EXTRACTION OF PLANT SOURCE "MEDICINAL SOUP" AND MANUAL PREPARATION OF "HERBAL MEDICINE" AND RELATED PRODUCTS

20210113641 ยท 2021-04-22

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided is a method for preparing bencaosome comprising the steps of: mixing one or more lipid components with any one or more of the following: nucleic acid, compound and mancromolecules, and treating the obtained mixture by heating. Also provided is a method for extracting decoctosome from plants comprising the steps of: preparing an extract of the plant with a solvent; performing differential centrifugation to the extract; resuspending the precipitates with an aqueous solution to provide the decoctosome.

    Claims

    1-25. (canceled)

    26. A method for preparing a bencaosome, comprising the steps of: (1) mixing one or more lipid components with any one or more of the following: one or more nucleic acids, one or more compounds and/or one or more macromolecules; wherein the one or more lipid components are synthesized or purified; (2) treating the obtained mixture by heating, wherein the heating temperature is from about 0 C. to about 100 C.; wherein the time for heating is about 0 minute to about 24 hours; wherein the mixing is performed by adding a solution of the lipid components in an organic solvent into an aqueous solution of the nucleic acid, macromolecule and/or compound; wherein the bencaosome is a nano-particulate substance with a membrane structure.

    27. The method of claim 26, wherein the lipid is Sphinganine (d22:0), the nucleic acid is PGY-sRNA-6 or HJT-sRNA-m7, and the lipid:the nucleic acid=0.1-20 g:0.1nmol; wherein the bencaosome has a Zeta potential of less than 60 mV, less than 50 mV, less than 0, 80 to 20, or 60 to 20, and has an average particle size of 50-1000, 90-300 or 100-200 nm.

    28. The method of claim 26, wherein the one or more lipid components include lipids selected from those shown in Table 1 or Table 10, and the nucleic acid is one or more small RNAs shown in Table 8, 9 and 13.

    29. The method of claim 26, wherein the nucleic acid is selected from single stranded or double stranded or partially double-stranded RNA or DNA.

    30. The method of claim 29, wherein the RNA is selected from the group consisting of messenger RNA (mRNA), rRNA (ribosomal RNA), tRNA (transfer RNA), heterogeneous nuclear RNA (hnRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), small cytoplasmic RNA, small RNA, transfer-messenger RNA (tmRNA), telomerase RNA and antisense RNA.

    31. The method of claim 29, wherein the DNA is selected from the group consisting of complementary DNA (cDNA), chloroplast DNA, multicopy single-stranded DNA (msDNA), mitochondrial DNA (mtDNA) and ribosomal DNA (rDNA).

    32. The method of claim 26, wherein the macromolecule is selected from synthesized or purified proteins or polysaccharide drugs, and/or one or more macromolecules shown in Table 6 or 7.

    33. The method of claim 32, wherein the protein is selected from the group consisting of antibody, -lactoglobulin, albumin, erythropoietin (EPO), interferon, colony stimulating factor, tissue plasminogen activator and various labeled proteins.

    34. The method of claim 26, wherein the bencaosome is used in one or more of the following: (1) lowering the expression of fibronectin and/or alpha-SMA, or lowering the protein expression of fibronectin in MRC-5 cells fibrosis model induced by TGF-beta1; (2) reducing hydroxyproline, or the hydroxyproline in pulmonary fibrosis model, or the hydroxyproline in pulmonary fibrosis model of mice; (3) preventing or treating fibrosis, or pulmonary fibrosis, or in the fibrosis model of MRC-5 cells induced by TGF-beta1 or the fibrosis model of mice induced by Bleomycin; (4) lowering IL-1beta, IL-6 and/or TNF-alpha, or the IL-1beta, IL-6 and/or TNF-alpha in A549 cells model induced by poly(I:C); (5) lowering the level of IL-1alpha, IL-1b, IL-2, IL-3, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12 p40, IL-12 p70, IL-13, IL-17A, GM-CSF, IFN-gamma or MCP-1beta; (6) treating IL-1beta, IL-6 and/or TNF-alpha-associated diseases, or for anti-inflammation, or for the treatment of pneumonia, myocarditis, acute and chronic gastritis, acute and chronic enteritis, acute and chronic hepatitis, acute and chronic nephritis, dermatitis, encephalitis, lymphitis, conjunctivitis, keratitis, iridocyclitis, otitis media, allergy rhinitis, asthma, pulmonary fibrosis, chronic obstructive pulmonary disease, allergic dermatitis, sickle cell disease, multiple sclerosis, systemic lupus erythematosus, lupus nephritis, lung cancer, gastric cancer, colorectal cancer, liver cancer, pancreatic cancer, cervical cancer, breast cancer, leukemia, multiple myeloma, diabetes and gout; and (7) enabling small RNA to enter cells efficiently; and/or (8) lowering the expression of RELA genes.

    35. The method of claim 34, wherein the bencaosome is used for oral administration, intravenous administration, subcutaneous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, intrapulmonary administration, intracerebrospinal administration, intraarticular administration, intrasynovial administration, intrathecal administration, intralesional administration, or administration via inhalation routes.

    36. A method of delivering a nucleic acid or protein comprising: heating or warming up the nucleic acid and lipids, the temperature for heating or warming up is from about 25 C. to about 100 C., from about 50 C. to about 100 C., from about 95 C. to about 100 C., or from about 80 C. to about 100 C., or, heating the protein and lipids, wherein the heating temperature is from about 50 C. to about 100 C., from about 80 C. to about 100 C., from about 80 C. to about 90 C.; the time for heating is about 0 minute to about 24 hours, about 5 minutes to about 20 hours, about 10 minutes to about 16 hours, about 15 minutes to about 12 hours, about 1 hour to about 8 hours, or about 2 hours to about 4 hours; wherein the nucleic acid is single or double stranded; the nucleic acid delivery is by oral administration.

    37. The method of claim 36, further comprising further mixing one or compounds, one or more nucleic acids, and/or one or more macromolecules; wherein the nucleic acids include DNA and RNA; wherein the compound is selected from one or more compounds shown in Table 2 to Table 5, the nucleic acid is selected from one or more small RNA shown in Table 8 and/or Table 9 and/or Table 13, and one or more DNA, the macromolecule is selected from one or more macromolecules shown in Table 6 or Table 7.

    38. The method of claim 36, wherein the more lipids are the lipids comprising the lipid combination selected from the following: a lipid combination of No. 8: No. 41=6:1; a lipid combination of No. 38:No. 41=6:1; a lipid combination of No. 39:No. 41=6:1; a lipid combination of No. 40:No. 41=6:1; a lipid combination of No. 38:No. 12:No. 41:No. 29=1:2:1:1; a lipid combination of No. 40:No. 12:No. 41=2:4:3; a lipid combination of No. 12:No. 41=1:6; a lipid combination of No. 12:No. 41=1:1; a lipid combination of No. 12:No. 41=6:1; a lipid combination of No. 40:No. 12:No. 41=2:2:2; a lipid combination of No. 4:No. 12:No. 41=1:1:1; DG combination of No. 1:No. 2:No. 3:No. 19:No. 35=1:1:1:1:1; TG combination of No. 6:No. 9:No. 10:No. 13:No. 15:No. 16:No. 18:No. 20:No. 21:No. 22:No. 23:No. 24:No. 25:No. 26:No. 27:No. 28:No. 32:No. 33=1:1:1:1:1:1:1:1:1:1:1:1:1:1:1:1:1:1; LPC combination of No. 36:No. 37=1:1; PC combination of No. 11:No. 12=1:1; PE combination of No. 8:No. 38=1:1; Cer combination of No. 4:No. 14=1:1; So combination of No. 17:No. 30:No. 31=1:1:1; an equal volume combination of No. 1-36 without No. 5, No. 7; an equal volume combination of No. 1-36 without No. 5, No. 7, No. 34; an equal volume combination of No. 1-36 without No. 5, No. 7, No. 1, No. 2, No. 3, No. 19, No. 35; an equal volume combination of No. 1-36 No. 5, No. 7, No. 6, No. 9, No. 10, No. 13, No. 15, No. 16, No. 18, No. 20, No. 21, No. 22, No. 23, No. 24, No. 25, No. 26, No. 27, No. 28, No. 32, No. 33; an equal volume combination of No. 1-36 without No. 5, No. 7, No. 36, No. 37; an equal volume combination of No. 1-36 without No. 5, No. 7, No. 11, No. 12; an equal volume combination of No. 1-36 without No. 5, No. 7, No. 8 in; an equal volume combination of No. 1-36 without No. 5, No. 7, No. 4, No. 14; an equal volume combination of No. 1-36 without No. 5, No. 7, No. 29; a lipid combination of No. 1:No. 34=2:1; a lipid combination of No. 1:said DG composition=2:1; a lipid combination of No. 1:said TG composition=2:1; a lipid combination of No. 1:said LPC composition=2:1; a lipid combination of No. 1:No. 8=2:1; a lipid combination of No. 1:No. 12=2:1; a lipid combination of No. 1:said Cer composition=2:1; a lipid combination of No. 1:said So composition=2:1; a lipid combination of No. 1:No. 29=2:1; a lipid combination of No. 1:No. 8:No. 12=1:1:1; a lipid combination of No. 8:No. 34=2:1; a lipid combination of No. 8:said DG composition=2:1; a lipid combination of No. 8:said TG composition=2:1; a lipid combination of No. 8:said LPC composition=2:1; a lipid combination of No. 8:No. 37=4:1; a lipid combination of No. 8:No. 12=2:1; a lipid combination of No. 8:said Cer composition=2:1; a lipid combination of No. 8:said So composition=2:1; a lipid combination of No. 8:No. 31=6:1; a lipid combination of No. 8:No. 29=2:1; a lipid combination of No. 12:No. 34=2:1; a lipid combination of No. 12:said DG composition=2:1; a lipid combination of No. 12:said TG composition=2:1; a lipid combination of No. 12:said LPC composition=2:1; a lipid combination of No. 12:No. 8=2:1; a lipid combination of No. 12:said Cer composition=2:1; a lipid combination of No. 12:said So composition=2:1; a lipid combination of No. 12:No. 29=2:1; a lipid combination of No. 12:No. 8:No. 1&2=2:1:1; a lipid combination of No. 12:No. 8:No. 15=2:1:1; a lipid combination of No. 12:No. 8:No. 36&37=2:1:1; a lipid combination of No. 12:No. 8:No. 11=2:1:1; a lipid combination of No. 12:No. 8:No. 12=2:1:1; a lipid combination of No. 12:No. 8:No. 4=2:1:1; a lipid combination of No. 12:No. 8:No. 31=2:1:1; a lipid combination of No. 12:No. 8:No. 29=2:1:1; a lipid combination of No. 12:No. 8:No. 34=3:2:1; a lipid combination of No. 12:No. 8:No. 34=4:2:3; a lipid combination of No. 12:No. 8:No. 2=4:2:3; a lipid combination of No. 12:No. 8:No. 2=16:8:3; a lipid combination of No. 12:No. 8:No. 32=4:2:3; a lipid combination of No. 12:No. 8:No. 37=4:2:3; a lipid combination of No. 12:No. 8:No. 11=4:2:3; a lipid combination of No. 12:No. 8:No. 38=4:2:3; a lipid combination of No. 12:No. 8:No. 4=4:2:3; a lipid combination of No. 12:No. 8:No. 31=4:2:3; a lipid combination of No. 12:No. 8:No. 29=4:2:3; a lipid combination of No. 12:No. 8:No. 29:No. 31=2:1:1:1; a lipid combination of No. 12:No. 8:No. 29:No. 31:No. 34=4:2:2:2:5; a lipid combination of No. 12:No. 8:No. 29:No. 31:No. 2=4:2:2:2:5; a lipid combination of No. 12:No. 8:No. 29:No. 31:No. 32=4:2:2:2:5; a lipid combination of No. 12:No. 8:No. 29:No. 31:No. 11=4:2:2:2:5; a lipid combination of No. 12:No. 8:No. 29:No. 31:No. 37=4:2:2:2:5; a lipid combination of No. 12:No. 8:No. 29:No. 31:No. 38=4:2:2:2:5; a lipid combination of No. 12:No. 8:No. 29:No. 31:No. 4=4:2:2:2:5; a lipid combination of No. 12:No. 8:No. 29:No. 31:No. 4:No. 1:No. 16=2:1:1:3:2:2:3; a lipid combination of No. 1:No. 8:No. 12:No. 1&2=2:2:2:3; a lipid combination of No. 1:No. 8:No. 12:No. 15=2:2:2:3; a lipid combination of No. 1:No. 8:No. 12:No. 36&37=2:2:2:3; a lipid combination of No. 1:No. 8:No. 12:No. 12=2:2:2:3; a lipid combination of No. 1:No. 8:No. 12:No. 4=2:2:2:3; a lipid combination of No. 1:No. 8:No. 12:No. 31=2:2:2:3; a lipid combination of No. 1:No. 8:No. 12:No. 29=2:2:2:3; a lipid combination of No. 8:No. 34:No. 1&2=2:1:1; a lipid combination of No. 8:No. 34:No. 15=2:1:1; a lipid combination of No. 8:No. 34:No. 36&37=2:1:1; a lipid combination of No. 8:No. 34:No. 12=2:1:1; a lipid combination of No. 8:No. 34:No. 4=2:1:1; a lipid combination of No. 8:No. 34:No. 31=2:1:1; a lipid combination of No. 8:No. 34:No. 29=2:1:1; a lipid combination of No. 8:No. 31:No. 34=12:3:5; a lipid combination of No. 8:No. 31:No. 2=12:3:5; a lipid combination of No. 8:No. 31:No. 37=12:3:5; a lipid combination of No. 8:No. 31:No. 11=12:3:5; a lipid combination of No. 8:No. 31:No. 12=12:3:5; a lipid combination of No. 8:No. 31:No. 4=12:3:5; a lipid combination of No. 8:No. 31:No. 29=12:3:5; a lipid combination of No. 8:No. 31:No. 32=12:3:5; a lipid combination of No. 8:No. 4:No. 34=12:3:5; a lipid combination of No. 8:No. 4:No. 2=12:3:5; a lipid combination of No 0.8:No. 4:No. 37=12:3:5; a lipid combination of No. 8:No. 4:No. 12=12:3:5; a lipid combination of No. 8:No. 4:No. 31=12:3:5; a lipid combination of No. 8:No. 4:No. 29=12:3:5; a lipid combination of No. 8:No. 4:No. 32=12:3:5; a lipid combination of No. 38:No. 34=2:1; a lipid combination of No. 38:No. 1=2:1; a lipid combination of No. 38:No. 2=2:1; a lipid combination of No. 38:No. 1&2=2:1; a lipid combination of No. 38:No. 15=2:1; a lipid combination of No. 38:No. 32=2:1; a lipid combination of No. 38:No. 37=2:1; a lipid combination of No. 38:No. 37=4:1; a lipid combination of No. 38:No. 11=2:1; a lipid combination of No. 38:No. 12=2:1; a lipid combination of No. 38:No. 11&12=2:1; a lipid combination of No. 38:No. 12=4:1; a lipid combination of No. 38:No. 8=2:1; a lipid combination of No. 38:No. 4=2:1; a lipid combination of No. 38: So (30)=2:1; a lipid combination of No. 38:No. 31=2:1; a lipid combination of No. 38:No. 29=2:1; a lipid combination of No. 1:No. 38:No. 12:No. 34=2:2:2:3; a lipid combination of No. 1:No. 38:No. 12:No. 15=2:2:2:3; a lipid combination of No. 1:No. 38:No. 12:No. 37=2:2:2:3; a lipid combination of No. 1:No. 38:No. 12:No. 8=2:2:2:3; a lipid combination of No. 1:No. 38:No. 12:No. 4=2:2:2:3; a lipid combination of No. 1:No. 38:No. 12:No. 31=2:2:2:3; a lipid combination of No. 1:No. 38:No. 12:No. 29=2:2:2:3; a lipid combination of No. 38:No. 34:No. 1=2:1:3; a lipid combination of No. 38:No. 34:No. 15=2:1:3; a lipid combination of No. 38:No. 34:No. 37=2:1:3; a lipid combination of No. 38:No. 34:No. 12=2:1:3; a lipid combination of No. 38:No. 34:No. 8=2:1:3; a lipid combination of No. 38:No. 34:No. 4=2:1:3; a lipid combination of No. 38:No. 34:No. 31=2:1:3; a lipid combination of No. 38:No. 34:No. 29=2:1:3; a lipid combination of No. 38:No. 12:No. 1=2:1:3; a lipid combination of No. 38:No. 12:No. 2=4:1:3; a lipid combination of No. 38:No. 12:No. 15=2:1:3; a lipid combination of No. 38:No. 12:No. 37=2:1:3; a lipid combination of No. 38:No. 12:No. 8=2:1:3; a lipid combination of No. 38:No. 12:No. 4=2:1:3; a lipid combination of No. 38:No. 12:No. 31=2:1:3; a lipid combination of No. 38:No. 12:No. 29=2:1:3; a lipid combination of No. 38:No. 12:No. 1:No. 15:No. 34=22:22:22:33:36; a lipid combination of No. 38:No. 12:No. 1:No. 15:No. 37=22:22:22:33:36; a lipid combination of No. 38:No. 12:No. 1:No. 15:No. 4=22:22:22:33:36; a lipid combination of No. 38:No. 12:No. 1:No. 15:No. 31=22:22:22:33:36; a lipid combination of No. 38:No. 12:No. 1:No. 15:No. 29=22:22:22:33:36; a lipid combination of No. 38:No. 34:No. 37:No. 1=44:22:33:36; a lipid combination of No. 38:No. 34:No. 37:No. 15=44:22:33:36; a lipid combination of No. 38:No. 34:No. 37:No. 12=44:22:33:36; a lipid combination of No. 38:No. 34:No. 37:No. 4=44:22:33:36; a lipid combination of No. 38:No. 34:No. 37:No. 31=44:22:33:36; a lipid combination of No. 38:No. 12:No. 4:No. 34=44:22:33:36; a lipid combination of No. 38:No. 12:No. 4:No. 1=44:22:33:36; a lipid combination of No. 38:No. 12:No. 4:No. 15=44:22:33:36; a lipid combination of No. 38:No. 12:No. 4:No. 37=44:22:33:36; a lipid combination of No. 38:No. 12:No. 4:No. 37=8:2:5:3; a lipid combination of No. 38:No. 12:No. 4:No. 31=44:22:33:36; a lipid combination of No. 38:No. 12:No. 4:No. 29=44:22:33:36; a lipid combination of No. 38:No. 12:No. 4:No. 29:No. 34=88:44:66:72:135; a lipid combination of No. 38:No. 12:No. 4:No. 29:No. 1=88:44:66:72:135; a lipid combination of No. 38:No. 12:No. 4:No. 29:No. 15=88:44:66:72:135; a lipid combination of No. 38:No. 12:No. 4:No. 29:No. 37=88:44:66:72:135; a lipid combination of No. 38:No. 12:No. 4:No. 29:No. 31=88:44:66:72:135; a lipid combination of No. 38:No. 12:No. 4:No. 2=20:10:15:9; a lipid combination of No. 38:No. 12:No. 4:No. 6=20:10:15:9; a lipid combination of No. 38:No. 12:No. 4:No. 17=20:10:15:9; a lipid combination of No. 38:No. 12:No. 4:No. 29=20:10:15:9; a lipid combination of No. 38:No. 12:No. 4:No. 34=20:10:15:9; a lipid combination of No. 38:No. 12:No. 4:No. 37=20:10:15:9; a lipid combination of No. 38:No. 12:No. 31:No. 34=2:1:3:3; a lipid combination of No. 38:No. 12:No. 31:No. 1=2:1:3:3; a lipid combination of No. 38:No. 12:No. 31:No. 15=2:1:3:3; a lipid combination of No. 38:No. 12:No. 31:No. 37=2:1:3:3; a lipid combination of No. 38:No. 12:No. 31:No. 4=2:1:3:3; a lipid combination of No. 38:No. 12:No. 31:No. 29=2:1:3:3; a lipid combination of No. 38:No. 34:No. 37:No. 31:No. 1=88:44:66:72:135; a lipid combination of No. 38:No. 34:No. 37:No. 31:No. 15=88:44:66:72:135; a lipid combination of No. 38:No. 34:No. 37:No. 31:No. 12=88:44:66:72:135; a lipid combination of No. 38:No. 34:No. 37:No. 31:No. 4=88:44:66:72:135; a lipid combination of No. 38:No. 34:No. 37:No. 31:No. 29=88:44:66:72:135; a lipid combination of No. 38:No. 37:No. 34=4:2:3; a lipid combination of No. 38:No. 37:No. 1=4:2:3; a lipid combination of No. 38:No. 37:No. 2=4:2:3; a lipid combination of No. 38:No. 37:No. 1&2=4:2:3; a lipid combination of No. 38:No. 37:No. 2=32:8:5; a lipid combination of No. 38:No. 37:No. 32=32:8:5; a lipid combination of No. 38:No. 37:No. 15=4:2:3; a lipid combination of No. 38:No. 37:No. 32=4:2:3; a lipid combination of No. 38:No. 37:No. 8=4:2:3; a lipid combination of No. 38:No. 37:No. 11=4:2:3; a lipid combination of No. 38:No. 37:No. 12=4:2:3; a lipid combination of No. 38:No. 37:No. 11&12=4:2:3; a lipid combination of No. 38:No. 37:No. 12=4:1:1; a lipid combination of No. 38:No. 37:No. 4=4:2:3; a lipid combination of No. 38:No. 37:No. 30=4:2:3; a lipid combination of No. 38:No. 37:No. 31=4:2:3; a lipid combination of No. 38:No. 37:No. 29=4:2:3; a lipid combination of No. 8:No. 37:No. 32=4:1:2; a lipid combination of No. 8:No. 37:No. 2=4:1:2; a lipid combination of No. 38:No. 37:No. 15:No. 34=64:16:10:45; a lipid combination of No. 38:No. 37:No. 15:No. 1=64:16:10:45; a lipid combination of No. 38:No. 37:No. 15:No. 12=64:16:10:45; a lipid combination of No. 38:No. 37:No. 15:No. 4=64:16:10:45; a lipid combination of No. 38:No. 37:No. 15:No. 31=64:16:10:45; a lipid combination of No. 38:No. 37:No. 15:No. 29=64:16:10:45; a lipid combination of No. 38:No. 2:No. 37=4:2:3; a lipid combination of No. 38:No. 2:No. 31=4:2:3; a lipid combination of No. 38:No. 2:No. 29=4:2:3; a lipid combination of No. 38:No. 2:No. 34=4:2:3; a lipid combination of No. 38:No. 2:No. 32=4:2:3; a lipid combination of No. 38:No. 2:No. 12=4:2:3; a lipid combination of No. 38:No. 2:No. 12=4:5:1; a lipid combination of No. 38:No. 2:No. 4=4:2:3; lipids No. 1&2, No. 11&12 and No. 36&37 represent lipids No. 1 and No. 2 in any ratio, lipids No. 11 and No. 12 in any ratio, lipids No. 36 and No. 37 in any ratio, respectively.

    39. The method of claim 36, wherein heating proteins and lipids is performed by: (i) mixing a protein solution with a solution of lipid in an organic solvent at v/v=1/5; removing the organic solvent by evaporation, and hydrating with an aqueous reagent; or (ii) adding a solution of lipid in an organic solvent to a protein solution, and warming up after mixing; wherein the lipid is one or more lipids in Table 1 or Table 10, or sphinganine (d22:0) or PE(16:0/16:0) or PE(16:0/22:1).

    40. A method for preparing a decoctosome from plants, comprising the steps of: (1) preparing an extract of the plants using a solvent or an aqueous solvent, wherein the extract of the plants is prepared by decocting the plants soaked in the solvent; wherein the decocting includes decocting with intense heating for 15-45 min, 20-30 min, or 30 min, followed by decoting with gentle heating for 5-30 min, 5-20 min, or 10 min; wherein the temperature of the intense heating is above 90 C., 90 C.-2000 C., 90 C.-1500 C., 90 C.-1000 C., 90 C.-500 C., 90 C.-300 C., 90 C.-250 C. or 90 C.-200 C.; wherein the temperature of the gentle heating is above 50 C., 50 C.-2000 C., 50 C.-1500 C., 50 C.-1000 C., 50 C.-500 C., 50 C.-300 C., 50 C.-250 C., 50 C.-200 C., 50 C.-100 C., 50 C.-80 C., 50 C.-70 C. or 50 C.-60 C.; wherein the aqueous solvent is selected from the group consisting of aqueous buffers, saline solutions, aqueous solutions of organic solvents and water; (2) differential centrifuging the extract at 0-10 C., at 800-5000 g for 20-40 min; taking the supernatant, and then centrifuging the supernatant at 6000 g-15000 g for 20-40 min; taking the supernatant, and then centrifuging the supernatant at 100000-200000 g for 60-120 min; taking the precipitates; and (3) resuspending the precipitates with an aqueous solution to provide the decoctosome, which is a nanoparticulate substance with a membrane structure or a double layered membrane structure, wherein the aqueous solution is selected from the group consisting of aqueous buffers, saline solutions, aqueous solutions of organic solvents and water, or aqueous buffers, or PBS buffers, or PBS buffers at pH7-9 or pH7.4.

    41. The method of claim 40, wherein the decoctosome has an average particle size of 30-1,000 nm or 80-300 nm, and a potential absolute value of 20-100 mV, the plant is selected from the group consisting of Taraxacum mongolicum, Rhodiola, Andrographis paniculata, Cabbage and Woody, wherein a Taraxacum mongolicum decoctosome has an average particle size of 30-300 nm or 150-200 nm, a Zeta potential of 393 mV, and a potential absolute value of 20-100 mV; wherein a Rhodiola decoctosome has an average particle size of 50-300 nm or 150-210 nm, a Zeta potential of 372 mV, and a potential absolute value of 20-100 mV.

    42. The method of claim 40, wherein the decoctosome is in the form of solid or liquid or colloid, comprising a nanoparticulate substance with a membrane structure, or a nanoparticulate substance with a double layered membrane structure.

    43. The method of claim 40, wherein the decoctosome comprises one or more lipid components shown in Table 1 or 10, one or more compounds, one or more DNAs, one or more macromolecules and/or one or more RNAs; or the decoctsome comprises one or more lipid components shown in Table 1 or Table 10, one or more compounds shown in Table 2 or 4, one or more compounds shown in Table 3 or 5, one or more macromolecules shown in Table 6 or 7, and/or one or more small RNAs shown in Table 8, 9 or 13.

    44. The method of claim 40, wherein the decoctosome is used for oral administration, intravenous administration, subcutaneous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, intrapulmonary administration, intracerebrospinal administration, intraarticular administration, intrasynovial administration, intrathecal administration, intralesional administration, or administration via inhalation routes.

    45. The method of claim 40, wherein the decoctosome is used in one or more of the following: (1) lowering the expression of fibronectin and/or alpha-SMA, or the protein expression of fibronectin in MRC-5 cells fibrosis model induced by TGF-beta1; (2) reducing hydroxyproline, or the hydroxyproline in pulmonary fibrosis model, or the hydroxyproline in pulmonary fibrosis model of mice; (3) preventing or treating fibrosis, or pulmonary fibrosis; (4) lowering IL-1beta, IL-6 and/or TNF-alpha, or the IL-1beta, IL-6 and/or TNF-alpha in A549 cells model induced by poly(I:C); (5) lowering the level of IL-1alpha, IL-1beta, IL-2, IL-3, IL-4, IL-5, IL-9, IL-10, IL-12 p40, IL-12 p70, IL-13, IL-17A, GM-CSF, IFN-gamma or MCP-1beta; (6) treating IL-1beta, IL-6 and/or TNF-alpha-associated diseases, or for anti-inflammation, or for the treatment of pneumonia, myocarditis, acute and chronic gastritis, acute and chronic enteritis, acute and chronic hepatitis, acute and chronic nephritis, dermatitis, encephalitis, lymphitis, conjunctivitis, keratitis, iridocyclitis, otitis media, allergy rhinitis, asthma, pulmonary fibrosis, chronic obstructive pulmonary disease, allergic dermatitis, sickle cell disease, multiple sclerosis, systemic lupus erythematosus, lupus nephritis, lung cancer, gastric cancer, colorectal cancer, liver cancer, pancreatic cancer, cervical cancer, breast cancer, leukemia, multiple myeloma, diabetes and gout; and/or (7) lowering the expression of RELA genes.

    Description

    DESCRIPTIONS OF THE DRAWINGS

    [0114] FIG. 1: A schematic diagram of the preparation process of the decoctosome of herbal medicines.

    [0115] FIG. 2: Transmission electron microscopy results of HJT decoctosome.

    [0116] FIG. 3: Transmission electron microscopy results of PGY decoctosome.

    [0117] FIG. 4: Results of particle size and Zeta potential of HJT decoctosome.

    [0118] FIG. 5: Results of particle size and Zeta potential of PGY decoctosome.

    [0119] FIG. 6: HJT decoction can reduce the protein expression of fibronectin in the fibrosis model of MRC-5 cells induced by TGF-1.

    [0120] FIG. 7: HJT decoctosome can reduce the protein expression of fibronectin in the fibrosis model of MRC-5 cells induced by TGF-1.

    [0121] FIG. 8A-C: PGY decoction can reduce the relative expression of IL-1/IL-6/TNF- mRNA in the A549 cell inflammation model induced by poly(I:C).

    [0122] FIG. 9A-C: PGY decoctosome can reduce the relative expression of IL-1/IL-6/TNF- mRNA in the A549 cell inflammation model induced by poly(I:C).

    [0123] FIG. 9D-E: PGY decoction and decoctosome can reduce the protein expression level of IL-6 in the inflammation model of A549 cells.

    [0124] FIG. 9F: The results of cleavage with RNase A and DNase I of RNA in HJT decoctosome.

    [0125] FIG. 9G: The results of cleavage with RNase A and DNase I of RNA in PGY decoctosome.

    [0126] FIG. 10: The test results of reducing the expression of hydroxyproline in a pulmonary fibrosis model of mice for the control MX and HJT decoctosome.

    [0127] FIG. 11: The results of Masson staining in a pulmonary fibrosis model of mice alleviated by the control MX and HJT decoctosome.

    [0128] FIG. 12: The statistical results of Masson staining in a pulmonary fibrosis model of mice alleviated by the control MX and HJT decoctosome.

    [0129] FIG. 13: The pathological test results in a pulmonary fibrosis model of mice alleviated by the control MX and HJT decoctosome.

    [0130] FIG. 14A-B: The test results of reducing the cytokine expression in plasma in an inflammation model of mice for the control cabbage and PGY decoctosome.

    [0131] FIG. 15: Identification results of lipids in HJT decoctosome.

    [0132] FIG. 16: Identification results of lipids in PGY decoctosome.

    [0133] FIG. 17: Identification results of small molecules in HJT decoctosome.

    [0134] FIG. 18: Identification results of small molecules in PGY decoctosome.

    [0135] FIG. 19: Identification results of proteins in HJT decoctosome.

    [0136] FIG. 20: Identification results of proteins in PGY decoctosome.

    [0137] FIG. 21: Length distribution of small RNAs in HJT decoctosome.

    [0138] FIG. 22: Length distribution of small RNAs in PGY decoctosome.

    [0139] FIG. 23: A schematic diagram of the preparation process of the bencaosome.

    [0140] FIG. 24: The relative expression of HJT-sRNA-m7 as determined by RT-PCR.

    [0141] FIG. 25: The entry of HJT-sRNA-m7 as determined by flow cytometry.

    [0142] FIG. 26: The entry of Cy5 labeled HJT-sRNA-m7 as determined by cell confocal test.

    [0143] FIG. 27: Addition of Sphinganine-HJT-sRNA-m7 reduces the expression of cell fibrosis-related proteins fibronectin and -matrix protein (-SMA), as determined by Western blotting test.

    [0144] FIG. 28: Different small RNAs in PGY reduce the relative expression of IL-1/IL-6/TNF- in A549 cells inflammation models, as determined by RT-PCR test.

    [0145] FIG. 29A-C: Transfection of PGY-sRNA-6 reduces the relative expression of IL-1/IL-6/TNF- after poly(I:C) stimulates A549 cells, as determined by RT-PCR test.

    [0146] FIG. 30A-C: Transfection of PGY-sRNA-6 reduces the relative expression of IL-1/IL-6/TNF- after poly(I:C) stimulates PBMC cells, as determined by RT-PCR test.

    [0147] FIG. 31: Transfection of PGY-sRNA-6 reduces the relative expression of RELA genes after poly(I:C) stimulates A549 cells, as determined by RT-PCR assay.

    [0148] FIG. 32: RELA is the target gene of PGY-sRNA-6 as determined by double fluorescent reporter gene test.

    [0149] FIG. 33: The analysis of kurtosis of PGY-sRNA-6 in PGY decoction and PGY decoctosome.

    [0150] FIG. 34: The relative uptake of PGY-sRNA-6 as determined by RT-PCR.

    [0151] FIG. 35: The entry of PGY-sRNA-6 as detected by flow cytometry.

    [0152] FIG. 36: The entry of Cy3 labeled PGY-sRNA-6 as detected by cell confocal test.

    [0153] FIG. 37A-C: Sphinganine-PGY-sRNA-6 reduces the relative expression of IL-1/IL-6/TNF- mRNA in A549 cells stimulated by poly(I:C), as determined by RT-PCR.

    [0154] FIG. 38: The relative fluorescent intensity after adding Sphinganine-PGY-sRNA-6 as determined by double fluorescent reporter gene test.

    [0155] FIG. 39: The pathological test results in a pulmonary fibrosis model of mice alleviated by Sphinganine-HJT-sRNA-m7.

    [0156] FIG. 40: The results of Masson staining in a pulmonary fibrosis model of mice alleviated by Sphinganine-HJT-sRNA-m7.

    [0157] FIG. 41: The statistical results of Masson staining in a pulmonary fibrosis model of mice alleviated by Sphinganine-HJT-sRNA-m7.

    [0158] FIG. 42A-G: The test results of the cytokine expression level in plasma of mouse inflammation model reduced by Sphinganine-PGY-sRNA-6.

    [0159] FIG. 43: By measuring the dependency of the fluorescence emission intensity of 1,6-diphenyl-1,3,5-hexatriene (DPH) on the concentration of surfactants, the critical micelle concentration (cmc) values of only small RNA and only Sphinganine are shown.

    [0160] FIG. 44A-D: The CMC properties of bencaosome sphinganine(So(d22:0))+200 nM or 600 nM sRNA with and without heat treatment.

    [0161] FIG. 45: Comparison of the static light scattering intensity of water, So(d22:0), So(d22:0)+200 nM, 400 nM or 600 nM sRNA.

    [0162] FIG. 46: Comparison of the Zeta potential of So(d22:0), So(d22:0)+200 nM, 400 nM or 600 nM sRNA.

    [0163] FIG. 47A-B: Particle size distribution of So(d22:0) and So(d22:0)+600 nM sRNA.

    [0164] FIG. 47C-D: Transmission electron microscopy of So(d22:0) and So(d22:0)+600 nM sRNA.

    [0165] FIG. 48: Different types of lipid combinations deliver single-stranded nucleic acid into MRC-5.

    [0166] FIG. 49A-B: Lipid combination delivers single-stranded nucleic acid into MRC-5 or Caco-2 cells.

    [0167] FIG. 50: Lipid combination delivers single-stranded nucleic acid into cells.

    [0168] FIG. 51: Lipid combination delivers single-stranded nucleic acid into cells.

    [0169] FIG. 52: Lipid combination delivers single-stranded nucleic acid into cells.

    [0170] FIG. 53: Lipid combination delivers single-stranded nucleic acid into A549 cells.

    [0171] FIG. 54: Lipid combination delivers single-stranded nucleic acid into A549 cells.

    [0172] FIG. 55: Lipid combination delivers single-stranded nucleic acid into A549 cells.

    [0173] FIG. 56: Lipid combination delivers single-stranded nucleic acid into A549 cells.

    [0174] FIG. 57: Lipid combination delivers single-stranded nucleic acid into A549 cells.

    [0175] FIG. 58: Lipid combination delivers single-stranded nucleic acid into A549 cells.

    [0176] FIG. 59: Lipid combination delivers single-stranded nucleic acid into A549 cells.

    [0177] FIG. 60: Lipid combination delivers single-stranded nucleic acid into A549 cells.

    [0178] FIG. 61: Lipid combination delivers single-stranded nucleic acid into A549 cells.

    [0179] FIG. 62: Lipid combination delivers single-stranded nucleic acid into A549 cells.

    [0180] FIG. 63: Lipid combination delivers single-stranded nucleic acid into A549 cells.

    [0181] FIG. 64: Lipid combination delivers single-stranded nucleic acid into A549 cells.

    [0182] FIG. 65: Lipid combination delivers double-stranded nucleic acid into MRC-5 cells.

    [0183] FIG. 66: Lipid combination delivers double-stranded nucleic acid into MRC-5 cells.

    [0184] FIG. 67: Lipid combination delivers double-stranded nucleic acid into A549 cells.

    [0185] FIG. 68: Lipid combination delivers double-stranded nucleic acid into A549 cells.

    [0186] FIG. 69: Lipid combination delivers double-stranded nucleic acid into A549 cells.

    [0187] FIG. 70: Lipid combination delivers double-stranded nucleic acid into A549 cells.

    [0188] FIG. 71: Lipid combination delivers double-stranded nucleic acid into A549 cells.

    [0189] FIG. 72: Lipid combination delivers double-stranded nucleic acid into A549 cells.

    [0190] FIG. 73: Lipid combination delivers double-stranded nucleic acid into A549 cells.

    [0191] FIG. 74: Lipid combination delivers double-stranded nucleic acid into A549 cells

    [0192] FIG. 75: Lipid combination delivers double-stranded nucleic acid into MRC-5 cells.

    [0193] FIG. 76: Lipid combination delivers double-stranded nucleic acid into MRC-5 cells.

    [0194] FIG. 77: Lipid combination delivers double-stranded nucleic acid into MRC-5 cells.

    [0195] FIG. 78: Lipid combination delivers double-stranded nucleic acid into MRC-5 cells.

    [0196] FIG. 79: Lipid combination delivers double-stranded nucleic acid into MRC-5 cells.

    [0197] FIG. 80: Lipid combination delivers double-stranded nucleic acid into MRC-5 cells.

    [0198] FIG. 81: Lipid combination delivers double-stranded nucleic acid into MRC-5 cells.

    [0199] FIG. 82: Lipid composition facilitates nucleic acids to enter lung through the digestive tract.

    [0200] FIG. 83: No. 8(PE):No. 12(PC) (v:v=1:2) mediates the entry of anti-fibrotic HJT-sRNA-m7 into MRC-5 cells to reduce the expression of fibronectin.

    [0201] FIG. 84: No. 8(PE):No. 12(PC) (v:v=1:2) mediates the entry of siRNA into A549 cells to inhibit the expression of corresponding proteins.

    [0202] FIG. 85: No. 8(PE):No. 12(PC) (v:v=1:2) mediates the entry of siRNA into A549 cells to inhibit the expression of corresponding proteins.

    [0203] FIG. 86: No. 8(PE):No. 12(PC) (v:v=1:2) mediates the entry of siRNA into THP-1 cells to inhibit the expression of corresponding proteins.

    [0204] FIG. 87: No. 8(PE):No. 12(PC):No. 2(DG) (v:v:v=2:4:3) mediates the entry of anti-fibrotic HJT-sRNA-m7 into MRC-5 cells to reduce the expression of fibronectin.

