Multicopper oxidase mutant with improved salt tolerance
11008552 · 2021-05-18
Assignee
Inventors
- Fang Fang (Wuxi, CN)
- Tao Yang (Wuxi, CN)
- Jingwen Zhou (Wuxi, CN)
- Jian Chen (Wuxi, CN)
- Guocheng Du (Wuxi, CN)
- Jie Xu (Wuxi, CN)
Cpc classification
International classification
Abstract
The present disclosure provides a multicopper oxidase mutant with improved salt tolerance. Threonine at site 317 of wild-type multicopper oxidase WT was mutated to asparagine, leucine at site 386 was mutated to tyrosine, and serine at site 427 was mutated to glutamic acid by site-directed mutagenesis to obtain a mutant T317N-L386Y-S427E. Compared with WT, the tolerance of T317N-L386Y-S427E to 6%, 9%, 12%, 15% and 18% NaCl (W/V) is improved.
Claims
1. A multicopper oxidase mutant, wherein: (a) the multicopper oxidase mutant comprises the amino acid sequence SEQ ID NO:1, or (b) the multicopper oxidase mutant comprises the amino acid sequence SEQ ID NO:1 with residue number 110 mutated to glutamic acid (A110E), and wherein the multicopper oxidase mutant possesses oxidase enzymatic activity.
2. A method for producing a multicopper oxidase mutant comprising: inoculating a genetically engineered bacterium transformed with a gene encoding a multicopper oxidase mutant of claim 1 into a medium; inducing the genetically engineered bacterium to express the gene; collecting the genetically engineered bacterium; disrupting the genetically engineered bacterium; and purifying the multicopper oxidase mutant from the disrupted genetically engineered bacterium.
3. The method according to claim 2, which further comprises: adding the purified multicopper oxidase mutant to a food, thereby removing biogenic amines in the food by degradation.
4. The method according to claim 3, wherein the food comprises soy sauce.
5. The method according to claim 3, wherein the biogenic amine comprises at least one of tryptamine, phenethylamine, putrescine, cadaverine, histamine, tyramine, spermine and spermidine.
Description
BRIEF DESCRIPTION OF FIGURES
(1)
(2)
(3)
DETAILED DESCRIPTION
(4) PrimerSTAR DNA polymerase and Solution I DNA ligase were purchased from TaKaRa Company (Dalian); EcoR I, Hind III, DpnI rapid restriction enzymes and DNA recovery kits were purchased from Thermo Fisher Scientific Company (USA); plasmid extraction kits and kanamycin were purchased from Sangon Biotech (Shanghai) Co., Ltd.; ABTS was purchased from aladdin Company. All other reagents are analytically pure reagents.
(5) Reaction system and method for determining activity of multicopper oxidase:
(6) The activity of multicopper oxidase was determined by a visible light absorptiometry: by using ABTS as a substrate, the activity of the multicopper oxidase was calculated by detecting the absorbance of reaction system after the enzyme reacting with the substrate for 2 min by using a reaction kinetics instrument. The reaction system includes 100 μL of an enzyme solution, 2900 μL of a citric acid-sodium citrate buffer (the citric acid-sodium citrate buffer contains 0.5 mM of ABTS and 1 mM of CuCl.sub.2). The reaction temperature and pH adopt the optimum temperature and optimum pH of the enzyme. The amount of enzyme required to catalyze 1 μmol of substrate per minute to oxidize is defined as an activity unit (U).
(7)
(8) where:
(9) ε: Molar absorptivity of ABTS at 420 nm, ε=3.6×10.sup.4 M.sup.−1 cm.sup.−1
(10) Δt: 2 min;
(11) DOD: Change value of absorbance OD.sub.420 within 2 min;
(12) V1: Total volume of a reaction solution in an enzyme reaction system, that is, 3 mL;
(13) V2: Volume of an enzyme solution in the enzyme reaction system, that is, 100 μL.
