Poly(3-hydroxypropionate-b-lactate) block copolymer using microorganisms

11845973 · 2023-12-19

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a novel 3-hydroxypropionate-lactate block copolymer [P(3HP-b-LA)], and a method for preparing same, and more specifically, provides a method for preparing a 3-hydroxypropionate-lactate block copolymer, and a 3-hydroxypropionate-lactate block copolymer produced thereby, the method comprising: a first culture step in which, by using recombinant E. coli improved so as to be incapable of biosynthesizing lactic acid, P(3HP) is biosynthesized at the early stage of culturing by having glycerol as a carbon source and through 3-hydroxypropionate-generating genes and an enhanced PHA synthase; and a second culture step in which P(3HP) production is inhibited by using a carbon catabolic repression system for selectively introducing only glucose into E. coli when glycerol and glucose are supplied together as carbon sources, and in which polylactate is biosynthesized to an interrupted P(3HP) terminus by the enabling of the expression of a lactate synthase and a lactyl-CoA converting enzyme through an IPTG induction system.

Claims

1. A 3-hydroxypropionate-lactate block copolymer [P(3HP-b-LA)] containing lactate and 3-hydroxypropionate as repeat units, wherein the 3-hydroxypropionate-lactate block copolymer [P(3HP-b-LA)] has a lactate monomer content of 10 mol % or more.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a diagram showing a preparation method and a cleavage map of pCDFJ23 vector.

(2) FIG. 2 is a diagram showing a preparation method and a cleavage map of pCDFJ23-dhaB123-gdrAB-pduP-reC_GK.

(3) FIG. 3 is a diagram showing a preparation method and a cleavage map of pTrcHisB-ldhD-CPPCT540.

(4) FIG. 4 is a graph showing the results of DSC analysis of the P(3HP-h-LA) block copolymer according to the present invention.

(5) FIG. 5 is a graph showing the results of DSC analysis of P(3HP-r-LA) random copolymer.

(6) FIG. 6 is a diagram showing a preparation method and a cleavage map of pBlue-re_GK-CPPCT540 vector for the preparation of a P(3HP-r-LA) random copolymer.

DETAILED DESCRIPTION OF THE EMBODIMENTS

(7) Hereinafter, preferred embodiments of the present invention will be described in more detail to facilitate understanding of the invention. However, these examples are presented for illustrative purposes only and are not intended to limit the scope of the present invention.

Example 1. Preparation of Recombinant Vector for Preparation of 3-Hydroxypropionate-Lactate Block Copolymer

(8) All DNA cloning experiments were performed according to standard methods (see J. Sambrook, E. F. Fritsch, T. Maniatis, Molecular Cloning. A laboratory Manual, 2 nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989).

(9) 1-1. Preparation of pCDFJ23-dhaB123-gdrAB-pduP-reC_GK Recombinant Vector

(10) pCDFduet™-1 (Novagen, USA, 3.7 kb) contains two T7 promoters whose expression is induced by IPTG. In this experiment, this was deleted and two constantly expressed promoters were inserted. DNA fragment of pCDFduet™-1 was digested with XbaI/XhoI, and DNA fragments containing the sequences of J23101 (SEQ ID NO: 19) and J23108 promoter (SEQ ID NO: 20) that were constantly expressed were inserted into the XbaI/XhoI recognition site. The size of the inserted DNA fragment (promoter) containing the sequences of the J23101 and J23108 promoters was 328 bp (SEQ ID NO: 21). For insertion of the J23101 and J23108 promoters, primers having XbaI/XhoI recognition sites [5′-TACTGAACCGCTCTAGATTTACAGCTAGC-3′(SEQ ID NO: 22) and 5′-CTTTACCAGACTCGAGTTCGAAGACGTCA-3′(SEQ ID NO: 23)] were used. The preparation method of the pCDFJ23 vector is shown in FIG. 1.