    [0205] FIG. 88: No. 8(PE):No. 12(PC):No. 2(DG) (v:v:v=2:4:3) lipid combination mediates the entry of XRN2 siRNA into A549 cells to inhibit gene expression (boiling method).

    [0206] FIG. 89: No. 8(PE):No. 12(PC):No. 4(Cer) (v:v:v=1:2:1) lipid combination mediates the entry of anti-fibrotic HJT-sRNA-m7 into MRC-5 cells (boiling method).

    [0207] FIG. 90: No. 8(PE):No. 12(PC):No. 4(Cer) (v:v:v=1:2:1) lipid combination mediates the entry of NFB siRNA into THP-1 cells to inhibit gene expression (boiling method).

    [0208] FIG. 91: No. 8(PE):No. 12(PC):No.PC(11) (v:v:v=1:2:1) lipid combination mediates the entry of XRN2 siRNA into A549 cells to inhibit gene expression.

    [0209] FIG. 92: No. 8(PE):No. 12(PC):No.LPC(37) (v:v:v=1:2:1) lipid combination mediates the entry of XRN2 siRNA into A549 cells to inhibit gene expression.

    [0210] FIG. 93: No. 8(PE):No. 12(PC):No.MG(34) (v:v:v=2:3:1) lipid combination mediates the entry of CPSF4 siRNA into A549 cells to inhibit gene expression.

    [0211] FIG. 94: No. 38(PE):No. 37(LPC):No. 32(TG) (v:v:v=32:8:5) lipid combination mediates the entry of anti-fibrotic HJT-sRNA-m7 into MRC-5 cells (boiling method).

    [0212] FIG. 95: No. 38(PE):No. 37(LPC):No. 32(TG) (v:v:v=32:8:5) lipid combination mediates the entry of XRN2 siRNA into A549 cells to inhibit gene expression.

    [0213] FIG. 96: No. 1(DG), No. 8(PE), No. 12(PC), No. 4(Cer), No. 31(So), No. 29(FA), No. 16(TG) (v:v:v:v:v:v:v=2:1:2:2:3:1:3) mediates the entry of anti-fibrotic HJT-sRNA-m7 into MRC-5 cells(boiling method) to reduce the expression of fibronectin.

    [0214] FIG. 97: No. 1(DG), No. 8(PE), No. 12(PC), No. 4(Cer), No. 31(So), No. 29(FA), No. 16(TG) (v:v:v:v:v:v:v=2:1:2:2:3:1:3) lipid combination mediates the entry of XRN2 siRNA into A549 cells to inhibit gene expression.

    [0215] FIG. 98: No. 8(PE):No. 12(PC):No. 31(So):No. 29(FA):No. 4(Cer) (v:v:v:v:v=2:4:2:2:2.5) mediates the entry of anti-fibrotic HJT small RNA HJT-sRNA-3, HJT-sRNA-a2, HJT-sRNA-h3, HJT-sRNA-m7 into MRC-5 cells (boiling method) to reduce the expression of fibronectin.

    [0216] FIG. 99: No. 8(PE):No. 12(PC):No. 31(So):No. 29(FA):No. 4(Cer) (v:v:v:v:v=2:4:2:2:2.5) lipid combination can effectively deliver nucleic acid into cells to function.

    [0217] FIG. 100: No. 38(PE):No. 37(LPC) (v:v=4:1) mediates the entry of anti-fibrotic HJT small RNA HJT-sRNA-3, HJT-sRNA-a2, HJT-sRNA-h3, HJT-sRNA-m7 into MRC-5 cells (boiling method) to reduce the expression of fibronectin and alpha-matrix protein.

    [0218] FIG. 101: No. 38(PE):No. 37(LPC) (v:v=4:1) lipid combination mediates the entry of XRN2 siRNA into A549 cells to inhibit gene expression (boiling method).

    [0219] FIG. 102: No. 38(PE):No. 12(PC):No. 2(DG) (v:v:v=4:1:3) lipid combination mediates the entry of XRN2 siRNA into A549 cells to inhibit gene expression.

    [0220] FIG. 103: No. 38(PE):No. 37(LPC):No. 12(PC) (v:v:v=4:1:1) lipid combination mediates the entry of XRN2 siRNA into A549 cells to inhibit gene expression (reverse evaporation method).

    [0221] FIG. 104: No. 4(Cer):No. 12(PC):No. 38(PE):No. 37(LPC) (v:v:v:v=5:2:8:3) lipid combination mediates the entry of anti-fibrotic HJT small RNA HJT-sRNA-3, HJT-sRNA-a2, HJT-sRNA-h3, HJT-sRNA-m7 into MRC-5 cells (boiling method).

    [0222] FIG. 105: No. 4(Cer):No. 12(PC):No. 38(PE):No. 37(LPC) (v:v:v:v=5:2:8:3) lipid combination mediates the entry of XRN2 siRNA into A549 cells to inhibit gene expression (boiling method).

    [0223] FIG. 106: No. 38(PE):No. 2(DG):No. 31(So) (v:v:v=4:2:3) lipid combination mediates the entry of anti-fibrotic HJT small RNA HJT-sRNA-3, HJT-sRNA-a2, HJT-sRNA-h3, HJT-sRNA-m7 into MRC-5 cells (boiling method).

    [0224] FIG. 107: No. 38(PE):No. 2(DG):No. 31(So) (v:v:v=4:2:3) lipid combination mediates the entry of XRN2 siRNA into A549 cells to inhibit gene expression (boiling method).

    [0225] FIG. 108: Lipid No. 41 delivers double-stranded DNA into A549 cells by different preparation methods (boiling method or reverse evaporation method).

    [0226] FIG. 109: Lipid No. 41 delivers double-stranded RNA into MRC-5 cells by different preparation methods (boiling method or reverse evaporation method).

    [0227] FIG. 110: Lipid No. 41 delivers single-stranded RNA into A549 and MRC-5 cells by boiling method.

    [0228] FIG. 111: The efficiency of lipid delivery of nucleic acid determined by digital PCR (ddPCR) technique.

    [0229] FIG. 112: The efficiency of lipid delivery of nucleic acid determined by flow cytometry.

    [0230] FIG. 113: The locations of lipid-delivered nucleic acid in cells observed using confocal fluorescence microscope.

    [0231] FIG. 114: The efficiency of lipid delivery of nucleic acid determine by Western Blotting test.

    [0232] FIG. 115: Lipid monomer No. 41 mediates the entry of anti-fibrotic HJT-sRNA-m7 into MRC-5 cells (boiling method).

    [0233] FIG. 116: The use of lipid combination 1 (No. 8+No. 41=6:1) and lipid combination 2 (No. 38+No. 41=6:1) in the delivery of nucleic acids.

    [0234] FIG. 117: The use of lipid combination 3 (No. 39+No. 41=6:1) and lipid combination 4 (No. 40+No. 41=6:1) in the delivery of nucleic acids.

    [0235] FIG. 118: The use of lipid combination 5 (38+12+41+29=1:2:1:1) in the delivery of nucleic acids.

    [0236] FIG. 119: The use of lipid combination 6 (40(PE)+12(PC)+41(So)=2:4:3) in the delivery of nucleic acids.

    [0237] FIG. 120: The use of lipid combination 7 (12(PC)+41(So)=1:6) and lipid combination 8 (12(PC)+41(So)=1:1) in the delivery of nucleic acids.

    [0238] FIG. 121: The use of lipid combination 9 (12(PC)+41(So)=6:1) and lipid combination 10 (40(PE)+12(PC)+41(So)=2:2:2) in the delivery of nucleic acids.

    [0239] FIG. 122: The use of lipid combination 11(4(Cer)+12(PC)+41(So)=1:1:1) in the delivery of nucleic acids.

    [0240] FIG. 123: Lipid No. 38 delivers double-stranded RNA into A549 and MRC-5 cells by boiling method.

    [0241] FIG. 124: Lipid No. 38 delivers single-stranded RNA into A549 and MRC-5 cells by boiling method.

    [0242] FIG. 125: The efficiency of lipid delivery of nucleic acid determined by Digital PCR (ddPCR) technique.

    [0243] FIG. 126: The efficiency of lipid delivery of nucleic acid determined by flow cytometry.

    [0244] FIG. 127: The locations of lipid-delivered nucleic acid in cells observed using confocal fluorescence microscope.

    [0245] FIG. 128: Lipid No. 64 delivers double-stranded RNA into A549 cells by different preparation methods (boiling method or reverse evaporation method).

    [0246] FIG. 129: The efficiency of lipid delivery of nucleic acid determined by flow cytometry.

    [0247] FIG. 130: The locations of lipid-delivered nucleic acid in cells observed using confocal fluorescence microscope.

    [0248] FIG. 131: The delivery effects of lipid No. 40 in boiling method and reverse evaporation method.

    [0249] FIG. 132: The efficiency of lipid delivery of nucleic acid determined by Digital PCR (ddPCR) technique.

    [0250] FIG. 133: The locations of lipid-delivered nucleic acid in cells observed using confocal fluorescence microscope.

    [0251] FIG. 134: The efficiency of lipid delivery of nucleic acid determined by Western Blotting test.

    [0252] FIG. 135: Lipid No. 37 delivers single-stranded RNA into A549 cells and MRC-5 cells by boiling method.

    [0253] FIG. 136: Lipid No. 39 delivers double-stranded RNA into A549 cells by different preparation methods (boiling method or reverse evaporation method).

    [0254] FIG. 137: The efficiency of lipid delivery of nucleic acid determined by Digital PCR (ddPCR) technique.

    [0255] FIG. 138: Lipid No. 60 delivers double-stranded RNA into A549 cells by different preparation methods (boiling method or reverse evaporation method).

    [0256] FIG. 139: Lipid No. 62 delivers double-stranded RNA into A549 cells by different preparation methods (boiling method or reverse evaporation method).

    [0257] FIG. 140: Lipid No. 41 can promote the entry of small RNA into blood and protect it from degradation in the blood.

    [0258] FIG. 141: Lipid No. 41 can promote the entry of small RNA into gastric cells and protect it from degradation in the stomach.

    [0259] FIG. 142: Lipid No. 41 can promote the entry of small RNA into small intestinal cells and protect it from degradation in the small intestine.

    [0260] FIG. 143: Lipid No. 41 can promote the entry of small RNA into liver and protect it from degradation in the liver.

    [0261] FIG. 144: PE monomer (No. 38) can effectively deliver sRNA single-stranded nucleic acid into the blood of mice by oral administration.

    [0262] FIG. 145: PE monomer (No. 40) can effectively deliver sRNA single-stranded nucleic acid into the blood of mice by oral administration.

    [0263] FIG. 146: PE monomer (No. 64) can effectively deliver sRNA single-stranded nucleic acid into the blood of mice by oral administration.

    [0264] FIG. 147: PE monomer (No. 71) can effectively deliver sRNA single-stranded nucleic acid into the blood of mice by oral administration.

    [0265] FIG. 148: Lipids effectively deliver single-stranded nucleic acids into MRCS cells under different temperature gradients.

    [0266] FIG. 149A-D: The entry of GFP protein of PE(16:0/22:1)-GFP (reverse evaporation method) into A549 cells as determined by flow cytometry.

    [0267] FIG. 150A-H: The entry of GFP protein of sphinganine(d22:0)-GFP (reverse evaporation method and boiling method) in A549 cells as determined by flow cytometry.

    [0268] FIG. 151A-D: The entry of GFP protein of PE(16:0/16:0)-GFP (reverse evaporation method) in A549 cells as determined by flow cytometry.

    [0269] FIG. 152: The entry of GFP protein of PE(16:0/22:1)-GFP (reverse evaporation method) in A549 cells as determined by flow cytometry.

    [0270] FIG. 153: The entry of GFP protein of sphinganine(d22:0)-GFP (reverse evaporation method) in A549 cells as determined by confocal fluorescence microscope.

    [0271] FIG. 154: The entry of GFP protein of PE (16:0/16:0)-GFP (reverse evaporation method) in A549 cells as determined by confocal fluorescence microscope.

    DETAILED DESCRIPTION

    [0272] A decoction is thermally processed and its main functional components must be thermally stable. Our research proved that small RNA is a new type of functional component in decoction for the first time. We extracted thermally stable decoctosome from the decoction and identified its ingredients. We found that the decoctosome comprises a large amount of lipids, compounds, proteins and nucleic acids. Our lab proved that decoctosome has better disease treatment effect than decoction by comparison. The decoctosome was confirmed by us for the first time as a new type of drug. We also found that a single compound, sphingosine, can deliver herbal medicine small RNAs in mice by oral administration, thereby improving disease symptoms. We mixed the single compound sphingosine with small RNA and conducted heating treatment to form a bencaosome. We also revealed the method for preparing bencaosome for the first time. This may be a combination drug in precision medicine, and also provides an effective oral delivery route for nucleic acid therapy.

    [0273] Through a lot of experiments, the inventor surprisingly discovered that there were some lipid components in some herbal medicines (including Rhodiola crenulata, Taraxacum mongolicum, Andrographis paniculata and Lonicera japonica). These lipids derived from herbal medicines can promote the absorption/entry of nucleic acids such as small RNAs into cells and/or target sites in a subject in need thereof. In the present application, the lipid component is synthetic.

    [0274] The inventor has surprisingly found that various lipids can form lipid-nucleic acid mixture that effectively promote the absorption and entry of nucleic acid into cells, which has the potential to increase the efficiency of clinical delivery of the nucleic acid drug. Further studies have shown that the lipid nucleic acid mixture of the present application promotes the efficiency of nucleic acid absorption and entry into cells in different cell lines, but differences were observed in different cell lines, which provides the possibility of targeted drug delivery. Moreover, such lipid nucleic acid mixtures show no sequence selectivity in nucleic acid delivery, and could deliver nucleic acid fragments having different sequences and sizes corresponding to small RNA (e.g. about 20 bp). In addition, confocal laser-scanning microscopy confirmed that the lipid nucleic acid mixture formed by artificially synthetic lipids can effectively promote the entry of exogenous nucleic acids into cytoplasm. The inventor has unexpectedly discovered that lipid nucleic acid mixtures prepared by boiling method or reverse evaporation method can facilitate entry of nucleic acids, such as RNA, into blood circulation and target tissues via non-invasive routes (e.g. via digestive tract, respiratory tract and topical administration). The inventor has also surprisingly discovered that lipids of the present application are capable of promoting entry of nucleic acids, such as RNA, into cells and modulating (e.g., inhibiting) the expression of their target sequences, while not exhibiting such modulating effects on non-target sequences, suggesting a target-specific modulating effect, which can be used as a mean for the delivery of nucleic acid drug.

    TABLE-US-00001 TABLE 1 Lipids in HJT decoctosome and PGY decoctosome. Molecular HJT PGY No. Lipid in ionic form weight Molecular formula decoctosome decoctosome 1 So(d20:0) + H 330.3366555 C20 H44 O2 N1 390326.091 1 2 So(d22:2) + H 354.3366555 C22 H44 O2 N1 1379473.756 1 3 So(d22:1) + H 356.3523055 C22 H46 O2 N1 3097636.171 1 4 So(d22:0) + H 358.3679555 C22 H48 O2 N1 4320212.925 1 5 LPC(16:0e) + H 482.3605035 C24 H53 O6 N1 P1 4320212.925 1 6 Cer(d14:1/16:0) + H 484.4724205 C30 H62 O3 N1 4586722.432 1 7 LPC(16:0) + H 496.3397685 C24 H51 O7 N1 P1 8208508.397 1 8 DG(6:0/22:5) + H 503.3731015 C31 H51 O5 4.72E+07 1 9 DG(16:1p/13:0) + H 509.4564365 C32 H61 O4 5.42E+07 1 10 LPC(18:0e) + H 510.3918035 C26 H57 O6 N1 P1 5.42E+07 1 11 Cer(d16:0/16:0) + H 512.5037205 C32 H66 O3 N1 2.34E+08 1 12 LPC(18:3) + H 518.3241185 C26 H49 O7 N1 P1 316425.605 4.07E+02 13 LPC(18:2) + H 520.3397685 C26 H51 O7 N1 P1 5807248.56 1075.766 14 LPC(18:1) + H 522.3554185 C26 H53 O7 N1 P1 5078868.945 6711.751 15 LPC(18:0) + H 524.3710685 C26 H55 O7 N1 P1 1.07E+05 6.72E+03 16 Cer(d18:2/16:1) + H 534.4880705 C34 H64 O3 N1 2.97E+07 7810.991 17 Cer(d18:1/16:1) + H 536.5037205 C34 H66 O3 N1 340747.965 14732.878 18 Cer(d18:1/16:0) + H 538.5193705 C34 H68 O3 N1 1.00E+00 3.72E+04 19 Cer(d16:0/18:0) + H 540.5350205 C34 H70 O3 N1 4.54E+06 4.05E+04 20 DG(161p/16:1) + H 549.4877365 C35 H65 O4 2373784.858 5.96E+04 21 DG(16:1p/16:0) + H 551.5033865 C35 H67 O4 3785087.325 59743.287 22 Cer(d18:2/16:0 + O) + H 552.4986355 C34 H66 O4 N1 328656.286 6.47E+04 23 Cer(d18:1/16:0 + O) + H 554.5142855 C34 H68 O4 N1 1709530.119 6.57E+04 24 Cer(d18:0/16:0 + O) + H 556.5299355 C34 H70 O4 N1 69546.865 77640.353 25 Cer(d18:0/18:3) + H 562.5193705 C36 H68 O3 N1 8092209.236 78841.083 26 Cer(d18:0/18:0) + H 568.5663205 C36 H74 O3 N1 6263411.658 80672.649 27 DG(16:1p/18:3) + H 573.4877365 C37 H65 O4 3183225.696 95450.14 28 DG(16:1p/18:2) + H 575.5033865 C37 H67 O4 8060692.43 100225.291 29 DG(16:1p/18:1) + H 577.5190365 C37 H69 O4 3008362.348 109555.742 30 Cer(d18:2/18:1 + O) + H 578.5142855 C36 H68 O4 N1 154813.142 117172.14 31 MG(33:4) + NH4 578.5142855 C36 H68 O4 N1 198407.509 134402.957 32 Cer(d18:1/18:1 + O) + H 580.5299355 C36 H70 O4 N1 9278565.831 139454.808 33 Cer(d18:1/18:0 + O) + H 582.5455855 C36 H72 O4 N1 922911.966 140010.676 34 DG(18:4/16:0) + H 589.4826515 C37 H65 O5 414144.075 146303.475 35 DG(16:0/16:0) + Na 591.4958965 C35 H68 O5 Na1 810363.971 159657.752 36 DG(16:0/18:3) + H 591.4983015 C37 H67 O5 1237322.198 161541.242 37 Cer(d20:0/18:0) + H 596.5976205 C38 H78 O3 N1 535487.515 162548.741 38 DG(18:2p/18:3) + H 599.5033865 C39 H67 O4 2100112.341 214838.29 39 DG(16:0e/18:2) + Na 601.5166315 C37 H70 O4 Na1 5987013.807 215132.574 40 DG(18:2p/18:2) + H 601.5190365 C39 H69 O4 5992262.247 215132.574 41 DG(16:0e/18:1) + Na 603.5322815 C37 H72 O4 Na1 911489.165 264655.886 42 DG(18:2p/18:1) + H 603.5346865 C39 H71 O4 293514.636 281788.08 43 DG(18: p/18:0) + H 607.5659865 C39 H75 O4 125637.415 295480.566 44 Cer(d18:2/20:0 + O) + H 608.5612355 C38 H74 O4 N1 1318843.199 312661.769 45 DG(16:0/18:2) + NH4 610.5405005 C37 H72 O5 N1 611494.546 340900.922 46 Cer(d18:1/20:0 + O) + H 610.5768855 C38 H76 O4 N1 2.33E+07 380924.111 47 DG(18:4/18:3) + H 611.4670015 C39 H63 O5 1.63E+07 390486.593 48 DG(18:3/18:3) + H 613.4826515 C39 H65 O5 2984204.99 413899.239 49 DG(18:3/18:2) + H 615.4983015 C39 H67 O5 285681.918 414960.383 50 DG(18:1/18:3) + H 617.5139515 C39 H69 O5 2292951.254 421434.548 51 Cer(d18:2/22:0) + H 620.5976205 C40 H78 O3 N1 3293287.666 422725.598 52 TG(4:0/14:0/16:2) + NH4 624.5197655 C37 H70 O6 N1 547860.816 427994.277 53 Cer(d22:0/18:0) + H 624.6289205 C40 H82 O3 N1 547860.816 427994.277 54 Cer(d18:2/24:1) + H 646.6132705 C42 H80 O3 N1 4570947.798 463579.332 55 Cer(d18:2/24:0) + H 648.6289205 C42 H82 O3 N1 927304.311 467709.326 56 Cer(d18:1/24:0) + H 650.6445705 C42 H84 O3 N1 2.26E+05 4.88E+05 57 Cer(d18:0/24:0) + H 652.6602205 C42 H86 O3 N1 191262.664 493993.59 58 DG(17:1/22:5) + H 655.5296015 C42 H71 O5 226398.328 493993.59 59 PE(15:0/15:0) + H 664.4911835 C35 H71 O8 N1 P1 9690748.232 505250.994 60 Cer(d18:2/26:1) + H 674.6445705 C44 H84 O3 N1 1061171.306 5.24E+05 61 SM(d16:0/16:1) + H 675.5435525 C37 H76 O6 N2 P1 5.81E+05 5.24E+05 62 PE(16:1/15:0) + H 676.4911835 C36 H71 O8 N1 P1 1212434.548 527966.642 63 TG(8:0e/13:0/18:2) + NH4 680.6187505 C42 H82 O5 N1 2.10E+07 586734.726 64 TG(8:0p/15:1/18:2) + H 687.5922015 C44 H79 O5 2016850.917 591047.503 65 PE(16:1/16:1) + H 688.4911835 C37 H71 O8 N1 P1 2016850.917 591047.503 66 PE(16:0/16:1) + H 690.5068335 C37 H73 O8 N1 P1 2044649.034 591047.503 67 PE(16:0/16:0) + H 692.5224835 C37 H75 O8 N1 P1 1 596452.251 68 PA(16:0/18:2) + Na 695.4622295 C37 H69 O8 N0 P1 Na1 1583729.741 604589.292 69 CerG1(d18:2/16:1) + H 696.5408955 C40 H74 O8 N1 2.94E+07 607151.481 70 CerG1(d18:2/16:0) + H 698.5565455 C40 H76 O8 N1 1001209.029 612230.949 71 CerG1(d18:1/16:0)+H 700.5721955 C40 H78 O8 N1 1001209.029 612230.949 72 SM(d16:0/18:2) + H 701.5592025 C39 H78 O6 N2 P1 1 615958.136 73 SM(d16:0/18:1) + H 703.5748525 C39 H80 O6 N2 P1 9689636.668 620573.75 74 PE(16:0/17:1) + H 704.5224835 C38 H75 O8 N1 P1 1119078.425 626407.441 75 PE(16:1/18:3) + H 712.4911835 C39 H71 O8 N1 P1 4712407.932 641633.829 76 PE(16:0/18:3) + H 714.5068335 C39 H73 O8 N1 P1 4712407.932 641633.829 77 CerG1(d18:2/16:0 + O) + H 714.5514605 C40 H76 O9 N1 5374247.838 655355.366 78 PE(16:0/18:2) + H 716.5224835 C39 H75 O8 N1 P1 77238.228 657638.592 79 CerG1(d16:0/18:1 + O) + H 716.5671105 C40 H78 O9 N1 163980.93 737837.362 80 PE(16:0/18:1) + H 718.5381335 C39 H77 O8 N1 P1 1894363.216 808505.904 81 PC(16:0e/16:1) + H 718.5745185 C40 H81 O7 N1 P1 1894363.216 808505.904 82 CerG1(d18:2/18:2) + H 722.5565455 C42 H76 O8 N1 6.74E+07 816985.595 83 PE(17:1/18:1) + H 730.5381335 C40 H77 O8 N1 P1 9583122.002 833575.452 84 SM(d16:0/20:1) + H 731.6061525 C41 H84 O6 N2 P1 2523788.556 835252.778 85 PE(16:0/19:1) + H 732.5537835 C40 H79 O8 N1 P1 936107.02 864415.827 86 PC(16:0/16:1) + H 732.5537835 C40 H79 O8 N1 P1 936107.02 864415.827 87 PC(16:0/16:0) + H 734.5694335 C40 H81 O8 N1 P1 1407657.532 879913.51 88 PE(18:3/18:2) + H 738.5068335 C41 H73 O8 N1 P1 9925101.043 985477.837 89 PE(18:2/18:2) + H 740.5224835 C41 H75 O8 N1 P1 3302104.175 1077270.174 90 TG(8:0/14:0/20:0) + NH4 740.6762655 C45 H90 O6 N1 2264998.498 1094998.386 91 PE(18:1/18:2) + H 742.5381335 C41 H77 O8 N1 P1 1150383.999 1109902.361 92 PC(15:0/18:2) + H 744.5537835 C41 H79 O8 N1 P1 1150383.999 1109902.361 93 PE(18:1/18:1) + H 744.5537835 C41 H79 O8 N1 P1 1150383.999 1109902.361 94 PC(16:0e/18:1) + H 746.6058185 C42 H85 O7 N1 P1 1229361.511 1129970.461 95 StE(22:1) + NH4 750.7122555 C51 H92 O2 N1 2745523.195 1129999.635 96 Cer(d18:2/32:4) + H 752.6915205 C50 H90 O3 N1 2745523.195 1129999.635 97 MGDG(16:0/18:3) + H 753.5511265 C43 H77 O10 2832053.494 1144067.874 98 TG(16:0/13:0/14:0) + NH4 754.6919155 C46 H92 O6 N1 4167371.876 1156642.369 99 PC(16:1/18:2) + H 756.5537835 C42 H79 O8 N1 P1 2.92E+07 1187856.898 100 PC(16:0/18:2) + H 758.5694335 C42 H81 O8 N1 P1 573145.979 1202535.92 101 SM(d16:0/22:1) + H 759.6374525 C43 H88 O6 N2 P1 1811041.154 1279973.45 102 PC(16:0/18:1) + H 760.5850835 C42 H83 O8 N1 P1 1811041.154 1279973.45 103 PC(18:0/16:0) + H 762.6007335 C42 H85 O8 N1 P1 1811041.154 1279973.45 104 TG(10:0/16:0/18:2) + NH4 764.6762655 C47 H90 O6 N1 1479856.98 1297842.776 105 TG(16:1/14:0/14:0) + NH4 766.6919155 C47 H92 O6 N1 1571400.019 1312345.569 106 PC(16:0e/20:4) + H 768.5901685 C44 H83 O7 N1 P1 51584.528 1330852.698 107 TG(16:0/14:0/14:0) + NH4 768.7075655 C47 H94 O6 N1 1699184.802 1335516.265 108 PC(18:0e/18:2) + H 772.6214685 C44 H87 O7 N1 P1 1699184.802 1335516.265 109 ZyE(26:4) + NH4 772.6966055 C53 H90 O2 N1 3061880.829 1337721.591 110 StE(24:3) + NH4 774.7122555 C53 H92 O2 N1 1658135.266 1356818.368 111 ZyE(26:3) + NH4 774.7122555 C53 H92 O2 N1 1658135.266 1356818.368 112 MGDG(18:3/18:3) + H 775.5354765 C45 H75 O10 1658135.266 1356818.368 113 MGDG(16:0/20:5) + H 777.5511265 C45 H77 O10 1.23E+07 1397050.829 114 PC(16:1/20:5) + H 778.5381335 C44 H77 O8 N1 P1 1160671.162 1409504.853 115 TG(16:1/14:0/15:1) + NH4 778.6919155 C48 H92 O6 N1 2859743.403 1409504.853 116 PC(16:1/20:4) + H 780.5537835 C44 H79 O8 N1 P1 6388353.447 1421139.681 117 CerG1(d18:2/22:1) + H 780.6347955 C46 H86 O8 N1 3996861.474 1428550.812 118 TG(16:0/13:0/16:1) + NH4 780.7075655 C48 H94 O6 N1 4104926.614 1428550.812 119 PC(16:0/20:4) + H 782.5694335 C44 H81 O8 N1 P1 2293306.68 1443289.679 120 TG(16:0/14:0/15:0) + NH4 782.7232155 C48 H96 O6 N1 4.93E+06 1.45E+06 121 PC(16:0/20:3) + H 784.5850835 C44 H83 O8 N1 P1 1687489.65 1457777.891 122 PC(18:0/18:2) + H 786.6007335 C44 H85 O8 N1 P1 1826384.028 1568242.71 123 SM(d16:0/24:1) + H 787.6687525 C45 H92 O6 N2 P1 1 1574194.876 124 PC(18:0/18:1) + H 788.6163835 C44 H87 O8 N1 P1 201033.513 1578140.397 125 TG(16:0e/13:0/16:0) + K 789.6732845 C48 H94 O5 K1 4905987.584 1586487.641 126 TG(16:1/12:0/18:1) + NH4 792.7075655 C49 H94 O6 N1 793977.438 1624200.908 127 TG(16:0/14:0/16:1) + NH4 794.7232155 C49 H96 O6 N1 2.56E+07 1712458.663 128 Co(Q9) + H 795.6285865 C54 H83 O4 4091215.849 1723000.308 129 TG(16:0/14:0/16:0) + NH4 796.7388655 C49 H98 O6 N1 2545856.286 1757197.789 130 MGDG(18:3/20:6) + H 797.5198265 C47 H73 O10 3828334.683 1796758.817 131 PC(16:0/21:3) + H 798.6007335 C45 H85 O8 N1 P1 3193628.707 1832224.876 132 MGDG(18:2/20:6) + H 799.5354765 C47 H75 O10 3193628.707 1832224.876 133 PE(22:0/18:2) + H 800.6163835 C45 H87 O8 N1 P1 627830.742 1844821.277 134 PC(16:0e/22:2) + H 800.6527685 C46 H91 O7 N1 P1 451258.13 1866334.475 135 CerGl(d22:0/18:1 + O) + H 800.6610105 C46 H90 O9 N1 1.25E+07 1885698.509 136 MGDG(18:2/20:5) + H 801.5511265 C47 H77 O10 3218234.483 1975336.948 137 MGDG(18:1/20:4) + H 805.5824265 C47 H81 O10 3218234.483 1975336.948 138 PC(16:0/22:6) + H 806.5694335 C46 H81 O8 N1 P1 3225480.406 1975336.948 139 TG(16:0/15:1/16:1) + NH4 806.7232155 C50 H96 O6 N1 3218234.483 1975890.277 140 CerG1(d18:2/24:1) + H 808.6660955 C48 H90 O8 N1 1515567.592 2036335.679 141 TG(16:0/15:0/16:1) + NH4 808.7388655 C50 H98 O6 N1 5722635.222 2042316.725 142 PC(18:0/20:4) + H 810.6007335 C46 H85 O8 N1 P1 5215144.093 2070037.151 143 TG(16:0/15:0/16:0) + NH4 810.7545155 C50 H100 O6 N1 5215144.093 2070037.151 144 SM(d16:0/26:3) + H 811.6687525 C47 H92 O6 N2 P1 3638255.96 2169861.389 145 PE(16:0/22:1) + K 812.5566165 C43 H84 O8 N1 P1 K1 3171629.347 2240390.664 146 PC(20:1/18:2) + H 812.6163835 C46 H87 O8 N1 P1 1.24E+07 2248084.433 147 SM(d16:0/26:2) + H 813.6844025 C47 H94 P6 N2 P1 3124941.275 2255746.981 148 PG(16:0/22:5) + NH4 814.5592635 C44 H81 O10 N1 P1 3124941.275 2255746.981 149 PC(20:0p/19:1) + H 814.6684185 C47 H93 O7 N1 P1 3124941.275 2255746.981 150 SM(d16:0/26:1) + H 815.7000525 C47 H96 O6 N2 P1 3.07E+07 2266806.368 151 CerGl(d22:1/18:0 + 2O) + H 816.6559255 C46 H90 O10 N1 7701671.44 2294410.726 152 TG(16:1/14:0/18:2) + NH4 818.7232155 C51 H96 O6 N1 94806.519 2337992.129 153 TG(16:0/14:0/18:2) + NH4 820.7388655 C51 H98 O6 N1 7.68E+07 2437867.716 154 TG(16:0/14:0/18:1) + NH4 822.7545155 C51 H100 O6 N1 6539612.263 2476000.263 155 TG(16:0/16:0/16:0) + NH4 824.7701655 C51 H102 O6 N1 67055.821 2510367.052 156 TG(18:4/16:0/16:0) + H 827.7123165 C53 H95 O6 7602971.241 2515441.944 157 PE(24:0/18:2) + H 828.6476835 C47 H91 O8 N1 P1 1079526.046 2537702.771 158 CerG1(d24:0/18:1 + O) + H 828.6923105 C48 H94 O9 N1 8497622.232 2555017.725 159 TG(16:0/16:0/18:3) + H 829.7279665 C53 H97 O6 8845982.298 2555017.725 160 TG(16:1/15:0/18:2) + NH4 832.7388655 C52 H98 O6 N1 8.15E+07 2555864.359 161 TG(16:0/16:1/17:1) + NH4 834.7545155 C52 H100 O6 N1 1665504.949 2583546.213 162 PI(16:0/18:2) + H 835.5331095 C43 H80 O13 N0 P1 7836794.71 2660458.252 163 TG(16:0/15:0/18:1) + NH4 836.7701655 C52 H102 O6 N1 7836794.71 2660458.252 164 TG(16:0/16:0/17:0) + NH4 838.7858155 C52 H104 O6 N1 1 2667039.687 165 TG(14:0/18:2/18:3) + NH4 842.7232155 C53 H96 O6 N1 7457712.048 2698263.487 166 TG(16:0/16:0/18:2) + NH4 848.7701655 C53 H102 O6 N1 3117177.732 2939662.058 167 TG(14:0/18:2/20:5) + H 849.6966665 C55 H93 O6 2882001.001 3019434.864 168 TG(16:0/16:0/18:1) + NH4 850.7858155 C53 H104 O6 N1 1.64E+07 3.07E+06 169 TG(16:0/18:3/18:3) + H 851.7123165 C55 H95 O6 4.38E+07 3076611.31 170 TG(16:0/17:0/17:0) + NH4 852.8014655 C53 H106 O6 N1 3702976.213 3186374.052 171 TG(16:0/16:0/20:5) + H 853.7279665 C55 H97 O6 3278567.909 3259422.694 172 TG(16:0/18:1/18:3) + H 855.7436165 C55 H99 O6 1448986.196 3265491.034 173 TG(15:0/18:2/18:3) + NH4 856.7388655 C54 H98 O6 N1 2962279.683 3272286.838 174 TG(18:0/16:0/18:3) + H 857.7592665 C55 H101 O6 7702748.834 3358029.901 175 TG(15:0/18:2/18:2) + NH4 858.7545155 C54 H100 O6 N1 7702748.834 3358029.901 176 TG(16:0/17:1/18:2) + NH4 860.7701655 C54 H102 O6 N1 5491186.88 3384766.298 177 TG(16:0/17:1/18:1) + NH4 862.7858155 C54 H104 O6 N1 2.14E+07 3470218.27 178 Co(Q10) + H 863.6911865 C59 H91 O4 4268929.475 3556931.782 179 TG(16:0/17:0/18:1) + NH4 864.8014655 C54 H106 O6 N1 5758516.782 3583143.66 180 TG(18:0/16:0/17:0) + NH4 866.8171155 C54 H108 O6 N1 9174698.596 3652349.072 181 TG(10:0p/22:6/22:6) + NH4 868.6813505 C57 H90 O5 N1 9174698.596 3652349.072 182 TG(18:4/18:3/18:3) + H 871.6810165 C57 H91 O6 4572289.266 3715286.618 183 TG(8:0/16:0/21:4) + (CH3CH2)3NH 872.7575895 C54 H100 O6 N2 2.29E+07 3756416.138 184 TG(18:3/18:3/18:3) + H 873.6966665 C57 H93 O6 6310376.314 3793593.876 185 TG(18:3/18:2/18:3) + H 875.7123165 C57 H95 O6 5914201.082 4071221.369 186 TG(16:0/18:1/18:1) + NH4 876.8014655 C55 H106 O6 N1 5914201.082 4071221.385 187 TG(16:0/18:2/20:5) + H 877.7279665 C57 H97 O6 1.90E+07 4148774.509 188 TG(18:0/16:0/18:1) + NH4 878.8171155 C55 H108 O6 N1 1.90E+07 4148774.509 189 TG(16:0/18:1/20:5) + H 879.7436165 C57 H99 O6 7534392.644 4230984.901 190 TG(18:0/16:0/18:0) + NH4 880.8327655 C55 H110 O6 N1 5.34E+07 4475225.248 191 TG(16:0/18:1/20:4) + H 881.7592665 C57 H101 O6 5.54E+07 4475225.248 192 TG(17:0/18:3/18:3) + NH4 882.7545155 C56 H100 O6 N1 5052602.769 4478342.531 193 TG(18:0/16:0/20:4) + H 883.7749165 C57 H103 O6 5784527.473 4660990.822 194 TG(17:0/18:2/18:3) + NH4 884.7701655 C56 H102 O6 N1 4482756.516 4672785.705 195 TG(17:0/18:2/18:2) + NH4 886.7858155 C56 H104 O6 N1 7454754.499 4726088.259 196 TG(17:0/18:1/18:2) + NH4 888.8014655 C56 H106 O6 N1 1265262.193 4764847.927 197 TG(17:0/18:1/18:1) + NH4 890.8171155 C56 H108 O6 N1 140126.277 5149855.933 198 TG(16:0/16:1/21:0) + NH4 892.8327655 C56 H110 O6 N1 4962844.564 5149855.933 199 TG(6:0/18:3/23:4) + (CH3CH2)3NH 894.7419395 C56 H98 O6 N2 9291077.065 5156630.083 200 TG(15:0/14:0/24:0) + NH4 894.8484155 C56 H112 O6 N1 492454.422 5207985.888 201 TG(18:4/18:3/20:5) + H 895.6810165 C59 H91 O6 6089561.802 5245553.541 202 TG(6:0/18:2/23:4) + (CH3CH2)3NH 896.7575895 C56 H100 O6 N2 1582567.8 5259759.322 203 TG(18:3/18:3/20:5) + H 897.6966665 C59 H93 O6 1.17E+07 5350123.549 204 TG(6:0/18:2/23:3) + (CH3CH2)3NH 898.7732395 C56 H102 O6 N2 1630296.575 5439965.387 205 TG(18:3/18:2/20:5) + H 899.7123165 C59 H95 O6 1.62E+07 5651893.831 206 TG(16:2/13:0/18:2) + (CH3CH2)3NH 900.7888895 C56 H104 O6 N2 1 5727851.112 207 TG(20:5/18:2/18:2) + H 901.7279665 C59 H97 O6 6701516.595 5875239.363 208 TG(8:0/18:1/21:2) + (CH3CH2)3NH 902.8045395 C56 H106 O6 N2 6874401.285 5875239.363 209 TG(16:0/18:1/20:2) + NH4 902.8171155 C57 H108 O6 N1 6874401.285 5875239.363 210 TG(18:1/18:2/20:5) + H 903.7436165 C59 H99 O6 6574610.08 6317164.375 211 TG(18:0/18:1/18:1) + NH4 904.8327655 C57 H110 O6 N1 8673046.78 6499861.567 212 TG(18:1/18:2/20:4) + H 905.7592665 C59 H101 O6 5155615.948 6.69E+06 213 TG(18:0/18:0/18:1) + NH4 906.8484155 C57 H112 O6 N1 1.58E+07 6849883.536 214 TG(18:1/18:1/20:4) + H 907.7749165 C59 H103 O6 4559240.845 7196188.345 215 TG(18:0/16:0/20:0) + NH4 908.8640655 C57 H114 O6 N1 2.28E+07 7217491.252 216 TG(18:0/18:1/20:4) + H 909.7905665 C59 H105 O6 8855056.976 7419109.87 217 PG(28:1/18:3) + H 911.6735645 C52 H96 O10 N0 P1 2.68E+06 7.44E+06 218 PG(28:0/18:2) + H 915.7048645 C52 H100 O10 N0 P1 2.25E+07 7479487.582 219 TG(18:1/18:1/19:1) + NH4 916.8327655 C58 H110 O6 N1 7716514.673 7825778.605 220 TG(16:0/18:1/21:1) + NH4 918.8484155 C58 H112 O6 N1 5743432.404 7968577.636 221 TG(16:0/16:1/23:0) + NH4 920.8640655 C58 H114 O6 N1 1.21E+07 8956738.021 222 TG(10:0/15:1/24:6) + (CH3CH2)3NH 922.7732395 C58 H102 O6 N2 343736.931 9258523.996 223 TG(16:0/15:0/24:0) + NH4 922.8797155 C58 H116 O6 N1 2.50E+07 9441741.193 224 TG(20:0/18:2/18:2) + NH4 928.8327655 C59 H110 O6 N1 1.93E+07 1.06E+07 225 TG(20:0/18:1/18:2) + NH4 930.8484155 C59 H112 O6 N1 2.23E+07 1.07E+07 226 TG(16:0/18:1/22:1) + NH4 932.8640655 C59 H114 O6 N1 2.74E+07 1.12E+07 227 TG(16:0/18:1/22:0) + NH4 934.8797155 C59 H116 O6 N1 200369.136 1.20E+07 228 TG(16:0/16:0/24:0) + NH4 936.8953655 C59 H118 O6 N1 649574.619 1.21E+07 229 TG(21:0/18:2/18:2) + NH4 942.8484155 C60 H112 O6 N1 1.25E+07 1.25E+07 230 TG(16:0/18:3/23:0) + NH4 944.8640655 C60 H114 O6 N1 6207969.868 1.25E+07 231 TG(16:0/18:2/23:0) + NH4 946.8797155 C60 H116 O6 N1 1.81E+08 1.28E+07 232 TG(15:0/18:1/24:0) + NH4 948.8953655 C60 H118 O6 N1 2.66E+07 1.34E+07 233 TG(25:0/15:0/17:0) + NH4 950.9110155 C60 H120 O6 N1 2092609.791 1.38E+07 234 TG(22:0/18:2/18:3) + NH4 954.8484155 C61 H112 O6 N1 5.40E+07 1.39E+07 235 TG(22:0/18:2/18:2) + NH4 956.8640655 C61 H114 O6 N1 5.40E+07 1.39E+07 236 TG(16:0/18:3/24:0) + NH4 958.8797155 C61 H116 O6 N1 1.08E+07 1.40E+07 237 TG(16:0/18:1/24:1) + NH4 960.8953655 C61 H118 O6 N1 1.36E+08 1.43E+07 238 TG(16:0/18:1/24:0) + NH4 962.9110155 C61 H120 O6 N1 1.41E+07 1.51E+07 239 TG(20:0/16:0/22:0) + NH4 964.9266655 C61 H122 O6 N1 4.22E+07 1.55E+07 240 TG(23:0/18:2/18:3) + NH4 968.8640655 C62 H114 O6 N1 4357343.609 1.69E+07 241 TG(23:0/18:2/18:2) + NH4 970.8797155 C62 H116 O6 N1 3.47E+07 1.71E+07 242 TG(18:1/18:2/23:0) + NH4 972.8953655 C62 H118 O6 N1 321103.904 1.72E+07 243 TG(25:0/16:0/18:2) + NH4 974.9110155 C62 H120 O6 N1 1.17E+07 1.78E+07 244 TG(27:0/14:0/18:1) + NH4 976.9266655 C62 H122 O6 N1 1.14E+08 2.07E+07 245 TG(18:4/21:4/22:5) + NH4 980.7701655 C64 H102 O6 N1 4.89E+07 2.24E+07 246 TG(24:0/18:3/18:3) + NH4 980.8640655 C63 H114 O6 N1 7.09E+07 2.25E+07 247 TG(24:0/18:2/18:3) + NH4 982.8797155 C63 H116 O6 N1 2002411.796 2.26E+07 248 TG(18:1/18:3/24:0) + NH4 984.8953655 C63 H118 O6 N1 2.41E+08 2.27E+07 249 TG(18:0/18:3/24:0) + NH4 986.9110155 C63 H120 O6 N1 3.58E+07 2.29E+07 250 TG(18:1/18:1/24:0) + NH4 988.9266655 C63 H122 O6 N1 3.20E+07 2.35E+07 251 TG(26:0/16:0/18:1) + NH4 990.9423155 C63 H124 O6 N1 4.21E+08 2.54E+07 252 TG(20:0/20:0/20:0) + NH4 992.9579655 C63 H126 O6 N1 5.91E+07 2.77E+07 253 TG(25:0/18:2/18:2) + NH4 998.9110155 C64 H120 O6 N1 6.62E+07 2.86E+07 254 TG(30:1/15:0/16:1) + NH4 1002.942315 C64 H124 O6 N1 2.76E+07 2.94E+07 255 TG(26:0/18:2/18:3) + NH4 1010.911015 C65 H120 O6 N1 3.49E+07 2.95E+07 256 TG(26:0/18:2/18:2) + NH4 1012.926665 C65 H122 O6 N1 5158621.809 3.08E+07 257 TG(26:0/18:1/18:2) + NH4 1014.942315 C65 H124 O6 N1 4.95E+07 3.26E+07 258 TG(20:0/18:2/24:0) + NH4 1016.957965 C65 H126 O6 N1 4.98E+07 3.29E+07 259 TG(30:0/16:0/16:1) + NH4 1018.973615 C65 H128 O6 N1 1.62E+08 3.71E+07 260 TG(16:0/22:0/24:0) + NH4 1020.989265 C65 H130 O6 N1 2.55E+07 3.80E+07 261 TG(32:1/15:0/16:0) + NH4 1032.989265 C66 H130 O6 N1 1.20E+08 3.85E+07 262 TG(22:0/18:2/24:0) + NH4 1044.989265 C67 H130 O6 N1 1.15E+08 3.92E+07 263 TG(26:1/15:0/24:1) + NH4 1059.004915 C68 H132 O6 N1 1.15E+08 3.92E+07 264 TG(24:0/18:2/24:0) + NH4 1073.020565 C69 H134 O6 N1 1.57E+07 4.03E+07 265 TG(18:1/24:0/24:0) + NH4 1075.036215 C69 H136 O6 N1 1.20E+08 4.06E+07 266 TG(26:0/18:2/24:0) + NH4 1101.051865 C71 H138 O6 N1 3.66E+07 4.31E+07 267 TG(36:1/16:0/18:2) + NH4 1127.067515 C73 H140 O6 N1 7.03E+07 4.40E+07 268 TG(20:0/24:2/24:2) + (CH3CH2)3NH 1195.117539 C77 H146 O6 N2 4.44E+07 4.61E+07 269 LPA(16:0) H 409.2360665 C19 H38 O7 N0 P1 2232476.522 4.86E+07 270 LPE(16:0) H 452.2782655 C21 H43 O7 N1 P1 2232476.522 4.86E+07 271 LPE(17:1) H 464.2782655 C22 H43 O7 N1 P1 6187754.425 4.94E+07 272 LPE(18:1) H 478.2939155 C23 H45 O7 N1 P1 1.87E+08 4.95E+07 273 LdMePE(16:0) H 480.3095655 C23 H47 P7 N1 P1 1.26E+08 5.28E+07 274 PAF(14:0e) + HCOO 540.3306955 C25 H51 P9 N1 P1 6.74E+07 5.37E+07 275 PAF(16:1p) + HCOO 564.3306955 C27 H51 P9 N1 P1 7.11E+07 5.50E+07 276 PAF(16:0p) + HCOO 566.3463455 C27 H53 O9 N1 P1 6.73E+07 5.77E+07 277 PAF(16:0e) + HCOO 568.3619955 C27 H55 O9 N1 P1 5.93E+07 6.84E+07 278 PMe(15:0/18:3) H 669.4500815 C37 H66 O8 N0 P1 2.33E+07 7.01E+07 279 PMe(15:0/18:2) H 671.4657315 C37 H68 O8 N0 P1 5.36E+07 7.48E+07 280 PEt(16:1/16:1) H 671.4657315 C37 H68 O8 N0 P1 5.36E+07 7.48E+07 281 PEt(16:0/16:1) H 673.4813815 C37 H70 O8 N0 P1 1.24E+07 7.71E+07 282 dMePE(16:1/14:0) H 688.4922805 C37 H71 O8 N1 P1 2.49E+08 8.08E+07 283 dMePE(16:0/14:0) H 690.5079305 C37 H73 O8 N1 P1 2.49E+08 8.08E+07 284 PEt(16:2/18:2) H 695.4657315 C39 H68 O8 N0 P1 5.58E+07 8.57E+07 285 PEt(16:0/18:2) H 699.4970315 C39 H72 O8 N0 P1 2.39E+07 8.62E+07 286 dMePE(17:1/14:0) H 702.5079305 C38 H73 O8 N1 P1 3.00E+08 9.06E+07 287 dMePE(16:1/16:1) H 714.5079305 C39 H73 O8 N1 P1 1.81E+08 9.14E+07 288 dMePE(18:1/14:0) H 716.5235805 C39 H75 O8 N1 P1 5.29E+07 1.10E+08 289 dMePE(19:1/14:0) H 730.5392305 C40 H77 O8 N1 P1 1.26E+07 2.69E+08 290 dMePE(16:2/18:2) H 738.5079305 C41 H73 O8 N1 P1 2.72E+08 2.80E+08 291 MGDG(16:0/18:2) + HCOO 799.5577035 C44 H79 O12 5203598.126 2.98E+08 292 PAF(32:2) + HCOO 802.5603605 C43 H81 O10 N1 P1 1.78E+08 3.87E+08 293 PAF(32:1) + HCOO 804.5760105 C43 H83 O10 N1 P1 2.01E+08 6.03E+08 294 PAF(34:6) + HCOO 822.5290605 C45 H77 O10 N1 P1 6.00E+08 1.23E+09 295 MGDG(18:2/18:2) + HCOO 823.5577035 C46 H79 O12 7.59E+08 1.52E+09 296 DGDG(16:0/16:0) H 891.6050485 C47 H87 O15 7.05E+08 2.27E+09