Example 1: Construction of Recombinant Bacteria
(14) A plasmid pET28a(+) carrying a T7 promoter was selected as an expression vector, and the pET28a(+) plasmid and an mcob gene, obtained by amplifying, encoding the unmutated multicopper oxidase were separately subjected to EcoR I and Hind III double enzyme digestion, the digested product was subjected to gel extraction, and then ligated with the DNA ligase Solution I overnight, the ligated product was transformed into E. coli JM109 competent cells, and cultured at 37° C. for 10 h, and positive transformants were identified by colony PCR.
(15) Three positive transformants were picked and inoculated in LB broth (containing 50 μg/mlkanamycin), and cultured at 37° C. for 10 h, and the plasmid was extracted to be validated by sequencing. The plasmid pET28a(+)-MCOB with correct sequence was transformed into E. coli BL21 (DE3), and then plated on LB agar containing 50 μg/mlkanamycin, and cultured at 37° C. for 10 h. Single colonies of transformants were picked, named BL21(DE3)-pET28a(+)-MCOB and inoculated in LB broth containing 50 μg/mlkanamycin, and cultured at 37° C. for 10 h, and the bacterial culture was mixed with sterile glycerol and stored at −80° C. The multicopper oxidase expressed by BL21(DE3)-pET28a(+)-MCOB was named as WT.
Example 2: Preparation of Mutant T317N-L386Y
(16) (1) Preparation of Mutant T317N
(17) According to the gene sequence of multicopper oxidase of B. amyloliquefaciens, primers for introducing T317N mutation were designed and synthesized, and an expression vector pET28a(+)-MCOB was used as a template by a rapid PCR technology.
(18) Primers for introducing the T317N mutation by site-directed mutagenesis were:
(19) TABLE-US-00001 SEQ. ID NO: 3: Forward primer: 5′-TTTTAAACAACGGCACCGGCTG-3′(the underline represents a mutated base) SEQ. ID NO: 4: Reverse primer: 5′-GTGCCGTTGTTTAAAATAATATGTTCTCCG-3′(the underline represents a mutated base)
(20) PCR reaction system: 25 μL of 2× PrimerSTAR DNA polymerase, 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 1 μL of template DNA, and 22 μL of ddH.sub.2O.
(21) PCR amplification conditions: pre-denature at a temperature of 95° C. for 3 min; followed by 30 cycles (95° C. 30 s, 55° C. 30 s, and 72° C. 7 min); supplement and extend at a temperature of 72° C. for 10 min.
(22) The PCR product was digested with DpnI and transformed into the E. coli BL21(DE3) competent cells. Monoclones were selected for sequencing. A strain with correct sequencing results was mixed with sterile glycerol and stored at −80° C. The strain was named BL21(DE3)-pET28a(+)-T317N. The multicopper oxidase mutant expressed by this strain was named T317N.
(23) (2) Preparation of Mutant T317N-L386Y
(24) According to the gene sequence of multicopper oxidase of B. amyloliquefaciens, primers introducing L386Y mutation were designed and synthesized, and a vector carrying a gene encoding the mutant T317N was used as a template by a rapid PCR technology.
(25) Site-directed mutagenesis primers introducing the L386Y mutation were:
(26) TABLE-US-00002 SEQ. ID NO: 5: Forward primer: 5′-GCCGGTTTATACGCTCAATAACAAGC-3′(the underline represents a mutated base) SEQ. ID NO: 6: Reverse primer: 5′-GTTATTGAGCGTATAAACCGGCCGG-3′(the underline represents a mutated base)
(27) PCR reaction system: 25 μL of 2× PrimerSTAR DNA polymerase, 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 1 μL of template DNA 1 μL, and 22 μL of ddH.sub.2O.
(28) PCR amplification conditions: pre-denature at 95° C. for 3 min; followed by 30 cycles (95° C. 30 s, 55° C. 30 s, and 72° C. 7 min); supplement and extend at 72° C. for 10 min.
(29) The PCR product was digested with DpnI and transformed into the E. coli BL21(DE3) competent cells. Monoclones were selected for sequencing. A strain with correct sequencing results was mixed with sterile glycerol and stored at −80° C. The strain was named BL21(DE3)-pET28a(+)-T317N-L386Y. The multicopper oxidase mutant expressed by this strain was named T317N-L386Y.
