conditions a-2, c, d and A-3 under #1 and #2 gave rise to Cpep+ cells that approximately half of the Cpep+ cells coexpressed NKX6.1 or MAFA (
(B) Material and Methods
(1) Human iPS Cell Lines
[0218] Toe human iPS cell (hiPSC) line was established by Toyoda M., Kiyokawa N., Okita H., Miyagawa Y., Akutsu H. and Umezawa A. in National Institute for Child Health and Development, Tokyo. RPChiPS771 cells were obtained from REPROCELL Inc. (Tokyo) (Yoshioka et al, CSC 201). 201B7, HLA homozygote donor derived iPSCs, Ff-I01s01, Ff-I14s03, Ff-I01s04, Ff-I14s04, Ff-MHO9s01, Ff-MH15s01, Ff-MH15s02 and Ff-MH23s01, were obtained from Center for iPS Cell Research and Application, Kyoto University (CiRA).
(2) Maintenance Culture of Undifferentiated hiPSCs
[0219] Undifferentiated Toe and RPChiPS771 cells were maintained in StemFit AK02N media (Ajinomoto Co., Inc., Tokyo), and HLA homozygote donor derived iPSCs were maintained in StemFit AK03N. StemFit media were supplemented with penicillin and streptomycin. Human iPSCs were freeze thawed and cultured on 100 mm CellBIND dish (Corning Incorporated) pre-coated overnight with Synthemax II (Corning Incorporated, Cat No. 3535) in maintenance media supplemented with 10 μM Y27632 (FUJIFILM Wako Pure Chemical Corporation, Cat No. 251-00514).
(3) Medium
[0220] StemFit KA01 medium is methionine-deprived medium of StemFit AK media. StemFit (registered trademark) Basic03 is Stem Fit AK03N without component C. If not else indicated of Zn concentration, AKM medium is Zn deprived, insulin deprived medium of StemFit Basic03.
[0221] AKM (INS) medium is AKM medium+100 ng/mL insulin.
[0222] AKM (IGF) medium: AKM medium+100 ng/mL IGF1 (to substitute insulin).
[0223] AKM (INS*) medium is AKM medium+100 ng/mL insulin glulisine (Apidra (registered trademark)).
[0224] Undiff-AKM medium is AKM medium+component C.
(4) Three Dimensional Sphere Formation, Methionine Deprivation Pretreatment
[0225] Undifferentiated hiPSCs cultured on two dimensional plates pre-coated with SynthemaxII were dissociated, and replated onto 6-well suspension culture plates at a density of 5×10.sup.6 cells/well (Greiner Bio-One International GmbH, #657185), and cultured at 37° C. for 24 h to form sphere on an rotating orbital shaker at 95 rpms. Then, methionine deprivation pretreatment was done by culturing the cells for 5 h in Met-deprived StemFit KA01 medium or control complete media (StemFit KA01+100 μM methionine) (Ajinomoto Co., Inc., Tokyo), before initiation of differentiation.
(5) Cell Viability Assay and RT-PCR Analysis with Undifferentiated iPS Cells Cultured in Media Containing Various Zn Concentrations
[0226] Undifferentiated Ff-I01s01 cells were thawed and cultured in AK03N. After reaching 80-90% cell confluency, the cells were plated 2000 cells/well in 96-well plates in AK03N. On the next day, the media were switched to AKM (IGF1) at 6 different Zn concentrations+component C, and further cultured for 3 days, then assayed for cell viability using PrestoBlue (trademark) Cell Viability Reagent (Invitrogen). For real time PCR analysis, undifferentiated Ff-I01s01 cells were seeded at 1×10.sup.5 cells/well in a 6-well plate in maintenance media AK03N. On the next day, the media were changed to AKM (IGF1) at 5 different Zn concentrations, or AKM (INS*; Apidra, an insulin analogue with no Zn binding sites) at 3 different Zn concentrations+component C, then cultured for 3 days. On day 3, cells were collected, and mRNAs were extracted and subjected for real time PCR analyses using a PrimerArray (registered trademark) Embryonic Stem Cells (Takara Bio Inc.).
(6) Differentiation of iPS Cells into Pancreatic Lineage Cells
[0227] Initially, the inventor used the following protocol for differentiation (
[0228] The media used for the 5-stage β cell differentiation basically followed protocol that reported by Shahjalal et al. and Nakashima et al, with minor modifications.