    TABLE-US-00002 TABLE 2 List of non-functional small molecules in HJT decoctosome. Compound Molecular Retention No. ID Name Description formula score m/e time(min) 1 HMDB60017 Pyrogallol-2-O- Pyrogallol-2-O- C12H14O9 44.4 285.06 4.02 glucuronide glucuronide 2 HMDB41511 Glycerol 2-(9Z,12Z- Glycerol 2-(9Z,12Z- C49H88O15 56.5 939.60 11.20 octadecadienoate) 1- octadecadienoate) 1- hexadecanoate 3-O- hexadecanoate 3-O- [alpha-D- [alpha-D- galactopyranosyl- galactopyranosyl- (1->6)-beta-D- (1->6)-beta-D- galactopyranoside] galactopyranoside] 3 HMDB41266 Quercetin 3-(6- Quercetin 3-(6- C42H46O25 44.4 951.23 3.16 caffeoylsophorotrioside) caffeoylsophorotrioside) 4 HMDB40769 Dioxinoacrimarine A Dioxinoacrimarine A C29H23NO8 55 531.17 2.82 5 HMDB40701 9-Hydroxy-7- 9-Hydroxy-7- C19H32O7 40.5 395.20 4.21 megastigmen-3-one megastigmen-3-one glucoside glucoside 6 HMDB40358 (R)-Bitalin A (R)-Bitalin A C13H14O3 52.1 219.10 2.82 7 HMDB39301 Epiafzelechin 3-O- Epiafzelechin 3-O- C44H34O20 51.5 883.17 1.29 gallate-(4beta->6)- gallate-(4beta->6)- epigallocatechin 3- epigallocatechin 3- O-gallate O-gallate 8 HMDB39286 1-O-Galloylfructose 1-O-Galloylfructose C13H16O10 42.1 315.07 4.75 9 HMDB38057 Dehydrophytosphingosine Dehydrophytosphingosine C18H37NO3 49.8 316.28 6.57 10 HMDB37543 (Halogen)-(Z)-2-(5- (Halogen)-(Z)-2-(5- C18H32O 43.7 282.28 10.29 Tetradecenyl)- Tetradecenyl)- cyclobutanone cyclobutanone 11 HMDB37519 2-(5,8- 2-(5,8- C18H30O 42.4 280.26 9.75 Tetradecadienyl)- Tetradecadienyl)- cyclobutanone cyclobutanone 12 HMDB37476 Neocarthamin Neocarthamin C21H22O11 52.3 433.11 3.33 13 HMDB33538 Fragransol B Fragransol B C19H22O5 52.5 331.15 2.82 14 HMDB32960 1-Octen-3-yl 1-Octen-3-yl C19H34O10 46.8 440.25 1.95 primeveroside primeveroside 15 HMDB32677 Soyacerebroside I Soyacerebroside I C40H75NO9 55.3 696.54 12.51 16 HMDB32147 Geranylcitronellol Geranylcitronellol C20H36O 39.5 310.31 11.01 17 HMDB31068 Isopalmitic acid Isopalmitic acid C16H32O2 43.2 274.27 5.83 18 HMDB30964 Linolenelaidic acid Linolenelaidic acid C18H30O2 51.3 296.26 8.46 19 HMDB29766 (3S,7E,9R)-4,7- (3S,7E,9R)-4,7- C24H40O11 53.2 522.29 1.45 Megastigmadiene- Megastigmadiene- 3,9-diol 9-[apiosyl- 3,9-diol 9-[apiosyl- (1->6)-glucoside] (1->6)-glucoside] 20 HMDB29711 Maritimetin Maritimetin C15H10O6 51.2 287.05 3.33 21 HMDB29348 Neryl Neryl C21H36O10 53 466.26 3.68 arabinofuranosyl- arabinofuranosyl- glucoside glucoside 22 HMDB13897 4-ene-Valproic acid 4-ene-Valproic acid C8H14O2 42.4 125.10 1.17 23 HMDB11507 lysophosphatidyl LysoPE(18:2(9Z, C23H44NO7P 50.8 478.29 7.89 ethanolamine 12Z)/0:0) (18:2(9Z, 12Z)/0:0) 24 HMDB11127 1,2-Di-(9Z,12Z,15Z- 1,2-Di-(9Z,12Z,15Z- C51H84O15 43.3 959.57 11.39 octadecatrienoyl)-3- octadecatrienoyl)-3- (Galactosyl-alpha-1- (Galactosyl-alpha-1- 6-Galactosyl-beta- 6-Galactosyl-beta- 1)-glycerol 1)-glycerol 25 HMDB10386 lysophosphatidyl LysoPC(18:2(9Z,12Z)) C26H50NO7P 55.7 520.34 8.08 choline (18:2(9Z, 12Z) 26 HMDB00413 3-Hydroxydodecanedioic 3-Hydroxydodecanedioic C12H22O5 49 269.14 7.14 acid acid 27 HMDB00269 Sphinganine Sphinganine C18H39NO2 41 302.30 6.95

    TABLE-US-00003 TABLE 3 List of functional small molecules in HJT decoctosome. Compound English Molecular Retention Description No. ID Name name formula score m/e time(min) of function 1 HMDB10366 Hyaluronan Hyaluronan C28H44N2O23 52.7 799.22023 3.3343 Anti-fibrosis; anti- inflammatory 2 HMDB05801 Kaempferol Kaempferol C15H10O6 54.4 287.05458 4.565633333 Anti-fibrosis; anti-tumor; anti-bacterial, etc. 3 HMDB10382 lysophosphatidyl LysoPC(16:0) C24H50NO7P 45.3 496.33797 8.649783333 Anti-fibrosis choline(16:0) 4 HMDB13648 Palmitoleoyl Palmitoleoyl C18H35NO2 43.5 320.255 9.00865 Anti- Ethanolamide Ethanolamide inflammatory; analgesic 5 HMDB12166 4alpha-Carboxy- 4alpha-Carboxy- C28H46O3 43.9 431.35036 13.47345 Anti- 5alpha-cholesta-8- 5alpha-cholesta-8- inflammatory en-3beta-ol en-3beta-ol 6 HMDB15168 Cerulenin Cerulenin C12H17NO3 45.9 241.15454 1.018633333 antifungal; anti-tumor 7 HMDB40586 Vitamin D5 Vitamin D5 C29H48O 41.2 395.36602 10.4718 Decreasing vagus activity 8 HMDB61062 7- 7- C18H24N4O2 48.4 346.22 7.14 Anti-tumor hydroxygranisetron hydroxygranisetron 9 HMDB33214 Schottenol Schottenol C29H50O 48.1 397.38218 12.70096667 Regulate cholesterol metabolism

    TABLE-US-00004 TABLE 4 List of non-functional small molecules in PGY decoctosome. Compound Molecular Retention No. ID Name Description formula Score m/e time (min) 1 HMDB13248 Monoethylhexylphthalic Monoethylhexylphthalic C16H22O4 39.9 301.14 0.76 acid acid 2 HMDB09725 Phosphatidylethanolamine PE(24:0/20:1(11Z)) C49H96NO8P 42 880.68 11.88 (24:0/20:1(11Z)) 3 HMDB10689 Phosphatidylglycerol PG(18:3(9Z,12Z, C46H73O10P 40 817.50 11.49 (18:3(9Z,12Z,15Z)/ 15Z)/22:6(4Z,7Z, 22:6(4Z,7Z,10Z, 10Z,13Z,16Z,19Z)) 13Z,16Z,19Z)) 4 HMDB32843 AS 1-5 AS 1-5 C40H77NO9 47.1 738.54 12.84 5 HMDB37840 N-(1-Deoxy-1- N-(1-Deoxy-1- C12H23NO7 48.1 294.15 0.91 fructosyl)leucine fructosyl)leucine 6 HMDB35402 Culinariside Culinariside C45H87NO10 39.6 824.62 11.69 7 HMDB94265 Diglyceride DG(21:0/i- C37H72O5 46 619.52 12.65 (21:0/i-13:0/0:0) 13:0/0:0) 8 HMDB55993 Diglyceride DG(15:0/0:0/22:ln9) C40H76O5 49 654.60 13.03 (15:0/0:0/22:ln9) 9 HMDB36855 Cincassiol B C20H32O8 48.7 423.20 8.02 10 HMDB41511 Glycerol 2- Glycerol 2- C49H88O15 52.8 939.59 13.61 (9Z,12Z- (9Z,12Z- octadecadienoate)1- octadecadienoate)1- hexadecanoate 3- hexadecanoate 3- O-[alpha-D- O-[alpha-D- galactopyranosyl- galactopyranosyl- (1->6)-beta-D- (1->6)-beta-D- galactopyranoside] galactopyranoside] 11 HMDB37846 N-(1-Deoxy-1- N-(1-Deoxy-1- C15H21NO7 40.6 328.14 1.07 fructosyl)- fructosyl)- phenylalanine phenylalanine 12 HMDB35970 (3beta,17alpha,23S)- (3beta,17alpha,23S)- C29H42O5 38.5 941.61 11.30 17,23-Epoxy-3,29- 17,23-Epoxy-3,29- dihydroxy-27- dihydroxy-27- norlanosta- norlanosta- 7,9(11)-diene- 7,9(11)-diene- 15,24-dione 15,24-dione 13 HMDB11384 Phosphatidylethanolamine PE(P- C43H80NO7P 45.3 776.56 13.41 (P-18:0/20:3(8Z,11 18:0/20:3(8Z,11 Z,14Z)) Z,14Z)) 14 HMDB37344 3,4-Diacetylcosmosiin 3,4-Diacetylcosmosiin C25H24O12 45.8 499.12 1.42 15 HMDB11127 1,2-Di- 1,2-Di- C51H84O15 41.4 959.56 11.49 (9Z,12Z,15Z- (9Z,12Z,15Z- octadecatrienoyl)- octadecatrienoyl)- 3-(Galactosyl- 3-(Galactosyl- alpha-1-6- alpha-1-6- Galactosyl-beta- Galactosyl-beta- 1)-glycerol 1)-glycerol 16 HMDB00614 Phosphatidylserine PS(16:0/16:0) C38H74NO10P 41.1 753.54 13.80 (16:0/16:0) 17 HMDB36333 4-Hydroxyacetophenone 4-Hydroxyacetophenone C28H34O15 50.7 628.22 1.24 4-[4-hydroxy-3,5- 4-[4-hydroxy-3,5- dimethoxybenzoyl- dimethoxybenzoyl- (->5)-apiosyl- (->5)-apiosyl- (1->2)-g1ucoside] (1->2)-g1ucoside] 18 HMDB04816 Formamide FAPy-adenine C5H7N5O 40.8 136.06 0.91 pyrimidine-adenine 19 HMDB33621 Araliacerebroside Araliacerebroside C40H77NO10 49.2 732.56 11.69 20 HMDB37396 xi-10- xi-10- C18H36O3 41.7 318.30 5.92 Hydroxyoctadecanoic Hydroxyoctadecanoic acid acid 21 HMDB35469 N-(2R- N-(2R- C40H81NO5 42.5 678.60 11.69 Hydroxydocosanoyl)- Hydroxydocosanoyl)- 2S-amino-1,3S,4R- 2S-amino-1,3S,4R- octadecanetriol octadecanetriol 22 HMDB31658 L-2-Amino-5- L-2-Amino-5- C5H11NO3 41.3 116.07 0.91 hydroxypentanoic hydroxypentanoic acid acid 23 HMDB32794 AS 1-1 AS 1-1 C38H71NO9 44.9 708.51 13.61 24 HMDB29276 Cis-Caffeoyl Cis-Caffeoyl C13H12O9 49.5 295.04 1.42 tartaric acid tartaric acid 25 HMDB35212 Sonchuiono side C Sonchuiono side C C19H30O8 42.8 409.18 7.44 26 HMDB38732 alpha-Ionol O- alpha-Ionol O- C24H40O10 53.6 511.25 8.22 [arabinosyl- [arabinosyl- (1->6)-g1ucoside] (1->6)-g1ucoside] 27 HMDB41140 Prenyl cis-caffeate Prenyl cis-caffeate C14H16O4 48.7 266.14 1.07 28 HMDB08765 Phosphatidylcholine PC(24:0/18:3(9Z, C50H94NO8P 42 850.67 11.30 (24:0/18:3(9Z,12Z,15Z)) 12Z,15Z)) 29 HMDB28725 Asparaginyl- Asparaginyl- C10H20N6O4 43.3 311.14 6.69 Arginine Arginine 30 HMDB02823 Docosatrienoic Docosatrienoic C22H38O2 41.1 352.32 10.15 acid acid 31 HMDB34159 Acetyl tributyl Acetyl tributyl C20H34O8 52.6 425.21 8.22 citrate citrate 32 HMDB28802 Glutaminyl- Glutaminyl- C11H22N4O4 44.5 292.20 7.07 Lysine Lysine 33 HMDB00269 Sphinganine Sphinganine C18H39NO2 46.8 284.29 11.11 34 HMDB29782 6-Epi-7- 6-Epi-7- C18H30O8 45.9 357.19 7.44 isocucurbic acid isocucurbic acid glucoside glucoside 35 HMDB35159 Paullinic acid Paullinic acid C20H38O2 48.2 328.32 10.92

    TABLE-US-00005 TABLE 5 List of functional small molecules in PGY decoctosome. Compound English Molecular Retention Description No. ID Name name formula score m/e time (min) of function 1 HMDB00734 Indoleacrylic Indoleacrylic C11H9NO2 44.6 205.10 1.06608333 Anti- acid acid inflammation 2 HMDB28959 Lysyl-Proline Lysyl-Proline C11H21N3O3 40.2 226.15 1.42 Alleviate inflammation and renal fibrosis 3 HMDB36846 Icariside B8 Icariside B8 C19H32O8 55.1 411.20 7.44408333 Anti- inflammation 4 HMDB35988 Ganoderic acid F Ganoderic acid F C32H42O9 44.8 593.27 10.7289167 Anti- inflammation 5 HMDB02375 Chicoric acid Chicoric acid C22H18O12 40.4 492.11 1.42343333 Stimulate phagocytosis 6 HMDB35990 Cerebroside B Cerebroside B C41H77NO9 39.4 750.54 12.8375833 Inhibit mononuclear cell migration and Cartilage degradation 7 HMDB60681 4-Hydroxy-2,6- 4-Hydroxy-2,6- C8H11NO 50.5 120.08 1.06608333 Relieve itching, dimethylaniline dimethylaniline heat, and pain caused by inflammation of the skin; antiarrhythmic 8 HMDB00050 Adenosine Adenosine C10H13N5O4 45.2 268.10 0.90858333 Dilate blood vessels, arrhythmia drugs of type V 9 HMDB02117 Oleamide Oleamide C18H35NO 50.9 282.28 10.53575 Relieve emotion and sleep disorders 10 HMDB10715 2- 2- C8H9NO 42.3 118.06 1.06608333 Antiarrhythmic Phenylacetamide Phenylacetamide 11 HMDB61104 7- 7- C20H22N8O6 41.8 453.16 7.2539 Folic acid hydroxymethotrexate hydroxymethotrexate antagonist; anti-tumor; treat autoimmune diseases 12 HMDB03431 L-Histidinol L-Histidinol C6H11N3O 40.79 124.0 11.49425 Enhance effects of anti-tumor drugs

    TABLE-US-00006 TABLE 6 List of proteins in HJT decoctosome. Protein ID No. No. Protein name English name Score Density 1 P42739 Polyubiquitin Polyubiquitin 18.922 3810200 2 P69310 Ubiquitin-605 ribosomal Ubiquitin-605 ribosomal 13.257 2414600 protein L40-2 protein L40-2 3 Q39752 Calmodulin-5 Calmodulin-5 8.8684 3206100 4 P08477 Glyceraldehyde-3- Glyceraldehyde-3- 6.7177 2599300 phosphate dehydrogenase phosphate dehydrogenase GAPC2, cytosolic GAPC2, cytosolic 5 Q271K6 Phragmoplast orienting Phragmoplast orienting 6.7093 19854000 kinesin kinesin 6 K4LMW2 Sesquiterpene synthase 2 Sesquiterpene synthase 2 6.4161 2251300 7 O81028 Pentatricopeptide repeat- Pentatricopeptide repeat- 6.1664 2385500 containing protein containing protein At2g26790, At2g26790, mitochondrial mitochondrial 8 Q10D00 ATP-dependent RNA ATP-dependent RNA 5.9266 1658900 helicase SUV3, helicase SUV3, mitochondrial; mitochondrial; 9 Q9LQ32 Glucuronoxylan 4-O- Glucuronoxylan 4-O- 5.9167 70158000 methyltransferase 3 methyltransferase 3 10 Q6R2K1 Protein STRUBBELIG- Protein STRUBBELIG- 5.9167 41164000 RECEPTOR FAMILY 5 RECEPTOR FAMILY 5 11 Q8W4H7 Elongation factor 1-alpha 2 Elongation factor 1-alpha 2 5.9167 20457000 12 Q9SCJ9 Ubiquitin carboxyl- Ubiquitin carboxyl- 5.9167 16483000 terminal hydrolase 26 terminal hydrolase 26 13 Q05753 Ankyrin repeat domain- Ankyrin repeat domain- 5.9167 15696000 containing protein, containing protein, chloroplastic chloroplastic 14 Q67J19 Probable BRI1 kinase Probable BRI1 kinase 5.9167 12764000 inhibitor 1 inhibitor 1 15 P26563 Aspartate Aspartate 5.9167 9863500 aminotransferase P2, aminotransferase P2, mitochondrial mitochondrial 16 P04672 Nodulin-44 Nodulin-44 5.9167 9466800 17 Q9SMO9 V-type proton ATPase V-type proton ATPase 5.9167 8766600 catalytic subunit A catalytic subunit A 18 Q8RWG2 Protein high chlorophyll Protein high chlorophyll 5.9167 8229500 fluorescent 107 fluorescent 107 19 Q9FYH1 Histone acetyltransferase Histone acetyltransferase 5.9167 7007400 HAC2 HAC2 20 P02857 Legumin A Legumin A 5.9167 5423500 21 F415D5 WAT1-related protein WAT1-related protein 5.9167 5284100 At1g70260 At1g70260 22 Q9SY74 Zinc finger CCCH Zinc finger CCCH 5.9167 5050900 domain-containing domain-containing protein 5 protein 5 23 P00585 Granule-bound starch Granule-bound starch 5.9167 4542000 synthase 1, synthase 1, chloroplastic/amyloplastic chloroplastic/amyloplastic 24 O22197 Probable E3 ubiquitin- Probable E3 ubiquitin- 5.9167 3564800 protein ligase RHC1A protein ligase RHC1A 25 O22056 RNA polymerase sigma RNA polymerase sigma 5.9167 3414300 factor sigB factor sigB 26 O22300 Homeobox protein Homeobox protein 5.9167 3027700 knotted-1-like LET12 knotted-1-like LET12 27 Q0JCU7 Zeaxanthin epoxidase, Zeaxanthin epoxidase, 5.9167 2818100 chloroplastic chloroplastic 28 P31582 Ras-related protein Ras-related protein 5.9167 2650700 RABF2A RABF2A 29 Q940K0 Probable disease Probable disease 5.9167 2376800 resistance protein resistance protein At1g61180 At1g61180 30 Q40237 Major pollen allergen Major pollen allergen 5.9167 2061200 Lol p 5b Lol p5 b 31 Q00864 Light-independent Light-independent 5.9167 2028700 protochlorophyllide protochlorophyllide reductase subunit B reductase subunit B 32 Q2R2Z0 Glutamyl-tRNA(Gln) Glutamyl-tRNA(Gln) 5.9167 1639300 amidotransferase subunit B amidotransferase subunit B 33 O65282 20 kDa chaperonin, 20 kDa chaperonin, 5.9167 1363600 chloroplastic chloroplastic 34 Q56W64-2 Probable isoaspartyl Probable isoaspartyl 5.9167 1299600 peptidase/L-asparaginase 3 peptidase/L-asparaginase 3 35 A7Y3C4 Photosystem II D2 protein Photosystem II D2 protein 5.9167 405460 36 Q8VZ79 Protein INVOLVED IN Protein INVOLVED IN 5.9167 322920 DE NOVO 2 DE NOVO 2 37 P52705 (S)-hydroxynitrile lyase (S)-hydroxynitrile lyase 5.9167 209640 38 O80467 Spermidine sinapoyl CoA Spermidine sinapoyl CoA 5.9167 167870 acyltransferase acyltransferase