Example 3: Preparation of Mutant T317N-L386Y-S427E and T317N-L386Y-A110E
(30) (1) Preparation of Mutant T317N-L386Y-S427E
(31) According to the gene sequence of multicopper oxidase of B. amyloliquefaciens, primers introducing S427E mutation were designed and synthesized, and a vector carrying a gene encoding the mutant T317N-L386Y was used as a template by a rapid PCR technology.
(32) Site-directed mutagenesis primers introducing the S427E mutation were:
(33) TABLE-US-00003 SEQ. ID NO: 7: Forward primer: 5′-CACCTGCACTTGGTTGAGTTCCAAGTCCTTGACCGG-3′(the underline represents a mutated base) SEQ. ID NO: 8: Reverse primer: 5′-CAAGGACTTGGAACTCAACCAAGTGCAGGTGTATCGG-3′(the underline represents a mutated base)
(34) PCR reaction system: 25 μL of 2× PrimerSTAR DNA polymerase, 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 1 μL of template DNA, and 22 μL of ddH.sub.2O.
(35) PCR amplification conditions: pre-denature at 95° C. for 3 min; followed by 30 cycles (95° C. 30 s, 55° C. 30 s, and 72° C. 7 min); supplement and extend at 72° C. for 10 min.
(36) The PCR product was digested with DpnI and transformed into the E. coli BL21(DE3) competent cells. Monoclones were selected and sent to Shanghai Sangon Biotech for sequencing. A strain with correct sequencing results was mixed with sterile glycerol and stored at −80° C. The strain was named BL21(DE3)-pET28a(+)-T317N-L386Y-S427E. The multicopper oxidase mutant expressed by this strain was named T317N-L386Y-S427E.
(37) (2) Preparation of Mutant T317N-L386Y-A110E
(38) According to the gene sequence of multicopper oxidase of B. amyloliquefaciens, primers introducing A110E mutation were designed and synthesized, and a vector carrying a gene encoding the mutant T317N-L386Y was used as a template by a rapid PCR technology.
(39) Site-directed mutagenesis primers introducing the A110E mutation were:
(40) TABLE-US-00004 SEQ. ID NO: 9: Forward primer: 5′- TTACACGGAGGAGAAACGCCG -3′(the underline represents a mutated base) SEQ. ID NO: 10: Reverse primer: 5′- GTTTCTCCTCCGTGTAAATGGACG -3′(the underline represents a mutated base)
(41) PCR reaction system: 25 μL of 2× PrimerSTAR DNA polymerase, 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 1 μL of template DNA, and 22 μL of ddH.sub.2O.
(42) PCR amplification conditions: pre-denature at 95° C. for 3 min; followed by 30 cycles (95° C. 30 s, 55° C. 30 s, and 72° C. 7 min); supplement and extend at 72° C. for 10 min.
(43) The PCR product was digested with DpnI and transformed into the E. coli BL21(DE3) competent cells. Monoclones were selected and sent to Shanghai Sangon Biotech for sequencing. A strain with correct sequencing results was mixed with sterile glycerol and stored at −80° C. The strain was named BL21(DE3)-pET28a(+)-T317N-L386Y-A110E. The multicopper oxidase mutant expressed by this strain was named T317N-L386Y-A110E.
Example 4: Preparation of Mutant T317N-L386Y-S427E-A110E
(44) According to the gene sequence of multicopper oxidase of B. amyloliquefaciens, primers introducing A110E mutation were designed and synthesized, and a vector carrying a gene encoding the mutant T317N-L386Y-S427E was used as a template by a rapid PCR technology.
(45) Site-directed mutagenesis primers introducing the A110E mutation were:
(46) TABLE-US-00005 SEQ. ID NO: 11: Forward primer: 5′- TTACACGGAGGAGAAACGCCG -3′(the underline represents a mutated base) SEQ. ID NO: 12: Reverse primer: 5′- GTTTCTCCTCCGTGTAAATGGACG -3′(the underline represents a mutated base)
(47) PCR reaction system: 25 μL of 2× PrimerSTAR DNA polymerase, 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 1 μL of template DNA, and 22 μL of ddH.sub.2O.