[0229] Medium 1 (M1): Initiation of differentiation was done by replacing the culture with Medium 1, including DMEM with 4, 500 mg/L glucose supplemented with 3 μM CHIR99021 (Stemgent), 100 ng/mL recombinant human activin-A (Cell Guidance Systems Ltd), and 2% B27 insulin (+) supplement (Life Technologies). On days 1 and 2, the media were replaced with medium 1 without CHIR99021.
[0230] Medium 2 (M2): On days 3 and 4, the media were replaced with Medium 2, containing RPMI (Life Technologies) supplemented with 0.25 μM SANT-1 (Sigma-Aldrich Co. LLC), 50 ng/mL recombinant human FGF10 (Pepro Tech, Inc.) and 2% B27 insulin (−) supplement (Life Technologies).
[0231] Medium 3 (M3): From day 5, the media were replaced with Medium 3, containing DMEM with 4, 500 mg/L glucose supplemented with 0.25 μM SANT-1, 0.1 μM LDN193189 (Sigma-Aldrich Co. LLC), 2 μM retinoic acid (Stemgent), and 1% B27 insulin (+) supplement.
[0232] Medium 4 (M4): From day 11, the media were changed to Medium 4, including DMEM with 4, 500 mg/L glucose supplemented with 0.1 μM LDN193189, 5 μM TGF-β type I receptor kinase inhibitor II (FUJIFILM Wako Pure Chemical Corporation), 0.3 μM (−)-indolactam V (Sigma-Aldrich Co. LLC), and 1% B27 insulin (+) supplement.
[0233] Medium 5 (M5): From day 13 to day 25, cells were cultured in Medium 5, containing Knockout DMEM/F-12 (Life Technologies) supplemented with 50 ng/mL exendin-4 (Cell Sciences, Inc.), 10 mM nicotinamide (Sigma-Aldrich Co. LLC), 1 mM N-acetyl-L-cysteine (NAC) (NACALAI TESQUE, INC.), 10 μM ZnSO.sub.4 (Sigma-Aldrich Co. LLC), and 1% B27 insulin (+) supplement. From day 5, media were replaced every 2 days with fresh media and growth factors.
[0234] All media (Media 1 to 4) were supplemented with Penicillin-Steptomycin (PS; NACALAI TESQUE, INC.), MEM Non-essential amino acid (NEAA; Life Technology), and 2-Mercaptoethanol (2-ME; Sigma-Aldrich Co. LLC).
[0235] For differentiation of hiPSC from HLA homozygote donors, the media used for differentiation are as following. (version 0) (
[0236] Medium 1 (M1-AKM): Differentiation was initiated by replacing the culture with Medium 1, including StemFit AKM (Zn 0.5) (Ajinomoto Co., Inc.) supplemented with 0.5, or 3 μM ZnSO.sub.4, 3 μM CHIR99021 (Stemgent), 100 ng/mL recombinant human activin-A (Cell Guidance Systems Ltd), 100 ng/mL recombinant human IGF1 (Cell Guidance Systems Ltd). The AKM medium is StemFit AK03N medium without Supplement C. StemFit AKM (Zn0) is StemFit AKM medium further deprived of Zn.
[0237] Medium 2 (M2-AKM): On days 3 and 4, the media were replaced with Medium 2, containing StemFit AKM (Zn 0) supplemented with 0.5 μM ZnSO.sub.4, 0.25 μM SANT-1 (Sigma-Aldrich Co. LLC), 50 ng/mL recombinant human FGF10 (Pepro Tech, Inc.).
[0238] Medium 3 (M3-AKM): From day 5 to day 11, the media were replaced with Medium 3, containing StemFit (registered trademark) Basic03, 25 μM SANT-1, 0.1 μM LDN193189 (Sigma-Aldrich Co. LLC), 2 μM retinoic acid (Stemgent), 44 μg/mL vitamin C (Sigma-Aldrich, Cat No. A4544), and 10 μM Y27632.
[0239] Medium 4 (M4-AKM): From day 11 to day 12, the media were replaced with Medium 4, containing StemFit (registered trademark) Basic03 (Ajinomoto Co., Inc.) supplemented with 0.1 μM LDN193189, 5 μM TGF-β type I receptor kinase inhibitor II (FUJIFILM Wako Pure Chemical Corporation), 0.3 μM (−)-indolactam V (Sigma-Aldrich Co. LLC), 100 ng/mL recombinant human EGF (Oriental Yeast Co., ltd.), 10 mM nicotinamide (Sigma-Aldrich Co. LLC), 44 μg/mL vitamin C and 1 μM T3 (Sigma-Aldrich Co. LLC Cat No. T6397).