    TABLE-US-00007 TABLE 7 List of proteins in PGY decoctosome. No. Protein ID Protein name Sample name Score Density 1 P86055 Peroxidase 2 Peroxidase 2 224.9 37332000 2 Q8RX86-2 Alpha-galactosidase 2 Alpha-galactosidase 2 194.44 7066200 3 P86067 Peroxidase 10 Peroxidase 10 107.25 46486000 4 A0A0B4JDK1 Non-specific lipid- Non-specific lipid- 72.406 206080000 transfer protein transfer protein 5 P27322 Heat shock 70 kDa Heat shock 70 kDa 69.029 72537000 protein 3 protein 3 6 P49693 60S ribosomal protein L19-3 60S ribosomal protein L19-3 58.835 6670300 7 Q40677 Probable fructose- Probable fructose- 54.273 37424000 bisphosphate aldolase 1, bisphosphate aldolase 1, chloroplastic chloroplastic 8 B3EWQ2 Antimicrobial peptide 2 Antimicrobial peptide 2 53.733 17372000 9 P26320 Oxygen-evolving Oxygen-evolving 48.621 101720000 enhancer protein 1 enhancer protein 1 10 Q41246 14-3-3-like protein 14-3-3-like protein 42.923 29295000 GF14 omicron GF14 omicron 11 P00073 Ubiquitin-NEDD8-like Ubiquitin-NEDD8-like 37.614 621770000 protein RUB2 protein RUB2 12 Q39752 Calmodulin-5 Calmodulin-5 37.051 60273000 13 P28450 Ribulose bisphosphate Ribulose bisphosphate 28.505 51941000 carboxylase large chain carboxylase large chain 14 Q9ZT00 Ribulose bisphosphate Ribulose bisphosphate 26.205 37659000 carboxylase/oxygenase carboxylase/oxygenase activase activase 15 P27879 18.1 kDa class I heat 18.1 kDa class I heat 24.306 101640000 shock protein shock protein 16 P26300 Enolase Enolase 22.081 28302000 17 P46523 Chaperone protein Chaperone protein 20.657 9179000 ClpC1, chloroplastic ClpC1, chloroplastic 18 O49065 Root allergen protein Root allergen protein 18.921 190000000 19 P27337 Peroxidase 1 Peroxidase 1 16.936 22889000 20 P49249 Probable aldo-keto Probable aldo-keto 16.249 3262800 reductase 5 reductase 5 21 Q43831 Chaperonin 60 subunit Chaperonin 60 subunit 15.476 32546000 beta 2, chloroplastic beta 2, chloroplastic 22 P85088 ATP synthase subunit beta ATP synthase subunit beta 14.837 9836400 23 P36688 50S ribosomal protein L12 50S ribosomal protein L12 14.819 167360000 24 O04996 Superoxide dismutase Superoxide dismutase 14.344 324980000 [Cu-Zn] [Cu-Zn] 25 P46257 Fructose-bisphosphate Fructose-bisphosphate 13.778 72863000 aldolase aldolase 26 P08477 Glyceraldehyde-3-phosphate Glyceraldehyde-3-phosphate 13.706 30987000 dehydrogenase GAPC2, dehydrogenase GAPC2, cytosolic cytosolic 27 P30170 Actin-12 Actin-12 12.918 77830000 28 O49080 Oxygen-evolving Oxygen-evolving 12.461 18880000 enhancer protein 2 enhancer protein 2 29 Q43215 Histone H2B.7 Histone H2B.7 12.287 65959000 30 Q9XEK6 40S ribosomal protein 40S ribosomal protein 11.553 141790000 S14-1 S14-1 31 B3A0N2 Non-specific lipid- Non-specific lipid- 11.477 63259000 transfer protein transfer protein 32 Q8L4N1-2 Universal stress protein Universal stress protein 10.193 13338000 PHOS34 PHOS34 33 Q9LEJO Enolase 1 Enolase 1 9.3352 5224700 34 Q9ASR1 Elongation factor 2 Elongation factor 2 8.6402 15693000 35 P48493 Triosephosphate Triosephosphate 8.6026 54557000 isomerase isomerase 36 P85915 Elongation factor 1- Elongation factor 1- 8.2353 19138000 alpha 2 alpha 2 37 Q8GVE8 Phosphoenolpyruvate Phosphoenolpyruvate 8.1239 17825000 carboxylase 4 carboxylase 4 38 Q38872 Calcium-dependent Calcium-dependent 7.4954 70644000 protein kinase 6 protein kinase 6 39 Q08080 Heat shock 70 kDa Heat shock 70 kDa 7.3833 48170000 protein 6, chloroplastic protein 6, chloroplastic 40 Q41649 Peptidyl-prolyl cis-trans Peptidyl-prolyl cis-trans 7.3335 8230800 isomerase FKBP15-1 isomerase FKBP15-1 41 P83218 Pectinesterase/pectinesterase Pectinesterase/pectinesterase 7.1315 215680000 inhibitor 3 inhibitor 3 42 Q9FLG1 Beta-D-xylosidase 4 Beta-D-xylosidase 4 7.0715 19208000 43 P47921 Nucleoside diphosphate Nucleoside diphosphate 6.9705 11757000 kinase kinase 44 P83373 Malate dehydrogenase 1, Malate dehydrogenase 1, 6.8677 9450300 mitochondrial mitochondrial 45 Q9SWF5 Adenosylhomocysteinase 2 Adenosylhomocysteinase 2 6.822 19916000 46 F4IN32 MATH domain and MATH domain and 6.8169 3016800 coiled-coil domain- coiled-coil domain- containing protein containing protein At2g42460 At2g42460 47 Q9FJD6 Putative respiratory Putative respiratory 6.8116 8143800 burst oxidase homolog burst oxidase homolog protein H protein H 48 P02520 Class I heat shock Class I heat shock 6.6857 34589000 protein protein 49 P86066 Peroxidase 9 Peroxidase 9 6.6696 6907400 50 O50003 60S ribosomal protein L12-2 60S ribosomal protein L12-2 6.6548 15793000 51 Q8M9Y8 50S ribosomal protein L20 50S ribosomal protein L20 6.5835 4242500 52 P85962 60S acidic ribosomal 60S acidic ribosomal 6.5112 4430800 protein P2 protein P2 53 O04350 Tubulin-folding Tubulin-folding 6.503 6355900 cofactor A cofactor A 54 Q2R482 DNA replication DNA replication 6.4837 493670000 licensing factor MCM2 licensing factor MCM2 55 Q8GYD9 Probable RNA helicase Probable RNA helicase 6.4036 10678000 SDE3 SDE3 56 Q9FEF8-2 Probable mediator of Probable mediator of 6.3693 49624000 RNA polymerase II RNA polymerase II transcription subunit 36b transcription subunit 36b 57 P83442 Late embryogenesis Late embryogenesis 6.3587 17038000 abundant protein Dc3 abundant protein Dc3 58 Q9SML8 Malate dehydrogenase, Malate dehydrogenase, 6.3468 4554300 cytoplasmic 1 cytoplasmic 1 59 Q7DMN9 Calmodulin-5/6/7/8 Calmodulin-5/6/7/8 6.306 31812000 60 Q42662 5- 5- 6.2899 3134700 methyltetrahydropteroyltriglutamate-- methyltetrahydropteroyltriglutamate-- homocysteine homocysteine methyltransferase methyltransferase 61 Q9ZU90 F-box protein SKIP28 F-box protein SKIP28 6.2367 42902000 62 Q9SLN1 Filament-like plant Filament-like plant 6.2279 3639900 protein 7 protein 7 63 F4JUI9 Kinesin-like protein Kinesin-like protein 6.1026 172810000 64 P15252 Rubber elongation Rubber elongation 6.0825 9877400 factor protein factor protein 65 B9HCR2 Methylthioribose-1- Methylthioribose-1- 6.0763 6670100 phosphate isomerase phosphate isomerase 66 Q39615 Photo system I reaction Photosystem I reaction 6.0636 12355000 center subunit II-2, center subunit II-2, chloroplastic chloroplastic 67 Q7XYS3 Allene oxide synthase 2 Allene oxide synthase 2 6.0586 7798500 68 Q8VY00 Pre-mRNA-splicing Pre-mRNA-splicing 6.0386 1458700 factor ATP-dependent factor ATP-dependent RNA helicase DEAH1 RNA helicase DEAH1 69 P27456 Glutathione reductase, Glutathione reductase, 6.0181 3722600 chloroplastic chloroplastic 70 Q8W171 Peptidyl-prolyl cis-trans Peptidyl-prolyl cis-trans 6.0126 3996200 isomerase 1 isomerase 1 71 Q9LJX4-2 Pumilio homolog 5 Pumilio homolog 5 5.9912 13389000 72 Q00383 Protein TIC 214 Protein TIC 214 5.9887 17037000 73 Q8LEU3 Chlorophyll(ide) b Chlorophyll(ide) b 5.9849 15552000 reductase NOL, reductase NOL, chloroplastic chloroplastic 74 Q39528 Agglutinin-1 Agglutinin-1 5.9834 8563200 75 F4JQZ3 Rho GTPase-activating Rho GTPase-activating 5.9802 45841000 protein REN1 protein REN1 76 Q39291 V-type proton ATPase V-type proton ATPase 5.9751 13904000 catalytic subunit A catalytic subunit A 77 Q9ZV88 BES1/BZR1 homolog BES1/BZR1 homolog 5.9713 8200900 protein 4 protein 4 78 Q9MB95 1-aminocyclopropane- 1-aminocyclopropane- 5.9712 11179000 1-carboxylate synthase 1 1-carboxylate synthase 1 79 Q8W4F0 Protein DA1-related 1 Protein DA1-related 1 5.951 17844000 80 A6MMS5 Maturase K Maturase K 5.9461 15716000 81 Q0JHF8 Fructose-1,6- Fructose-1,6- 5.9436 5507400 bisphosphatase bisphosphatase 82 Q99070 Glycine-rich RNA- Glycine-rich RNA- 5.9435 110970000 binding protein 2 binding protein 2 83 Q5JLS2 CBL-interacting CBL-interacting protein 5.9368 4959100 protein kinase 12 kinase 12 84 F4IGL2 Kinesin-like protein Kinesin-like protein 5.9359 8858700 85 P35687 40S ribosomal protein S21 40S ribosomal protein S21 5.9336 22222000 86 QODUI1 Probable serine Probable serine 5.9311 5516400 acetyltransferase 3 acetyltransferase 3 87 Q9ZWC8 Serine/threonine- Serine/threonine- 5.9226 4741100 protein kinase BRI1- protein kinase BRI1- like 1 like 1 88 P26413 Heat shock 70 kDa Heat shock 70 kDa 5.9225 5500600 protein protein 89 Q9LM66 Xylem cysteine Xylem cysteine 5.9057 8304600 proteinase 2 proteinase 2 90 Q8VZY6 Polycomb group Polycomb group 5.9054 3038900 protein FIE2 protein FIE2 91 Q9FPS9 Ubiquitin carboxyl- Ubiquitin carboxyl- 5.9045 7895400 terminal hydrolase 15 terminal hydrolase 15 92 Q9FEC4 Trans-splicing factor Trans-splicing factor 5.8962 28562000 Raa3 Raa3 93 Q75W17 Furcatin hydrolase Furcatin hydrolase 5.8778 3844900 94 Q8LG77 Isocitrate Isocitrate 5.8737 5903800 dehydrogenase [NAD] dehydrogenase [NAD] catalytic subunit 6, catalytic subunit 6, mitochondrial mitochondrial 95 Q43153 Bifunctional L-3- Bifunctional L-3- 5.8735 8302400 cyanoalanine cyanoalanine synthase/cysteine synthase/cysteine synthase synthase 96 O80673 CDPK-related kinase 1 CDPK-related kinase 1 5.8663 3386400 97 Q07510 3-oxoacyl-[acyl-carrier- 3-oxoacyl-[acyl-carrier- 5.8656 12050000 protein] synthase III protein] synthase III 98 Q6KAIO Polyribonucleotide Polyribonucleotide 5.8626 5509000 nucleotidyltransferase 2 nucleotidyltransferase 2 99 Q0D317 WUSCHEL-related WUSCHEL-related 5.8621 6510400 homeobox 12 homeobox 12 100 P18905 Elongation factor Tu Elongation factor Tu 5.8615 3084900 101 Q6WNRO Isoflavone 2- Isoflavone 2- 5.8569 26449000 hydroxylase hydroxylase 102 P85905 Translationally- Translationally- 5.8548 19728000 controlled tumor controlled tumor protein homolog protein homolog 103 Q0J9V3 Kinesin-like protein Kinesin-like protein 5.8546 3860700 KIN-14H KIN-14H 104 Q9C5Q8 Small RNA 2-O- Small RNA 2-O- 5.8542 18023000 methyltransferase methyltransferase 105 Q00081 Glucose-1-phosphate Glucose-1-phosphate 5.8513 12444000 adenylyltransferase adenylyltransferase large subunit 1 large subunit 1 106 Q9FJK7 Cyclin-C1 -2 Cyclin-C1-2 5.8513 53998000 107 QOWT24 Protein SENSITIVE Protein SENSITIVE 5.8488 5961500 TO PROTON TO PROTON RHIZOTOXICITY 2 RHIZOTOXICITY 2 108 P12466 Ribulose bisphosphate Ribulose bisphosphate 5.8477 5198800 carboxylase large chain carboxylase large chain 109 Q859K3 Zinc finger protein Zinc finger protein 5.8469 5129100 VAR3, chloroplastic VAR3, chloroplastic 110 Q8LG10 GATA transcription GATA transcription 5.8463 8793300 factor 15 factor 15 111 F4IDW9 Protein PARTING Protein PARTING 5.8442 3152300 DANCERS DANCERS 112 Q9ZPY2-2 Laccase-6 Laccase-6 5.8436 12149000 113 Q9SBB2 Protein ABC Protein ABC 5.8407 5570200 transporter 1 transporter 1 114 P09753 Uncharacterized 38.5 Uncharacterized 38.5 5.8387 21558000 kDa protein in psbA kDa protein in psbA intron 1 intron 1 115 A4GNA8 Phosphatidylserine Phosphatidylserine 5.8376 6961500 decarboxylase decarboxylase proenzyme 3 proenzyme 3 116 AlXGTO Protein Ycf2 Protein Ycf2 5.8374 6466300 117 Q9LEL5 3-hydroxy-N-methyl- 3-hydroxy-N-methyl- 5.8359 4223300 (S)-coclaurine 4-O- (S)-coclaurine 4-O- methyltransferase methyltransferase 118 Q8WHZ0 30S ribosomal protein 30S ribosomal protein 5.833 13403000 S11 S11 119 Q9ZUB9 Putative F-box protein Putative F-box protein 5.8316 4699200 At1g23770 At1g23770 120 Q42831 Non-symbiotic Non-symbiotic 5.8313 21708000 hemoglobin hemoglobin 121 Q8LPS6 Pentatricopeptide Pentatricopeptide 5.831 1790000 repeat-containing repeat-containing protein At1g02150 protein At1g02150 122 O64597 Putative F-box protein Putative F-box protein 5.8308 5481900 At1g70390 At1g70390 123 Q93ZG9 Peptidyl-prolyl cis- Peptidyl-prolyl cis- 5.8305 1454100 trans isomerase trans isomerase FKBP53 FKBP53 124 P42777 G-box-binding factor 4 G-box-binding factor 4 5.8304 5305500 125 Q9LF41 Probable ubiquitin Probable ubiquitin 5.8298 4992200 conjugation factor E4 conjugation factor E4 126 P36183 Endoplasmin homolog Endoplasmin homolog 5.8297 13029000 127 O49696 Aluminum-activated Aluminum-activated 5.8294 5467900 malate transporter 12 malate transporter 12 128 Q9SFD8 Nuclear transcription Nuclear transcription 5.8291 2838000 factor Y subunit B-9 factor Y subunit B-9 129 Q6ZFZ4 Calpain-type cysteine Calpain-type cysteine 5.829 5255300 protease ADL1 protease ADL1 130 Q9LYT5 Probable Probable 5.829 3104900 pectinesterase/pectinesterase pectinesterase/pectinesterase inhibitor 35 inhibitor 35 131 Q7XAMO Spindle and Spindle and 5.8289 4385400 kinetochore-associated kinetochore-associated protein 1 homolog protein 1 homolog 132 Q6YXR4 Photosystem I assembly Photosystem I assembly 5.8288 2716300 protein Ycf4 protein Ycf4 133 Q9SYM4 Alpha,alpha-trehalose- Alpha,alpha-trehalose- 5.8279 3427200 phosphate synthase phosphate synthase [UDP-forming] 1 [UDP-forming] 1 134 Q1PET6 Probable Probable 5.8278 12092000 isoprenylcysteine isoprenylcysteine alpha-carbonyl alpha-carbonyl methylesterase methylesterase ICMEL2 ICMEL2 135 Q9LKG7 UTP--glucose-1- UTP--glucose-1- 5.8278 18078000 phosphate phosphate uridylyltransferase uridylyltransferase 136 Q6NPP4 Calmodulin-binding Calmodulin-binding 5.8277 3782600 transcription activator 2 transcription activator 2 137 Q9CAM8 Pentatricopeptide Pentatricopeptide 5.8277 16708000 repeat-containing repeat-containing protein At1g63150 protein At1g63150 138 O04204 60S acidic ribosomal 60S acidic ribosomal 5.8274 19674000 protein P0-1 protein P0-1 139 QOWRJ2 3-dehydrosphinganine 3-dehydrosphinganine 5.8266 3549600 reductase TSC10A reductase TSC10A 140 Q6AUV1 Xanthine Xanthine 5.8262 1690900 dehydrogenase dehydrogenase

    TABLE-US-00008 TABLE8 ListofsmallRNAsequencesinHJTdecoctosome. Column1 Sequence Decoction Decoctosome Control 0h 60h HJT-sRNA- TTGGGTGCGAGAG 1113 535 866 1135 1108 18 GTCCC(SEQID NO:40) HJT-sRNA- CTTTGTCGCTTCG 380 157 0 49 41 19 ATTCGT(SEQID NO:41) HJT-sRNA- GAAGTCCTCGTGT 7539 6007 1 42 33 20 TGCACCCC(SEQ IDNO:42) HJT-sRNA- AGTCCTCGTGTTG 17747 13298 1 37 28 21 CACCCCT(SEQID NO:43) HJT-sRNA- CTCGGCCTTTTGG 657 199 10 28 30 22 CTAAG(SEQID NO:44) HJT-sRNA- ACGACTCTCGGCA 14450 8944 7 27 21 23 ACGGA(SEQID NO:45) HJT-sRNA- CGACTCTCGGCAA 16051 7604 7 23 20 24 CGGATA(SEQID NO:46) HJT-sRNA- CATAACGACTCTC 841 467 0 20 7 25 GGCAA(SEQID NO:47) HJT-sRNA- CTCGGCAACGGAT 9252 5581 4 15 18 26 ATCTCG(SEQID NO:48) HJT-sRNA- CCTATGTCGCTTC 417139 215505 0 9 16 27 GATTCG(SEQID NO:49) HJT-sRNA- CTATGTCGCTTCG 422659 208523 0 9 15 28 ATTCGT(SEQID NO:50) HJT-sRNA- CTCTCGGCAACGG 9174 4957 5 14 17 29 ATATCT(SEQID NO:51) HJT-sRNA- CGGATATCTCGGC 20596 6860 2 7 16 30 TCTCG(SEQID NO:52) HJT-sRNA- GGTGCGAGAGGTC 429 216 14 17 29 31 CCGAGT(SEQID NO:53) HJT-sRNA- ACGGATATCTCGG 8662 4222 2 10 12 32 CTCTC(SEQID NO:54) HJT-sRNA- CTGGTTGATCCTG 452 480 8 17 16 33 CCAGTAGT(SEQ IDNO:55) HJT-sRNA- CGACCCCAGGTCA 44210 13924 2 12 9 34 GGCGGG(SEQID NO:56) HJT-sRNA- CGGCAACGGATAT 3915 3718 2 7 14 35 CTCGGCT(SEQID NO:57) HJT-sRNA- GCGACCCCAGGTC 39609 12687 2 12 8 36 AGGCGG(SEQID NO:58) HJT-sRNA- GACTCTCGGCAAC 3876 2756 4 11 13 37 GGATATC(SEQID NO:59) HJT-sRNA- TACCCGGCCGTCG 4637 1841 0 11 5 38 GGGCA(SEQID NO:60) HJT-sRNA- TCTCGGCTCTCGC 10898 4833 0 7 8 39 ATCGA(SEQID NO:61) HJT-sRNA- GGGGATGTAGCTC 58885 27774 0 9 5 40 AGATG(SEQID NO:62) HJT-sRNA- TTCCCACAGACGG 1144 2106 0 6 8 41 CGCCA(SEQID NO:63) HJT-sRNA- ATTGTGAAGCAGA 1149 270 200 232 181 42 ATTCA(SEQID NO:64) HJT-sRNA- CCAAGTGTTGGAT 6126 2240 1 7 8 43 TGTTCA(SEQID NO:65) HJT-sRNA- GGTCATCGCGCTT 18171 9379 3 9 9 44 GGTTGA(SEQID NO:66) HJT-sRNA- TGCCGGCCGGGGG 26430 10501 0 7 5 45 ACGGA(SEQID NO:67) HJT-sRNA- GTTAAGCGTGCTT 10017 5458 0 5 7 46 GGGCGA(SEQID NO:68) HJT-sRNA- ACTCGACGGATCG 14872 12327 0 6 5 47 CACGGC(SEQID NO:69) HJT-sRNA- CTGGTCGATGGAA 3808 2992 0 5 6 48 CAATGT(SEQID NO:70) HJT-sRNA- TGCTTTTTGATCCT 9523 2830 0 5 5 49 TCGATG(SEQID NO:71) HJT-sRNA- TTGGGTGCGAGAG 1113 535 866 1135 1108 50 GTCCCGGGT(SEQ IDNO:72) HJT-sRNA- CCTGGGAAGTCCT 7539 6007 1 42 33 51 CGTGTTGCACCCC T(SEQIDNO: 73) HJT-sRNA- TTCTCGGCCTTTT 657 199 10 28 30 52 GGCTAAGA(SEQ IDNO:74) HJT-sRNA- CATAACGACTCTC 14450 8944 7 27 21 53 GGCAACGGATA (SEQIDNO:75) HJT-sRNA- ATTGTGAAGCAGA 99 39 193 215 170 54 ATTCACC(SEQID NO:76) HJT-sRNA- TGCACCGGATCCC 2971 2051 0 8 5 55 ATCAGA(SEQID NO:77) HJT-sRNA- CCTTAACGAGGAT 3331 630 2 5 6 56 CCATT(SEQID NO:78) HJT-sRNA- ATTGGTCATCGCG 12495 5966 3 5 57 CTTGG(SEQID 7 NO:79) HJT-sRNA- CACGGACCAAGG 1071 637 4 6 7 58 AGTCTG(SEQID NO:80) HJT-sRNA- TTAGGGTTCGATT 15336 2974 6 10 5 59 CCGGA(SEQID NO:81)

    TABLE-US-00009 TABLE9 ListofsmallRNAsequencesinPGYdecoctosome. Column1 Sequence TZ Decoctosome Ctrl 0h 55h PGY-sRNA- CCCGAGAGAGGG 147 95 784 1259 45148 33 GCCCGT(SEQID NO:82) PGY-sRNA- GGGGTGCGAGAG 411 80 2942 4643 25291 34 GTCCCG(SEQID NO:83) PGY-sRNA- TGGGGTGCGAGA 405 78 2687 4281 23813 35 GGTCCC(SEQID NO:84) PGY-sRNA- TTGGGGTGCGAGA 411 95 2538 3885 21700 36 GGTCC(SEQID NO:85) PGY-sRNA- TGGGTGCGAGAG 677 268 899 1671 11667 37 GTCCCG(SEQID NO:86) PGY-sRNA- TTGGGTGCGAGAG 687 269 866 1600 11472 38 GTCCC(SEQID NO:40) PGY-sRNA- GGGTTGCGAGAG 136 53 1001 1661 8788 39 GTCCCG(SEQID NO:87) PGY-sRNA- TTGGGTTGCGAGA 144 51 860 1398 7574 40 GGTCC(SEQID NO:88) PGY-sRNA- TTGGTTGCGAGAG 191 52 246 443 3125 41 GTCCC(SEQID NO:89) PGY-sRNA- TCTGAACTCTGAA 1238 18306 1 13 377 42 CTCCAGTCA(SEQ IDNO:90) PGY-sRNA- GGTGCGAGAGGTC 276 317 14 25 161 43 CCGAG(SEQID NO:91) PGY-sRNA- GTGCGAGAGGTCC 337 517 14 24 145 44 CGAGT(SEQID NO:92) PGY-sRNA- CAAGGAAGGCAG 1200 1957 338 356 409 45 CAGGCG(SEQID NO:93) PGY-sRNA- GCGACCCCAGGTC 79325 88783 3 15 5 46 AGGCG(SEQID NO:94) PGY-sRNA- AGGCTGGGTGTGG 146 644 1 7 9 47 AAGTG(SEQID NO:95) PGY-sRNA- TCGTGTCGTGAGA 620 1862 1 6 8 48 TGTTG(SEQID NO:96) PGY-sRNA- CGCCCCGAGAGA 147 95 784 1259 45148 49 GGGGCCCGTG (SEQIDNO:97) PGY-sRNA- TTGGGGTGCGAGA 411 80 2942 4643 25291 50 GGTCCCGGGT (SEQIDNO:98) PGY-sRNA- TTGGGTGCGAGAG 677 268 899 1671 11667 51 GTCCCGGGT(SEQ IDNO:72) PGY-sRNA- TTGGTTGCGAGAG 191 52 246 443 3125 52 GTCCCGGGT(SEQ IDNO:99) PGY-sRNA- ATCCAAGGAAGG 1200 1957 338 356 409 53 CAGCAGGCG(SEQ IDNO:100) PGY-sRNA- CAGAGTTCTACAG 8227 122940 967 1051 3115 54 TCCGA(SEQID NO:21)

    [0275] The technical solutions of the present application can significantly improve the high-efficiency targeted delivery of nucleic acids, and overcome the shortcomings in the prior art nucleic acid liposome, including low encapsulation rate, poor safety, poor stability, complicated manufacture process, heterogeneity in product, low reproducibility, and the targeting to be improved.

    TABLE-US-00010 TABLE 10 List of synthetic lipids Working Concentration No. Manufacturer Catalogue # Abbreviation (mg/mL) 1 Avanti 110882 DG(18:0/18:0/0:0) 5 2 Avanti 110883 DG(18:0/16:0/0:0) 5 3 Avanti 800816C DG(16:0/16:0/0:0) 10 4 Avanti 860627P C18 Dihydroceramide 10 (d18:0/18:0) 6 Avanti 110613 TG(18:1/18:1/18:1) 1 8 Avanti 850756C PE(16:0/18:2) 10 9 Avanti 110521 TG(16:0/16:0/18:1) 5 10 Avanti 111000 TG(16:0/16:0/16:0) 10 11 Avanti 850468 PC(18:0/18:2) 10 12 Avanti 850458C PC(16:0/18:2) 10 13 Avanti 111002 TG(18:2/18:2/18:2) 10 14 Avanti 860634P C16 Dihydroceramide 5 (d18:0/16:0) 15 Sigma P8577 TG(16:0/18:1/18:2) 1 16 Nu-chek T-160 TG(18:0/18:0/18:0) 1 17 Matreya 1326 So(d16:0) 1 18 Sigma D1782 TG(16:0/18:1/18:1) 5 19 Larodan 32-1656-7 DG(16:0/18:2) 5 20 Larodan 34-1603-7 TG(16:0/16:0/18:2) 5 21 Larodan 34-1862-7 TG(16:0/18:2/18:2) 5 22 Larodan 34-3003-7 TG(18:0/16:0/18:1) 5 23 Larodan 34-1822-7 TG(18:0/18:1/18:1) 5 24 Larodan 34-3007-7 TG(18:0/18:1/18:2) 5 25 Larodan 34-1827-7 TG(18:1/18:1/18:2) 5 26 Larodan 34-1828-7 TG(18:1/18:1/18:3) 5 27 Larodan 34-1866-7 TG(18:1/18:2/18:2) 5 28 Larodan 34-1855-7 TG(18:3/18:2/18:2) 5 29 Larodan 10-1840-4 FA(18:4) 5 30 Avanti 110748 Sphinganine (d18:0) 5 31 Avanti 110749 Sphinganine (d20:0) 1 32 Avanti 110520 TG(18:0/16:0/16:0) 5 33 Larodan 34-1810-7 TG(18:0/16:0/18:0) 10 34 Larodan 31-1820-7 MG(18:2p) 10 35 nu-chek D-251 DG(18:2/18:2) 10 36 Larodan 38-1802-0 LPC(18:2) 10 37 avanti 791251 LPC(18:3) 10 38 avanti 791016 PE(16:0/16:1) 10 39 avanti 792077C 16:1-18:1 PE 10 40 avanti 792078C 16:0-22:1 PE 10 41 avanti 792079P Sphinganine(d22:0) 10 42 Larodan 31-2220 MG(22:2) 10 43 Larodan 32-1658 DG(16:0/18:3) 10 44 Larodan 34-1289 TG(18:1/18:1/20:4) 10 45 Larodan 34-1870 DG(18:3/18:2) 10 46 Larodan 32-1871 DG(20:5/18:2) 10 47 Larodan 34-1880 TG(18:3/18:2/18:3) 10 48 Larodan 34-2230 TG(18:1/22:1/22:1) 10 49 Larodan 34-3031 TG(16:0/16:1/18:1) 10 50 Larodan 34-3032 TG(16:0/18:1/18:3) 10 51 Larodan 34-3033 TG(16:0/18:1/20:4) 10 52 Larodan 34-3034 TG(18:3/18:2/20:5) 10 53 Avanti 792143 Cer(d16:0/16:0) 10 54 Avanti 792144 Cer(d20:0/18:0) 10 55 Avanti 792145 Cer(d22:0/18:0) 10 56 Avanti 792146 TG(16:0/18:2/18:3) 10 57 Avanti 792147 TG(18:1/18:2/18:3) 10 58 Avanti 792150 PEt(16:1/16:1) 10 59 Avanti 792151 dMePE(16:1/14:0) 10 60 Avanti 792152 dMePE(16:1/16:1) 10 61 Avanti 792153 dMePE(18:1/14:0) 10 62 Avanti 792154 dMePE(16:1/18:1) 10 63 Avanti 792156 PC(18:0/18:3(6Z,9Z,12Z)) 10 64 Avanti 792155 PE(15:0/24:1(15Z)) 10 65 Avanti 792157 PC(20:0/14:1(9Z)) 10 66 Avanti 792160 TG(18:0/18:2/18:3) 10 67 Avanti 792148 TG(18:1/18:2/20:5) 10 68 Avanti 792149 TG(20:5/18:2/18:2) 10 69 Avanti 792158 PC(18:1(11Z)-16:1(9Z)) 10 70 Larodan 32-1830-7 DG(18:3/18:3) 25 71 Larodan 37-1620-7 PE(16:0/16:0) 25

    TABLE-US-00011 TABLE 11 Description of lipids 1-32. Abbrevia- No. tion IUPAC name Structure 1 DG(18:0/ 18:0/0:0) (2S)-1-hydroxy-3- (octadecanoyloxy) propan-2-yl octadecanoate [00001]embedded image 2 DG(18:0/ 16:0/0:0) (2S)-2-(hexa- decanoyloxy)-3- hydroxypropyl octadecanoate [00002]embedded image 3 DG(16:0/ 16:0/0:0) (2S)-1-(hexa- decanoyloxy)-3- hydroxypropan- 2-yl hexadecanoate [00003]embedded image 4 C18 Dihydro- ceramide (d18:0/18:0) N-[(2S,3R)-1,3- dihydroxy- octadecan-2- yl]octadecanamide [00004]embedded image 6 TG(18:1/ 18:1/18:1) 1,3-bis[(9Z)-octadec- 9-enoyloxy]propan- 2-yl (9Z)-octadec- 9-enoate [00005]embedded image 8 PE(16:0/ 18:2) (2-amino- ethoxy)[(2R)-3- (hexadecanoyloxy)- 2-[(9Z,12Z)- octadeca-9,12- dienoyloxy] propoxy] phosphinic acid [00006]embedded image 9 TG(16:0/ 16:0/18:1) (2R)-2,3-bis(hexa- decanoyloxy) propyl (9Z)- octadec-9-enoate [00007]embedded image 10 TG(16:0/ 16:0/16:0) 1,3-bis(hexa- decanoyloxy) propan-2-yl hexadecanoate [00008]embedded image 11 PC(18:0/ 18:2) trimethyl(2-{[(2R)- 2-[(9Z,12Z)- octadeca-9,12- dienoyloxy]-3- (octadecanoyloxy) propyl phosphonato]oxy} [00009]embedded image ethyl)azanium 12 PC(16:0/ 18:2) (2-{[(2R)-3- (hexadecanoyloxy)- 2-[(9Z,12Z)- octadeca-9,12- dienoyloxy]propyl phosphonato]oxy} ethyl)trimethyl- [00010]embedded image azanium 13 TG(18:2/ 18:2/18:2) 1,3-bis[(9Z,12Z)- octadeca-9,12- dienoyloxy]propan- 2-yl (9Z,12Z)- octadeca- 9,12-dienoate [00011]embedded image 14 C16 Dihydro- ceramide (d18:0/16:0) N-[(2S,3R)-1,3- dihydroxy- octadecan-2- yl]hexadecanamide [00012]embedded image 15 TG(16:0/ 18:1/18:2) 1-Palmitoyl-2- oleoyl-3-linoleoyl- rac-glycerol [00013]embedded image 16 TG(18:0/ 18:0/18:0) 1,3-bis(octa- decanoyloxy) propan-2-yl octadecanoate [00014]embedded image 17 So(d16:0) D,L-2-Amino- hexadecane- 1,3-diol [00015]embedded image 18 TG(16:0/ 18:1/18:1) 1,2-Di(cis-9- octadecenoyl)-3- hexadecanoyl-rac- glycerol [00016]embedded image 19 DG(16:0/ 18:2) 1-Palmitoyl-3- Linoleoyl-sn- glycerol [00017]embedded image 20 TG(16:0/ 16:0/18:2) 1,2-Palmitoyl-3- Linoleoyl-sn- glycerol [00018]embedded image 21 TG(16:0/ 18:2/18:2) 1,2-Linoleoyl-3- Palmitoyl-sn- glycerol [00019]embedded image 22 TG(18:0/ 16:0/18:1) 1-Stearoyl-2- Palmitoyl-3- Oleoyl-sn- glycerol [00020]embedded image 23 TG(18:0/ 18:1/18:1) 1,2-olein-3-stearin [00021]embedded image 24 TG(18:0/ 18:1/18:2) 1-Stearoyl-2-Oleoyl- 3-Linoleoyl-sn- glycerol [00022]embedded image 25 TG(18:1/ 18:1/18:2) 1,2-Oleoyl-3- Linoleoyl-sn- glycerol [00023]embedded image 26 TG(18:1/ 18:1/18:3) 1,2-Oleoyl-3- Linolenoyl-sn- glycerol [00024]embedded image 27 TG(18:1/ 18:2/18:2) 1,2-Linoleoyl-3- Oleoyl-sn-glycerol [00025]embedded image 28 TG(18:3/ 18:2/18:2) 1,2-Linoleoyl-3- Linolenoyl-sn- glycerol [00026]embedded image 29 FA(18:4) 6c,9c,12c,15c- Octadecatetraenoic [00027]embedded image Acid 30 Sphing- anine (d18:0) (2S,3R)-2- aminooctadecane- 1,3-diol [00028]embedded image 31 Sphing- anine (d20:0) (2S,3R)-2-amino- 1,3-eicosanediol [00029]embedded image 32 TG(18:0/ 16:0/16:0) (2R)-2,3-bis(hexa- decanoyloxy) propyl octadecanoate [00030]embedded image [00031]text missing or illegible when filed

    TABLE-US-00012 TABLE 12 Description of lipids 33-71. No. Abbreviation IUPAC Name Structure 33 TG(18:0/16:0/18:0) 1,3-Stearin-2- Palmitin 1,3-Octadecanoyl-2- Palmitoyl-glycerol [00032]embedded image 34 MG(18:2p) (9Z,12Z)-Octadeca- 9,12-dienoic acid, monoester with glycerol 9,12-Octadecadienoic acid (9Z,12Z)-, [00033]embedded image monoester with 1,2,3- propanetriol 9,12-Octadecadienoic acid, (Z,Z)-, monoester with 1,2,3- propanetriol [00034]embedded image 35 DG(18:2/18:2) (2S)-1-hydroxy-3- [(9Z,12Z)-octadeca- 9,12- dienoyloxy]propan-2- yl (9Z,12Z)-octadeca- 9,12-dienoate, [00035]embedded image 36 LPC(18:2) 1-Linoleoyl-2- Hydroxy-sn-Glycero- 3- Phosphatidylcholine [00036]embedded image 37 LPC(18:3) (2-{[(2R)-2-hydroxy- 3-[(9Z,12Z,15Z)- octadeca-9,12,15- trienoyloxy]propyl phosphonato]oxy} ethyl)trimethylazanium [00037]embedded image 38 PE(16:0/16:1) (2- aminoethoxy)[(2R)-2- [(9Z)-hexadec-9- enoyloxy]-3- (hexadecanoyloxy) propoxy]phosphinic acid [00038]embedded image 39 16:1-18:1PE (2- aminoethoxy)[(2R)-3- [(9Z)-hexadec-9- enoyloxy]-2-[(11Z)- octadec-11- enoyloxy]propoxy] phosphinic acid [00039]embedded image 40 16:0-22:1 PE (2- aminoethoxy)[(2R)-2- [(13Z)-docos-13- enoyloxy]-3- (hexadecanoyloxy) propoxy]phosphinic acid [00040]embedded image 41 Sphinganine(d22:0) [00041]embedded image 42 MG(22:2) Monodocosadienoin [00042]embedded image 43 DG(16:0/18:3) 1-Palmitin-3- Linolenin [00043]embedded image 44 TG(18:1/18:1/20:4) 1,2-Olein-3- Arachidonin (5Z,8Z,11Z,14Z) [00044]embedded image 45 DG(18:3/18:2) 1-Linolein-3- Linolenin [00045]embedded image [00046]embedded image 46 DG(20:5/18:2) 1-EPA-3-Linolein [00047]embedded image 47 TG(18:3/18:2/18:3) 1,3-Linolenin-2- Linolein [00048]embedded image 48 TG(18:1/22:1/22:1) 1,2-Eucin(13Z)-3- Olein [00049]embedded image 49 TG(16:0/16:1/18:1) 1-Palmitin-2- Palmitolein-3-Olein [00050]embedded image 50 TG(16:0/18:1/18:3) 1-Palmitin-2-Olein-3- Linolenin [00051]embedded image 51 TG(16:0/18:1/20:4) 1-Palmitin-2-Olein-3- Arachidonin (5Z,8Z,11Z,14Z) [00052]embedded image 52 TG(18:3/18:2/20:5) 1-Linolenin-2- Linolein-3-EPA [00053]embedded image 53 Cer(d16:0/16:0) C16 dihydroceramide (d16:0/16:0) [00054]embedded image 54 Cer(d20:0/18:0) C18 dihydroceramide (d20:0/18:0) [00055]embedded image 55 Cer(d22:0/18:0) C18 dihydroceramide (d22:0/18:0) [00056]embedded image 56 TG(16:0/18:2/18:3) Triglyceride (16:0/18:2/18:3) [00057]embedded image 57 TG(18:1/18:2/18:3) Triglyceride (18:1/18:2/18:3) [00058]embedded image 58 PEt(16:1/16:1) 1,2-dipalmitoleoyl- sn-glycero-3- phosphoethanol [00059]embedded image 59 dMePE(16:1/14:0) 1-palmitoleoyl-2- myristoyl-sn-glycero- 3- phosphoethanolamine- N,N-dimethyl [00060]embedded image 60 dMePE(16:1/16:1) 1,2-dipalmitoleoyl- sn-glycero-3- phosphoethanolamine- N,N-dimethyl [00061]embedded image 61 dMePE(18:1/14:0) 1-oleoyl-2-myristoyl- sn-glycero-3- phosphoethanolamine- N,N-dimethyl [00062]embedded image 62 dMePE(16:1/18:1) 1-palmitoleoyl-2- oleoyl-sn-glycero-3- phosphoethanolamine- N,N-dimethyl [00063]embedded image 63 PC(18:0/ 18:3(6Z,9Z,12Z)) 1-stearoyl-2- linolenoyl(gamma)- sn-glycero-3- phosphocholine [00064]embedded image 64 PE(15:0/24:1(15Z)) 1-pentadecanoyl-2- nervonoyl-sn- glycero-3- phosphoethanolamine [00065]embedded image 65 PC(20:0/14:1(9Z)) 1-eicosanoyl-2- myristoleoyl-sn- glycero-3- phosphocholine [00066]embedded image 66 TG(18:0/18:2/18:3) Triglyceride (18:0/18:2/18:3) [00067]embedded image 67 TG(18:1/18:2/20:5) Triglyceride (18:1/18:2/20:5) [00068]embedded image 68 TG(20:5/18:2/18:2) Triglyceride (20:5/18:2/18:2) [00069]embedded image 69 PC(18:1(11Z)- 16:1(9Z)) 1-vaccenoyl-2- palmitoleoyl-sn- glycero-3- phosphocholine [00070]embedded image 70 DG(18:3/18:3) Dilinolenin CCCCCCCCCCCCCCCCCC(O)OCC(O)COC(O)CCCCCCCCCCCCCCCCC 71 PE(16:0/16:0) 1,2-Dipalmitoyl-sn- Glycero-3- Phosphatidyl- ethanolamine [00071]embedded image [00072]text missing or illegible when filed

    Definition of Terms

    [0276] Decoctosome: a nanoparticulate substance derived from the plant decoction, having a thermally stable, exosome-like membrane structure and composed of lipids, proteins, nucleic acids, compounds and the like. In the present application, the decoctosome can also be referred to as an active composition with a membrane structure, preferably an active combination prepared by the method of the foregoing embodiments 10-13.

    [0277] Bencaosome: Artificially prepared nano-particulate substance with membrane structure. The membrane structure includes one or more lipid components, which are characterized by being derived from chemical synthesis or chemical separation and purification, and include but not limited to the lipids shown in Table 1 or Table 10 or lipids having 70% or more similarity with those shown in Table 1 or Table 10 (the lipid similarity is defined by the following method: having the same parent structure), and has an impurity content less than 5%. The lipids are mixed with any one or more of the following: one or more nucleic acids, one or more compounds, and one or more macromolecules. Bencaosome is a nano-particulate substance with a membrane structure prepared by heating lipids and other substances including one or more nucleic acids, one or more compounds, and/or one or more macromolecules. In this application, bencaosome can also be referred to as an active composition with a membrane structure, preferably an active composition prepared by the method of the foregoing embodiments 1-2, 5-9 or 20-28.

    [0278] The one or more lipid components can be synthesized or purified, including but not limited to the lipids shown in Table 1 or Table 10; the one or more nucleic acid components can be synthesized or purified, including but not limited to the RNA shown in Table 8, 9 or 13; the one or more compounds can be synthesized or purified, including but not limited to the compounds shown in Table 2 to Table 5; the one or more macromolecular components can be synthesized or purified, including but not limited to the proteins shown in Table 6 or Table 7.

    [0279] The term reverse evaporation method as described herein refers to adding an aqueous solution of nucleic acids/macromolecules/compounds to a solution of lipid in organic solvent, ultrasonicating, evaporating to remove the organic solvent, and then hydrating to obtain a mixture of lipid and nucleic acids/macromolecules/compounds.

    [0280] The term boiling method (also refers to heating method) as described herein refers to adding a solution of lipid in an organic solvent to an aqueous solution of nucleic acids/macromolecules/compounds and boiling at about 90 C. for 15 minutes to obtain a mixture of lipid and nucleic acids/macromolecules/compounds. The method is not limited to heating in water bath, and other means for raising temperature or heating known in the art can also be used.

    [0281] The reverse evaporation method and boiling method are carried out under controlled temperature and mixing conditions. Suitable processing time and temperature can be readily determined by a person skilled in the art. For example, the temperature for reverse evaporation method preferably ranges from about 25 C. to about 70 C., more preferably from about 30 C. to about 65 C., and more preferably from about 40 C. to about 60 C., especially about 55 C. The temperature for boiling method preferably ranges from about 0 C. to about 100 C., more preferably from about 50 C. to about 100 C., and more preferably from about 70 C. to about 90 C., especially preferably from about 80 C. to 90 C.

    [0282] The nucleic acid as described herein includes synthetic and purified DNA and RNA, preferably RNA, more preferably small RNA, for example, the small RNA having a length of 14-32 bp, 16-28 bp, 18-24 bp, and particularly, a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 bp.

    [0283] The inventor has surprisingly found that various lipids can form lipid-nucleic acids/macromolecules/compounds mixtures that effectively promote cellular absorption and entry of nucleic acid, which has the potential to increase the efficiency of clinical delivery of the nucleic acid drug. Further studies have shown that the lipid nucleic acid mixture of the present application promotes the efficiency of nucleic acid absorption and entry into cells in different cell lines, but differences were observed in different cell lines, which provides the possibility of targeted drug delivery. Moreover, such lipid nucleic acid mixtures show no sequence selectivity in nucleic acid delivery, and could deliver nucleic acid fragments having different sequences and sizes corresponding to small RNA (e.g. about 20 bp). In addition, confocal laser-scanning microscopy confirmed that the lipid nucleic acid mixture formed by artificially synthetic lipids can effectively promote the entry of exogenous nucleic acids into cytoplasm. The inventor has unexpectedly discovered that lipid nucleic acid mixtures prepared by boiling method or reverse evaporation method can facilitate entry of nucleic acids, such as RNA, into blood circulation and target tissues via non-invasive routes (e.g. via digestive tract, respiratory tract and topical administration). The inventor has also surprisingly discovered that lipids of the present application are capable of promoting entry of nucleic acids, such as RNA, into cells and modulating (e.g., inhibiting) the expression of their target sequences, while not exhibiting such modulating effects on non-target sequences, suggesting a target-specific modulating effect, which can be used as a mean for the delivery of nucleic acid drug.

    [0284] Lipid compounds of the present application are selected from the group consisting of lysolecithin, ceramide, diglyceride, phosphatidylethanolamine, phosphatidylcholine, triglyceride, monogalactosyl diglycerides, sphingosine, phosphatidyl ethanol, monoacylglycerol, fatty acid, platelet activating factor, or dimethyl phosphatidyl ethanolamine. In one embodiment, the lipid is non-natural, e.g. synthetic, or manufactured from fermentation.

    [0285] Synthesized or purified lipids can be used to deliver nucleic acids/macromolecules/compounds into a target cell. The lipid can be used to deliver nucleic acids/macromolecules/compounds into a subject in need thereof and into its blood circulation and/or a target site/cell.

    [0286] Synthesized or purified lipid can be selected from phosphatidylcholine, e.g., 1-stearoyl-2-oleoyl-sn-glycerol-3-phosphocholine (PC(18:0/18:2), i.e., lipid No. 11 in Table 1), and 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphocholine (PC(16:0/18:2), i.e., lipid No. 12 in Table 1). These two phosphocholines (PCs) are capable of efficiently encapsulating nucleic acids or promoting entry of nucleic acids into cells. The lipid may be lipid No. 41 in Table 1, i.e. sphinganine(d22:0), which is capable of efficiently encapsulating nucleic acids or promoting entry of nucleic acids into cells.

    [0287] The present application provides compositions comprising lipids and nucleic acids, macromolecules, compounds provided herein, preferably the nucleic acid is small RNA.

    [0288] The composition can be prepared for administration via non-invasive routes (e.g., topical administration) and/or injection, e.g., administration via digestive tract, respiratory tract, and/or injection, e.g., oral administration, inhalation and/or injection. In some instances, invasive routes are preferably used (e.g., injection, including intramuscular, subcutaneous, intravenous, intraarterial, intraperitoneal, and injection into a target tissue). In other instances, non-invasive routes are preferably used.