(48) PCR amplification conditions: pre-denature at 95° C. for 3 min; followed by 30 cycles (95° C. 30 s, 55° C. 30 s, and 72° C. 7 min); supplement and extend at 72° C. for 10 min.
(49) The PCR product was digested with DpnI and transformed into the E. coli BL21(DE3) competent cells. Monoclones were selected and sent to Shanghai Sangon Biotech for sequencing. A strain with correct sequencing results was mixed with sterile glycerol and stored at −80° C. The strain was named BL21(DE3)-pET28a(+)-T317N-L386Y-S427E-A110E. The multicopper oxidase mutant expressed by this strain was named T317N-L386Y-S427E-A110E.
Example 5: Expression and Purification of Mutant T317N-L386Y-S427E
(50) BL21(DE3)-pET28a(+)-T317N-L386Y-S427E was inoculated in LB broth containing 50 μg/ml kanamycin, and cultured at of 37° C. and 220 rpm for 10 h, a seed culture was inoculated into TB broth containing 50 μg/ml kanamycin with 2% of inoculation size, and cultured at a 37° C. and 220 rpm until OD.sub.600 was equal to 0.6 to 0.8, then added with 0.1 mM of IPTG and 1 mM of CuCl.sub.2, and induced at 20° C. and 220 rpm for 20 to 22 h. The obtained fermentation broth was centrifuged at 4° C. and 8000 r/min for 15 min, and the cells were collected, and washed twice with a 20 mM phosphate buffer of pH 7.0, and then the cells were resuspended with the phosphate buffer. The suspension was placed on ice, and the cells were disrupted by sonication (35% power, oscillating for 2 s and stopping for 4 s) until the solution was clear. The solution was centrifuged at 4° C. and 10000 r/min for 30 min and the supernatant was collected, namely, a crude enzyme solution. The crude enzyme solution was filtered through a 0.22 μm filter and purified by HisTrap FF affinity column to obtain a pure enzyme. After determining, the specific enzyme activity was 5.58 U/mg.
(51) The recombinant bacteria BL21(DE3)-pET28a(+)-MCOB (WT), BL21(DE3)-pET28a(+)-T317N-L386Y, BL21(DE3)-pET28a(+)-T317N-L386Y-A110E and BL21(DE3)-pET28a(+)-T317N-L386Y-S427E-A110E were fermented and cultured according to the above method, and were isolated to obtain unmutated multicopper oxidase (WT) and mutant T317N-L386Y, T317N-L386Y-A110E and T317N-L386Y-S427E-A110E.
Example 6: Determination of Activity and Analysis of Enzymatic Properties of Multicopper Oxidase
(52) (1) Effect of Temperatures on Activity of Multicopper Oxidase
(53) The activities of multicopper oxidase obtained by purifying and the substrate were determined by a visible light absorptiometry at different temperatures (40, 45, 50, 55, 60 and 65° C.). The relative activity at each temperature was calculated according to 100% of the highest activity so as to determine the optimum reaction temperature of the enzyme. The results showed that the optimum reaction temperatures of WT, T317N-L386Y, T317N-L386Y-S427E, T317N-L386Y-A110E and T317N-L386Y-S427E-A110E were all 55° C.
(54) (2) Effect of pH on Activity of Multicopper Oxidase
(55) At an optimum temperature of 55° C., the activities of the enzyme at different pH (2.5, 3.0, 3.5, 4.0, 4.5 and 5.0) were determined by the visible light absorptiometry. The relative activity at each pH was calculated according to 100% of the highest activity so as to determine the optimum reaction pH. The results showed that the optimum reaction pH of WT, T317N-L386Y, T317N-L386Y-S427E, T317N-L386Y-A110E and T317N-L386Y-S427E-A110E were all pH 3.0, while the relative activity of T317N-L386Y, T317N-L386Y-S427E, T317N-L386Y-A110E and T317N-L386Y-S427E-A110E at pH 4.0 all increased compared with WT.