(11) Meanwhile, in order to isolate glycerol dehydratase (DhaB), glycerol dehydratase reactivase (GdrAB) and. CoA-dependent propionaldehyde (PduP) genes, the total DNA of Klebsiella pneumoniae DSM 2026 was extracted, primers [5′-cagcca gaattcatgaaaagatcaaaacgatttgca-3′(SEQ ID NO: 24) and 5′-ccctct aagctt gatctcccactgaccaaagctggccccg-3′(SEQ ID NO: 25)] were prepared. PCR was performed at one time using the extracted total DNA as a template, and then a 4.7 kb gene fragment corresponding to dhaB1, dhaB2, dhaB3 and gdrA genes was identified. Gene fragments formed as a result of PCR were isolated using 1% agarose gel and purified using Wizard DNA purification kit. The purified gene fragment was treated with restriction enzymes EcoRI and HindIII, and then mixed with the pCDFJ23 vector fragment, to which T4 DNA ligase (available from Takara) was added, allowed to react at 4° C., and inserted into EcoRI/HindIII recognition site. Thereby, 7 kb of pCDFJ23-dhaB123-gdrAB recombinant plasmid was prepared.

(12) In addition, in order to isolate Glycerol dehydratase reactivase (GdrB) gene, the total DNA of Klebsiella pneumoniae DSM 2026 was extracted and primers [5′-gagatc aagctt agagggggccgtcatgtcgattcaccgccaggcgta-3′(SEQ ID NO: 26) and 5′-gttcga cttaag tcagtactctcacttaacggcaggac-3′(SEQ ID NO: 27)] were prepared. PCR was performed using the extracted total DNA as a template, and then a 0.3 kb gene fragment corresponding to gdrB gene was identified. Gene fragments formed as a result of PCR were isolated using 1% agarose gel and purified using Wizard DNA purification kit. The purified gene fragment was treated with restriction enzymes HindIII and AflII, and then mixed with the pCDFJ23-dhaB123-gdrA recombinant plasmid fragment, to which T4 DNA ligase (available from Takara) was added, allowed to react at 4° C., and inserted into the HindIII/AflII recognition site. Thereby, 7.3 kb of pCDFJ23-dhaB123-gdrAB recombinant plasmid was prepared.

(13) Furthermore, in order to isolate CoA-dependent propionaldehyde (PduP) gene, the total DNA of Klebsiella pneumoniae DSM 2026 was extracted and primers [(5′-gctagc ggtacc tgttaaaggagcatctgacaatgaatacagcagaactggaaacc-3′ (SEQ ID NO: 28) and 5′-ttaaca catatg ttagcgaatggaaaaaccgttggt-3′ (SEQ ID NO: 29))] were prepared. PCR was performed at one time using the extracted total DNA as a template, and a 1.4 kb gene fragment corresponding to pduP gene was identified. Gene fragments formed as a result of PCR were isolated using 1% agarose gel and purified using Wizard DNA purification kit. The purified gene fragment was treated with restriction enzymes KpnI and NdeI, and then mixed with the pCDFJ23-dhaB123-gdrAB recombinant plasmid fragment, to which T4 DNA ligase (available from Takara) was added and allowed to react at 4° C. Thereby, 8.7 kb of pCDFJ23-dhaB123-gdrAB-pduP recombinant plasmid was prepared.

(14) And, in order to amplify the gene fragment corresponding to reC_GK which is a variant (S506G. A510K) gene of Cupriavidus necator (Ralstonia eutropha) PHA synthase, PCR was performed using primers [(5′-cgctaa catatg tgttaaaggagcatctgacatggcgaccgataaaggc-3′ (SEQ ID NO: 30) and 5′-caattg agatct tcatgccttggctttgacgtatcgccc-3′ (SEQ ID NO: 31)], the amplified 1.8 kb gene fragment was treated with NdeI/BglII restriction enzyme, then mixed with the pCDFJ23-dhaB123-gdrAB-pduP recombinant plasmid fragment, to which T4 DNA ligase (available from Takara) was added, allowed to react at 4° C. and inserted into the NdeI/BglII recognition site. Thereby, 10.5 kb of pCDFJ23-dhaB123-gdrAB-pduP-reC_GK recombinant vector was finally prepared. The preparation method and cleavage map of such pCDFJ23-dhaB123-gdrAB-pduP-reC_GK recombinant vector are shown in FIG. 2.