    [0289] In the compositions, at least part of or all of the lipids and nucleic acids can be prepared into the form of lipid nucleic acid mixture. Various methods for preparing the lipid nucleic acid mixtures have been widely disclosed, and the suitable methods for preparing the lipid nucleic acid mixture can be selected according to actual needs.

    [0290] The present application provides kits comprising the lipids and nucleic acids described herein, wherein the lipids and the nucleic acids are each independently provided in a first container and a second container. The first container and the second container may be the same or different. In some embodiments, at least part of or all of the lipids and the nucleic acids are prepared into lipid nucleic acid mixtures immediately prior to use.

    [0291] The present application provides methods of delivering a nucleic acid, macromolecule, and compound into a target tissue/cell, wherein the nucleic acid, macromolecule, compound are provided in a form of a pharmaceutical composition or the kit as described herein.

    [0292] The present application provides methods of in vivo delivering a nucleic acid, macromolecule, compound into a subject in need thereof, wherein the nucleic acid is provided in a form of a pharmaceutical composition or the kit as described herein, for example, in vivo delivering the nucleic acid into blood circulation or a target tissue/cell of the subject, e.g., wherein the lipid and the nucleic acid are administrated via non-invasive routes (e.g., topical administration) and/or injection, e.g., via digestive tract, respiratory tract and/or injection, e.g., by oral administration, inhalation and/or injection.

    [0293] The present application provides methods of preventing and/or treating a disease/disorder that can be prevented and/or treated with decoctosome and bencaosome, comprising providing the pharmaceutical composition or the kit described herein to a subject in need thereof, for example wherein the lipid and the nucleic acid are administered via non-invasive routes (e.g., topical administration) and/or by injection, e.g., via digestive tract, respiratory tract and/or injection, e.g., by oral administration, inhalation and/or injection. Surprisingly, the administration via non-invasive routes (e.g., via digestive tract, respiratory tract, including oral administration, gavage, inhalation and the like) can significantly promote the entry and efficacy of nucleic acids.

    [0294] The present application provides methods for the manufacture of the pharmaceutical composition or the kit, and use of the pharmaceutical composition and/or the kit in the methods described in the above aspects. Besides, also provides lipids, pharmaceutical compositions and/or kits for use in the various methods described above.

    [0295] The nucleic acid can be a small RNA, for example, the small RNA may have a length of 14-32 bp, 16-28 bp, 18-24 bp, in particular, a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 bp. In addition, the small RNA may be single-stranded, e.g., having a stem-loop structure, or double-stranded. For example, the nucleic acid may be HJT-sRNA-m7 having a sequence of ugagguagua gguugugugg uuguaagc.

    [0296] The compositions or the kits or the compounds of the present application can be used for treating a disease, such as cancer, e.g., gastric cancer, lung cancer, colorectal cancer, liver cancer, pancreatic cancer, cervical cancer, breast cancer, leukemia, multiple myeloma; such as inflammation, such as pneumonia, myocarditis, acute and chronic gastritis, acute and chronic enteritis, acute and chronic hepatitis, acute and chronic nephritis, dermatitis, encephalitis, Lymphitis, conjunctivitis, keratitis, iridocyclitis, otitis media, allergic rhinitis, asthma, pulmonary fibrosis, chronic obstructive pulmonary disease, allergic dermatitis, sickle cell disease, multiple sclerosis, systemic lupus erythematosus, lupus nephritis; and fibrosis etc.

    [0297] The compositions or the kits or the compounds of the present application can be used for treatment in vitro or in vivo, for example, to inhibit the growth of NCI-N87 cell (gastric cancer cell), MRC-5 cell (lung fibroblast) and A549 cell (lung cancer cell).

    [0298] In various embodiments of the present application, the lipid nucleic acid mixture can be obtained by a variety of methods, e.g., reverse evaporation method or boiling method. In the reverse evaporation method, an aqueous solution of nucleic acid is added to a solution of lipid in an organic solvent, ultrasonicated, evaporated to remove the organic solvent, and then hydrated to obtain a lipid nucleic acid mixture. The boiling method described in the present application refers to adding a solution of lipid in an organic solvent to an aqueous solution of nucleic acid and boiling at about 100 C. for 30 minutes to obtain a lipid nucleic acid mixture. The reverse evaporation method and the boiling method are carried out under controlled temperature and mixing conditions. Suitable processing times and temperatures can be readily determined by a person skilled in the art. For example, the temperature of reverse evaporation method can range preferably from about 25 C. to about 70 C., more preferably from about 30 C. to about 65 C., more preferably from about 40 C. to about 60 C., especially preferably about 55 C. The temperature of the boiling method (also referred to as heating) can range preferably from about 25 C. to about 100 C., more preferably from about 50 C. to about 100 C., more preferably from about 70 C. to about 90 C., especially preferably about 90 C.

    [0299] Exemplary embodiments of the present application include, but are not limited to, the following:

    [0300] Embodiment 1. A method for preparing a bencaosome, comprising the steps of:

    [0301] (3) mixing one or more lipid components with any one or more of the following: one or more nucleic acids, one or more compounds and/or one or more macromolecules;

    [0302] preferably, the one or more lipid components are synthesized or purified, such as include lipids selected from those shown in Table 1 or Table 10;

    [0303] (4) treating the obtained mixture by heating,

    [0304] wherein the heating temperature is preferably from about 0 C. to about 100 C., more preferably from about 50 C. to about 100 C., and more preferably from about 70 C. to about 90 C., in particular preferably from about 80 C. to about 90 C., preferably 90 C.;

    [0305] preferably, the time for heating is about 0 minute to about 24 hours, about 5 minutes to about 20 hours, about 10 minutes to about 16 hours, about 30 minutes to about 12 hours, about 1 hour to about 8 hours, or about 0.5 hour to about 4 hours, preferably 5 minutes to 30 minutes;

    [0306] preferably, the mixing is performed by adding a solution of the lipid components in an organic solvent into an aqueous solution of the nucleic acid, macromolecule and/or compound;

    [0307] preferably, the organic solvent includes alcohols, ethers, and benzenes, preferably chloroform, ethyl ether, methanol, or ethanol;

    [0308] preferably, the aqueous solution is selected from the group consisting of aqueous buffers, saline solutions, aqueous solutions of organic solvents and water;

    [0309] preferably, wherein the bencaosome is a nano-particulate substance with a membrane structure, preferably a nanoparticulate substance with a double layered membrane structure;

    [0310] preferably, wherein the bencaosome is used for oral and intravenous administration, such as bolus injection or continuous infusion for a period of time, via subcutaneous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, intrapulmonary administration, intracerebrospinal administration, intraarticular administration, intrasynovial administration, intrathecal administration, intralesional administration, or administration via inhalation routes such as intranasal, typically intravenous or subcutaneous administration.

    [0311] Embodiment 2. The method of embodiment 1, wherein the lipid is Sphinganine (d22:0), and/or the small RNA is PGY-sRNA-6 or HJT-sRNA-m7,

    [0312] wherein preferably, the Sphinganine (d22:0) is used as 10 mg/ml chloroform solution,

    [0313] lipid:sRNA=0.1-20 g:0.1 nmol;

    [0314] wherein preferably, the bencaosome has a Zeta potential of less than 60 mV, less than 50 mV, less than 0, 80 to 20, or 60 to 20, and has an average particle size of 50-1000, 90-300 or 100-200 nm.

    [0315] Embodiment 3. The bencaosome prepared by the method of embodiment 1 or 2, preferably used in one or more of the following:

    [0316] (9) lowering the expression of fibronectin and/or alpha-SMA, preferably the protein expression of fibronectin in MRC-5 cells fibrosis model induced by TGF-beta1;

    [0317] (10) reducing hydroxyproline, preferably the hydroxyproline in pulmonary fibrosis model, preferably the hydroxyproline in pulmonary fibrosis model of mice;

    [0318] (11) preventing or treating fibrosis, preferably pulmonary fibrosis, preferably in the fibrosis model of MRC-5 cells induced by TGF-beta1 or the fibrosis model of mice induced by Bleomycin;

    [0319] (12) lowering IL-1beta, IL-6 and/or TNF-alpha, preferably the IL-1beta, IL-6 and/or TNF-alpha in A549 cells model induced by poly(I:C);

    [0320] (13) lowering the level of IL-1alpha, IL-1b, IL-2, IL-3, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12 p40, IL-12 p70, IL-13, IL-17A, GM-CSF, IFN-gamma or MCP-1beta, preferably the level of plasma, preferable in an inflammation model of mouse;

    [0321] (14) treating IL-1beta, IL-6 and/or TNF-alpha-associated diseases, or for anti-inflammation, preferably for the treatment of pneumonia, myocarditis, acute and chronic gastritis, acute and chronic enteritis, acute and chronic hepatitis, acute and chronic nephritis, dermatitis, encephalitis, lymphitis, conjunctivitis, keratitis, iridocyclitis, otitis media, allergy rhinitis, asthma, pulmonary fibrosis, chronic obstructive pulmonary disease, allergic dermatitis, sickle cell disease, multiple sclerosis, systemic lupus erythematosus, lupus nephritis, lung cancer, gastric cancer, colorectal cancer, liver cancer, pancreatic cancer, cervical cancer, breast cancer, leukemia, multiple myeloma, diabetes and gout; and

    [0322] (15) enabling small RNA to enter cells efficiently; and/or

    [0323] (16) lowering the expression of RELA genes;

    [0324] preferably, the bencaosome lowers the expression of fibrosis-associated protein fibronectin and alpha-SMA, and/or lowers the expression of IL-1beta, IL-6 and/or TNF-alpha, preferably the expression level of IL-1beta, IL-6 and/or TNF-alpha in A549 cells model induced by poly(I:C).

    [0325] Embodiment 4. Use of the bencaosome of embodiment 3 in one or more of the following, or use of the bencaosome of embodiment 3 in manufacture of medicament for use in one or more of the following, or methods for using the bencaosome of embodiment 3 in one or more of the following:

    [0326] (9) lowering the expression of fibronectin and/or alpha-SMA, preferably the protein expression of fibronectin in MRC-5 cells fibrosis model induced by TGF-beta1;

    [0327] (10) reducing hydroxyproline, preferably the hydroxyproline in pulmonary fibrosis model, preferably the hydroxyproline in pulmonary fibrosis model of mice;

    [0328] (11) preventing or treating fibrosis, preferably pulmonary fibrosis, preferably in the fibrosis model of MRC-5 cells induced by TGF-beta1 or the fibrosis model of mice induced by Bleomycin;

    [0329] (12) lowering IL-1beta, IL-6 and/or TNF-alpha, preferably the IL-1beta, IL-6 and/or TNF-alpha in A549 cells model induced by poly(I:C);

    [0330] (13) lowering the level of IL-1alpha, IL-1beta, IL-2, IL-3, IL-4, IL-5, IL-9, IL-10, IL-12 p40, IL-12 p70, IL-13, IL-17A, GM-CSF, IFN-gamma or MCP-1beta, preferably the level of plasma, preferable in an inflammation model of mouse;

    [0331] (14) treating IL-1beta, IL-6 and/or TNF-alpha-associated diseases, or for anti-inflammation, preferably for the treatment of pneumonia, myocarditis, acute and chronic gastritis, acute and chronic enteritis, acute and chronic hepatitis, acute and chronic nephritis, dermatitis, encephalitis, lymphitis, conjunctivitis, keratitis, iridocyclitis, otitis media, allergy rhinitis, asthma, pulmonary fibrosis, chronic obstructive pulmonary disease, allergic dermatitis, sickle cell disease, multiple sclerosis, systemic lupus erythematosus, lupus nephritis, lung cancer, gastric cancer, colorectal cancer, liver cancer, pancreatic cancer, cervical cancer, breast cancer, leukemia, multiple myeloma, diabetes and gout; and

    [0332] (15) enabling small RNA to enter cells efficiently; and/or

    [0333] (16) lowering the expression of RELA genes;

    [0334] preferably, the bencaosome lowers the expression of fibrosis-associated protein fibronectin and alpha-SMA, and/or lowers the expression of IL-1beta, IL-6 and/or TNF-alpha, preferably the expression level of IL-1beta, IL-6 and/or TNF-alpha in A549 cells model induced by poly(I:C);

    [0335] preferably, wherein the medicament is used for oral and intravenous administration, such as bolus injection or continuous infusion for a period of time, via subcutaneous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, intrapulmonary administration, intracerebrospinal administration, intraarticular administration, intrasynovial administration, intrathecal administration, intralesional administration, or administration via inhalation routes such as intranasal, typically intravenous or subcutaneous administration.

    [0336] Embodiment 5. A method of facilitating nucleic acid delivery comprising heating or warming up nucleic acid and one or more lipids in Table 1 or Table 10, preferably Sphinganine (d22:0), the temperature for heating or warming up is preferably from about 4 C. to about 100 C., from about 25 C. to about 100 C., more preferably from about 50 C. to about 100 C., more preferably from about 95 C. to about 100 C., particularly preferably from about 80 C. to about 100 C., i.e. 4 C., 37 C., 60 C., 80 C. or 100 C., wherein preferably, the nucleic acid is a small nucleic acid, preferably is single or double stranded, preferably the small nucleic acid has a length of 14-32 bp, 16-28 bp or 18-24 bp, preferably any one or more small RNA in Tables 8, 9 and 13, preferably PGY-sRNA-6 or HJT-sRNA-m7; preferably, the nucleic acid delivery is by oral administration; preferably, the nucleic acid is used for treating a disease, such as inflammation-associated diseases and cancer, for example gastric cancer or lung cancer, preferably used for anti-inflammation and anti-fibrosis, preferably for reducing inflammation-associated factors IL-1beta, IL-6 and/or TNF-alpha, cytokine storm IL-1alpha, IL-1beta, IL-2, IL-3, IL-4, IL-5, IL-9, IL-10, IL-12 p40, IL-12 p70, IL-13, IL-17A, GM-CSF, IFN-gama, RANTES or MCP-1beta, and lowering the expression of fibrosis-associated protein fibronectin and -SMA.

    [0337] Embodiment 6. The method of embodiment 5, further comprising further mixing one or compounds, one or more nucleic acids, and/or one or more macromolecules; wherein the nucleic acids include DNA and RNA, preferably RNA, more preferably small RNA;

    [0338] preferably mixing one or more compounds shown in Table 2 to Table 5, one or more small RNA shown in Table 8 and/or Table 9 and/or Table 13, one or more DNA and/or one or more macromolecules shown in Table 6 or Table 7.

    [0339] Embodiment 7. The method of any one of embodiments 1-6, wherein the more lipids are the lipids comprising the lipid combination selected from the following: a lipid combination of No. 8: No. 41=6:1; a lipid combination of No. 38:No. 41=6:1; a lipid combination of No. 39:No. 41=6:1; a lipid combination of No. 40:No. 41=6:1; a lipid combination of No. 38:No. 12:No. 41:No. 29=1:2:1:1; a lipid combination of No. 40:No. 12:No. 41=2:4:3; a lipid combination of No. 12:No. 41=1:6; a lipid combination of No. 12:No. 41=1:1; a lipid combination of No. 12:No. 41=6:1; a lipid combination of No. 40:No. 12:No. 41=2:2:2; a lipid combination of No. 4:No. 12:No. 41=1:1:1; DG combination of No. 1:No. 2:No. 3:No. 19:No. 35=1:1:1:1:1; TG combination of No. 6:No. 9:No. 10:No. 13:No. 15:No. 16:No. 18:No. 20:No. 21:No. 22:No. 23:No. 24:No. 25:No. 26:No. 27:No. 28:No. 32:No. 33=1:1:1:1:1:1:1:1:1:1:1:1:1:1:1:1:1:1; LPC combination of No. 36:No. 37=1:1; PC combination of No. 11:No. 12=1:1; PE combination of No. 8:No. 38=1:1; Cer combination of No. 4:No. 14=1:1; So combination of No. 17:No. 30:No. 31=1:1:1; an equal volume combination of No. 1-36 without No. 5, No. 7; an equal volume combination of No. 1-36 without No. 5, No. 7, No. 34; an equal volume combination of No. 1-36 without No. 5, No. 7, No. 1, No. 2, No. 3, No. 19, No. 35; an equal volume combination of No. 1-36 No. 5, No. 7, No. 6, No. 9, No. 10, No. 13, No. 15, No. 16, No. 18, No. 20, No. 21, No. 22, No. 23, No. 24, No. 25, No. 26, No. 27, No. 28, No. 32, No. 33; an equal volume combination of No. 1-36 without No. 5, No. 7, No. 36, No. 37; an equal volume combination of No. 1-36 without No. 5, No. 7, No. 11, No. 12; an equal volume combination of No. 1-36 without No. 5, No. 7, No. 8 in; an equal volume combination of No. 1-36 without No. 5, No. 7, No. 4, No. 14; an equal volume combination of No. 1-36 without No. 5, No. 7, No. 29; a lipid combination of No. 1:No. 34=2:1; a lipid combination of No. 1:said DG composition=2:1; a lipid combination of No. 1:said TG composition=2:1; a lipid combination of No. 1:said LPC composition=2:1; a lipid combination of No. 1:No. 8=2:1; a lipid combination of No. 1:No. 12=2:1; a lipid combination of No. 1:said Cer composition=2:1; a lipid combination of No. 1:said So composition=2:1; a lipid combination of No. 1:No. 29=2:1; a lipid combination of No. 1:No. 8:No. 12=1:1:1; a lipid combination of No. 8:No. 34=2:1; a lipid combination of No. 8:said DG composition=2:1; a lipid combination of No. 8:said TG composition=2:1; a lipid combination of No. 8:said LPC composition=2:1; a lipid combination of No. 8:No. 37=4:1; a lipid combination of No. 8:No. 12=2:1; a lipid combination of No. 8:said Cer composition=2:1; a lipid combination of No. 8:said So composition=2:1; a lipid combination of No. 8:No. 31=6:1; a lipid combination of No. 8:No. 29=2:1; a lipid combination of No. 12:No. 34=2:1; a lipid combination of No. 12:said DG composition=2:1; a lipid combination of No. 12:said TG composition=2:1; a lipid combination of No. 12:said LPC composition=2:1; a lipid combination of No. 12:No. 8=2:1; a lipid combination of No. 12:said Cer composition=2:1; a lipid combination of No. 12:said So composition=2:1; a lipid combination of No. 12:No. 29=2:1; a lipid combination of No. 12:No. 8:No. 1&2=2:1:1; a lipid combination of No. 12:No. 8:No. 15=2:1:1; a lipid combination of No. 12:No. 8:No. 36&37=2:1:1; a lipid combination of No. 12:No. 8:No. 11=2:1:1; a lipid combination of No. 12:No. 8:No. 12=2:1:1; a lipid combination of No. 12:No. 8:No. 4=2:1:1; a lipid combination of No. 12:No. 8:No. 31=2:1:1; a lipid combination of No. 12:No. 8:No. 29=2:1:1; a lipid combination of No. 12:No. 8:No. 34=3:2:1; a lipid combination of No. 12:No. 8:No. 34=4:2:3; a lipid combination of No. 12:No. 8:No. 2=4:2:3; a lipid combination of No. 12:No. 8:No. 2=16:8:3; a lipid combination of No. 12:No. 8:No. 32=4:2:3; a lipid combination of No. 12:No. 8:No. 37=4:2:3; a lipid combination of No. 12:No. 8:No. 11=4:2:3; a lipid combination of No. 12:No. 8:No. 38=4:2:3; a lipid combination of No. 12:No. 8:No. 4=4:2:3; a lipid combination of No. 12:No. 8:No. 31=4:2:3; a lipid combination of No. 12:No. 8:No. 29=4:2:3; a lipid combination of No. 12:No. 8:No. 29:No. 31=2:1:1:1; a lipid combination of No. 12:No. 8:No. 29:No. 31:No. 34=4:2:2:2:5; a lipid combination of No. 12:No. 8:No. 29:No. 31:No. 2=4:2:2:2:5; a lipid combination of No. 12:No. 8:No. 29:No. 31:No. 32=4:2:2:2:5; a lipid combination of No. 12:No. 8:No. 29:No. 31:No. 11=4:2:2:2:5; a lipid combination of No. 12:No. 8:No. 29:No. 31:No. 37=4:2:2:2:5; a lipid combination of No. 12:No. 8:No. 29:No. 31:No. 38=4:2:2:2:5; a lipid combination of No. 12:No. 8:No. 29:No. 31:No. 4=4:2:2:2:5; a lipid combination of No. 12:No. 8:No. 29:No. 31:No. 4:No. 1:No. 16=2:1:1:3:2:2:3; a lipid combination of No. 1:No. 8:No. 12:No. 1&2=2:2:2:3; a lipid combination of No. 1:No. 8:No. 12:No. 15=2:2:2:3; a lipid combination of No. 1:No. 8:No. 12:No. 36&37=2:2:2:3; a lipid combination of No. 1:No. 8:No. 12:No. 12=2:2:2:3; a lipid combination of No. 1:No. 8:No. 12:No. 4=2:2:2:3; a lipid combination of No. 1:No. 8:No. 12:No. 31=2:2:2:3; a lipid combination of No. 1:No. 8:No. 12:No. 29=2:2:2:3; a lipid combination of No. 8:No. 34:No. 1&2=2:1:1; a lipid combination of No. 8:No. 34:No. 15=2:1:1; a lipid combination of No. 8:No. 34:No. 36&37=2:1:1; a lipid combination of No. 8:No. 34:No. 12=2:1:1; a lipid combination of No. 8:No. 34:No. 4=2:1:1; a lipid combination of No. 8:No. 34:No. 31=2:1:1; a lipid combination of No. 8:No. 34:No. 29=2:1:1; a lipid combination of No. 8:No. 31:No. 34=12:3:5; a lipid combination of No. 8:No. 31:No. 2=12:3:5; a lipid combination of No. 8:No. 31:No. 37=12:3:5; a lipid combination of No. 8:No. 31:No. 11=12:3:5; a lipid combination of No. 8:No. 31:No. 12=12:3:5; a lipid combination of No. 8:No. 31:No. 4=12:3:5; a lipid combination of No. 8:No. 31:No. 29=12:3:5; a lipid combination of No. 8:No. 31:No. 32=12:3:5; a lipid combination of No. 8:No. 4:No. 34=12:3:5; a lipid combination of No. 8:No. 4:No. 2=12:3:5; a lipid combination of No 0.8:No. 4:No. 37=12:3:5; a lipid combination of No. 8:No. 4:No. 12=12:3:5; a lipid combination of No. 8:No. 4:No. 31=12:3:5; a lipid combination of No. 8:No. 4:No. 29=12:3:5; a lipid combination of No. 8:No. 4:No. 32=12:3:5; a lipid combination of No. 38:No. 34=2:1; a lipid combination of No. 38:No. 1=2:1; a lipid combination of No. 38:No. 2=2:1; a lipid combination of No. 38:No. 1&2=2:1; a lipid combination of No. 38:No. 15=2:1; a lipid combination of No. 38:No. 32=2:1; a lipid combination of No. 38:No. 37=2:1; a lipid combination of No. 38:No. 37=4:1; a lipid combination of No. 38:No. 11=2:1; a lipid combination of No. 38:No. 12=2:1; a lipid combination of No. 38:No. 11&12=2:1; a lipid combination of No. 38:No. 12=4:1; a lipid combination of No. 38:No. 8=2:1; a lipid combination of No. 38:No. 4=2:1; a lipid combination of No. 38: So (30)=2:1; a lipid combination of No. 38:No. 31=2:1; a lipid combination of No. 38:No. 29=2:1; a lipid combination of No. 1:No. 38:No. 12:No. 34=2:2:2:3; a lipid combination of No. 1:No. 38:No. 12:No. 15=2:2:2:3; a lipid combination of No. 1:No. 38:No. 12:No. 37=2:2:2:3; a lipid combination of No. 1:No. 38:No. 12:No. 8=2:2:2:3; a lipid combination of No. 1:No. 38:No. 12:No. 4=2:2:2:3; a lipid combination of No. 1:No. 38:No. 12:No. 31=2:2:2:3; a lipid combination of No. 1:No. 38:No. 12:No. 29=2:2:2:3; a lipid combination of No. 38:No. 34:No. 1=2:1:3; a lipid combination of No. 38:No. 34:No. 15=2:1:3; a lipid combination of No. 38:No. 34:No. 37=2:1:3; a lipid combination of No. 38:No. 34:No. 12=2:1:3; a lipid combination of No. 38:No. 34:No. 8=2:1:3; a lipid combination of No. 38:No. 34:No. 4=2:1:3; a lipid combination of No. 38:No. 34:No. 31=2:1:3; a lipid combination of No. 38:No. 34:No. 29=2:1:3; a lipid combination of No. 38:No. 12:No. 1=2:1:3; a lipid combination of No. 38:No. 12:No. 2=4:1:3; a lipid combination of No. 38:No. 12:No. 15=2:1:3; a lipid combination of No. 38:No. 12:No. 37=2:1:3; a lipid combination of No. 38:No. 12:No. 8=2:1:3; a lipid combination of No. 38:No. 12:No. 4=2:1:3; a lipid combination of No. 38:No. 12:No. 31=2:1:3; a lipid combination of No. 38:No. 12:No. 29=2:1:3; a lipid combination of No. 38:No. 12:No. 1:No. 15:No. 34=22:22:22:33:36; a lipid combination of No. 38:No. 12:No. 1:No. 15:No. 37=22:22:22:33:36; a lipid combination of No. 38:No. 12:No. 1:No. 15:No. 4=22:22:22:33:36; a lipid combination of No. 38:No. 12:No. 1:No. 15:No. 31=22:22:22:33:36; a lipid combination of No. 38:No. 12:No. 1:No. 15:No. 29=22:22:22:33:36; a lipid combination of No. 38:No. 34:No. 37:No. 1=44:22:33:36; a lipid combination of No. 38:No. 34:No. 37:No. 15=44:22:33:36; a lipid combination of No. 38:No. 34:No. 37:No. 12=44:22:33:36; a lipid combination of No. 38:No. 34:No. 37:No. 4=44:22:33:36; a lipid combination of No. 38:No. 34:No. 37:No. 31=44:22:33:36; a lipid combination of No. 38:No. 12:No. 4:No. 34=44:22:33:36; a lipid combination of No. 38:No. 12:No. 4:No. 1=44:22:33:36; a lipid combination of No. 38:No. 12:No. 4:No. 15=44:22:33:36; a lipid combination of No. 38:No. 12:No. 4:No. 37=44:22:33:36; a lipid combination of No. 38:No. 12:No. 4:No. 37=8:2:5:3; a lipid combination of No. 38:No. 12:No. 4:No. 31=44:22:33:36; a lipid combination of No. 38:No. 12:No. 4:No. 29=44:22:33:36; a lipid combination of No. 38:No. 12:No. 4:No. 29:No. 34=88:44:66:72:135; a lipid combination of No. 38:No. 12:No. 4:No. 29:No. 1=88:44:66:72:135; a lipid combination of No. 38:No. 12:No. 4:No. 29:No. 15=88:44:66:72:135; a lipid combination of No. 38:No. 12:No. 4:No. 29:No. 37=88:44:66:72:135; a lipid combination of No. 38:No. 12:No. 4:No. 29:No. 31=88:44:66:72:135; a lipid combination of No. 38:No. 12:No. 4:No. 2=20:10:15:9; a lipid combination of No. 38:No. 12:No. 4:No. 6=20:10:15:9; a lipid combination of No. 38:No. 12:No. 4:No. 17=20:10:15:9; a lipid combination of No. 38:No. 12:No. 4:No. 29=20:10:15:9; a lipid combination of No. 38:No. 12:No. 4:No. 34=20:10:15:9; a lipid combination of No. 38:No. 12:No. 4:No. 37=20:10:15:9; a lipid combination of No. 38:No. 12:No. 31:No. 34=2:1:3:3; a lipid combination of No. 38:No. 12:No. 31:No. 1=2:1:3:3; a lipid combination of No. 38:No. 12:No. 31:No. 15=2:1:3:3; a lipid combination of No. 38:No. 12:No. 31:No. 37=2:1:3:3; a lipid combination of No. 38:No. 12:No. 31:No. 4=2:1:3:3; a lipid combination of No. 38:No. 12:No. 31:No. 29=2:1:3:3; a lipid combination of No. 38:No. 34:No. 37:No. 31:No. 1=88:44:66:72:135; a lipid combination of No. 38:No. 34:No. 37:No. 31:No. 15=88:44:66:72:135; a lipid combination of No. 38:No. 34:No. 37:No. 31:No. 12=88:44:66:72:135; a lipid combination of No. 38:No. 34:No. 37:No. 31:No. 4=88:44:66:72:135; a lipid combination of No. 38:No. 34:No. 37:No. 31:No. 29=88:44:66:72:135; a lipid combination of No. 38:No. 37:No. 34=4:2:3; a lipid combination of No. 38:No. 37:No. 1=4:2:3; a lipid combination of No. 38:No. 37:No. 2=4:2:3; a lipid combination of No. 38:No. 37:No. 1&2=4:2:3; a lipid combination of No. 38:No. 37:No. 2=32:8:5; a lipid combination of No. 38:No. 37:No. 32=32:8:5; a lipid combination of No. 38:No. 37:No. 15=4:2:3; a lipid combination of No. 38:No. 37:No. 32=4:2:3; a lipid combination of No. 38:No. 37:No. 8=4:2:3; a lipid combination of No. 38:No. 37:No. 11=4:2:3; a lipid combination of No. 38:No. 37:No. 12=4:2:3; a lipid combination of No. 38:No. 37:No. 11&12=4:2:3; a lipid combination of No. 38:No. 37:No. 12=4:1:1; a lipid combination of No. 38:No. 37:No. 4=4:2:3; a lipid combination of No. 38:No. 37:No. 30=4:2:3; a lipid combination of No. 38:No. 37:No. 31=4:2:3; a lipid combination of No. 38:No. 37:No. 29=4:2:3; a lipid combination of No. 8:No. 37:No. 32=4:1:2; a lipid combination of No. 8:No. 37:No. 2=4:1:2; a lipid combination of No. 38:No. 37:No. 15:No. 34=64:16:10:45; a lipid combination of No. 38:No. 37:No. 15:No. 1=64:16:10:45; a lipid combination of No. 38:No. 37:No. 15:No. 12=64:16:10:45; a lipid combination of No. 38:No. 37:No. 15:No. 4=64:16:10:45; a lipid combination of No. 38:No. 37:No. 15:No. 31=64:16:10:45; a lipid combination of No. 38:No. 37:No. 15:No. 29=64:16:10:45; a lipid combination of No. 38:No. 2:No. 37=4:2:3; a lipid combination of No. 38:No. 2:No. 31=4:2:3; a lipid combination of No. 38:No. 2:No. 29=4:2:3; a lipid combination of No. 38:No. 2:No. 34=4:2:3; a lipid combination of No. 38:No. 2:No. 32=4:2:3; a lipid combination of No. 38:No. 2:No. 12=4:2:3; a lipid combination of No. 38:No. 2:No. 12=4:5:1; a lipid combination of No. 38:No. 2:No. 4=4:2:3; lipids No. 1&2, No. 11&12 and No. 36&37 represent lipids No. 1 and No. 2 in any ratio, lipids No. 11 and No. 12 in any ratio, lipids No. 36 and No. 37 in any ratio, respectively.

    [0340] Embodiment 8. A method of promoting the formation of bencaosome from nucleic acid and lipid, comprising heating a mixture of nucleic acid and lipid to promote the insertion of nucleic acid into the lipid membrane and promoting the stability of the lipid-nucleic acid complex, as determined by critical micelle concentration;

    [0341] wherein the nucleic acid inserts into the lipid layer or is encapsulated by the lipid layer to form the bencaosome, which is a nanoparticulate substance with a membrane structure, preferably a nanoparticulate substance with a double membrane structure;

    [0342] wherein the heating temperature is preferably from about 0 C. to about 100 C., more preferably from about 50 C. to about 100 C., and more preferably from about 80 C. to about 100 C., particularly preferably from about 80 C. to about 90 C., preferably 90 C.;

    [0343] preferably, the time for heating is about 0 minute to about 24 hours, about 5 minutes to about 20 hours, about 10 minutes to about 16 hours, about 15 minutes to about 12 hours, about 1 hour to about 8 hours, or about 2 hours to about 4 hours, preferably 15 minutes;

    [0344] preferably, the lipid is one or more lipids in Table 1 or Table 10, preferably Sphinganine (d22:0), or the lipid combination of embodiment 7; preferably, the nucleic acid is small RNA, preferably one or more small RNA shown in Tables 8, 9 and 13, preferably PGY-sRNA-6 or HJT-sRNA-m7.

    [0345] Embodiment 9. A method for lipid delivery of proteins to cells, comprising heating the proteins and lipids, wherein the heating temperature is preferably from about 0 C. to about 100 C., more preferably from about 50 C. to about 100 C., and more preferably from about 80 C. to about 100 C., particularly preferably from about 80 C. to about 90 C., preferably 90 C.;

    [0346] preferably, the time for heating is about 0 minute to about 24 hours, about 5 minutes to about 20 hours, about 10 minutes to about 16 hours, about 15 minutes to about 12 hours, about 1 hour to about 8 hours, or about 2 hours to about 4 hours, preferably 6 hours;

    [0347] or the method for lipid delivery of proteins to cells comprises mixing a protein solution with a solution of lipid in an organic solvent, preferably at v/v=1/5; removing the organic solvent, preferably by evaporation; and hydrating with an aqueous reagent;

    [0348] or conduct the preparation by a boiling method comprising adding a solution of lipid in an organic solvent to a protein solution, and warming up after mixing;

    [0349] preferably, the lipid is one or more lipids in Table 1 or Table 10, preferably sphinganine (d22:0) or PE(16:0/16:0) or PE(16:0/22:1).

    [0350] Embodiment 10. A method for preparing a decoctosome from plants, comprising the steps of:

    [0351] (4) preparing an extract of the plants using a solvent, preferably an aqueous solvent,

    [0352] wherein preferably, the extract of the plants is prepared by decocting the plants soaked in the solvent;

    [0353] wherein preferably, the decocting includes decocting with intense heating for 15-45 min, preferably 20-30 min, preferably 30 min, followed by decoting with gentle heating for 5-30 min, preferably 5-20 min, preferably 10 min;

    [0354] wherein preferably, the temperature of the intense heating is above 90 C., preferably 90 C.-2000 C., 90 C.-1500 C., 90 C.-1000 C., 90 C.-500 C., 90 C.-300 C., 90 C.-250 C. or 90 C.-200 C.;

    [0355] preferably, the temperature of the gentle heating is above 50 C., preferably 50 C.-2000 C., 50 C.-1500 C., 50 C.-1000 C., 50 C.-500 C., 50 C.-300 C., 50 C.-250 C., 50 C.- 200 C., 50 C.-100 C., 50 C.-80 C., 50 C.-70 C. or 50 C.-60 C.;

    [0356] preferably, the aqueous solvent is selected from the group consisting of aqueous buffers, saline solutions, aqueous solutions of organic solvents and water;

    [0357] (5) differential centrifuging the extract at an appropriate temperature, preferably 0-10 C., 4 C., preferably at 800-5000 g, preferably 1000-4000 g, preferably 2000-3000 g, preferably at 2000 g for 20-40 min, preferably 30 min; taking the supernatant, and then centrifuging the supernatant at 6000 g-15000 g, preferably 7000 g-12000 g, preferably 8000 g-11000 g, preferably at 10000 g for 20-40 min, preferably 30 min; taking the supernatant, and then centrifuging the supernatant at 100000-200000, preferably at 200000 g for 60-120 min, preferably 90 min; taking the precipitates, which are the solid form of the decoctosome; and

    [0358] (6) optionally, resuspending the precipitates with an aqueous solution, preferably an aqueous buffer, preferably PBS buffer, more preferably PBS buffer at pH7-9, preferably pH7.4 to provide the decoctosome, which is a nanoparticulate substance with a membrane structure, preferably a nano-particulate substance with a double layered membrane structure, the aqueous solution is selected from the group consisting of aqueous buffers, saline solutions, aqueous solutions of organic solvents and water.

    [0359] Embodiment 11. The method of embodiment 10, wherein the decoctosome has an average particle size of 30-1,000 nm, preferably 80-300 nm, and a potential absolute value of 20-100 mV.

    [0360] Embodiment 12. The method of embodiment 10 or 11, wherein the plant is selected from the group consisting of Taraxacum mongolicum, Rhodiola, Andrographis paniculata, Cabbage and Woody etc.

    [0361] Embodiment 13. The method of any one of embodiments 10-12, wherein for Taraxacum mongolicum, the decoctosome has a peak value for the average particle size of 30-300 nm, preferably 150-200 nm, and a Zeta potential of 393 mV; for Rhodiola, the decoctosome has an average particle size of 50-300 nm, preferably 150-210 nm, and a Zeta potential of 372 mV;

    [0362] the Taraxacum mongolicum decoctosome has a potential absolute value of 20-100 mV, and the Rhodiola decoctosome has a potential absolute value of 20-100 mV.

    [0363] Embodiment 14. The decoctosome prepared by the method of any one of embodiments 10-13, wherein the decoctosome is in the form of solid or liquid or colloid, and the decoctosome comprises a nanoparticulate substance with a membrane structure, preferably a nanoparticulate substance with a double layered membrane structure.

    [0364] Embodiment 15. The decoctosome of embodiment 14, comprising one or more lipid components shown in Table 1 or 10, one or more compounds, one or more DNAs, one or more macromolecules and/or one or more RNAs;

    [0365] preferably, the decoctsome comprises one or more lipid components shown in Table 1 or Table 10, one or more compounds shown in Table 2 or 4, one or more compounds shown in Table 3 or 5, one or more macromolecules shown in Table 6 or 7, and/or one or more small RNAs shown in Table 8, 9 or 13.

    [0366] Embodiment 16. The decoctosome of embodiment 14 or 15, which is a composition used for oral and intravenous administration, such as bolus injection or continuous infusion for a period of time, via subcutaneous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, intrapulmonary administration, intracerebrospinal administration, intraarticular administration, intrasynovial administration, intrathecal administration, intralesional administration, or administration via inhalation routes such as intranasal, typically intravenous or subcutaneous administration.

    [0367] Embodiment 17. The decoctosome of any one of embodiments 14-16, used in one or more of the following:

    [0368] (1) lowering the expression of fibronectin and/or alpha-SMA, preferably the protein expression of fibronectin in MRC-5 cells fibrosis model induced by TGF-beta1;

    [0369] (2) reducing hydroxyproline, preferably the hydroxyproline in pulmonary fibrosis model, preferably the hydroxyproline in pulmonary fibrosis model of mice;

    [0370] (3) preventing or treating fibrosis, preferably pulmonary fibrosis;

    [0371] (4) lowering IL-1beta, IL-6 and/or TNF-alpha, preferably the IL-1beta, IL-6 and/or TNF-alpha in A549 cells model induced by poly(I:C);

    [0372] (5) lowering the level of IL-1alpha, IL-1beta, IL-2, IL-3, IL-4, IL-5, IL-9, IL-10, IL-12 p40, IL-12 p70, IL-13, IL-17A, GM-CSF, IFN-gamma or MCP-1beta, preferably the level of plasma, preferable in an inflammation model of mouse;

    [0373] (6) treating IL-1beta, IL-6 and/or TNF-alpha-associated diseases, or for anti-inflammation, preferably for the treatment of pneumonia, myocarditis, acute and chronic gastritis, acute and chronic enteritis, acute and chronic hepatitis, acute and chronic nephritis, dermatitis, encephalitis, lymphitis, conjunctivitis, keratitis, iridocyclitis, otitis media, allergy rhinitis, asthma, pulmonary fibrosis, chronic obstructive pulmonary disease, allergic dermatitis, sickle cell disease, multiple sclerosis, systemic lupus erythematosus, lupus nephritis, lung cancer, gastric cancer, colorectal cancer, liver cancer, pancreatic cancer, cervical cancer, breast cancer, leukemia, multiple myeloma, diabetes and gout; and/or

    [0374] (7) lowering the expression of RELA genes.