[0240] Medium 5 (M5-AKM): From day 13 to day 22, cells were cultured in Medium 5, containing StemFit (registered trademark) Basic03 supplemented with 50 ng/mL exendin-4 (Cell Sciences, Inc.), 10 mM nicotinamide, 1 mM N-acetyl-L-cysteine (NAC) (NACALAI TESQUE, INC.), 10 μM ZnSO.sub.4 (Sigma-Aldrich Co. LLC), 44 μg/mL vitamin C, 10 μM TGF-β type I receptor kinase inhibitor II and 1 μM T3.
(7) Single Amino Acid Deprivation
[0241] Custom made StemFit AK01 media with each amino acid deprived singly were used (Ajinomoto Co., Inc., Tokyo).
(8) Zn Deprivation from the Medium Using Chelex 100
[0242] Chelex 100 resin was prewashed following manufacturer's instructions (Bio-Rad Laboratories, Inc.). Human iPSC maintenance media 40 ml were added with prewashed Chelex 100 resin 1.2 g and incubated for 2 hr 45 min with rotation, and were filtered (0.22 μm) and quantified the metals by Ajinomoto Co., Inc. Control complete media was made by adding back all heavy metals, ZnSO.sub.4 7H.sub.2O (Sigma-Aldrich Co. LLC), Fe(NO.sub.3).sub.3 9H.sub.2O (FUJIFILM Wako Pure Chemical Corporation, Tokyo), CaCl.sub.2 (NACALAI TESQUE, INC., Kyoto), and MgSO.sub.4 (Sigma-Aldrich Co. LLC). Zn deprived medium was made by adding back the heavy metals excluding only ZnSO.sub.4 7H.sub.2O.
[0243] 201B7 undifferentiated hiPSCs were dissociated and plated at 1×10.sup.5 cells/well on SynthemaxII coated plates 6-well plates (Corning Incorporated) and cultured at 37° C. for 24 h. The cells were then washed with PBS (−) and with the medium replaced with Zn deprived or control complete medium described above, and cultured for 24 h, 48 h or 72 h, and then the cells were dissociated, cell counted and harvested.
(9) A Revised Protocol for Pancreatic Differentiation (Version 1) (FIGS. 7 and 8)
[0244] The inventor tested the previously published protocol (Pagliuca et al, 2014) using the Met, Zn deprival media AKM (IGF1/Zn0.5) or AK03Basic03 for pancreatic differentiation. The media used were as followings.
[0245] Differentiation was initiated by replacing maintenance media with M1-AKM. On day 3, media were replaced with M2-AKM. On day 5, the media were replaced with S2-2 media and cultured for 2 days (or skipped culturing in S2 media). Then on day 7 switched to S3 media and cultured for 2 days. Then on day 9, switched to S4 media. On day 14 switched to S5-1 media, and on day 17 switched to S5-2 media. On day 21 switched to S6 media. Medium components are as followings.
S2-2 medium: StemFit (registered trademark) Basic03 (FitB)+50 ng/ml KGF (FUJIFILM Wako Pure Chemical Corporation) and 44 μg/ml vitamin C.
S3 medium: StemFit (registered trademark) Basic03+50 ng/ml KGF, 0.25 μM SANT, 50 nM indolactam V, 2 μM retinoic acid (RA) and 44 μg/ml vitamin C.
S4 medium: StemFit (registered trademark) Basic03+50 ng/ml KGF, 0.25 μM SANT, 100 nM RA, 44 μg/ml vitamin C and 100 nM LDN193189.
S5-1 medium: StemFit (registered trademark) Basic03+10 μM Alk5i II, 33.3 ng/ml EGF, 10 μM DAPT (FUJIFILM WAKO PURE CHEMICAL CORPORATION, 049-33583), 1 μM L-3, 30, 5-Triiodothyronine (T3), 100 nM RA and 44 μg/ml vitamin C. S5-2 media: StemFit (registered trademark) Basic03+10 μM Alk5i II, 33.3 ng/ml EGF, 10 μM DAPT (N-[N-(3,5-Difluorophenacetyl-L-alanyl)]-S-phenylglycine tert-butyl ester), 1 μM T3, 25 nM RA.