(15) 1-2. Preparation of pTrcHisB-ldhD-cppct540 Recombinant Vector

(16) A propionyl-CoA transferase (CP-PCT) variant derived from Clostridium propionicum was used as a propionyl-CoA transferase gene (pet), and a gene derived from Pediococcus acidilactici was used as a lactate dehydrogenase gene. The vector used at this time was pTricHisB (Invitrogen Co., USA) containing a Trc promoter which is an IPTG induction system.

(17) First, in order to isolate a lactate dehydrogenase gene, the total DNA of Pediococcus acidilactici was extracted, primers [5′-aataaa ccatgg atgaaaattattgcttat-3′(SEQ ID NO: 32) and 5′-caagat ctcgag ttaatcaaatttgacctc-3′(SEQ ID NO: 33)] were prepared and PCR was performed using the extracted total DNA as a template. The obtained PCR product was electrophoresed to confirm a 1 kb gene fragment corresponding to a ldhD gene, and the gene was obtained. Gene fragments formed as a result of PCR were isolated using 1% agarose gel and purified using Wizard DNA purification kit. The purified gene fragment was treated with restriction enzymes NcoI and XhoI, and then mixed with the pTricHisB, to which T4 DNA ligase (available from Takara) was added and allowed to react at 4° C. Thereby, 5.4 kb of pTrcHisB-ldhD recombinant plasmid was prepared.

(18) Then, in order to construct an operon-type system so that the propionyl-CoA transferase was expressed under the influence of the Trc promoter, Clostridium propionicum-derived propionyl-CoA transferase (CP-PCT) variant (CP-PCT Variant 540; including Va1193Ala and silent mutations T78C, T669C, A1125G, T1158C) were used. The selection method of CP-PCT 540 is described in detail in Korean Patent Application No. 10-2018-002497, which is incorporated herein by reference. CP-PCT Variant 540 (including Val 193Ala and silent mutations T78C, T669C, A1125G, T1158C) selected in this way was subjected to PCK using primers [5′-aactcg agatct tgttaaaggagcatctgac atgagaaaggacccattatt-3′(SEQ ID NO: 34) and 5′-ccatat ggtacc ttaggacttcatacctt-3′(SEQ ID NO: 35)] to obtain a L5 kb amplified gene fragment. This was treated with restriction enzyme BglII/KpnI, and then mixed with the pTrcHisB-ldhD recombinant plasmid, to which T4 DNA ligase (available from Takara) was added and allowed to react at 4° C. to prepare 6.9 kb of pTrcHisB-ldhD-CPPCT 540 recombinant plasmid. The preparation method and cleavage map of the pTrcHisB-ldhD-CPPCT 540 recombinant vector are shown in FIG. 3.

Example 2. Preparation of Recombinant Strain for Preparation of 3-Hydroxypropionate-Lactate Block Copolymer

(19) 2.1. Preparation of ldhA Gene Knockout Variants

(20) In order to prepare a lactate free polymer based on Escherichia coli XL1-Blue (Stratagene, USA), Escherichia coli XL1-blue-derived D-lactate dehydrogenase gene (ldhA; fermentative D-lactate dehydrogenase, NAD-dependent [Escherichia coli str. K-12 substr.] Gene accession number: NC_000913.3, enzyme accession number: EC_1.1.1.28), involving in the preparation of lactate during the metabolic process of Escherichia coli, was knocked out from genomic DNA to prepare Escherichia coli variant, E. coli XL1-Blue (Δ ldhA) having deletion in ldhA was prepared. Deletion of the gene was performed using a red-recombination method well known in the art. The oligomer used to delete ldhA was synthesized by the base sequence of SEQ ID NO: 36 (5′-atcagcgtacccgtgatgctaacttctctctggaaggtctgaccggctttaattaaccctcactaaagggcg-3′) and SEQ ID NO: 37 (5′-acaccgattttaccggtaccgataacgcctgccgttttgccatacatagttaatacgactcactatagggctc-3′)

(21) 2.2, Preparation of Recombinant Strain for Preparation of 3-Hydroxypropionate-Lactate Block Copolymer

(22) The Escherichia coli mutant having deletions in ldhA, E. coli XL1-Blue (ΔldhA), prepared in Example 2.1 was transformed by electroporation using the recombinant vectors pCDFJ23-dhaB123-gdrAB-pduP-reC_GK and pTrcHisB-ldhD-CPPCT 540 prepared in Examples 1.1 and 1.2 to prepare a recombinant strain for the preparation of the P(LA-b-3HP) block copolymer.