    [0375] Embodiment 18. Use of the decoctosome of any one of embodiments 14-16 in the manufacture of medicament for use in one or more of the following:

    [0376] (8) lowering the expression of fibronectin and/or alpha-SMA, preferably the protein expression of fibronectin in MRC-5 cells fibrosis model induced by TGF-beta1;

    [0377] (9) reducing hydroxyproline, preferably the hydroxyproline in pulmonary fibrosis model, preferably the hydroxyproline in pulmonary fibrosis model of mice;

    [0378] (10) preventing or treating fibrosis, preferably pulmonary fibrosis;

    [0379] (11) lowering IL-1beta, IL-6 and/or TNF-alpha, preferably the IL-1beta, IL-6 and/or TNF-alpha in A549 cells model induced by poly(I:C);

    [0380] (12) lowering the level of IL-1alpha, IL-1beta, IL-2, IL-3, IL-4, IL-5, IL-9, IL-10, IL-12 p40, IL-12 p70, IL-13, IL-17A, GM-CSF, IFN-gamma or MCP-1beta, preferably the level of plasma, preferable in an inflammation model of mouse;

    [0381] (13) treating IL-1beta, IL-6 and/or TNF-alpha-associated diseases, or for anti-inflammation, preferably for the treatment of pneumonia, myocarditis, acute and chronic gastritis, acute and chronic enteritis, acute and chronic hepatitis, acute and chronic nephritis, dermatitis, encephalitis, lymphitis, conjunctivitis, keratitis, iridocyclitis, otitis media, allergy rhinitis, asthma, pulmonary fibrosis, chronic obstructive pulmonary disease, allergic dermatitis, sickle cell disease, multiple sclerosis, systemic lupus erythematosus, lupus nephritis, lung cancer, gastric cancer, colorectal cancer, liver cancer, pancreatic cancer, cervical cancer, breast cancer, leukemia, multiple myeloma, diabetes and gout; and/or

    [0382] (14) lowering the expression of RELA genes;

    [0383] wherein the medicament is used for oral and intravenous administration, such as bolus injection or continuous infusion for a period of time, via subcutaneous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, intrapulmonary administration, intracerebrospinal administration, intraarticular administration, intrasynovial administration, intrathecal administration, intralesional administration, or administration via inhalation routes such as intranasal, typically intravenous or subcutaneous administration.

    [0384] Embodiment 19. Method for the following purposes including the use of the decoctosome in any one of embodiments 14-16:

    [0385] (1) lowering the expression of fibronectin and/or alpha-SMA, preferably the protein expression of fibronectin in MRC-5 cells fibrosis model induced by TGF-beta1;

    [0386] (2) reducing hydroxyproline, preferably the hydroxyproline in pulmonary fibrosis model, preferably the hydroxyproline in pulmonary fibrosis model of mice;

    [0387] (3) preventing or treating fibrosis, preferably pulmonary fibrosis;

    [0388] (4) lowering IL-1beta, IL-6 and/or TNF-alpha, preferably the IL-1beta, IL-6 and/or TNF-alpha in A549 cells model induced by poly(I:C);

    [0389] (5) lowering the level of IL-1alpha, IL-1beta, IL-2, IL-3, IL-4, IL-5, IL-9, IL-10, IL-12 p40, IL-12 p70, IL-13, IL-17A, GM-CSF, IFN-gamma or MCP-1beta, preferably the level of plasma, preferable in an inflammation model of mouse;

    [0390] (6) treating IL-1beta, IL-6 and/or TNF-alpha-associated diseases, or for anti-inflammation, and/or

    [0391] (7) lowering the expression of RELA genes.

    [0392] Embodiment 20. The methods of embodiments 1, 2 or 5, wherein the nucleic acid is synthesized or purified and is selected from RNA and DNA, such as selected from single stranded or double stranded or partially double-stranded RNA and DNA.

    [0393] Embodiment 21. The method of embodiment 20, wherein the RNA is selected from the group consisting of messenger RNA (mRNA), rRNA (ribosomal RNA), tRNA (transfer RNA), heterogeneous nuclear RNA (hnRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), small cytoplasmic RNA, small RNA, transfer-messenger RNA (tmRNA), telomerase RNA and antisense RNA, preferably small RNA, preferably one or more small RNAs shown in Table 8, 9 or 13.

    [0394] Embodiment 22. The method of embodiment 20, wherein the DNA is selected from the group consisting of complementary DNA (cDNA), chloroplast DNA, multicopy single-stranded DNA (msDNA), mitochondrial DNA (mtDNA) and ribosomal DNA (rDNA).

    [0395] Embodiment 23. The method of embodiment 1, 2 or 6, wherein the macromolecule is synthesized or purified and is selected from proteins or polysaccharide drugs, and/or one or more macromolecules shown in Table 6 or 7.

    [0396] Embodiment 24. The method of embodiment 23, wherein the protein is selected from the group consisting of antibody, -lactoglobulin, albumin, erythropoietin (EPO), interferon, colony stimulating factor, tissue plasminogen activator and various labeled proteins, such as green fluorescent protein, red fluorescent protein, phycoerythrin, etc.

    [0397] Embodiment 25. The method of embodiment 24, wherein the antibody is selected from IgG, IgA, IgM, IgD or IgE antibodies.

    EXAMPLES

    [0398] The following examples are merely illustrative of the invention disclosed herein, and are not to be construed as limiting the scope of the appended claims.

    TABLE-US-00013 TABLE13 PartofsmallRNAsandtheirsequences usedintheexamples SEQ ID No siRNA Sequence Length 1 sly-miR168b- TCGCTTGGTGCAGGTCGGGAC 21 5p 2 Pab-miR3711 GGCCCTCCTTCTAGCGCCA 19 3 CXL-sRNA-17 CAGAGTCGCGCAGCGGAA 18 4 PGY-sRNA-6 GTTCAGAGTTCTACAGTCCGA 21 5 PGY-sRNA-18 CGGGGCTACGCCTGTCTGAGCGTCGC 26 6 HJT-sRNA-m7 TGAGGTAGTAGGTTGTGTGGTTGTA 28 AGC 7 HJT-sRNA-3 CAGCCAAGGATGACTTGCCGG 21 8 HJT-sRNA-a2 TAGCACCATCCGAAATCGGTA 21 9 HJT-sRNA-h3 TGGGGCTACGCCTGTCTGAGCGTC 27 GCT 10 si-XRN2 GAGUACAGAUGAUCAUGUUGAGTA 19 CAGATGATCATGTT 11 si-Ssu72 GACUCACGUGAAGCUUCCAGACTCA 19 CGTGAAGCTTCCA 12 si-CPSF4 GAGUCAUCUGUGUGAAUUAGAGTCAT 19 CTGTGTGAATTA 13 si-LAMP1 CAAUGCGAGCUCCAAAGAA 19 14 si-LAMP2 GCGGUCUUAUGCAUUGGAA 19 15 si-NFB AGUACCCUGAAGCUAUAUUUU 21 16 si-TNF CACAACCAACUAGUGGUGCUU 21 17 PGY-sRNA-23 CCCTCCGCGGCCAGCTTCT 19 18 PGY-sRNA-26 TCCGGAATGATTGGGCGTAAAGCGT 25 19 PGY-sRNA-32 CCGGCCCCGAACCCGTCGGC 20 20 PGY-sRNA-1 GCGACCCCAGGTCAGGCGGGA 21 21 PGY-sRNA-2 CAGAGTTCTACAGTCCGA 18 22 PGY-sRNA-3 AGAGTTCTACAGTCCGACGAT 21 23 PGY-sRNA-4 CAGAGTTCTACAGTCCGACGAT 22 24 PGY-sRNA-5 GTTCAGAGTTCTACAGTC 18 25 PGY-sRNA-6 GTTCAGAGTTCTACAGTCCGA 21 26 PGY-sRNA-7 GTTCTACAGTCCGACGATC 19 27 PGY-sRNA-8 CAGAGTTCTACAGTCCGACGATC 23 28 PGY-sRNA-9 GACCGCATAGCGCAGTGGA 19 29 PGY-sRNA-10 CGGTGGCCATGGAAGTCGG 19 30 PGY-sRNA-11 TCTGAACTCTGAACTCCAGTCAC 23 31 PGY-sRNA-12 CGCCTGTCTGAGCGTCGCT 19 32 PGY-sRNA-13 GGCTTTGGTCTAGGGGTATGATTCT 25 33 PGY-sRNA-14 ACGCCTGTCTGAGCGTCGCT 20 34 PGY-sRNA-15 GCTACGCCTGTCTGAGCGTCGCT 23 35 PGY-sRNA-16 GGGCTACGCCTGTCTGAGCGTCGCT 25 36 PGY-sRNA-17 GGGGCTACGCCTGTCTGAGCGTCGCT 26 37 PGY-sRNA-18 CGGGGCTACGCCTGTCTGAGCGTCGC 26 38 PGY-sRNA-19 CGGGGCTACGCCTGTCTGAGCGTC 27 GCT 39 PGY-sRNA-20 CCGGGGCTACGCCTGTCTGAGCGT 24 Note: Double-stranded sRNA is indicated by the si-prefix.

    TABLE-US-00014 TABLE 14 Partial antibodies used in examples Primary Primary antibody antibody dilution Secondary name Company Catalog No. ratio antibody Fibronectin Sigma Aldrich F7387 1:2000 M -SMA Abcam ab7817 1:1000 M GAPDH Protein Tech 60004-1-lg 1:5000 M LAMP1 Santa Cruze sc-20011 1:1000 M LAMP2 Santa Cruze sc-18822 1:1000 M XRN2 Santa Cruze sc-365258 1:2000 M CPSF4 Protein Tech 15023-1-AP 1:1000 R Ssu72 CST 12816s 1:1000 R NF-B CST 4764S 1:2000 R -Actin Sigma Aldrich A5441 1:5000 M NF-B p65 CST #6956 1:1000 R

    First Part of the Experiments

    Example 1

    [0399] 1. Preparation of Decoction of Herbal Medicine and the Extraction of Decoctosome.

    [0400] 1.1 Preparation of Decoction of Herbal Medicine

    [0401] 1) 200 g herbal medicine decoction pieces (Rhodiola crenulata, Taraxacum mongolicum, purchased from Beijing Tongrentang pharmacy) was added into 1000 mL ddH.sub.2O and soaked for 30 min.

    [0402] 2) The mixture was decocted in a decoction pot with intense heating for 30 min, and with gentle heating for 10 min.

    [0403] 3) After decocting, the decoction of Rhodiola crenulata was about 250 ml, and the decoction of Taraxacum mongolicum was about 360 ml.

    [0404] 1.2 Preparation of Decoctosome

    [0405] 1) 200 g decoction pieces (Rhodiola crenulata, Taraxacum mongolicum, purchased from Beijing Tongrentang pharmacy) was added into 1000 mL ddH.sub.2O and soaked for 30 min.

    [0406] 2) The mixture was decocted in a decoction pot with intense heating for 30 min, and with gentle heating for 10 min.

    [0407] 3) After decocting, the decoction of Rhodiola crenulata was about 250 ml, and the decoction of Taraxacum mongolicum was about 360 ml.

    [0408] 4) The obtained decoction was differential centrifuged at 4 C. (centrifuged at 2,000 g for 30 min to get the supernatant, at 10,000 g for 30 min to get the supernatant, and at 200,000 g for 90 min, and discarded the supernatant) to get the precipitates.

    [0409] 5) The obtained precipitates were resuspended in double-distilled water, from which an appropriate amount was taken into the EP tube and vacuum dried for about 5 hours, thereby obtaining the precipitates of the decoctosome, which were weighed and quantified.

    [0410] The preparation methods of the decoction and decoctosome precipitates of other herbal medicines were the same as the methods described in Sections 1.1 and 1.2. For a schematic diagram of the preparation process of the decoctosome, see FIG. 1.

    [0411] 2. Features of the Decoctosome of Herbal Medicine

    [0412] 2.1 Morphology of the Decoctosome of Herbal Medicine Observed by Transmission Electron Microscope

    [0413] The precipitates obtained in Section 1.2 were resuspended in double-distilled water to obtain decoctosome solution.

    [0414] 2) The morphology of the decoctosome was observed by transmission scanning electron microscope.

    [0415] 2.2 Determination of particle size and Zeta potential of decoctosome of herbal medicine

    [0416] 1) The precipitates obtained in Section 1.2 were resuspended in pH7.4 PBS buffer to obtain decoctosome solution.

    [0417] 2) Particle size and Zeta potential of the decoctosome were determined by dynamic light scattering technology (DLS), Instrument Zetasizer Nano ZS90 (Malvern Instrument, UK), and the data were analyzed.

    [0418] The electron microscope observation results of the decoctosomes of Rhodiola crenulata and Taraxacum mongolicum are shown in FIG. 2 and FIG. 3, respectively. See FIG. 4 and FIG. 5 for the particle size distribution and Zeta potential of Rhodiola crenulata and Taraxacum mongolicum decoctosomes, respectively.

    [0419] 3. Analysis for Components of Decoctosome of Herbal Medicines.

    [0420] 3.1 Proteomics Analysis of Decoctosome of Herbal Medicine

    [0421] 3.1.1 Reagents and Materials

    [0422] Milli-Q water, Non-powder gloves, Face mask, Hat, 10 l and 200 l tips (eppendorf), Acetonitrile (Fisher A/0626/17), Methanol (Fisher), Sodium thiosulfate pentahydrate (Sigma), Potassium ferricyanide (Sigma), Dithiothreitol (PlusOne), Iodoacetamide (Sigma), Trypsin (Promega V5280), Trypsin resolve solution (Promega V530), Ammonium bicarbonate (Sigma A6141), Zip Tip (Millipore), FA Formic acid (Sigma), 0.2 ml and 0.5 ml EP tubes (eppendorf), 50 ml EP, 15 ml EP (Corning).

    [0423] 3.1.2 Main Equipments:

    [0424] Q Exactive mass spectrometer (Thermo fisher), vacuum dryer, water bath, 10 and 200 pipettes, waste tank, ice making and ice filling equipment, 200 tube rack, scissors, plastic box that can hold 200 tube rack, 200 l tube centrifugal machine.

    [0425] 3.1.3 Experimental Steps:

    [0426] 1) Protein Extraction:

    [0427] A. An appropriate amount of sample was weighed and was added 5 times volume of pre-cooled 10% TCA-acetone, shaken and mixed, and settled at 20 C. for 2 hours or overnight.

    [0428] B. The mixture was centrifuged at 12000 g and 4 C. for 10 min, and the precipitates were collected.

    [0429] C. An appropriate volume of pre-cooled acetone was added to the precipitates, shaked and mixed, and centrifuged at 12000 g, 4 C. for 15 min. The precipitates were collected. Repeated this step twice to remove other impurities completely.

    [0430] D. The precipitates were dried at room temperature, dissolved in 1 ml sample dissolving solution (9M urea, 4% CHAPS, 1% IPG Buffer, 1% DTT) and completely dissolved the proteins to be used for follow-up experiments.

    [0431] 2) Enzyme Digestion:

    [0432] Trypsin at a concentration of 15 ng/L was diluted with 25 mmol/L NH.sub.4HCO.sub.3. Trypsin solution was added in an amount of 7-10 L/tube, and incubated in the refrigerator at 4 C. for 40 min. After taking the tube out, each tube was supplemented with 5-10 L of 25 mmol/L NH.sub.4HCO.sub.3 solution, sealed and placed in a 37 C. water bath for enzyme digestion for 16h.

    [0433] 3) Peptide Fragment Extraction:

    [0434] Extraction solution (5% TFA-50% ACN-45% water) was added at 100 L/tube. The tube was placed in 37 C. water bath for 1 hour, ultrasound for 5 minutes, centrifuged for 5 minutes. The extraction solution was transferred to another new EP tube, and the extraction was repeated once. The extracts were combined and dried by vacuum centrifugation.

    [0435] 4) Mass Spectrometry Measurement

    [0436] A. Peptide fragments were dissolved by sample dissolving solution (0.1% formic acid, 2% acetonitrile), shaken and vortexed completely, centrifuged at 13200 rpm, 4 C. for 10 min. The supernatant was transferred into sample tube to perform mass spectrometry measurement.

    [0437] B. Chromatography Column Information:

    [0438] 300 um i.d.5 mm, filled with Acclaim PepMap RSLC C18, 5 um, 100 , nanoViper

    [0439] Acclaim PepMap 75 um150 mm, C18, 3 um, 100A

    [0440] Mobile phase A: 0.1% formic acid;

    [0441] Mobile phase B: 0.1% formic acid, 80% ACN;

    [0442] Flow rate: 300 nL/min;

    [0443] Analysis time for each component: 40 min;

    TABLE-US-00015 Time Phase B 0 5% 5 5% 25 50% 30 90% 35 90% 45 5%

    [0444] C. The separated peptide fragments were directly tested online, and the specific parameters were as follows:

    [0445] Primary mass spectrometry parameters:

    [0446] Resolution: 70,000

    [0447] AGC target: 3e6

    [0448] Maximum IT: 40 ms

    [0449] Scan range: 350 to 1800 m/z

    [0450] Secondary mass spectrometry parameters:

    [0451] Resolution: 17,500

    [0452] AGC target: 1e5

    [0453] Maximum IT: 60 ms

    [0454] TopN: 20

    [0455] NCE/stepped NCE: 27

    [0456] 4) Database Search

    [0457] Initial mass spectrometry documents were processed and converted by MM File Conversion software to get the MGF format file. MAXQUANT was used to search in uniprot-Viridiplantae database with the search parameters as follows:

    [0458] a) Fixed modifications: Carbamidomethyl (C)

    [0459] b) Variable modifications: Oxidation (M)

    [0460] c) Enzyme: Trypsin

    [0461] d) Maximum Missed Cleavages: 2

    [0462] e) Peptide Mass Tolerance: 20 ppm

    [0463] f) Fragment Mass Tolerance: 0.6 Da

    [0464] g) Mass values of peptide fragment/fragment ion: Monoisotopic

    [0465] h) Significance threshold: 0.05

    [0466] 3.1.4 Description of Results

    [0467] Accession (ID No. of proteins in uniprot database), Description (annotation of proteins), Exp. q-value (q-value, the smaller the better), Sum PEP Score (protein score, the higher the score, the better), Coverage (coverage of identified amino acids of the peptide fragments in the total amino acids of the protein), # Peptides (the number of peptide fragments of the identified protein), #PSMs (the total number of all peptide fragments in the identified corresponding protein), # Unique Peptides (the number of unique peptide fragments in the identified corresponding protein), # Protein Groups (the number of proteins corresponding to the identified peptide fragments), # Aas (theoretical amino acid number of identified corresponding protein), MW [kDa] (theoretical molecular weight of identified corresponding protein), calc. pI (theoretical isoelectric point of identified corresponding protein), score: protein score; intensity: protein relative intensity.

    [0468] Sequence (amino acid sequence of the peptide fragment), #Proteins (the number of proteins corresponding to the peptide fragments), #PSMs (the number of times the peptide fragment was identified), Master Protein Accessions (ID of proteins corresponding to peptide fragments), Theo. MH+ [Da] (theoretical molecular weight of peptide fragment).

    [0469] See Table 6 and Table 7 and FIGS. 19 and 20 for the proteomics analysis results.

    [0470] 3.2 Metabolomics Analysis of Compounds in Decoctosome of Herbal Medicines

    [0471] 1) The Conditions for Liquid Chromatography

    [0472] Samples were separated by Waters H-class type Ultra Performance Liquid Chromatography (UPLC). The analysis conditions were as follows: chromatographic column: waters HSS C18 (3.0100 mm, 1.7 m), column temperature: 50 C.; mobile phase A is 0.1% formic acid in water, mobile phase is acetonitrile; analysis gradient: 0-1 min, 2% B; 1-3 min, 2% B-15% B; 3-6 min, 15% B-50% B; 6-9 min, 50-95% B; 9-9.1 min, 95-100% B-2% B; 9.1-12 min, 100% B; flow rate was 0.5 ml/min; volume of injection was 5 l.

    [0473] 2) The Conditions for Mass Spectrum (MS)

    [0474] UPLC-MS tandem LTQ-Orbitrap velos (Thermo Fisher Scientific, SanJose, Calif., USA) mass spectrum using electronspray ion source in positive ion mode; sheath gas was nitrogen and auxiliary gas, the flow rate was 45 arbitrary and 10 arbitrary units, respectively; MS scan range was 100-1000 m/z; spray voltage was set to 4.2 KV; capillary temperature was 350 C. The data was acquired by high resolution Fourier Transform mode (FT), with primary resolution of 60000 and secondary resolution of 15000. The secondary data was acquired in data-dependent analysis mode; dynamic exclusion time was 15 s; HCD was selected as the fragmentation method with related parameters set as follows: isolation width: 3 Da; collision energy: 20%, 40% and 60% depending on different metabolites; activation time: 30 ms.

    [0475] 3) Results Analysis:

    [0476] The original data acquired by UPLC-LTQ was processed by commercial omics analysis software progenesis QI (Version 2.0, Nonlinear Dynamics, UK) of Waters Company. The processing included peak alignment, peak identification, peak calibration, and three-dimensional matrix output including spectral peak index variables composed of retention time and accurate m/e, sample names and peak intensities/areas. Variables having the coefficient of variation (CV) less than 30% were screened from the acquired data based on the CV of quality control samples, and were subjected to subsequent multivariate statistical analysis. Variable matrix was first imported into SIMCA-P software 14.0 (Umetrics AB, Umea, Sweden) for PCA analysis, and the intergroup changes were visualized. Intergroup difference variables were screened using VIP value acquired by OPLS-DA model. The variable with VIP value greater than 1.5 was considered as significant intergroup difference variable, and could be used as a potential marker candidate. The metabolic pathway analysis was conducted on the identified difference variables to analyze the metabolic pathway closely correlated with disease process.

    [0477] The analysis results for small molecules in decoctosome of Rhodiola and Taraxacum mongolicum are shown in Tables 2-5 and FIGS. 17-18.

    [0478] 3.3 High-Throughput Sequencing and Analysis of Small RNA in the Decoctosome of Herbal Medicines

    [0479] 1) The precipitates of the decoctosome of the herbal medicines obtained during the extraction process were cleaved with Trizol (Sigma) to extract RNA;

    [0480] 2) The sequencing was performed by Beijing BerryGenomics Biotechnology Co., Ltd using the Illumina HiSeq2500 platform, 50SE;

    [0481] 3) Using Fastx_toolkit software (v0.0.13), the adaptors of the sequencing reads were removed and small RNA sequences with a length greater than or equal to 18 nt were retained (by calling the command fastx_clipper), and the low-quality sequences were removed (by calling the command fastq_quality_filter, set the parameters q10, p100));

    [0482] 4) Length distribution statistics on small RNA sequences was performed;

    [0483] 5) De-redundancy processing on small RNA sequences was performed and duplicate reads were removed;

    [0484] 6) A library of small RNA sequences in herbal medicine soup and decoctosome was built (by calling the command bowtie-build) using bowtie software (http://bowtie-bio.sourceforge.net/index.shtml), and the small RNA sequences that can match both the herbal medicine soup and the decoctosome in the human blood after administrating the herbal medicines ((herbal medicines (10 g, about 100 ml) decoction was administered orally and continuously for three days) was screened (by calling the command bowtie);

    [0485] 7) For herbal medicines with known genomes such as Rhodiola, it was necessary to use bowtie software to match the small RNA sequences above to the genomes of herbal medicines to obtain the matched sequences;

    [0486] 8) Small RNAs having a number of reads greater than 5 in the herbal medicine soup and decoctosome and a number of reads in human blood after administrating the herbal medicines that was higher than that before administrating the herbal medicines were screened from the small RNAs obtained above;

    [0487] 9) For the above small RNA sequences with inclusion relationships, the shortest small RNA sequence and the sequence having the highest number of reads in human blood after administrating herbal medicines (10 g, about 100 ml) were selected.

    [0488] See Tables 8-9 and FIGS. 21-22 for the analysis results of small RNAs in Rhodiola and Taraxacum mongolicum decoctosomes.

    [0489] 3.4 Lipid Mass Spectrometry Method:

    [0490] Lipid extraction and High performance liquid chromatography-tandem secondary mass spectrometry technology

    [0491] The lipids in Rhodiola and Taraxacum mongolicum decoctosomes were extracted by Bligh&Dyer method (Bligh and Dyer, 1959). High performance liquid chromatography-tandem analysis was completed by Shanghai Minxin Information Technology Co., Ltd. Chromatographic conditions: column temperature was 45 C.; flow rate was 0.4 mL/min; binary gradient elution, 70% mobile phase A 2 min; linear increased to 100% mobile phase B for at least 20 min; 100% B 2 min; 70% A 5 min; volume of injection was 4 l. Negative ion mode mass conditions: source spray voltage was 3.0 kV; heating capillary temperature 300 C.; flow rate of sheath gas was 45Arb; flow rate of auxiliary gas was 15Arb; scavenging flow rate was 1Arb; s-lens RF level was 30%; scanning range was m/z 200-1,500. Positive ion mode mass conditions: source spray voltage was 2.5 kV; heating capillary temperature was 350 C.; flow rate of sheath gas was 45Arb; flow rate of auxiliary gas was 10Arb; scavenging flow rate was 1Arb; s-lens RF level was 60%; scanning range was m/z 200-1,500.

    [0492] LC-MS data was initially analyzed by Thermo SIEVE 2.1 Qualitative analysis software (Thermo Fisher Scientific, USA). Then, the data of each sample were normalized to the total area, and all data including peak value number [based on retention time and mass-to-charge ratio (m/z)], sample name, and normalized peak intensity were imported into SIMCA-P+13.0 (Umetrics, Sweden) to process and analyze again.

    [0493] 4. Functional Verification Experiment in Cell Models for Decoction of Herbal Medicines and Decoctosome

    [0494] 4.1 Culture of MRC-5 Cells and A549 Cells

    [0495] Human embryo lung fibroblast cell line MRC-5, human lung adenocarcinoma cell line A549 used in the experiments were purchased from Cell Culture Center in Peking Union Medical College. Cells were cultured in 37 C., 5% CO.sub.2 incubator, wherein MRC-5 cells were cultured in EME medium (Gibco); A549 cells were cultured in Ham's F-12 medium (HyClone). Each medium contained 10% fetal bovine serum and a certain percentage of antibiotics (Penicillin 100U/ml & Streptomycin 100 mg/ml).

    [0496] 4.2 Changes in the Protein Expression Levels of Fibronectin in MRC-5 Cells Fibrosis Model Induced by TGF-1 for Rhodiola (HJT) Decoction and HJT Decoctosome, as Determined by Western Blot

    [0497] 4.2.1 Experiment Groups for Decoction were as Follows:

    [0498] 1) Naive group: untreated MRC-5 cells. This group acted as a blank control group.

    [0499] 2) TGF-1 stimulation group: MRC-5 cells were treated with 3 ng/mL transforming growth factor TGF-1 (Pepro Tech) for 72 hours. This group acted as a positive control group.

    [0500] 3) Decoction experiment group: MRC-5 cells were treated with 3 ng/mL transforming growth factor TGF-1 (Pepro Tech) for 72 hours, added 300 ug/ml decoction of control plant Woody (MX, the preparation method for decoction of woody was the same as that for decoction of Rhodiola) or HJT (300 ug decoction was added per ml of culture medium, the decoction was quantified by the amount of precipitates after the liquid was drained) 24 hours in advance.

    [0501] 4.2.2 Experiment Groups for Decoctsome were as Follows:

    [0502] 1) Naive group: untreated MRC-5 cells. This group acted as a blank control group

    [0503] 2) TGF-1 stimulation group: MRC-5 cells were treated with 3 ng/mL transforming growth factor TGF-1 (Pepro Tech) for 72 hours. This group acted as a positive control group.

    [0504] 3) Decoctosome experiment group: MRC-5 cells were treated with 3 ng/mL transforming growth factor TGF-1 (Pepro Tech) for 72 hours, added 50 ug/ml decoctosome of control plant MX or HJT (50 ug decoctosome was added per ml of culture medium, the decoction was quantified by the amount of precipitates after the liquid was drained) 24 hours in advance.

    [0505] 4.2.3 Collection of protein samples and concentration measurement by BCA method:

    [0506] 1) Collection of protein samples of MRC-5 cells which were stimulated by TGF-1 for 72 hours and intervened 24 hours in advance and protein concentration measurement by BCA method:

    [0507] A. The medium and 12-well plate cells (10.sup.6) were discarded. Each well was added 1 mL PBS buffer to wash, and was added 100 L of pre-cooled strong RIPA lysis solution (recipe of which was shown below). The cells was scraped with a pipette and transferred into a centrifuge tube and lysed on ice for 20 minutes;

    TABLE-US-00016 Dosage Molecular Final Component (200 ml) weight concentration NaCl 1.75 g 58.44 150 mM Tris 1.2114 g 121.14 50 mM NP-40 2 ml 1% Sodium 1 g 414.55 0.5% Deoxycholate SDS 0.2 g 288.38 0.1%

    [0508] B. Centrifugation was conducted at 4 C., 12,000 rpm, for 10 min. The supernatant was transferred into new centrifuge tube;

    [0509] C. BCA reagents A and B (TIANGEN, #PA115) (50:1, v/v) were mixed sufficiently to prepare BCA working solution;

    [0510] D. 25 L of freshly prepared BSA standard solution and sample to be tested were taken and added to a 96-well plate, respectively. 200 L of BCA working solution was added to each well and mixed thoroughly. Incubation was conducted at 37 C. for 30 min;

    [0511] E. The absorbance at 562 nm was measured with an ultraviolet spectrophotometer (Synergy 4 multifunctional microplate reader), and the protein concentration in the sample was calculated according to the standard curve;

    [0512] F. The sample concentration was adjusted with RIPA lysis solution and Loading Buffer (10% SDS 20 ml, sucrose 5 g, bromophenol blue 0.2 g, beta-mercaptoethanol 5 ml) to make the concentration of each sample consistent (consistent with the lowest concentration);

    [0513] G. Conducted denaturation treatment at 95 C. for 10 min.

    [0514] 4.2.4 Western Blot Measurement

    [0515] A. Gel preparation: separation gel (lower layer gel) at a concentration of 10% and concentrated gel (upper layer gel) at a concentration of 5% were used, 15-hole comb was used to make lanes, and the amount of sample protein in each lane was equal;

    [0516] B. Protein electrophoresis: the electrophoresis buffer was added, and the electrophoresis starting voltage was 80V. When the bromophenol blue dye reached the separation gel, the voltage was increased to 120V and the electrophoresis continued until the bromophenol blue dye reached the bottom of the separation gel or all of it swam out of the gel;

    [0517] C. Wet transfer: assembly was done following the order of transfer splint (negative electrode)-sponge-filter paper-gel-PVDF film-filter paper-sponge-transfer splint (positive electrode). After installation, the entire transfer device was placed in 4 C. cold room. The constant current was 300 mA, and the film was transferred for 120 min;

    [0518] D. Blocking: after transferring the film, it was placed in 3% BSA blocking solution and blocked for 1 hour at room temperature;

    [0519] E. Primary antibody incubation: the sealed PVDF film was transferred to the hybridization bag. 3% BSA blocking solution containing the corresponding primary antibody (the information of which was as follows) was added. The air bubbles in the bag were driven out, and incubation was conducted at 4 C. overnight after sealing;

    [0520] Fibronectin antibody (sigma F7387)

    [0521] GAPDH antibody (protein tech 60004-1)

    [0522] F. Washing the film: the PVDF film was taken out and washed 3 times with TBST, 10 min each time.

    [0523] G. Secondary antibody incubation: TBST was discarded and 3% BSA blocking solution (secondary antibody dilution ratio 1:5000) containing goat anti-rabbit or goat anti-mouse secondary antibody (purchased from Hangzhou Lianke Biotechnology Co., Ltd.) with horseradish peroxidase (HRP) was added. Incubation was conducted at room temperature for 1 hour;

    [0524] H. Washing the film: the film was washed 3 times with TBST, 10 min each time.

    [0525] I. Development: Western color-substrate solution (1:1, V/V, Merck Millipore, ECL chemiluminescence color-substrate solution purchased from Millipore) was prepared, and evenly dropped onto one side of the membrane-bound proteins. The film was carefully wrapped with plastic wrap and was observed after the colors were developed;

    [0526] J. Analysis: Image J software was used for analysis.

    [0527] 4.3 the mRNA Expression Level of IL-1/IL-6/TNF- for PGY Decoction and PGY Decoctosome in the Inflammation Model of Poly(I:C) Stimulated A549 Cells as Determined by Real-Time Fluorescent Quantitative PCR (RT-qPCR)

    [0528] 4.3.1 Experiment Groups for Decoction were as Follows:

    [0529] 1) Naive group: untreated A549 cells. This group acts as a blank control group.

    [0530] 2) Poly(I:C) stimulation group: A549 cells were treated with 1 g/mL double stranded RNA virus mimics poly(I:C) (P1530, Sigma-Aldrich) for 6 hours. This group acted as a positive control group.

    [0531] 3) Decoction experiment group: A549 cells were added control plants cabbage (JXC) or Taraxacum mongolicum decoction (10 g/ml, 30 g/ml, 100 g/ml) in advance and co-incubated for 24 hours, followed by treatment with 1 g/mL double stranded RNA virus mimics poly(I:C) for 6 hours.

    [0532] 4.3.2 Experiment Groups for Decoctsome were as Follows:

    [0533] 1) Naive group: untreated A549 cells. This group acts as a blank control group

    [0534] 2) Poly(I:C) stimulation group: A549 cells were treated with 1 g/mL double stranded RNA virus mimics poly(I:C) (P1530, Sigma-Aldrich) for 6 hours. This group acts as a positive control group.

    [0535] 3) Decoctosome experiment group: A549 cells were treated with 1 g/mL double stranded RNA virus mimics poly(I:C) (P1530, Sigma-Aldrich) for 6 hours, added control plants cabbage (JXC) or Taraxacum mongolicum (PGY) decoctosome (the preparation method of which was the same as that of Rhodiola decoctosome) 2 g/ml, 6 g/ml, 20m/ml 24 hours in advance.

    [0536] 4.3.3 Extraction of Total RNA in Cells

    [0537] A. Cells were cultured in a 12-well plate (about 110.sup.6 cells/well). After discarding the culture medium, 1 mL TRIzol lysis solution was added to each well. The plate was placed on ice first. After all samples were added TRIzol, the samples were left at room temperature for 5 minutes to be fully lysed.

    [0538] B. Centrifugation was conducted at 4 C., 12000 rpm for 5 min. The precipitates were discarded and TRIzol was transferred into new centrifuge tubes;

    [0539] C. Chloroform was added at 200 L chloroform/mL TRIzol. After sufficient shaking and uniform mixing, the mixture was placed at room temperature for 5 min;

    [0540] D. Centrifugations was conducted at 4 C., 12000 rpm for 15 min;

    [0541] E. The upper water phase was pipetted into another centrifuge tube, to which was added isopropanol at 0.5 mL isopropanol/mL TRIzol and mixed well. The mixture was placed at room temperature for 5-10 min;

    [0542] F. Centrifugations was conducted at 4 C., 12000 rpm for 15 min. The supernatant was discarded, and RNA deposited at the bottom of the tube;

    [0543] G. The centrifuge tube was added 1 mL 75% ethanol and gently shaken to suspend the sediment;

    [0544] H. 4 C., 12000 rpm centrifuged for 10 min, discarded supernatant, added 1 mL 75% ethanol, gently shook the centrifuge tube to suspend the sediment;

    [0545] I. Centrifugations was conducted at 4 C., 12000 rpm for 10 min. The supernatant was discarded. The RNA samples were dried at room temperature and dissolved with 50 L RNase-free water. O.D value was measured to quantify RNA concentration.

    [0546] 4.3.4 Reverse Transcription of Total RNA to cDNA

    [0547] Reverse Transcription Kit (High-Capacity cDNA Reverse Transcription Kits, Applied Biosystems, cat. No. 4368813) was used to reverse transcribe RNA into cDNA. The reverse transcription system was as follows: total RNA extracted above (150 ng/l) 10 L, 10RT buffer 2.0 L, 25dNTP Mix (100 mM) 0.8 L, RT random primer 2.0 L, MultiScribe reverse transcriptase 1.0 L, RNase inhibitor 1.0 L (Invitrogen), nuclease-free H.sub.2O 3.2 L. After short spin, the sample was loaded into a PCR reactor to react, and the reaction conditions were as follows: (1) 25 C., 10 min; (2) 37 C., 120 min; (3) 85 C., 5 min; (4) 4 C., terminating the reaction. 20 l RNase-free ddH.sub.2O was added to make up the final volume to 40 l after the reaction.

    [0548] 4.3.5 Quantitative PCR Amplification Reaction

    [0549] The qPCR reaction system had a total volume of 10 l, containing: 5 L 2SYBR Green Master Mix, 0.5 L forward primer (10 M), 0.5 L reverse primer (10 M), 1 L cDNA obtained by reverse transcription, 3 L RNase-free ddH.sub.2O. LightCycler 480 fluorescence quantitative PCR instrument was used, and the PCR reaction conditions were: 95 C. for 5 min for pre-denaturation, followed by PCR amplification cycle: (1) 95 C., 10 s; (2) 55 C., 10 s; (3) 72 C., 20 s; a total of 40 cycles; 40 C. for 10 s in the end to cool down. Both the forward and reverse primers of the amplification reaction were designed and synthesized by Beijing Tsingke Biotechnology Co., Ltd. Primer sequence (reference gene UBC forward primer: CTGGAAGATGGTCGTACCCTG (SEQ ID NO: 101), reference gene UBC reverse primer: GGTCTTGCCAGTGAGTGTCT (SEQ ID NO: 102); target gene IL-1 forward primer: CTCGCCAGTGAAATGATGGCT (SEQ ID NO: 103); target gene IL-1 reverse primer: GTCGGAGATTCGTAGCTGGAT (SEQ ID NO: 104); target gene IL-6 forward primer: GGTACATCCTCGACGGCATCT (SEQ ID NO: 105); target gene IL-6 reverse primer: GTGCCTCTTTGCTGCTTTCAC (SEQ ID NO: 106); target gene TNF- forward primer: CTGCCCCAATCCCTTTATT (SEQ ID NO: 107); target gene TNF- reverse primer: CCCAATTCTCTTTTTGAGCC (SEQ ID NO: 108)).

    [0550] 4.3.6 the Calculation of Relative Expression Level of mRNA

    [0551] 2-Ct method (gene relative expression level=2-(Ct target gene-Ct reference gene)) was used to calculate the relative entry level(single stranded or double stranded RNA).