S6 medium: StemFit (registered trademark) Basic03+10 μM Alk5i II, 1 μM T3. The inventor conducted 2 conditions as shown in
(10) A Revised Protocol for Pancreatic Differentiation (Version 2) (FIGS. 9 and 10)
[0246] The inventor tested two published protocol (Pagliuca et al, 2014, Velazco-Cruz 2019) using the Met, Zn deprival media AKM (IGF1/Zn0.5) or AK03Basic03 [AKM (INS)] for pancreatic differentiation. The media used were as followings.
[0247] Initiation of differentiation was done after 5 h complete or methionine deprivation pretreatment, by replacing maintenance media with M1-AKM. On day 3, the media were replaced with S2-AKM. On day 6, replaced with S3-AKM media and cells were cultured for 1 day. Then on day 7 switched to S4-AKM media and cultured for 5 days. Then on day 12, switched to S5 AKM media. On day 19 switched to S6 media.
[0248] 2 conditions were conducted as shown in
S2 AKM medium: AKM (IGF1/Zn0.5)+50 ng/ml KGF (FUJIFILM Wako Pure Chemical Corporation) and 44 μg/ml vitamin C.
S3 AKM medium: StemFit (registered trademark) Basic03+50 ng/ml KGF, 0.25 μM SANT, 2 μM Retinoic acid (RA) and 44 μ/ml vitamin C. For condition #1, 500 nM PdBU, 100 nM LDN193189, 10 μM Y27632 were added. For condition #2, 50 nM indolactam V was added, instead.
S4 AKM medium: StemFit (registered trademark) Basic03+50 ng/ml KGF, 0.25 μM SANT, 100 nM RA and 44 μg/ml vitamin C. For condition #1, activin A (100 μg/ml) and 10 μM Y27632 were added. For condition #2, 100 nM LDN193189 was added instead.
S5-1 AKM medium: StemFit (registered trademark) Basic03+10 μM Alk5i II, 1 μM L-3, 30, 5-Triiodothyronine (T3), 100 nM RA and 44 μg/ml vitamin C. For condition #1, 20 ng/ml betacellulin, 1 μM GSXXi were added. For condition #2, 33.3 ng/ml EGF, 10 μM DAPT were used instead.
S5-2 AKM media: StemFit (registered trademark) Basic03+10 μM Alk5i II, 1 μM T3, 25 nM RA and 44 μg/ml vitamin C. For condition #1, 20 ng/ml betacellulin, 1 μM GSXXi were added. For condition #2, 33.3 ng/ml EGF and 10 μM DAPT were used instead.
[0249] For S6 AKM medium, 6-8 conditions were tested.
a-1: StemFit (registered trademark) Basic03+10 μM Alk5i, 1 μM T3.
a-2: StemFit (registered trademark) Basic03+10 μM ZnSO.sub.4, Trace Elements A & B.
A-3: AKM (INS*)+10 μM ZnSO.SUB.4..
[0250] A-4: AKM (INS*)+10 μM ZnSO.sub.4, 1 mM NAC, 10 μM Y27632, 50 ng/mL exendin-4, Trace Elements A & B.
b-1: CMRL+fetal bovine serum, 10 μM Alk5i, 1 μM T3.
b-2: CMRL+fetal bovine serum, 10 μM ZnSO.sub.4, Trace Elements A & B.
c: Essential 6+10 μM Alk5i, 1 μM T3, 10 mM nicotinamide, 1 mM N-acetyl-L-cysteine (NAC), 50 ng/mL exendin-4, 10 μM ZnSO.sub.4.
d: MCDB+0.046% glucose, bovine serum albumin (BSA), Glutamax, NEAA, 10 μM ZnSO.sub.4, 10 μg/ml heparin, 44 μg/ml vitamin C, Trace Elements A & B.
(11) Endoderm Differentiation of Human iPS Cells Under Different Zn Concentrations in AKM Media Containing IGF1, IGF2 or Insulin
[0251] Undifferentiated Ff-I01s01 cultured on SynthemaxII-coated plate using AK03N were dissociated, and replated onto 6-well suspension culture plates at a density of 5×10.sup.6 cells/well, and cultured at 37° C. for 24 h to form sphere while rotating on a rotating orbital shaker at 95 rpms. Initiation of differentiation was done by replacing AK03N with M1-StemFit (registered trademark) Basic03 or M1-AKM, with IGF1, IGF2 or INS*, supplemented with Zn at different Zn concentration.