(56) (3) Determination of Catalytic Parameters of the Multicopper Oxidase
(57) The purified enzyme WT, T317N-L386Y, T317N-L386Y-S427E, T317N-L386Y-A110E or T317N-L386Y-S427E-A110E was mixed with citric acid-sodium citrate buffer (the citric acid-sodium citrate buffer contains ABTS and 1 mM of CuCl.sub.2) to obtain the reaction system. The reaction system includes 100 μL of an enzyme solution, 2900 μL of a citric acid-sodium citrate buffer. Concentration of ABTS changed from 0.250 to 0.025 mM intervals of 0.025 mM. The reaction temperature and pH adopt the optimum temperature (55° C.) and optimum pH (3.0) of the enzyme. The activity of the multicopper oxidase was calculated by detecting the absorbance of the reaction system after enzyme reacting with the substrate for 2 min by using a reaction kinetics instrument. Furthermore, the Km, Kcat and Kcat/Km were calculated by Lineweaver-Burk plot.
(58) The amount of enzyme required to catalyze 1 μmol of substrate per minute to oxidize is defined as an activity unit (U). As shown in Table 1, compared with WT, the Kcat/Km of T317N-L386Y-A110E decreased 0.13 times, the Kcat/Km of T317N-L386Y-S427E-A110E decreased 0.31 times, while the Kcat/Km of T317N-L386Y and T317N-L386Y-S427E increased 1.15 times and 0.95 times.
(59) TABLE-US-00006 TABLE 1 Catalytic parameters of the multicopper oxidase Specific Km Kcat Kcat/Km activity Enzyme (μM) (S.sup.−1) (S.sup.−1 .Math. mM.sup.−1) (U/mg) WT 507.21 3.72 7.33 3.33 T317N-L386Y 335.35 5.31 15.83 5.79 T317N-L386Y-S427E 338.94 4.85 14.30 5.58 T317N-L386Y-A110E 534.79 3.40 6.38 2.84 T317N-L386Y-S427E-A110E 568.34 2.91 5.12 2.43
(60) (4) Effect of NaCl on Activity of Multicopper Oxidase
(61) 100 μL of WT, T317N-L386Y, T317N-L386Y-S427E, T317N-L386Y-A110E and T317N-L386Y-S427E-A110E purified by HisTrap FF affinity column were placed in 2 mL of a phosphate buffer containing 3%, 6%, 9%, 12%, 15% and 18% NaCl (W/V, g/100 mL), the initial activity was determined immediately, the remaining activity was determined after being placed at a temperature of 4° C. for 1 h, and the relative activity was equal to the remaining activity divided by the initial activity. The activity was determined at 55° C. and pH 3.0. After T317N-L386Y-S427E, T317N-L386Y, T317N-L386Y-A110E, T317N-L386Y-S427E-A110E and WT were treated for 1 h in 3% NaCl (W/V), the activities were almost not lost; after T317N-L386Y-S427E, T317N-L386Y, T317N-L386Y-A110E, T317N-L386Y-S427E-A110E and WT were treated for 1 h in 6%, 9%, 12%, 15% and 18% NaCl (W/V), the remaining activity of T317N-L386Y, T317N-L386Y-A110E and T317N-L386Y-S427E-A110E did not change much compared with WT, while the remaining activity of T317N-L386Y-S427E was higher than that of WT, indicating that the salt tolerance of the mutant T317N-L386Y-S427E was improved compared with WT. (See Table 2).
(62) TABLE-US-00007 TABLE 2 Effect of NaCl on activities of WT and mutants NaCl (%) 3 6 9 12 15 18 WT 99.5% 83.5% 64.5% 53.0% 37.3% 31.4% T317N-L386Y 98.2% 84.0% 63.5% 51.0% 35.4% 33.2% T317N-L386Y- 99.9% 100.0% 76.0% 67.5% 60.3% 41.5% S427E T317N-L386Y- 98.1% 82.2% 58.0% 48.4% 41.5% 29.1% A110E T317N-L386Y- 100.0% 91.5% 62.7% 52.4% 44.5% 33.4% S427E-A110E