Example 3. Preparation of 3-Hydroxypropionate-Lactate Block Copolymer Using IPTG Induction

(23) The recombinant strain prepared in Example 2.2 was cultured in two-steps as follows to obtain a 3-hydroxypropionate-lactate block copolymer.

(24) First, for the first-step culture, the transformed recombinant E. coli prepared in Example 2.2 was inoculated into 100 ml MR medium further containing 100 mg/L of ampicillin, 25 mg/L of streptomycin, 20 g/L of glycerol, 0.5 mM of vitamin 1312 and 10 mg/L of thiamine (KH.sub.2PO.sub.4 6.67 g, (NH.sub.4).sub.2HPO.sub.4 4 g, MgSO.sub.4.Math.7H.sub.2O 0.8 g, citric acid 0.8 g, and trace metal solution 5 mL per 1 L of medium; wherein the trace metal solution contains 5M HCl 5 mL, FeSO.sub.4.Math.7H.sub.2O 10 g, CaCl.sub.2 2 g, ZnSO.sub.4.Math.7H.sub.2O 2.2 g, MnSO.sub.4.Math.4H.sub.2O 0.5 g, CuSO.sub.4.Math.5H.sub.2O 1 g, (NH.sub.4).sub.6Mo.sub.7O.sub.2.Math.4H.sub.2O 0.1 g, and Na.sub.2B.sub.4O.sub.2.Math.10H.sub.2O 0.02 g per 1 L) and cultured with stirring at 30° C. and 250 rpm.

(25) After 1 day from the start of the culture, isopropyl β-D-1-thiogalactopyranoside (IPTG) was added at 0.5 mM so that the IPTG induction system was used in 100 ml of the culture, and 10 g/L of glucose was added to perform IPTG induction. Thereby, the LA biosynthetic enzyme and the LA-CoA-converting enzyme were expressed, and the use of glycerol was interrupted and the Preparation of P(3HP) was inhibited, resulting in PLA biosynthesis at the interrupted P(3HP) end.

(26) Subsequently, the induced culture solution was further cultured (second-sep culture) for 3 days.

Comparative Example 1. Preparation of 3-Hydroxypropionate Polymer without IPTG Induction

(27) In order to compare with the preparation method according to the present invention, 3-hydroxypropionate polymer was produced in one-step culture without using IPTG induction. Specifically, in a separate flask, the transformed recombinant E. coli prepared in Example 2.2 was inoculated in 100 ml MR medium further containing 100 mg/L of ampicillin, 25 mg/L of streptomycin, 20 g/L of glycerol and 0.5 mM of vitamin B12 (KH.sub.2PO.sub.4 6.67 g, (NH.sub.4)2HPO.sub.4 4 g, MgSO.sub.4.Math.7H.sub.2O 0.8 g, citric acid 0.8 g, and trace metal solution 5 mL per 1 L of medium; wherein the trace metal solution contains 5M HCl 5 mL, FeSO.sub.4.Math.7H.sub.2O 10 g, CaCl.sub.2 2 g, ZnSO.sub.4.Math.7H.sub.2O 2.2 g, MnSO.sub.4.Math.4H.sub.2O 0.5 g, CuSO.sub.4.Math.5H.sub.2O 1 g, (NH.sub.4)6Mo.sub.7O.sub.2.Math.4H.sub.2O 0.1 g, and Na.sub.2B.sub.4O.sub.2.Math.10H.sub.2O 0.02 g per 1 L) and cultured for a total of 4 days while stirring at 250 rpm at 30° C.