[0252] The concentrations of Zn used on day 1, day 2 and day 3 are indicated as (x_y_z) μM. For gene expression analysis, on day 3, cells were collected and mRNAs were extracted and subjected for real time PCR analyses using specific primers listed in PrimerArray (registered trademark) Embryonic Stem Cells (ACTB, GAPDH, POU5F1, SOX2, NANOG, CD34, PAX6, GATA4 and GATA6), or made by Takara Bio Inc. in a custom order (GBX2). The primer sequences of GBX2 were as follows: forward primer, CAGGCAATGCCAATTCCAAG (SEQ ID No: 29); reverse primer, CCTGTTCTAGCTGCTGATGCTGAC (SEQ ID No: 30).
(12) Human Pancreatic Islets
[0253] Non-diabetic human pancreatic islets were obtained from Prodo Laboratories, Inc., and cultured in Prodo Islet Medium (Prodo Laboratories, Inc.). Donor information is as follows. Age, 56; gender, male; ethnicity, Caucasian; body mass index, 13.7; diabetes, no history; and hemoglobin A1c, 5.0%.
(13) Zn and Heavy Metal Content Analysis
[0254] Intracellular free and protein bound heavy metal (Zn, Co, Fe, Mg, Ca) contents were measured using High Performance Liquid Chromatography (HPLC) coupled to ICP-MS (Inductively Coupled Plasma-Mass Spectrometry) (HPLC-ICP-MS) in Ajinomoto Co., Inc. as previously described (Arakawa et al, 2016). Contents of heavy metals in the medium were measured before and after chelex100 treatment, then added back. However, Zn was not added in production of ΔZn medium.
(14) Immunocytochemistry
[0255] Cells were fixed in 4% paraformaldehyde (NACALAI TESQUE, INC.) in PBS, permeabilized with 0.1% Triton X-100 (NACALAI TESQUE, INC.), and were then blocked with 20% Blocking One (NACALAI TESQUE, INC., Japan) in PBST (0.1% Tween-20 in PBS). Antibodies were diluted in 20% Blocking One (NACALAI TESQUE, INC., Japan) in PBST (0.1% Tween-20 in PBS). Cells were counterstained with 6-diamidino-2-phenylindole (DAPI) (Roche Diagnostics K.K., Switzerland).
[0256] The following primary antibodies were used: mouse anti-Oct3/4 (Santa Cruz Biotechnology, Inc.), goat anti-Sox17 (R&D Systems, Inc.), goat anti-PDX1 (R&D Systems, Inc.), guinea pig anti-insulin (Dako), rabbit anti-C-peptide (Cell Signaling Technology, Inc.), and mouse anti-Nkx6.1 (Developmental Studies Hybridoma Bank). Secondary antibodies used were Alexa 488-conjugated donkey anti-mouse IgG antibodies, Alexa 488-conjugated donkey anti-guinea pig IgG antibodies, Alexa 488-labeled donkey anti-rabbit IgG antibodies, Alexa 568-labeled donkey anti-goat IgG antibodies, and Alexa 568-labeled donkey anti-mouse IgG antibodies (Invitrogen). Positive cells versus total cells (DAPI-positive cells) were quantified using ImageXpress Micro cellular imaging system (Molecular Devices, LLC.).
(15) Real Time RT-PCR Analysis
[0257] RNA was extracted from iPS cells using the RNeasy micro-kit, or All prep (DNA/RNA) Micro Kit (QIAGEN K.K., Germany) and then treated with DNase (QIAGEN K.K.). For reverse transcription reactions, 1 μg RNA was reverse-transcribed using PrimeScript (registered trademark) RT Master Mix (Takara Bio Inc., Japan). For real-time PCR analysis, the mRNA expression was quantified with SyberGreen on a StepOne Plus (Applied Biosystems, Foster City, Calif.). The PCR conditions were as follows: Initial denaturation at 95° C. for 30 sec, followed with denaturation at 95° C. for 5 sec, annealing and extension at 60° C. for 30 sec, for up to 40 cycles. Target mRNA levels were expressed as arbitrary units and were determined using the ΔΔ CT method.
[0258] PrimerArray Embryonic Stem Cells (Human) (TaKaRa Bio Inc., #PH016, Kyoto) containing primer pairs optimized for real-time RT-PCR analysis of 88 genes associated with pluripotency and self-renewal of embryonic stem cells and 8 housekeeping genes, were used.