    [0552] 4.4 the Target Gene of PGY-sRNA-6 Verified by Double Fluorescent Reporter Gene

    [0553] HEK293T cells were trypsinized and added to a 48-well plate to culture for about 24 hours, then PGY-sRNA-6 and NC negative control (single-stranded NC sequence UUGUACUACACAAAAGUACUG (SEQ ID NO: 109)) were transiently transfected with the transfection reagent Lipofectamine RNAiMAX, with the final concentration of 100 nM. After 24 hours, transfection reagent Lipofectamine 2000 was used to transfect 300 ng wild-type psiCHECK2-3-UTR (purchased from Promega, #C8201) and mutant psiCHECK2-3-mUTR plasmid (biosynthesis, see FIG. 32 for the mutant sequence) per well. After 48 hours of transfection, cell samples were collected to detect the expression level according to the steps of the dual luciferase reporter gene detection kit (Promega, #E1960).

    [0554] 4.5 the Protein Expression Levels of IL-6 for Taraxacum mongolicum Decoction and Decoctosome in the Inflammation Model of Poly(I:C) Stimulated A549 Cells as Determined by Enzyme Linked Immunosorbent Assay (ELISA)

    [0555] 4.5.1 Experiment groups for decoction were as follows:

    [0556] 1) Naive group: untreated A549 cells. The supernatant of medium was collected for use in ELISA test for protein content. This group acted as a blank control group.

    [0557] 2) Poly(I:C) stimulation group: A549 cells were treated with 1 g/mL double stranded RNA virus mimics poly(I:C)(P1530, Sigma-Aldrich) for 6 hours. The supernatant of medium was collected for use in ELISA test for protein content. This group acted as a positive control group.

    [0558] 3) Decoction experiment group: A549 cells were added control plants cabbage (JXC) or Taraxacum mongolicum (PGY) decoction (10 g/ml, 30 g/ml, 100 g/ml) in advance and co-incubated for 24 hours, followed by treatment with 1 g/mL double stranded RNA virus mimics poly(I:C) for 6 hours. The supernatant of medium was collected for use in ELISA test for protein content.

    [0559] According to FIG. 9D, 100 g/ml decoction can reduce the expression of interleukin-6 in A549 cells induced by poly(I:C) stimulation.

    [0560] 4.5.2 Experiment Groups for Decoctsome were as Follows:

    [0561] 1) Naive group: untreated A549 cells. This group acted as a blank control group

    [0562] 2) Poly(I:C) stimulation group: A549 cells were treated with 1 g/mL double stranded RNA virus mimics poly(I:C)(P1530, Sigma-Aldrich) for 6 hours. The supernatant of medium was collected for use in ELISA test for protein content. This group acted as a positive control group.

    [0563] 3) Decoctosome experiment group: A549 cells were added control plants cabbage (JXC) or Taraxacum mongolicum (PGY) decoctsome (2 g/ml, 6 g/ml, 20 g/ml) in advance and co-incubated for 24 hours, followed by treatment with 1 g/mL double stranded RNA virus mimics poly(I:C) for 6 hours. The supernatant of medium was collected for use in ELISA test for protein content.

    [0564] According to FIG. 9E, 20 g/ml decoctosome can reduce the expression of interleukin-6 in A549 cells caused by poly(I:C) stimulation, the effectiveness is significantly higher than the same dose of decoction

    [0565] 4.6 Extraction of RNA from Rhodiola Decoctosome and Detection of Small RNA in Decoctosome by Agarose Gel Electrophoresis

    [0566] 1) Decoctosome was extracted by decocting 200 g Rhodiola decoction pieces followed by differential centrifugation;

    [0567] 2) Decoctosome precipitates were added 6 ml TRIZol(sigma-Aldrich) to be fully lysed, and RNA of decoctosome was extracted;

    [0568] 3) The extracted RNA was evenly divided into 4 parts which were treated as follows: without treatment, added 5 l DNase I, added 5 l RNase A, added 5 l DNase I and RNase A, and digested overnight in a 37 C. water bath;

    [0569] 4) Agarose gel electrophoresis: gel electrophoresis was carried out using 1% agarose gel under 90 volts for 20 minutes. After completion, UV lamp was used for observation.

    [0570] According to FIG. 9F, there were small RNAs of about 25 bp in Rhodiola decoctosome.

    [0571] 4.7 Extraction of RNA from Taraxacum mongolicum decoctosome and determination of small RNA in decoctosome by Agarose gel electrophoresis

    [0572] 1) Decoctosome was extracted by decocting 200 g Taraxacum mongolicum decoction pieces followed by differential centrifugation;

    [0573] 2) Decoctosome precipitates were added 6 ml TRIZol(sigma-Aldrich) to be fully lysed, and RNA of decoctosome was extracted;

    [0574] 3) The extracted RNA was evenly divided into 4 parts which were treated as follows: without treatment, added 5 l DNase I, added 5 l RNase A, added 5 l DNase I and RNase A, and digested overnight in a 37 C. water bath;

    [0575] 4) Agarose gel electrophoresis: gel electrophoresis was carried out using 1% agarose gel under 90 volts for 20 minutes. After completion, UV lamp was used for observation.

    [0576] According to FIG. 9G, there were small RNAs of about 25 bp in Taraxacum mongolicum decoctosome.

    [0577] 5. Functional Verification Experiment in Animal Model for Decoctosome of Herbal Medicine

    [0578] 5.1 Experimental Animal

    [0579] The 6-8 week old male C57BL/6J mice used in the experiment were purchased from Beijing Charles River and raised under sterile conditions in the Animal Experiment Center of Peking Union Medical College. All animal experiment procedures follow the guidelines of government and animal care and use committee.

    [0580] 5.1.1 Bleomycin-Induced Pulmonary Fibrosis in Mice

    [0581] In the model group, bleomycin (Beijing Hisun Pfizer Pharmaceutical Co., Ltd.) was injected by instillation into the trachea at a dose of 2.5 U/kg to build the model, while the control group was only injected with saline by intratracheal instillation. The mice were sacrificed on the 21st day, and the left and right lungs were collected for testing.

    [0582] 5.1.2 Mouse Acute Lung Injury Model

    [0583] Under sterile conditions, poly(I:C) was dissolved in PBS to prepare a stock solution with a concentration of 10 mg/mL. According to the dose of 500 g poly(I:C) per mouse, the stock solution was divided into aliquots at 50 L per tube. An acute lung injury model was created by intratracheal instillation, and the mice were sacrificed 9 hours later, and blood and alveolar lavage fluid were collected for testing.

    [0584] 5.2 Function of HJT Decoctosome in Bleomycin-Induced Fibrosis Model in Mice

    [0585] 5.2.1 the Animal Experiment Groups were as Follows:

    [0586] 1) Control group: this group was only injected with saline by intratracheal instillation, and served as saline control group.

    [0587] 2) Bleomycin group: bleomycin was injected by instillation into the trachea at a dose of 2.5 U/kg to build the model. After 21 days, the left and right lungs were collected for testing. This group served as a positive control group.

    [0588] 3) Woody decoctosome experiment group: bleomycin was injected by instillation into the trachea at a dose of 2.5 U/kg to build the model. The woody decoction-derived decoctosome was administered by gavage for three consecutive days in advance at a dose of 40 g woody decoction source decoctosome (500 L) per mouse. After 21 days, the left and right lungs were collected for testing.

    [0589] 4) Rhodiola decoctosome experiment group: bleomycin was injected by instillation into the trachea at a dose of 2.5 U/kg to build the model. The Rhodiola decoction-derived decoctosome was administered by gavage for three consecutive days in advance at a dose of 40 g Rhodiola decoction source decoctosome (500 L) per mouse. After 21 days, the left and right lungs were collected for testing.

    [0590] 5.2.2 Determination of Hydroxyproline Content in Animal Lung Tissue

    [0591] The hydroxyproline assay kit (#MAK008, Sigma Aldrich) was used to determine the collagen content of mouse lungs. The mouse right lung tissue was vacuum dried, weighed and hydrolyzed with 6M hydrochloric acid at 120 C. for 3 hours, and the hydroxyproline content was determined according to the kit instructions. Hydroxyproline content was expressed as g/right lung, unless otherwise specified

    [0592] 5.2.3 Pathological Examination of Animal Lung Tissue

    [0593] 1) Experimental Steps of Embedding Sections into Tissue Paraffin

    [0594] A. Material taking: Fresh tissues were fixed in 4% paraformaldehyde for more than 24 hours. The tissues were taken out of the fixative solution and placed in a fume hood to trim the target site tissue with a scalpel. Put the trimmed tissues and the corresponding label in the dehydration box.

    [0595] B. Dehydrating: The dehydration box was put into the hanging basket and dehydrated with gradient alcohol in the dehydrator. 75% alcohol 4h-85% alcohol 2h-90% alcohol 2h-95% alcohol 1 h-anhydrous ethanol I 30 min-anhydrous ethanol II 30 min-alcohol benzene 5-10 min-xylene I 5-10 min-xylene II 5-10 min-wax I 1 h-wax II 1 h-wax III 1 h.

    [0596] C. Embedding: The wax-soaked tissue was embedded in the embedding machine. First the melted wax was put into the embedding frame, and before the wax solidified, the tissue was taken out of the dehydration box and put into the embedding frame according to the requirements of the embedding surface and was attached the corresponding label. The tissue of cooled on a 20 C. freezing table, and after the wax solidified the wax block was removed from the embedding frame and trimmed.

    [0597] D. Sectioning: Put the trimmed wax block on a paraffin microtome for sectioning into a thickness of 4 m. The slices were floated on the 40 C. warm water of spreader to flatten the tissues. The tissues were picked out with glass slides, and baked in a 60 C. oven. After the water was gone and the wax melted, the sections were taken out and stored at room temperature for later use.

    [0598] 2) Experimental Steps of HE Staining

    [0599] A. Dewaxing the paraffin sections to water: the sections were sequentially put into xylene I 20 min-xylene II 20 min-anhydrous ethanol I 10 min-anhydrous ethanol II 10 min-95% alcohol 5 min-90% alcohol 5 min-80% alcohol 5 min-70% alcohol 5 min-washed with distilled water.

    [0600] B. Hematoxylin staining of cell nuclei: the sections were put into Harris hematoxylin to stain for 3-8 min, washed with tap water, differentiated with 1% hydrochloric acid alcohol for a few seconds, rinsed with tap water, turned blue with 0.6% ammonia, and rinsed with running water. If the cytoplasm was blue, the differentiation time can be prolonged.

    [0601] C. Eosin stained cytoplasm: the sections were put into eosin stain solution and stained for 1-3 min without wash with water.

    [0602] D. Dehydration and covering of sections: the sections were sequentially put in 95% alcohol I 5 min-95% alcohol II 5 min-anhydrous ethanol I 5 min-anhydrous ethanol II 5 min-xylene I 5 min-xylene II 5 min to dehydrate to transparent. The sections were taken out from xylene and dried, and were covered with neutral gum

    [0603] E. Microscopic examination, image acquisition and analysis.

    [0604] F. Staining results: cell nuclei was blue, cytoplasm was red.

    [0605] 5.2.4 Masson Staining Detection of Animal Lung Tissue

    [0606] 1) Dewaxing the paraffin sections to water: the sections were put into xylene I 20 min-xylene II 20 min-anhydrous ethanol I 10 min-anhydrous ethanol II 10 min-95% alcohol 5 min-90% alcohol 5 min-80% alcohol 5 min-70% alcohol 5 min-washed with distilled water.

    [0607] 2) Hematoxylin staining of cell nuclei: Weigert's iron hematoxylin in the masson staining kit was used to stain for 5 min. The sections were washed with tap water, differentiated with 1% hydrochloric acid alcohol for a few seconds, rinsed with tap water, rinsed with running water for a few minutes to return to blue.

    [0608] 3) Ponceau staining: Ponceau acid magenta solution in the masson staining kit was used to stain for 5-10 min. The sections were rinsed quickly with distilled water.

    [0609] 4) Phosphomolybdic acid treatment: the phosphomolybdic acid aqueous solution in the masson staining kit was used for treating for about 3-5 min.

    [0610] 5) Aniline blue staining: the aniline blue solution in the masson staining kit was directly used to counterstained for 5 min without washing with water.

    [0611] 6) Differentiation: 1% acetic acid was used for treating for 1 min.

    [0612] 7) Dehydration and covering sections: the sections were sequentially put in 95% alcohol I 5 min-95% alcohol II 5 min-anhydrous ethanol I 5 min-anhydrous ethanol II 5 min-xylene I 5 min-xylene II 5 min, dehydrated to transparent, and taken out from xylene and dried, then covered with neutral gum

    [0613] 8) Microscopic examination, image acquisition and analysis.

    [0614] Staining results: collagen fibers, mucus, and cartilage were blue; muscle fibers, cellulose, and red blood cells were red; cell nuclei was blue-black.

    [0615] 5.3 Function of PGY Decoctosome in Poly(I:C)-Induced Inflammation Model in Mice

    [0616] 5.3.1 the Animal Experiment Groups were as Follows:

    [0617] 1) Control group: this group was only infused with saline by intratracheal instillation, and served as a saline control group.

    [0618] 2) Poly(I:C) group: 500 g poly(I:C) was injected by instillation into the trachea to build the model. After 9 h, the alveolar lavage fluid and whole blood samples of mice were collected. This group served as a positive control group.

    [0619] 3) Cabbage (JXC) decoctosome experiment group: the cabbage decoction-derived decoctosome was constantly administered by gavage 72 h, 48 h, 24 h, 3 h in advance at a dose of 10 mg cabbage decoctosome (500 L) per mouse. 500 g poly(I:C) was injected by instillation into the trachea to stimulate and build the inflammation model. 3h after model building, 10 mg cabbage decoctosome (500 L) was administered by gavage. After 9h of intratracheal instillation of 500 g poly(I:C), the alveolar lavage fluid and whole blood samples of mice were collected.

    [0620] 4) Taraxacum mongolicum decoctosome experiment group: poly(I:C) was injected by instillation into the trachea at a dose of 2.5 U/kg to build the model. 10 mg(500 L) of the Taraxacum mongolicum decoction-derived decoctosome was administered by gavage for three consecutive days in advance. 500 g poly(I:C) was injected by instillation into the trachea to build the model. 3h after model building, 10 mg cabbage decoctosome (500 L) was administered by gavage. 9h after model building, the alveolar lavage fluid and whole blood samples of mice were collected.

    [0621] 5.3.2 the Expression of Cytokines in Mouse Plasma Determined by Bioplex Mouse 23 Cytokine Kit

    [0622] 1) Sample treatment: The whole blood of mice was collected in an EDTA-2K anticoagulation tube, and the plasma was collected by centrifugation at 2000 rpm, 4 C. for 10 min. The plasma continued to be centrifuged at 12000 rpm, 4 C. for 10 min, the precipitates were discarded, and the upper plasma was used for measurement.

    [0623] 2) Bioplex experimental method: The cytokine expression in mouse alveolar lavage fluid and plasma was measured using Bioplex Mouse 23 Cytokine Detection Kit (Cat #M60009RDPD) according to the instructions. 2 replicate holes were set for the standard to improve the accuracy of the test results.

    [0624] 5.4 Statistical Analysis

    [0625] The data were expressed as meanSEM. All experimental data had been verified by two or more independent repeated experiments. The data showed normal distribution and there was no significant difference between groups. The parameter difference between the experimental group and the control group was evaluated by unpaired t test. The measurement data of hydroxyproline content and mouse cytokine expression content were statistically analyzed by GraphPad Prism5.0 software, and the results of Masson staining were statistically analyzed by Image Pro PLUS software. The mouse cytokine expression content was normalized with poly(I:C) group, and the statistics of Masson staining results were normalized with saline group. P<0.05 was considered statistically significant.

    [0626] 6. Preparation of Bencaosome and Function Verification Thereof

    [0627] 6.1 Preparation Process of Bencaosome

    [0628] 6.1.1 Experiment Materials

    [0629] Lipid Sphinganine (d22:0) (AVANTI, #792079P) was purchased from Avanti Polar Lipids company in US, and stored in chloroform at the concentration of 10 mg/ml. HJT-sRNA-m7 was purchased from Guangzhou Ruibo Biotechnology Co., Ltd., PGY-sRNA-6 was purchased from Suzhou Gemma Gene Co., Ltd., and the stored concentration was 20 Mol.

    [0630] 6.1.2 Preparation Method

    [0631] A. The small RNA was diluted with RNase-removed water to a 100 L system according to the required dose.

    [0632] B. The corresponding amount of lipid stock solution was added to the diluted small RNA solution with a ratio of small RNA to lipid of 0.1 nmol-20 g, 0.2 nmol-25 g, 0.4 nmol-200 g. The solution was mixed thoroughly to make the components fully dispersed.

    [0633] C. The dispersion system was heated in a water bath at 90 C. for 15 minutes to obtain a homogeneous system of herbal medicine.

    [0634] 6.2 Functional Process Verification in Cell Models for Bencaosome

    [0635] 6.2.1 the Culture of MRC-5 Cells, A549 Cells and 293T Cells

    [0636] Human embryo lung fibroblast cell line MRC-5, human lung adenocarcinoma cell line A549, human embryonic kidney cell line HEK293T used in experiments were purchased from Cell Culture Center in Peking Union Medical College. Cells were cultured in 37 C., 5% CO.sub.2 incubator, wherein MRC-5 cells were cultured in EME medium (Gibco), and A549 and HEK-293T cells were cultured in Ham's F-12 medium (HyClone) and DMEM (Gibco). All mediums contained 10% fetal bovine serum and a certain percentage of antibiotics (Penicillin 100U/ml& Streptomycin 100 mg/ml). The cells were cultured to the logarithmic growth phase, and then plated into 12-well plates respectively with a cell density of 610.sup.5/l ml medium/well. The cells were incubated overnight at 37 C., and subsequent experiments were conducted after the cells adhered to the wall.

    [0637] 6.2.2 the Expression of the Nucleic Acid Delivered by Bencaosome in the Cell Model Determined by Real-Time Fluorescent Quantitative PCR (RT-qPCR)

    [0638] 6.2.2.1 Experiment Groups for Bencaosome were as Follows:

    [0639] 1) Naive control group: untreated cells. This group acted as a blank control group.

    [0640] 2) Free uptake group: HJT-sRNA-m7 or PGY-sRNA-6 solution was added directly (final concentration was 100 nM). This group acted as a negative control group;

    [0641] 3) Bencaosome treatment group: the mixture of lipid prepared in step 2 with HJT-sRNA-m7 or PGY-sRNA-6 was added to cells and mixed well. The final concentration of HJT-sRNA-m7 or PGY-sRNA-6 was 100 nM.

    [0642] 6.2.2.2 Measurement of Expression of Nucleic Acid Delivered by Bencaosome

    [0643] After co-incubating with cells for 12-24h, the cells were washed with PBS twice and collected with TRIzol lysis solution (Sigma). The total RNA was extracted. RT-qPCR (SYBR Green dye method) was used to measure the abundance of HJT-sRNA-m7 or PGY-sRNA-6 entering the cells with the specific steps as follows:

    [0644] A. Extraction of total RNA in cells:

    [0645] 1) Cells were added Trizol and placed on ice. After all samples were added Trizol, they were left at room temperature for 5 minutes to be fully lysed.

    [0646] 2) Centrifugation was conducted at 12000 rpm for 5 min. The precipitates were discarded and Trizol was transferred into new centrifuge tubes;

    [0647] 3) Chloroform was added at 200 L chloroform/mL Trizol. The mixture was fully shaken and mixed, followed by placing at room temperature for 5 min;

    [0648] 4) Centrifugation was conducted at 4 C., 12000 rpm for 15 min;

    [0649] 5) The upper water phase was pipetted into another centrifuge tube, and isopropanol was added at 0.5 mL isopropanol/mL Trizol, mixed well, and placed at room temperature for 5-10 min;

    [0650] 6) Centrifugation was conducted at 4 C., 12000 rpm for 15 min, supernatant was discarded, and RNA deposited to the bottom of the tube;

    [0651] 7) 1 mL 75% ethanol was added. The centrifuge tube was gently shaken to suspend the precipitates;

    [0652] 8) 4 C., 12000 rpm centrifuged for 10 min, discarded supernatant, added 1 mL 75% ethanol, gently shook the centrifuge tube to suspend the precipitates;

    [0653] 9) Centrifugation was conducted at 4 C., 12000 rpm for 10 min. The supernatant was discarded. The RNA samples were dried at room temperature and dissolved by 50 L RNase-free water. RNA concentration was quantified by measuring O.D value.

    [0654] B. The total RNA was reverse transcribed to cDNA: Reverse Transcription Kit (High-Capacity cDNA Reverse Transcription Kits, Applied Biosystems, cat. No. 4368813) was used to reverse transcribe sRNA into cDNA by stem-loop method. The reverse transcription system was as follows: RNA template (150 ng/l) 10 l, 10RT buffer, 2.0 l, 25dNTP Mix (100 mM) 0.8 l, U6 RT stem-loop primer 2.0 HJT-sRNA-RT-m7 stem-loop primer 2.0 l (or PGY-sRNA-6 RT stem-loop primer 2.0 L), MultiScribe reverse transcriptase 1.0 l, RNase inhibitor 1.0 l, nuclease-free H.sub.2O 1.2 l. After short spin, the sample was loaded into a PCR reactor to react, and the reaction conditions were as follows: (1) 25 C., 10 min; (2) 37 C., 120 min; (3) 85 C., 5 min; (4) 4 C., terminating the reaction. 20 l RNase-free ddH.sub.2O was added to make up the final volume to 40 l after the reaction. The stem-loop primer used in the reverse transcription process was synthesized by Beijing Tsingke Biotechnology Co., Ltd. (U6 RT primer: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAAATA TG (SEQ ID NO: 110); HJT-sRNA-m7 RT stem-loop primer: GTCGTATCCAGTGCACGCTCCGAGGTATTCGCACTGGATACGACGCTTACA A (SEQ ID NO: 111)). PGY-sRNA-6 RT primer: GTCGTATCCAGTGCACGCTCCGAGGTATTCGCACTGGATACGACTCGGAC (SEQ ID NO: 112).

    [0655] C. Quantitative PCR amplification reaction: the qPCR reaction system has a total volume of 10 l, containing: 5 L 2SYBR Green Master Mix, 0.5 l forward primer (10 M), 0.5 l reverse primer (10 M), 1 l cDNA obtained by reverse transcription, 3 l RNase-free dH2O. LightCycler 480 fluorescence quantitative PCR instrument was used, and the PCR reaction conditions were: 95 C. for 5 min for pre-denaturation, followed by PCR amplification cycle: (1) 95 C., 10 s; (2) 55 C., 10 s; (3) 72 C., 20 s; a total of 40 cycles; 40 C. for 10 sin the end to cool down. Both the forward and reverse primers of the amplification reaction were designed and synthesized by Beijing Tsingke Biotechnology Co., Ltd. (U6 forward primer: GCGCGTCGTGAAGCGTTC (SEQ ID NO: 113), U6 reverse primer: GTGCAGGGTCCGAGGT (SEQ ID NO: 114), HJT-sRNA-m7 forward primer: TCGCGCTGAGGTAGTAGGTT (SEQ ID NO: 115), HJT-sRNA-m7 reverse primer: GTGCACGCTCCGAGGT (SEQ ID NO: 116)). PGY-sRNA-6 primer: GTCGTATCCAGTGCACGCTCCGAGGTATTCGCACTGGATACGACTCGGAC (SEQ ID NO: 112).

    [0656] E. The relative entry level calculated by 2-Ct method.

    [0657] 6.2.3 the Expression Level of mRNA Determined by the Real-Time Fluorescent Quantitative PCR (RT-qPCR)

    [0658] 6.2.3.2 Experiment Groups were as Follows:

    [0659] 1) Naive group: untreated cells. This group acted as a blank control group.

    [0660] 2) Poly(I:C) treatment group: A549 cells were treated by 1 g/mL double stranded RNA virus mimics poly(I:C) for 6 hours. This group acted as a positive stimulation group.

    [0661] 3) So(d22:0)-NC group: A549 cells were added So(d22:0)-NC bencaosome solution (final concentration was 400 nM) in advance and co-incubated for 24h, followed by treatment with 1 g/mL double stranded RNA virus mimics poly(I:C) for 6 hours. This group acted as a negative control group;

    [0662] 4) So(d22:0)-PGY-sRNA-6 bencaosome treatment group: A549 cells were added So(d22:0)-PGY-sRNA-6 bencaosome prepared in step 2, in which final concentration of nucleic acid was 400 nM, and co-incubated for 24h, followed by treatment with 1 g/mL double stranded RNA virus mimics poly(I:C) for 6 hours.

    [0663] 6.2.2.3 Cells were lysed with TRIzol lysis solution. The total RNA was extracted, and mRNA expression level of corresponding genes was measured by RT-qPCR (SYBRGreen dye method), in which the specific steps were as follows:

    [0664] 1) Extraction of total RNA in cells:

    [0665] After Trizol was added into cells, the cells were placed on ice first. After all samples were added Trizol, the samples were left at room temperature for 5 minutes to be fully lysed;

    [0666] Centrifugation was conducted at 12000 rpm for 5 min. The precipitates were discarded and Trizol was transferred into new centrifuge tubes;

    [0667] Chloroform was added at 200 L chloroform/mL Trizol. After sufficient shaking and uniform mixing, the mixture was placed at room temperature for 5 min;

    [0668] Centrifugation was conducted at 4 C., 12000 rpm for 15 min;

    [0669] The upper water phase was pipetted into another centrifuge tube, to which was added isopropanol at 0.5 mL isopropanol/mL Trizol and mixed well. The mixture was placed at room temperature for 5-10 min;

    [0670] Centrifugation was conducted at 4 C., 12000 rpm for 15 min. The supernatant was discarded, and RNA deposited at the bottom of the tube;

    [0671] The centrifuge tube was added 1 mL 75% ethanol and gently shaken to suspend the precipitates;

    [0672] Centrifugation was conducted at 4 C., 12000 rpm for 10 min. The supernatant was discarded. The centrifuge tube was added 1 mL 75% ethanol and gently shaken to suspend the precipitates;

    [0673] Centrifugation was conducted at 4 C., 12000 rpm for 10 min. The supernatant was discarded. The RNA samples were dried at room temperature and dissolved with 50 L RNase-free water. O.D value was measured to quantify RNA concentration.

    [0674] 2) The total RNA was reverse transcribed to cDNA: Reverse Transcription Kit (High Capacity cDNA Reverse Transcription Kits, Applied Biosystems, cat. No. 4368813) was used to reverse transcribe the total RNA into cDNA. The reverse transcription system was as follows: RNA template (150 ng/l) 10 l, 10RT buffer, 2.0 l, 25dNTP Mix (100 mM) 0.8 random primer (included in the kit) 2.0 l, MultiScribe reverse transcriptase 1.0 l, RNase inhibitor 1.0 l, nuclease-free H.sub.2O 3.2 l. After short spin, the samples was loaded into a PCR reactor to react, and the reaction conditions were as follows: (1) 25 C., 10 min; (2) 37 C., 120 min; (3) 85 C., 5 min; (4) 4 C., terminating the reaction. 20 l RNase-free ddH.sub.2O was added to make up the final volume to 40 l after the reaction.

    [0675] 3) Quantitative PCR amplification reaction: the qPCR reaction system has a total volume of 10 l, containing: 5 L 2SYBR Green Master Mix, 0.5 l forward primer (10 M), 0.5 l reverse primer (10 M), 1 l cDNA obtained by reverse transcription, 3 l RNase-free dH2O. LightCycler 480 fluorescence quantitative PCR instrument was used, and the PCR reaction conditions were: 95 C. for 5 min for pre-denaturation, followed by PCR amplification cycle: (1) 95 C., 10 s; (2) 55 C., 10 s; (3) 72 C., 20 s; a total of 40 cycles; 40 C. for 10 sin the end to cool down. Both the forward and reverse primers of the amplification reaction were designed and synthesized by Beijing Tsingke Biotechnology Co., Ltd. The primer sequence was same as that in section 4.3.5.

    [0676] 4) The Relative Expression Level was Calculated by 2-Ct Method.

    [0677] 6.2.4 Protein Expression Level Detected by Western Blot

    [0678] 6.2.4.1 Experiment Groups were as Follows:

    [0679] 1) Naive group: untreated cells. This group acted as a blank control group.

    [0680] 2) TGF-1 treatment group: MRC-5 cells were stimulated by 3 ng/mL transforming growth factor TGF-1 and collected after 72 hours of treatment. This group acted as the positive stimulation group.

    [0681] 3) So(d22:0)-NC group: MRC-5 cells were added So(d22:0)-NC bencaosome solution (final concentration was 400 nM) and co-incubated for 24 hours, followed by stimulation with 3 ng/mL transforming growth factor TGF-1 and collection after 72 hours of treatment. This group served as a negative control group;

    [0682] 4) So(d22:0)-HJT-sRNA-m7 bencaosome treatment group: MRC-5 cells were added prepared So(d22:0)-HJT-sRNA-m7 bencaosome (final concentration was 400 nM) and co-incubated for 24 hours, followed by stimulation with 3 ng/mL transforming growth factor TGF-1 and collection after 72 hours of treatment.

    [0683] 6.2.4.2 after 24h Co-Incubation with Cells, MRC-5 Cells were Stimulated with 3 ng/mL Transforming Growth Factor TGF-1 for 72 Hours and Lysed with Strong RIPA Lysis Solution. Lysis Solution was Collected to Detect the Protein Expression Level of Corresponding Genes by Western Blot.

    [0684] 6.2.5 the Expression Levels of Inflammatory Cytokines as Determined by Enzyme Linked Immunosorbent Assay (ELISA)

    [0685] 6.2.5.1 Experiment Groups were as Follows:

    [0686] 1) Naive group: untreated A549 cells supernatant. This group acted as a blank control group.

    [0687] 2) Poly(I:C) treatment group: cell supernatant obtained by treating A549 cells with 1 g/mL double stranded RNA virus mimics poly(I:C) for 6 hours. This group acted as a positive stimulation group.

    [0688] 3) So(d22:0)-NC group: A549 cells were added So(d22:0)-NC bencaosome solution (final concentration is 400 nM) and co-incubated for 24 hours, followed by treatment with 1 g/mL double stranded RNA virus mimics poly(I:C) for 6 hours. The cell supernatant was collected. This group acted as a negative control group;

    [0689] 4) So(d22:0)-PGY-sRNA-6 bencaosome treatment group: A549 cells were added prepared So(d22:0)-PGY-sRNA-6 bencaosome with the final concentration of nucleic acid of 400 nM and co-incubated for 24 hours, followed by treatment with 1 g/mL double stranded RNA virus mimics poly(I:C) for 6 hours. The cell supernatant was collected.

    [0690] 6.2.5.2 the Cell Supernatant was Centrifuged at 4 C., 12,000 Rpm for 5 Min, then Transferred to a New 1.5 mL EP Tube, and was Added 100xx Cocktail. ELISA was Used to Detect the Expression Level of Inflammatory Cytokines. The Specific Steps were as Follows:

    [0691] Coating: Self-coated ELISA plate (kit: IL-1 #DY201-05, IL-6 #DY206-05, TNF- #DY210-05, which includes Detection Antibody and Related Genes Avidin-HRP of corresponding genes) from R&D company was used. Capture Antibody (IL-1, IL-6, TNF-) was diluted with PBS (according to the dilution ratio in the instructions) and coated overnight at room temperature for about 16-18 h;

    [0692] Patent washing: The coated ELISA plate was taken out, with the Capture Antibody solution discarded and remaining liquid patted to dry with the filter paper. Then 300 L of the prepared washing solution (PBS+0.1% tween 20) was added for washing, each time 1 min (using ELISA plate shaker). Each time the washing solution was discarded and the remaining liquid was patted to dry with the filter paper (below is the same). The washing was conducted 4 times;

    [0693] Blocking: After washing, 300 L blocking solution (PBS+1% BSA) was added and incubation was conducted at room temperature for 1 h;

    [0694] Preparation: The corresponding standards (IL-1, IL-6, TNF-) were prepared within 1 hour, diluted according to the concentration gradient of after preparing the highest concentration according to the instructions, and diluted 7 times. The eighth tube was added diluent and taken as the blank tube;

    [0695] Plate washing: The plate was washed 4 times with washing solution after incubating for 1 hour;

    [0696] Sample adding: The prepared standards were added to the left and right rows of the ELISA plate, and samples were added to other wells. The incubation was conducted at room temperature for 2 hours;

    [0697] Adding primary antibody: The plate was washed 4 times with washing solution, added 100 L Detection Antibody, sealed and incubated at room temperature for 2 h;

    [0698] Adding secondary antibody: The plate was washed 4 times with washing solution, added 100 L Avidin-HRP, sealed and incubated at room temperature for 20 min;

    [0699] Adding substrate: The plate was washed 4 times with washing solution, added 100 L TMB Substrate Solution in the dark, and then immediately put into a drawer in the dark for about 10-20 min. After the color turned blue, 100 L termination solution was added to terminate the reaction, and the color changed from blue to yellow;

    [0700] The absorbance was measured within 30 minutes, the detection wavelength is 450 nm, and the reference wavelength is 570 nm.

    [0701] 6.3 Functional Process Verification for Bencaosome in Animal Model

    [0702] 6.3.1 Experiment Steps:

    [0703] 1) Preparation of bencaosome: Bencaosome was prepared by boiling method, 400 L NC mimic (provided by Guangzhou Ruibo Biotechnology Co., Ltd.) or HJT-sRNA-m7 (10nmol) double-stranded RNA DEPC-treated aqueous solution was respectively added 10 L sphinganine (d22:0) lipid, mixed well and heated at 90 C. for 30 min.

    [0704] 2) 6-8 week old male C57 mice were administered RNA by gavage, the bencaosome solution system of lipid with NC or HJT-sRNA-m7 was administered with an intragastric needle, 400 L/mouse, the groups were as follows:

    [0705] 1) Saline control group: untreated mice which were administered with saline only.

    [0706] 2) Bleomycin group: bleomycin was injected by instillation into the trachea at a dose of 2.5 U/kg to build the model. After 21 days, the left and right lungs were collected for testing. This group served as a positive control group.

    [0707] 3) Lipid Sphinganine-NC group: bleomycin was injected by instillation into the trachea at a dose of 2.5 U/kg to build the model. The bencaosome composed of lipid Sphinganine-NC (0.1 mg:5 nmol) was administered by gavage for three consecutive days in advance. After bleomycin was injected by instillation into the trachea to build the model, the same dose of bencaosome composed of lipid Sphinganine-NC was administered on Days 7-14 days. After 21 days, the left and right lungs were collected for testing.

    [0708] 4) Lipid Sphinganine-HJT-sRNA-m7 group: bleomycin was injected by instillation into the trachea at a dose of 2.5 U/kg to build the model. The bencaosome composed of lipid Sphinganine-HJT-sRNA-m7 (0.1 mg:5 nmol) was administered for three consecutive days in advance. After bleomycin was injected by instillation into the trachea to build the model, the same dose of bencaosome composed of lipid Sphinganine-HJT-sRNA-m7 was administered on Days 7-14. After 21 days, the left and right lungs were collected for testing.

    [0709] 6.3.2 Determination of Hydroxyproline Content in Animal Lung Tissue

    [0710] The hydroxyproline assay kit (#MAK008, Sigma Aldrich) was used to determine the collagen content of mouse lungs. The mouse right lung tissue was vacuum dried, weighed and hydrolyzed with 6M hydrochloric acid at 120 C. for 3 hours, and the hydroxyproline content was determined according to the kit instructions. Hydroxyproline content was expressed as g/right lung, unless otherwise specified.

    [0711] 6.3.3 Pathological Examination of Animal Lung Tissue

    [0712] See 5.2.3.

    [0713] 6.3.4 Masson Staining Detection of Animal Lung Tissue

    [0714] See 5.2.4.

    Example 2. Detection of Characteristics of Decoctosome of Herbal Medicine

    [0715] Based on the schematic diagram for the preparation of decoctosome of herbal medicine in FIG. 1, the decoctions of two herbal medicines of Rhodiola (HJT) and Taraxacum mongolicum (PGY) were prepared according to the specific steps in Example 1, and then the precipitates of two herbal medicines, HJT and PGY, were obtained by differential centrifugation. The decoctosome precipitates were dissolved in double distilled water and their characteristics were detected after quantification. The results of transmission electron microscope are shown in FIG. 2 and FIG. 3. Both HJT decoctosome and PGY decoctosome were exosome-like nanoparticles having the outermost double-layer membrane and inhomogeneous diameter. However, the diameter of most of the decoctosomes falled between 100 nm and 200 nm.

    [0716] To further observe the characteristic of decoctosome, we measured the particle size and Zeta potential of decoctosome. FIG. 4 and FIG. 5 showed that the average particle size peak of HJT decoctosome was 197.6 nm, the average particle size peak of PGY decoctosome was 153.2 nm. The particle size was uniformly distributed and showed normal distribution. Zeta potential results showed that the potential absolute value of HJT decoctosome and PGY decoctosome were greater than 30 mV, and the system was relatively stable.

    Example 3. Functional Verification of Decoctosome of Herbal Medicine in Cell Model

    [0717] After quantifying the HJT decoction and the HJT decoctosome extracted from the decoction, the decoction with the concentration of 300 g/ml and the decoctosome with the concentration of 50 g/ml were selected to verify their functions in fibrosis model of MRC-5 cells induced by TGF-1. The results were shown in FIG. 6 and FIG. 7. Both HJT decoction and HJT decoctosome could effectively reduce the expression of fibrin fibronectin in MRC-5 cells induced by TGF-1, compared with decoction and decoctosome of control woody (MX) with the same concentration and prepared by same method.

    [0718] After quantifying the PGY decoction and the PGY decoctosome extracted from the decoction, the decoction with the concentration of 10 g/ml, 30 g/ml, and 100 g/ml and the decoctosome with the concentration of 2 g/ml, 6 g/ml, and 20 g/ml were selected to verify their functions in inflammation model of A549 cells stimulated by poly(I:C). The results were shown in FIG. 8A-C and FIG. 9A-E, both PGY decoction and PGY decoctosome could effectively reduce the relative expression of mRNA of IL-1, IL-6, TNF- in inflammation model of A549 cells stimulated by poly(I:C), compared with decoction and decoctosome of control cabbage (JXC) with the same concentration and prepared by same method.

    [0719] The above results were completed in cell models. The decoction and decoctosome of two herbal medicines HJT and PGY had anti-fibrosis and anti-inflammatory functions, respectively. The effective concentration of the decoction was significantly higher than that of the decoctosome, proving that the decoctosome may be a form of a mixture of herbal medicines that primarily function.

    Example 4. Functional Verification of Decoctosome of Herbal Medicines in Animal Model

    [0720] After quantifying the HJT decoctosome extracted from decoction, decoction-derived HJT decoctosome prepared by decocting Rhodiola as prepared above (previously prepared with 200 g) was selected to verify the anti-fibrosis function in the bleomycin-induced mouse fibrosis model. Animal experiments groups were as follows:

    [0721] 1) Control group: this group was injected with saline by intratracheal instillation, and served as a saline control group.

    [0722] 2) Bleomycin group: bleomycin was injected by instillation into the trachea at a dose of 2.5 U/kg to build the model. After 21 days, the left and right lungs were collected for testing. This group served as a positive control group.

    [0723] 3) Woody decoctosome control group: bleomycin was injected by instillation into the trachea at a dose of 2.5 U/kg to build the model. The woody decoction-derived decoctosome was administered by gavage for three consecutive days in advance at a dose of 40 g woody decoction-derived decoctosome (500 L) per mouse. After 21 days, the left and right lungs were collected for testing.

    [0724] 4) Rhodiola decoctosome control group: bleomycin was injected by instillation into the trachea at a dose of 2.5 U/kg to build the model. The Rhodiola decoction-derive decoctosome was administered by gavage for three consecutive days in advance at a dose of 40 g Rhodiola decoction-derived decoctosome (500 L) per mouse. After 21 days, the left and right lungs were collected for testing.