Experimental Example 1. Analysis of Molecular Weight and Composition of the Prepared Polymer

(28) The culture solution subjected to the IPTG induction according to Example 3, and the culture solution not subjected to the IPTG induction according to Comparative Example 1 were respectively centrifuged at 4° C. and 4000 rpm for 10 minutes to collect microbial cells, washed twice with a sufficient amount of distilled water and then dried at 80° C. for 12 hours. In order to confirm the polymer content and composition in the dried microbial cells, GC analysis was performed. For this purpose, the microbial cells from which moisture was removed were quantified and then reacted with methanol under a sulfuric acid catalyst using chloroform as a solvent at 100° C. This was mixed by adding distilled water in an amount equivalent to a half of chloroform at room temperature and then allowed to stand until it was separated into two layers. Of the two layers, a chloroform layer in which the monomers of the methylated polymer were dissolved was collected, and the components of the polymer were analyzed by gas chromatography (GC). Benzoate was used as an internal standard. The GC conditions used at this time are shown in Table 1 below.

(29) In order to determine the molecular weight of the polymer, GPC analysis was performed. For this purpose, polymer extraction and purification were carried out as follows. The microbial cells from which moisture was removed were collected in a cylindrical filter paper, and then extracted with a chloroform solvent at 60° C. for 4 hours or more using a Soxhlet extractor, After extraction, chloroform as a solvent was removed using an evaporator to obtain a film-type polymer. In order to purify this, the film-type polymer was dissolved 5 ml of chloroform, and then dropped little by little in 100 ml of methanol at 4° C. to remove impurities. The molecular weight of the polymer thus purified was confirmed by GPC analysis. Specifically, the purified polymer was dissolved in chloroform at a concentration of 1 to 2 mg/mL, and then filtered through a 0.45 μm syringe filter and analyzed using GPC (Waters E0813X) equipment for chloroform. Chloroform was flowed as a mobile phase at a rate of 1 mL/min, the column temperature was adjusted to 35° C. and it was detected using RI refractive index detector. Thus, the number average molecular weight (Mn), the weight average molecular weight (Mw), the maximum peak molecular weight (Mp), and the polydispersity index (PDI) of the biopolymer composition of the present invention were measured, respectively.

(30) TABLE-US-00001 GC analysis conditions Item Quality Model Hewlett Packard 6890N Detector Flame ionization detector(FID) Column Alltech Capillary AT ™-WAX, 30 m, 0.53 mm Liquid phase 100% polyethylene Glycol Inj. port temp/Det. port temp  250° C./250° C. Carrier gas He Total flow 3 ml/min septum purge vent flow 1 ml/min Column head pressure 29 kPa Injection port mode Splitless Injection volume/Solvent    .sup. 1 μL/chloroform Initial temp/Time 80° C./5 min Final temp/Time 230° C./5 min  Ramp of temp. 7.5° C./min .sup. 

(31) The results obtained in the GC analysis are shown in Table 2 below.

(32) TABLE-US-00002 TABLE 2 Weight Number Maximum LA mol PHA Average Average Peak IPTG content in content Molecular Molecular Molecular induction polymer in a Weight Weight Weight Polydispersity time (%) cell (%) Mw(×10.sup.4) Mn(×10.sup.4) Mp(×10.sup.4) index PDI 24 hr 13.3 ± 0.4 P(3HP-b- 5.09 2.02 3.87 2.52 LA): 29.9 ± 2.2 No 0.1 P(3HP): 9.18 3.87 8.43 2.38 induction 43.9 ± 2.9

(33) As shown in Table 2, when IPTG induction was performed using the transformed recombinant strain according to the present invention, it can be confirmed that a 3-hydroxypropionate-lactic acid block copolymer was produced. However, when IPTG induction was not performed, it can be seen that only P(3HP) was produced, and LA was substantially not produced.

Experimental Example 2. Confirming a Copolymer is a Block Copolymer

(34) In order to confirm whether the polymer prepared as described above is a P(3HP-b-LA) block copolymer, the test was performed using a differential scanning calorimeter (DSC Q100, TA instrument) together with P(3HP-r-LA) random copolymer, and the results were compared.

(35) As a comparative example, a P(3HP-r-LA) random copolymer was prepared by the following method. First, as a vector for the comparative example, rec-GK and CPPT-540 were put in a pBluescript based vector and not an IPTG induction vector, and the prepared pBlue-reC_GK-CPPCT540 was used.