[0259] Primer sequences for SLC30A and SLC39A genes are listed in the following table and SEQ ID Nos: 1 to 28.
TABLE-US-00001 TABLE 1 Gene Forward Reverse GAPDH GCACCGTCAA TGGTGAAGAC GGCTGAGAAC GCCAGTGGA SLC30A1 CACCAGGAGG TCACCACTTC AGACCAACAC TGGGTTTTC SLC30A5 TTTCAGCATA GCACGCCATAGA GCTCTTCAAT ATAATTCCACAA CGATCC SLC30A6 TTGGAACAGCC CATCGTGAACAGG CGAGATACACA TTGAAACAAAGA SLC30A7 GCTGGACTGGC CCAGCCAGAACT AGCTTCTGTTA TCCGCTCTA SLC30A9 GCCACTTGCAT CTGGATGGACC GGGCCTTAC GCCCTAAGA SLC39A1 CCTGACTACCT GGATGAACTCTT GGCTGCCATA GCAGTGGGAAC SLC39A6 GGTGATGGCCT TTAACGGTCATG GCACAATTTC CCAGCCTTTAG SLC39A7 ACTTTGCCATC ACGTAGATAAAGC TTGGTCCAGTC CACCTGCAGTAA SLC39A8 CCTAAAGCATT TCGCAGAGCGT ACCTGCCATCAA TATCATCCA SLC39A9 ATGTTACGTGG TGCCAGAGCAG CCGGAATCA TTCCACAGAG SLC39A10 TCTGTCATGAAC CATACTGACCAA TGCCACATGAA CAGCTGTGCCTA SLC39A11 GGGCAGCTCTC GCAGCAAAGCC GTGTTCGTA AAGACTTCCCA SLC39A14 CTACTTCATAGCT CACCACTGCAGAC CTGGCGATTGGA TTGGAGAGATAA
(16) Affymetrix Microarray Analysis
[0260] Human iPSC-derived differentiated cells on differentiation day 3 DE cells, differentiation day 5 PG cells, differentiation day 11 PP cells, and differentiation day 25 EC cells were compared, using GeneChip (registered trademark) Human Gene 2.0 ST Array (Applied Biosystems). Expression profile of undifferentiated human ESCs (KhES3), or 201B7 hiPSCs cultured under methionine deprivation or control complete medium were compared using GeneChip (registered trademark) Human Genome U133 Plus 2.0 Array (Applied Biosystems), GeneChip (registered trademark) Human Gene 2.0 ST Array (Applied Biosystems), or Human Transcriptome Array (HTA) 2.0 (Applied Biosystems). Comparison #1 201B7_CSTI7_ST Array and #2 khES3_CSTI7_U133 Array (GSE55285): cells were cultured on matrigel-coated dish with ReproFF (ReproCELL Inc.) and cultured in control complete CSTI-7 medium (Cell Science & Technology Institute, Inc.) or Met-deprived CSTI-7 medium for 5 h. Comparison #3 201B7_StemFit_HTA: cells were cultured on SynthemaxII-coated dish with control complete AK02N or Met-deprived StemFit media (KA01).
(17) Principal Component Analysis
[0261] A Principal Component Analysis (PCA) was performed, to visualize the results and map the expression profile among undifferentiated cells, hiPSC-derived differentiated cells on differentiation day 3 DE cells, differentiation day 5 PG cells, differentiation day 11 PP cells, and differentiation day 25 EC cells (
(18) C-Peptide Release and Content Assay
[0262] The C-peptide release and content assay was performed as described previously (Sakano et al., 2014) with minor modifications. Briefly, differentiated cells were pre-incubated at 37° C. for 2 h with low glucose media, DMEM (Life Technologies) containing 3 mM glucose and 0.2% BSA. Cells were washed twice with PBS and then incubated at 37° C. for 1 h with low glucose medium. The culture medium was collected, and the same cells were further incubated with high glucose medium, DMEM containing 20 mM glucose and 0.2% BSA, at 37° C. for another 1 h. The culture solution was collected and stored at −80° C. until analysis. Next, the cells were lysed and purified both RNA and DNA using AllPrep DNA/RNA Micro Kit (QIAGEN K.K.).
[0263] C-peptide secretion into the culture media were measured using the human C-peptide ELISA Kit (FUJIFILM Wako Shibayagi Corporation, Japan). The amount of C-peptide was normalized to the amount of total DNA contents in the corresponding cell lysate.