(36) Specifically, as the PHA synthase gene for the preparation of pBlue-reC_GK-CPPCT540, PHA synthase variant derived from Cupriavidus necator (Ralstonia eutropha)(5506G. A510K) was used (reC_GK). The vector used was pBluescript II (Stratagene Co., USA).

(37) In order to express ReC_GK, in the pSYL105 vector (Lee et al., Biotech. Bioeng., 1994, 44: 1337-1347), DNA fragments containing PHB-producing operons derived from Ralstonia eutropha H16 were digested with BamHI/EcoRI, and inserted into the BamHI/EcoRI recognition site of pBluescript II (Stratagene Co., USA). Thereby, pReCAB recombinant vector was prepared. In the pReCAB vector, PHA synthase (phaCRE) and monomer-supplying enzyme (phaARE and phaBRE) were constantly expressed by the PHB operon promoter. ReC synthase gene of pReCAB vector was completely removed by BstBI/SbfI restriction enzyme, and a variant ReC_GK synthase gene was inserted at this position. For amplification of this ReC_GK synthase gene fragment, PCR was performed using the primers [(5′-cgctaa TTCGAA tagtgacggcagagagacaatcaaatc atggcgaccggcaaaggc-3′ (SEQ ID NO: 38) and 5′-caattg CCTGCAGG tcatgccttggctttgacgtatcgccc-3′ (SEQ ID NO: 39)] to obtain the amplified 1.8 kb gene fragment. This was treated with restriction enzymes BstBI/SbfI, mixed with the plasmid fragment, to which T4 DNA ligase (available from. Takara) was added, allowed to react at 4° C., and inserted into a BstBI/SbfI recognition site to prepare a pBlue-reC_GK recombinant vector.

(38) In order to construct a constantly expressed system of the operon form in which propionyl-CoA transferase were expressed together here, propionyl-CoA transferase variant (CPPCT540) derived from Clostridium propionicum was used. In order to amplify the CPPCT540 gene fragment, PCR was performed using primers [5′-caattgCCTGCAGGcggataacaatttcacacaggaaacagaattcatgagaaaggttcccattatt-3′ (SEQ ID NO: 40), 5′-ccatat catatg ttaggacttcatttcctt-3′(SEO ID NO: 41)], and the obtained 1.5 kb fragment was used. This PCR fragment was treated with restriction enzymes SbfI/NdeI, then mixed with the pBlue-reC_GK recombinant plasmid fragment, to which T4 DNA ligase was added, allowed to react at 4° C. and inserted into the SbfI/NdeI recognition site to prepare a pBlue-rec_GK-CPPCT540 recombinant vector. The preparation method and cleavage map of the pBlue-rec_GK-CPPCT540 recombinant vector are shown in FIG. 6.

(39) Polymer-producing microorganisms were made so that lactate monomer was supplied during culture using E. coli XL1-Blue wild-type strain from which ldhA has not been deleted. The carbon source used for the culture was glucose. 3HP (3-hydroxypropionate)monomer was added at 0.5 g/L to biosynthesize the P(3HP-r-LA) random copolymer. MR medium, culture time and temperature were applied to the same conditions as the block polymer synthesis described in Example 3.

(40) The copolymer according to the present invention prepared in Example 3 and the random copolymer prepared as described above were tested using a differential scanning calorimeter (DSC Q100, TA Instrument) and the measurement was performed by raising the temperature from −40° C. to 220° C. at a temperature rise rate of 10° C./min. The results are shown in FIGS. 4 and 5.

(41) As can be seen in FIGS. 4 and 5, for the P(3HP-b-LA) block copolymer of the present invention, both the glass transition temperature (Tg) and melting temperature (Tm) of P(3HP) and PLA are specified, whereas for the P(3HP-r-LA) random copolymer of the comparative example, Tg was found at the intermediate position between P(3HP) and PLA, and Tm was not measured. Therefore, it was clearly confirmed that the copolymer prepared according to the present invention was P(3HP-b-LA) block copolymer.