(19) New GSIS Method
[0264] Differentiated cells were loaded on Transwell (Corning Incorporated, #3415) and then pre-incubated 4×10 min+30 min at 37° C. in low glucose (3 mM) HKRB buffer (HEPES Krebs-Ringer Bicarbonate buffer, Cosmo Bio Co., Ltd.) with 0.2% BSA, on an orbital shaker (70 rpm). The buffer was collected (low glucose), and the same cells were further incubated in high glucose (20 mM) HKRB buffer with 0.2% BSA, at 37° C. on an orbital shaker (70 rpm) for another 1 h. During 1 h incubation in high glucose buffer, 10% of supernatant was collected at 10 and 30 min, and then added back same volumes of high glucose buffer. Collected culture supernatant was stored at −30° C. until analysis. Next, cells were lysed, and RNA and DNA were purified using AllPrep DNA/RNA Micro Kit (QIAGEN K.K.). C-peptide secretion was measured using a human C-peptide ELISA Kit (Mercodia AB). The amount of C-peptide was normalized to the amount of total DNA contents in the corresponding cell lysate.
(20) Statistics
[0265] Data are expressed as the mean±SEM. Differences between groups were analyzed by Student's t-tests or one-way ANOVA and Dunnett's multiple comparisons test. The statistical analyses and P-values thereof are noted in legends of their respective figures. p<0.05, **p<0.01 or ***p<0.005 by Student's t-test; .sup.§ P<0.05 or .sup.§§ P<0.01, by one-way ANOVA and Dunnett's multiple comparisons test, are considered to be significant.
REFERENCES
[0266] Andrews, G. K., Wang, H., Dey, S. K., and Palmiter, R. D. (2004). Mouse zinc transporter 1 gene provides an essential function during early embryonic development. Genesis 40, 74-81. [0267] Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami, M., Takahashi, K., Maruyama, M., Maeda, M., and Yamanaka, S. (2003). The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell 113, 631-642. [0268] Nakashima, R., Morooka, M., Shiraki, N., Sakano, D., Ogaki, S., Kume, K., and Kume, S. (2015). Neural cells play an inhibitory role in pancreatic differentiation of pluripotent stem cells. Genes Cells 1028-1045. [0269] Shahjalal, H. M., Shiraki, N., Sakano, D., Kikawa, K., Ogaki, S., Baba, H., Kume, K., and Kume, S. (2014). Generation of insulin-producing β-like cells from human iPS cells in a defined and completely xeno-free culture system. J. Mol. Cell Biol. 0, 1-15. [0270] Shi, Z. D., Lee, K., Yang, D., Amin, S., Verma, N., Li, Q. V., Zhu, Z., Soh, C. L., Kumar, R., Evans, T., et al. (2017). Genome Editing in hPSCs Reveals GATA6 Haploinsufficiency and a Genetic Interaction with GATA4 in Human Pancreatic Development. Cell Stem Cell 20, 675-688.e6. [0271] Sugita, S., Iwasaki, Y., Makabe, K., Kimura, T., Futagami, T., Suegami, S., and Takahashi, M. (2016). Lack of T Cell Response to iPSC-Derived Retinal Pigment Epithelial Cells from HLA Homozygous Donors. Stem Cell Reports 7, 619-634. [0272] Takahashi, K., and Yamanaka, S. (2016). A decade of transcription factor-mediated reprogramming to pluripotency. Nat. Rev. Mol. Cell Biol. 17, 183-193. [0273] Yoshioka, N., Gros, E., Li, H. R., Kumar, S., Deacon, D. C., Maron, C., Muotri, A. R., Chi, N. C., Fu, X. D., Yu, B. D., et al. (2013). Efficient generation of human iPSCs by a synthetic self-replicative RNA. Cell Stem Cell 13, 246-254. [0274] Zhu, S., Russ, H. A., Wang, X., Zhang, M., Ma, T., Xu, T., Tang, S., Hebrok, M., and Ding, S. (2016). Human pancreatic beta-like cells converted from fibroblasts. Nat. Commun. 7, 10080.
[0275] All publications, patents, and patent applications cited in this specification are incorporated herein by reference as they are.
INDUSTRIAL APPLICABILITY
[0276] The present invention is a method for promoting differentiation of pluripotent stem cells into cells of pancreas, liver, intestine, and the like and thus can be used in the industrial field using such cells.