    [0725] The results were shown in FIGS. 10-13. Compared with the control MX decoctosome prepared by the same method at the same dose, the HJT decoctosome could effectively reduce the level of hydroxyproline in mouse lung in bleomycin-induced mouse fibrosis model (FIG. 10), effectively reduced the pulmonary fibrosis in the fibrosis model of mice induced by bleomycin (FIG. 11 and FIG. 12), and effectively reduced the pathological changes in the lungs of mice in the bleomycin-induced mouse fibrosis model (FIG. 13).

    [0726] After quantifying PGY decoctosome extracted from decoction, inflammation model of A549 cells stimulated by poly(I:C) were selected when the dose of PGY decoctosome was 10 mg/mouse to verify its function. The animal experiment groups were as follows:

    [0727] 1) Control group: this group was only infused with saline by intratracheal instillation, served as a saline control group.

    [0728] 2) Poly(I:C) group: 500 g poly(I:C) was injected by instillation into the trachea to build the model. After 9 h, the alveolar lavage fluid and whole blood samples of mice were collected. This group served as a positive control group.

    [0729] 3) Cabbage(JXC) decoctosome control group: the cabbage decoction derived decoctosome was administered by gavage for 72 h, 48 h, 24 h, 3 h in advance at a dose of 10 mg cabbage decoctosome (500 L) per mouse. 500 g poly(I:C) was injected by instillation into the trachea to stimulate and build the inflammation model. After 3 h of model building, 10 mg cabbage decoctosome (500 L) was administered by gavage. 9 h after intratracheal instillation of 500 g poly(I:C), the alveolar lavage fluid and whole blood samples of mice were collected.

    [0730] 4) Taraxacum mongolicum decoctosome control group: the Taraxacum mongolicum decoction derived decoctosome 10 mg (500 L) was administered by gavage for three consecutive days in advance. 500 g poly(I:C) was injected by instillation into the trachea to build the model. 3h after model building, 10 mg Taraxacum mongolicum decoctosome (500 L) was administered by gavage. 9 h after model building, the alveolar lavage fluid and whole blood samples of mice were collected.

    [0731] The results were shown in FIG. 14A-B. Compared with the control JXC decoctosome prepared by the same method at same dose, PGY decoctosome could effectively reduce the expression of all kinds of cytokines in mice plasma in mice inflammation model induced by poly(I:C).

    [0732] The above results were completed in animal models. The decoctosome of two herbal medicines HJT and PGY had anti-fibrosis and anti-inflammatory functions, respectively. Based on the function verification of decoctosome in cell model in Example 3, it is proved that the decoctosome may be an important component for herbal medicine to function.

    Example 5. Identification of Each Component in Decoctosome of Herbal Medicines

    [0733] Since the decoctosome of herbal medicines plays an important role in its medicinal value, it is important to study the composition of the decoctosome. Taking the HJT and PGY herbal medicines as examples, first we used HPLC-MS/MS to identify the lipid components of these two decoctosomes, and a total of 25 kinds of lipid components were identified, as shown in FIG. 15 (Identification of lipids in Rhodiola decoctosome), FIG. 16 (Identification of lipids in Rhodiola decoctosome). The contents of TG, Cer, DG, PE and PC accounted for the main part of the lipids in the decoctosome.

    [0734] By analyzing the compound components in HJT decoctosome and PGY decoctosome, FIG. 17 showed that 36 kinds of compounds were identified in HJT decoctosome. FIG. 18 showed that 47 kinds of compounds were identified in PGY decoctosome.

    [0735] By analyzing protein components, FIG. 19 showed that 38 kinds of proteins were identified in HJT decoctosome. Similarly, FIG. 20 showed that 140 kinds of proteins were identified in PGY decoctosome. Upon simple classification of these proteins, the identified protein components in decoctosome were mainly related to metabolism, signal transduction, ubiquitination and transcription, and translation.

    [0736] By extracting the RNA in the precipitates of the decoctosome, the small RNA sequencing was performed. As shown in FIG. 21 and FIG. 22, the length of the small RNA in the HJT decoctosome and the PGY decoctosome was mainly distributed between 18 nt to 25 nt. Table 8-9 showed the main information of the small RNA sequence in HJT decoctosome and PGY decoctosome. 80,573 small RNAs were identified in HJT decoctosome, and 614,545 small RNAs were identified in PGY decoctosome.

    [0737] In summary, the components in the decoctosome include lipids, compounds, proteins and small RNAs.

    Example 6. Preparation and Function Identification of Bencaosome

    [0738] We defined bencaosome as artificially prepared nanoparticulate substances with thermally stable exosome-like membrane structure, composed of one or more synthetic lipids and sustances including but not limited to synthetic or extracted lipids, artificially expressed or modified proteins, artificially synthesized or purified nucleic acids (including DNA, RNA, including small RNA), artificially synthesized or purified compounds and the like. As shown in FIG. 23, bencaosome is a substance formed by artificially combining two or more active ingredients, such as lipids, compounds, small RNAs, and proteins followed by heat treatment.

    [0739] Our research proved that the small RNA in Rhodiola decoction, i.e., HJT-sRNA-m7, had effective anti-fibrosis effect in both fibrosis model of MRC-5 cells induced by TGF-1 and mice fibrosis model induced by bleomycin (Du. et al., 2017). We mixed a certain proportion of lipid Sphinganine with HJT-sRNA-m7, and heated and boiled to form the bencaosome of Sphinganine-HJT-sRNA-m7. As shown in FIG. 24-FIG. 26, RT-PCR was used to detect the relative expression level of HJT-sRNA-m7 in MRC-5 cells, flow cytometry was used to detect the entry of HJT-sRNA-m7 in MRC-5 cells and the cell confocal experiment was used to detect the entry and distribution of Cy5-labeled HJT-sRNA-m7 in A549 cells, all of which proved that the bencaosome of Sphinganine-HJT-sRNA-m7 could make HJT-sRNA-m7 effectively enter cells. FIG. 27 showed that Sphinganine-HJT-sRNA-m7 had an anti-fibrosis effect in the fibrosis model of MRC-5 cells induced by TGF-1. Sphinganine-HJT-sRNA-m7 could effectively reduce the expression of fibrosis-related protein fibronectin and a-SMA.

    [0740] We synthesized and screened the top 20 small RNAs (PGY-sRNA-120) with the highest kurtosis in PGY decoction to verify their anti-inflammatory function. FIG. 28 showed that in the inflammation model of poly(I:C)-induced A549, PGY-sRNA-6 was the most effective in reducing the expression of IL-1, IL-6 and TNF- in A549 cells. PGY-sRNA-6 was verified in poly(I:C) stimulated A549 cells and PUMC cell inflammation models, FIG. 29A-C and FIG. 30A-C showed that PGY-sRNA-6 could effectively reduce the relative expression of IL-1, IL-6 and TNF- mRNA in A549 cells and PBMC cells stimulated by poly(I:C). Bioinformatics analysis and dual-fluorescence reporter gene detection methods were also used, and FIG. 31 and FIG. 32 showed that RELA (p65, Gene ID: 5970) was the direct target gene of PGY-sRNA-6. As shown in FIG. 33, upon bioinformatics analysis, PGY-sRNA-6 existed in both PGY decoction and PGY decoctosome, and the latter contained higher kurtosis. We mixed a certain proportion of lipid Sphinganine with PGY-sRNA-6, which was heated and boiled to form the bencaosome of Sphinganine-PGY-sRNA-6. As shown in FIG. 34-FIG. 36, RT-PCR was used to detect the relative expression level of PGY-sRNA-6 in A549 cells, flow cytometry was used to detect the entry of PGY-sRNA-6 in A549 cells and the cell confocal experiment was used to detect the entry and distribution of Cy5-labeled PGY-sRNA-6 in A549 cells, all of which proved that the bencaosome of Sphinganine-PGY-sRNA-6 can make PGY-sRNA-6 effectively enter cells. FIG. 37A-C showed that Sphinganine-PGY-sRNA-6 had an anti-inflammatory effect in the inflammation model of A549 cells stimulated by poly(I:C). Sphinganine-PGY-sRNA-6 could effectively reduce the relative expression of IL-1, IL-6 and TNF- mRNA in cells. FIG. 38 showed that Sphinganine-PGY-sRNA-6 effectively reduced the expression of 3UTR of PGY-sRNA-6 target gene RELA in HEK 293T cells.

    [0741] The bencaosome formed by combining lipid Sphinganine with two functional small RNAs, HJT-sRNA-m7 or PGY-sRNA-6, had effective anti-fibrosis and anti-inflammatory effects in cell models of fibrosis and inflammation. The bencaosome of Sphinganine-HJT-sRNA-m7 was shown in FIGS. 39-41. Sphinganine-HJT-sRNA-m7 could effectively reduce the changes in mouse lung cases in a bleomycin-induced fibrosis model of mice (FIG. 39), effectively reduced fibrosis of mouse lung in a mice fibrosis model induced by bleomycin (FIG. 40 and FIG. 41).

    Example 7: The Bencaosome Formed by Combining Sphinganine-PGY-sRNA-6 had an Effective Anti-Inflammatory Effect in the Inflammation Model of Mice

    [0742] 1) Preparation of bencaosome: Boiling and heating method was used. 500 L aqueous solution of NC mimic or PGY-sRNA-6 (5 nmol) single-stranded RNA treated with DEPC was respectively added 10 L sphinganine (d22:0) lipid, mixed well and heated at 90 C. for 15 min.

    [0743] 2) The bencaosome solution systems of lipid and NC or PGY-sRNA-6 was administered to 6-8 week old male C57 mice with an intragastric needle at 500 L/mouse. Groups were as follows:

    [0744] 1) Naive group: untreated mice.

    [0745] 2) Poly(I:C) group: 500 g poly(I:C) was injected by instillation into the trachea to stimulate to build the model. 9h after stimulation, mice plasma was collected to detect cytokine. This group served as a positive control group.

    [0746] 3) Lipid Sphinganine-NC group: After the bencaosome composed of lipid Sphinganine(d22:0)-NC was administered 48 h, 24 h, 3 h in advance, 500 g poly(I:C) was injected by instillation into the trachea to stimulate to build a model. 3 h after stimulation, lipid Sphinganine(d22:0)-NC bencaosome was administered again. 9 h after stimulation, mice plasma was collected to detect cytokine.

    [0747] 4) Lipid Sphinganine-PGY-sRNA-6 group: After the bencaosome composed of lipid Sphinganine(d22:0)-HJT-sRNA-m7 was administered 48 h, 24 h, 3 h in advance, 500 g poly(I:C) was injected by instillation into the trachea to stimulate to build a model. 3 h after stimulation, lipid Sphinganine(d22:0)-PGY-sRNA-6 bencaosome was administered again. 9 h after stimulation, mice plasma was collected to detect cytokine. The reagent kit BIO-Plex Pro Mouse Cytokines Standard 23-Plex, Group I kit (#60009RDPD, BIO-RAD) was used to determine the expression levels of mouse plasma cytokines. Whole blood was taken into an EDTA-2K anticoagulation tube, and centrifuged at 4 C. 2000 g for 10 minutes. The upper plasma was taken and centrifuged at 4 C. 12000 g for 10 minutes. The supernatant was taken for cytokine detection.

    [0748] The results were shown in FIG. 42A-G. Bencaosome effectively reduced the levels of cytokines shown in the figure.

    Example 8: Different Ways to Detect the Physical and Chemical Properties of Bencaosome

    [0749] 1. Critical Micelle Concentration (CMC) Detection:

    [0750] 6 M 1,6-diphenyl-1,3,5-hexatriene (DPH) solution was prepared using 0.25% tetrahydrofuran:99.75% water (v/v). 50 L DPH solution was added to 50 L experimental group solution in each well of a black 96-well plate. After the plate was incubated at room temperature for 1 hour in the dark, DPH fluorescence was detected. The excitation wavelength was 350 nm and the emission wavelength was 420 nm.

    [0751] 2. sRNA group: 50 L DPH solution was added to 50 L sRNA solution in each well of a black 96-well plate. After the plate was incubated at room temperature for 1 hour in the dark, DPH fluorescence was detected.

    [0752] 3. Sphinganine(So, d22:0) group: 50 L DPH solution was added to 504, So(d22:0) solution in each well of a black 96-well plate. After the plate was incubated at room temperature for 1 hour in the dark, DPH fluorescence was detected.

    [0753] 4. Bencaosome group: 504, DPH solution was added to 504, bencaosome solution in each well of a black 96-well plate. After the plate was incubated at room temperature for 1 hour in the dark, DPH fluorescence was detected.

    [0754] A. So(d22:0)-HJT-sRNA-m7(200 nM) bencaosome group of heating method: 50 L DPH solution was added to 50 L So(d22:0)-HJT-sRNA-m7(200 nM) bencaosome solution prepared by heating method in each well of a black 96-well plate. After the plate was incubated at room temperature for 1 hour in the dark, DPH fluorescence was detected.

    [0755] B. So(d22:0)-HJT-sRNA-m7(600 nM) bencaosome group of heating method: 50 L DPH solution was added to 50 L So(d22:0)-HJT-sRNA-m7(600 nM) bencaosome solution prepared by heating method in each well of a black 96-well plate. After the plate was incubated at room temperature for 1 hour in the dark, DPH fluorescence was detected.

    [0756] C. Unheated So(d22:0)-HJT-sRNA-m7(200 nM) bencaosome group: 50 L DPH solution was added to 50 L So(d22:0)-HJT-sRNA-m7(200 nM) bencaosome solution prepared by directly mixing in each well of a black 96-well plate. After the plate was incubated at room temperature for 1 hour in the dark, DPH fluorescence was detected.

    [0757] D. Unheated So(d22:0)-HJT-sRNA-m7(600 nM) bencaosome group: 50 L DPH solution was added to 50 L So(d22:0)-HJT-sRNA-m7(600 nM) bencaosome solution prepared by directly mixing in each well of a black 96-well plate. After the plate was incubated at room temperature for 1 hour in the dark, DPH fluorescence was detected.

    [0758] As shown in FIG. 43-44, the small and medium RNAs of bencaosome may exist in the form of being embedded in lipid membranes. Heating can promote the stability of the process of inserting small and medium RNAs of bencaosome into lipid membranes.

    [0759] 2. The Results of the Geometric Distribution and Zeta Potential of Bencaosome Determined by Static Light Scattering Method

    [0760] Detection of particle size and Zeta potential of bencaosome

    [0761] 1) Preparation of bencaosome: To 100 microliters of RNA solution (2 M, 4 M, 6 M) was added 30 g lipid respectively, mixed well and heated in a water bath at 90 C. for 15 minutes, then diluted to 1 ml with ddH.sub.2O during measurement.

    [0762] 2) Particle size measurement: 1 ml of the system was transferred to a cuvette and measured with a Zetasizer Nano ZS90 (Malvern Instrument, UK) instrument. The measuring temperature was 25 C.

    [0763] 3) Zeta potential measurement: Zetasizer Nano ZS90 (Malvern Instrument, UK) instrument was used. The measuring temperature was 25 C.

    [0764] 3. Particle Size Distribution, Zeta Potential Measurement and Transmission Electron Microscope Morphological Observation of Bencaosome

    [0765] Preparation of bencaosome: To 100 microliters of water or RNA solution (6 M) was added 30 g lipid respectively, mixed well and heated in a water bath at 90 C. for 15 minutes, then diluted to 1 ml with ddH.sub.2O during measurement.

    [0766] 1) Particle size measurement: 1 ml of the system was transferred to a cuvette and measured with a Zetasizer Nano ZS90 (Malvern Instrument, UK) instrument. Measuring temperature was 25 degrees.

    [0767] 2) Zeta potential detection: 1 ml of the system was transferred to a cuvette and measured with a Zetasizer Nano ZS90 (Malvern Instrument, UK) instrument. Measuring temperature was 25 degrees.

    [0768] 3) Transmission electron microscope observation: a drop of bencaosome solution was dripped on a 200-mesh copper mesh, and the excess liquid was absorbed with filter paper. 2% phosphotungstic acid (w/w, pH 7.0) was dripped for negative dyeing for 2 minutes, excess liquid was absorbed with filter paper and dried at room temperature for 1 hour. JEOL JEM-1400 PLUS transmission electron microscope was used to observe. Observation condition voltage was 80 kV.

    [0769] The geometric distribution of bencaosome was shown in FIG. 45, the Zeta potential results were shown in FIG. 46, and the particle size distribution was shown in FIG. 47A-47D. The particle size distribution of the bencaosome was about 100 nanometers, the static light scattering intensity was 50-120 kcps, the zeta potential was less than 60 mV, and the absolute value was greater than 20 mV.

    Example 9: The Protein Delivery Efficiency and Positioning of Bencaosome

    [0770] 1. Efficiency of Lipid 40 PE (16:0/22:1) to Deliver Protein Determined by Flow Cytometry

    [0771] Experimental materials: A549 cells (purchased from the Cell Center of the Chinese Academy of Medical Sciences), green fluorescent protein (internally constructed plasmid expression, 200 nM), lipid 40 PE (16:0/22:1) (10 mg/mL), Accuri C6 instrument (Purchased from American BD Company)

    [0772] Experimental method: The bencaosome was prepared by reverse evaporation of ether. 0.2 nmol green fluorescent protein dissolved in 20 l water was added to 100 l ether solutions containing 0 g, 1 g, 3 g lipid respectively. After fully mixing, sonication was conducted for 3 min. After evaporation at 60 C. to remove organic solvent, the bencaosome solution was obtained by hydrating with 100 L opti-MEM. Then the bencaosome was added to A549 cells and co-incubated for 6 hours. The samples were collected and tested. After washing three times with PBS, the samples were digested with trypsin for three minutes. The trypsin was removed, and then the samples were washed with PBS and blown off. Accuri C6 instrument was used to measure.

    [0773] According to FIG. 149A-D, the efficiency of green fluorescent protein free entry into A549 cells was 3.6%, the efficiency of 10 g/mL lipid 40 to deliver green fluorescent protein into A549 cells was 7.2%, and the efficiency of 30 g/mL lipid 41 to deliver green fluorescent protein into A549 cells was 9.1%, which was higher. Lipid 40 could deliver protein into A549 cells

    [0774] 2. Efficiency of Lipid 41 Sphinganine(d22:0) to Deliver Protein Determined by Flow Cytometry

    [0775] Experimental materials: A549 cells (purchased from the Cell Center of the Chinese Academy of Medical Sciences), green fluorescent protein (internally constructed plasmid expression, 200 nM), lipid 41 sphinganine(d22:0) (10 mg/mL), Accuri C6 instrument (Purchased from American BD Company).

    [0776] Experimental method: The bencaosome was prepared by reverse evaporation method. 0.2 nmol green fluorescent protein dissolved in 20 l water was added to 100 l ether solutions containing 0 g, 1 s, 3 g lipid respectively. After fully mixing, sonication was conducted for 3 min. After evaporation at 60 C. to remove organic solvent, the bencaosome solution was obtained by hydrating with 100 L opti-MEM. Then the bencaosome was added to A549 cells and co-incubated for 6 hours. The samples were collected and tested. After washing three times with PBS, the samples were digested with trypsin for three minutes. The trypsin was removed, and then the samples were washed with PBS and blown off. Accuri C6 instrument was used to measure.

    [0777] According to FIG. 150A-D, the efficiency of green fluorescent protein free entry into A549 cells was 3.6%, the efficiency of 10 g/mL lipid 41 to deliver green fluorescent protein into A549 cells was 23.4%, and the efficiency of 30 g/mL lipid 41 to deliver green fluorescent protein into A549 cells was 26.6%, which was higher. Lipid 41 could deliver protein into A549 cells efficiently.

    [0778] 3. Efficiency of Lipid 41 Sphinganine(d22:0) to Deliver Protein Determined by Flow Cytometry

    [0779] Experimental materials: A549 cells (purchased from the Cell Center of the Chinese Academy of Medical Sciences), green fluorescent protein (internally constructed plasmid expression, 200 nM), lipid 41 sphinganine(d22:0) (10 mg/mL), Accuri C6 instrument (Purchased from American BD Company)

    [0780] Experimental method: The bencaosome was prepared by heating method. 0.2 nmol green fluorescent protein dissolved in 100 l water was added to 0 L, 1 L, 3 L of lipid respectively. After fully mixing, the bencaosome solution was obtained by heating at 90 C. for 15 min. Then the bencaosome was added to A549 cells and co-incubated for 6 hours. The samples were collected and tested. After washing three times with PBS, the samples were digested with trypsin for three minutes, the trypsin was removed, and then the samples were washed with PBS and blown off. Accuri C6 instrument was used to measure.

    [0781] According to FIG. 150E-H, the efficiency of green fluorescent protein free entry into A549 cells was 3.6%, the efficiency of 10 g/mL lipid 41 to deliver green fluorescent protein into A549 cells was 5.5%, and the efficiency of 30 g/mL lipid 41 to deliver green fluorescent protein into A549 cells was 9.5%, which was higher. Lipid 41 could deliver protein into A549 cells efficiently.

    [0782] 4. Efficiency of Lipid 71 PE(16:0/16:0) to Deliver Protein Determined by Flow Cytometry

    [0783] Experimental materials: A549 cells (purchased from the Cell Center of the Chinese Academy of Medical Sciences), green fluorescent protein (internally constructed plasmid expression, 200 nM), lipid 71 PE(16:0/16:0) (10 mg/mL), Accuri C6 instrument (Purchased from American BD Company)

    [0784] Experimental method: The bencaosome was prepared by reverse evaporation method. 0.2 nmol green fluorescent protein dissolved in 20 l water was added 100 l ether solutions containing 0 g, 1 g, 3 g lipid respectively. After fully mixing, sonication was conducted for 3 min. After evaporated at 60 C. to remove organic solvent, the bencaosome solution was obtained by hydrating with 100 L opti-MEM. Then the bencaosome was added to A549 cells and co-incubated for 6 hours. The samples were collected and tested. After washing three times with PBS, the samples were digested with trypsin for three minutes, the trypsin was removed, and the samples were washed with PBS and blown off. Accuri C6 instrument was used to measure.

    [0785] According to FIG. 151A-D, the efficiency of green fluorescent protein free entry into A549 cells was 3.6%, the efficiency of 10 g/mL lipid 71 to deliver green fluorescent protein into A549 cells was 7.1%, and the efficiency of 30 g/mL lipid 41 to deliver green fluorescent protein into A549 cells was 9.1%, which was higher. Lipid 71 could deliver protein into A549 cells efficiently.

    [0786] 5. Localization of Protein Delivered by Lipid 40 PE (16:0/22:1) in Cells Observed by Confocal Fluorescence Microscope

    [0787] Experimental materials: A549 cells (purchased from the Cell Center of the Chinese Academy of Medical Sciences), green fluorescent protein (internally constructed plasmid expression), lipid 40 PE (16:0/22:1) (10 mg/mL), Zeiss LSM780 (purchased from Germany Zeiss Company), Alexa Fluor 488 phalloidin (purchased from Invitrogen, USA), DAPI (purchased from Invitrogen, USA), paraformaldehyde (purchased from Sigma Company, USA)

    [0788] Experimental method: The bencaosome was prepared by reverse evaporation method. 0.2 nmol green fluorescent protein dissolved in 20 l water was added to 100 l ether solutions containing 0 g, 0.25 g, 0.75 g lipid respectively. After fully mixing, sonication was conducted for 3 min. After evaporated at 60 C. to remove organic solvent, the bencaosome solution was obtained by hydrating with 100 L opti-MEM. Then the bencaosome was added to A549 cells and co-incubated for 6 hours. The samples were collected and tested. After washing three times with PBS, the samples were fixed with 4% paraformaldehyde. After washing three times with PBS, the samples were stained with Alexa Fluor 488 phalloidin for 30 min. After washing three times with PBS, the samples were stained with Dapi for 5 min, then washed with PBS and sealed for observation.

    [0789] According to FIG. 152, under confocal microscope, the entry of green fluorescent protein could be clearly observed, and lipid 40 could effectively deliver protein into A549 cells.

    [0790] 6. Localization of Protein Delivered by Lipid 41 Sphinganine(d22:0) in Cells Observed by Confocal Fluorescence Microscope

    [0791] Experimental materials: A549 cells (purchased from the Cell Center of the Chinese Academy of Medical Sciences), green fluorescent protein (internally constructed plasmid expression), lipid 41 sphinganine(d22:0), Zeiss LSM780 (purchased from Germany Zeiss Company), Alexa Fluor 488 phalloidin (purchased from Invitrogen, USA), DAPI (purchased from Invitrogen, USA), paraformaldehyde (purchased from Sigma Company, USA)

    [0792] Experimental method: The bencaosome was prepared by reverse evaporation method. 0.2 nmol green fluorescent protein dissolved in 20 l water was added to 100 l ether solutions containing 0 g, 0.25 g, 0.75 g lipid respectively. After fully mixing, sonication was conducted for 3 min. After evaporated at 60 C. to remove organic solvent, the bencaosome solution was obtained by hydrating with 100 L opti-MEM. Then the bencaosome was added to A549 cells and co-incubated for 6 hours. The samples were collected and tested. After washing three times with PBS, the samples were fixed with 4% paraformaldehyde. After washing three times with PBS, the samples were stained with Alexa Fluor 488 phalloidin for 30 min. After washing three times with PBS, the samples were stained with Dapi for 5 min, then washed with PBS and sealed for observation.

    [0793] According to FIG. 153, under confocal microscope, the entry of green fluorescent protein could be clearly observed, and lipid 41 could effectively deliver protein into A549 cells.

    [0794] 7. Localization of Protein Delivered by Lipid 71 PE(16:0/16:0) in Cells Observed by Confocal Fluorescence Microscope

    [0795] Experimental materials: A549 cells (purchased from the Cell Center of the Chinese Academy of Medical Sciences), green fluorescent protein (internally constructed plasmid expression), lipid 71 PE(16:0/16:0), Zeiss LSM780 (purchased from Germany Zeiss Company), Alexa Fluor 488 phalloidin (purchased from Invitrogen, USA), DAPI (purchased from Invitrogen, USA), paraformaldehyde (purchased from Sigma Company, USA)

    [0796] Experimental method: The bencaosome was prepared by reverse evaporation method. 0.2 nmol green fluorescent protein dissolved in 20 l water was added to 100 l ether solutions containing 0 g, 0.25 g, 0.75 g lipid respectively. After fully mixing, sonication was conducted for 3 min. After evaporated at 60 C. to remove organic solvent, the bencaosome solution was obtained by hydrating with 100 L opti-MEM. Then the bencaosome was added to A549 cells and co-incubated for 6 hours. The samples were collected and tested. After washing three times with PBS, the samples were fixed with 4% paraformaldehyde. After washing three times with PBS, the samples were stained with Alexa Fluor 488 phalloidin for 30 min. After washing three times with PBS, the samples were stained with Dapi for 5 min, then washed with PBS and sealed for observation.

    [0797] According to FIG. 154, under confocal microscope, the entry of green fluorescent protein could be clearly observed, and lipid 71 could effectively deliver protein into A549 cells.

    [0798] Second Part of the Experiment

    Method

    [0799] 1. Extraction of Lipids from Herbal Medicine

    [0800] 1.1 Decoction Preparation of Herbal Medicine

    [0801] 1) 100 g decoction pieces (Rhodiola crenulata, Taraxacum mongolicum, Lonicera japonica and Andrographis paniculata, purchased from Beijing Tongrentang pharmacy) were added to 1000 mL ddH.sub.2O and soaked for 30 min.

    [0802] 2) The mixture was decocted in a decoction pot for 15 min with intense heating, and for 20 min with gentle heating.

    [0803] 3) 400 mL of the heated medicine soup was added to a rotary evaporator, and was concentrated to 100 mL at 60 C., 60 rpm, 30 min.

    [0804] 1.2 Lipid Extraction

    [0805] 1) To the 160 mL decoction based on the above 1.1 (concentrated by rotary evaporator) was added 600 mL of chloroform-methanol mixture (chloroform:methanol=1:2, v/v) to make chloroform:methanol:water=1:2:0.8, and stirred for 10-15 min to mix.

    [0806] 2) 200 mL chloroform was add to the Erlenmeyer flask and stirred for 10 min to mix.

    [0807] 3) 200 ml ddH.sub.2O was added to the Erlenmeyer flask to make chloroform:methanol:water=2:2:1.8, stirred for 10 min to mix.

    [0808] 4) The liquid of upper layer and the insoluble substances of intermediate layer was removed, and the chloroform layer of lower layer was taken out and stored at 40 C.

    [0809] 1.3 HPLC-MS/MS Identification of Lipid Components

    [0810] Instrument Setup

    [0811] 1) Chromatographic setup:

    [0812] Instrument: Ultimate 3000; column: Kinetex C18 (1002.1 mm, 1.9 m); column temperature: 45 C.; mobile phase A: acetonitrile: water (v/v, 60:40), the solution containing 10 mmol/L ammonium formate, mobile phase B: acetonitrile: isopropanol (10:90, v/v), the solution containing 10 mmol/L ammonium formate and 0.1% formic acid. Flow rate: 0.4 mL/min; injection volume: 4 l.

    [0813] 2) Mass spectrometry parameters:

    [0814] a) Positive mode: Heater Temp 300 C., Sheath Gas Flow rate, 45 arb, Aux Gas Flow Rate, 15 arb, Sweep Gas Flow Rate, 1 arb, spray volt age, 3.0 KV, Capillary Temp, 350 C., S-Lens RF Level, 30%. Scan ranges: 200-1500.

    [0815] b) Negative mode: Heater Temp 300 C., Sheath Gas Flow rate, 45 arb, Aux Gas Flow Rate, 15 arb, Sweep Gas Flow Rate, 1 arb, spray voltage, 2.5 KV, Capillary Temp, 350 C., S-Lens RF Level, 60%. Scan ranges: 200-1500.

    [0816] 1.4 Identification of the Lipids Derived from Herbal Medicine

    [0817] The lipid components were identified by HPLC-MS/MS, and a total of 138 lipid components derived from herbal medicine were identified, among which 125 were identified in positive mode and 13 in negative mode. The following experiments was performed on the compounds 1-69 shown in Table 10. It should be noted that the lipids tested below were all commercially purchased or commercially synthesized, and used as described in Table 10.

    [0818] 2. Manufacture of Lipid Nucleic Acid Mixture

    [0819] 2.1 Reverse Evaporation Method:

    [0820] 100 l lipid in diethyl ether solution was prepared, and grouped according to the lipid numbers shown in Table 1 (the lipid concentrations are shown in the table below). To the lipid solution was added 20 l nucleic acid solution (HJT sRNA or siRNA) at the volume ratio of 5:1, and sonicated for after 3 min. The diethyl ether was removed by evaporation at 55 C., and then 100 l DEPC water was added for hydration to give nucleic acid lipid mixture.

    TABLE-US-00017 TABLE 15 Single lipid or lipid Concentration/ FIG. combination (mg/mL) 83 8 + 12 = 1:2 No. 8 0.0833 No. 12 0.1667 103 38 + 12 + 37 = 4:1:1 No. 38 0.2 No. 12 0.05 No. 37 0.05 108/109/111/114 No. 41 No. 41 0.25 119 40 + 12 + 41 = 2:4:3 No. 40 0.0667 No. 12 0.1333 No. 41 0.1 120 left 12 + 41 = 1:6 No. 12 0.0428 No. 41 0.2571 120 right 12 + 41 = 1:1 No. 12 0.15 No. 41 0.15 121 left 12 + 41 = 6:1 No. 12 0.2571 No. 41 0.0428 121 right 4 + 12 + 41 = 1:1:1 No. 4 0.1 No. 12 0.1 No. 41 0.1 122 4 + 12 + 41 = 1:1:1 No. 4 0.1 No. 12 0.1 No. 41 0.1 125 No. 38 No. 38 0.25 131/132/134 No. 40 No. 40 0.25 136/137 No. 39 No. 39 0.25 138 No. 60 No. 60 0.25 139 No. 62 No. 62 0.25

    [0821] 2.2 Boiling Method:

    [0822] 100 L of the nucleic acid solution (HJT sRNA or siRNA) was added to 2-5 L of the lipid solution (the concentration was shown in Table 1), mixed, and heated at 80-100 C. for 15-30 min to give nucleic acid lipid mixture.

    [0823] 3. In Vitro Delivery Experiment of Lipid Nucleic Acid Mixture

    [0824] 3.1 Real-Time Quantitative PCR (RT-qPCR) Detection of Intracellular Expression of Nucleic Acids Delivered by Lipid.

    [0825] 3.1.1 MRC-5 Cell (Pulmonary Embryonic Fibroblast), A549 Cell (Human Lung Adenocarcinoma Cell), Caco-2 Cell (Human Colon Adenocarcinoma Cell) (Purchased from the Cell Resource Center of the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences) were Cultured to Logarithmic Growth Phase, then Plated into 12-Well Plates at a Cell Density of 610.sup.5/l mL Medium/Well; MRC-5 and Caco-2 Cells were Cultured in Eagle's MEM Medium (MEM, Gibco); A549 Cells were Cultured in Ham's F-12 Medium (HyClone); Followed by Incubation Overnight at 37 C., and the Follow-Up Experiments were Performed after the Cells were Attached to the Walls.

    [0826] 3.1.2 Experimental Groups were as Follows:

    [0827] 1) Naive group: it referred to untreated cells, and this group served as a blank control group.

    [0828] 2) RNAimax treatment group: 2 l Lipofectamine RNAimax transfection reagent (full name of Lipofectamine RNAiMAX, Invitrogen, Thermo Fisher Scientific) and HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium (purchased from Invitrogen, Thermo Fisher Scientific) respectively and then the two were mixed, allowed to stand for 15 min, added into cells and then mixed. The final concentration of HJT-sRNA-m7 was 100 nM; this group served as a positive control group.

    [0829] 3) Free uptake group: HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM), and the group served as a negative control group.

    [0830] 4) Lipid nucleic acid mixture: the mixture of lipid and HJT-sRNA-m7 prepared from the step 2 were added into cells and mixed, and the final concentration of HJT-sRNA-m7 was 100 nM.

    [0831] 3.1.3 after Co-Incubation with Cells for 12-24 Hours, the Cells were Washed Twice with PBS. The Cells were Harvested with TRIzol Lysis Buffer (Purchased from Sigma-Aldrich), and Total RNA was Extracted. The Abundance of HJT-sRNA-m7 that Entered the Cells was Detected by RT-qPCR; the Protocols were as Follows:

    [0832] 1) Extraction of total cellular RNA:

    [0833] A. To the cells cultured in a 12-well plate (about 110.sup.6 cells/well) was added 1 mL TRIzol lysis buffer in each well, and then placed on ice. After to all the samples was added TRIzol, they were allowed to stand at room temperature for 5 min to allow them fully lysed.

    [0834] B. Centrifuge at 4 C., 12,000 rpm for 5 min, discard the pellet and transfer TRIzol to a fresh centrifuge tube;

    [0835] C. Add chloroform at a ratio of 200 L chloroform/mL TRIzol, shake well, mix and allow to stand for 5 min at room temperature;

    [0836] D. Centrifuge at 4 C., 12,000 rpm for 15 min;

    [0837] E. Pipette the upper aqueous phase into another centrifuge tube, add isopropanol at a ratio of 0.5 mL isopropanol/mL TRIzol and allow to stand at room temperature for 5-10 min;

    [0838] F. Centrifuge at 4 C., 12,000 rpm for 15 min, discard the supernatant, and allow the RNA to precipitate to the bottom of the tube;

    [0839] G. Add 1 mL 75% ethanol, gently shake the tube to suspend the precipitate;

    [0840] H. Centrifuge at 4 C., 12,000 rpm for 10 min, discard the supernatant, add 1 mL 75% ethanol, gently shake the centrifuge tube to suspend the precipitate;

    [0841] I. Centrifuge at 4 C., 12,000 rpm for 10 min, discard the supernatant, dry at room temperature, dissolve the RNA sample with 50 L RNase-free H.sub.2O, and quantify the RNA concentration by the measurement of OD value.

    [0842] 2) Total RNA was reverse transcribed to cDNA: Reverse Transcription Kit (High-Capacity cDNA Reverse Transcription Kits, Applied Biosystems, cat. no. 4368813) was used to reverse transcribe sRNA to cDNA by stem-loop method (see, e.g. Real-time quantification of microRNAs by stem-loop RT-PCR, Nucleic Acids Res. 2005 Nov. 27; 33(20):e179, incorporated by reference herein). The reverse transcription system was as follows: template RNA (150 ng/L) 10 L, 10RT buffer 2.0 L, 25dNTP Mix (100 mM) 0.8 L, U6 RT stem-loop primer 2.0 L, HJT-sRNA-m7 RT stem-Loop primer 2.0 L, MultiScribe reverse transcriptase 1.0 L, RNase inhibitor 1.0 L, nuclease-free H.sub.2O 1.2 L, loaded into a PCR reactor after brief centrifugation. The reaction conditions were as follows: (1) 25 C., 10 min; (2) 37 C., 120 min; (3) 85 C., 5 min; (4) 4 C., termination of reaction. 20 l RNase-free ddH.sub.2O was added to make up the final volume to 40 l after the reaction. The stem-loop primer used in the reverse transcription process was synthesized by Beijing Tsingke Biotechnology Co., Ltd. (U6 RT primer, because the quantification of small RNA by RT-qPCR reaction can only be relative, so U6 was used as a standard reference gene for calculating relative expression level): GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAAAT ATG (SEQ ID NO: 110); HJT-sRNA-m7 RT stem-loop primer: GTCGTATCCAGTGCACGCTCCGAGGTATTCGCACTGGATACGACGCTTAC AA (SEQ ID NO: 111)).

    [0843] 3) Quantitative PCR amplification reaction: the qPCR reaction system had a total volume of 10 l, containing: 5 L 2SYBR Green Master Mix, 0.5 l forward primer (10 M), 0.5 l reverse primer (10 M), 1 l cDNA by reverse transcription, 3 l RNase-free dH2O. LightCycler 480 fluorescence quantitative PCR instrument was used, and the PCR reaction conditions were: 95 C., pre-denaturation for 5 min, followed by PCR amplification cycle: (1) 95 C., 10 s; (2) 55 C., 10 s; (3) 72 C., 20 s; a total of 40 cycles; 40 C. for 10 s in the end to cool down. Both the forward and reverse primers of the amplification reaction were designed and synthesized by Beijing Tsingke Biotechnology Co., Ltd. (U6 forward primer: GCGCGTCGTGAAGCGTTC (SEQ ID NO: 113), U6 reverse primer: GTGCAGGGTCCGAGGT (SEQ ID NO: 114), HJT-sRNA-m7 forward primer: TCGCGCTGAGGTAGTAGGTT (SEQ ID NO: 115), HJT-sRNA-m7 reverse primer: GTGCACGCTCCGAGGT (SEQ ID NO: 116)).

    [0844] 4) 2-Ct method (relative gene expression level=2-(Ct target gene-Ct internal reference gene)) was used to calculate the relative amount of entry (single or double stranded RNA).

    [0845] 3.2 Real-Time Quantitative PCR (RT-qPCR) Detection of mRNA Expression Levels

    [0846] 3.2.1 THP-1 cell (human monocyte) was cultured to logarithmic growth phase, then plated into 12-well plates at a cell density of 6105/1 mL medium/well; THP-1 cells were cultured in RPMI-1640 medium (HyClone); the cells were incubated overnight at 37 C., and the follow-up experiments were performed after the cells were attached to the walls.

    [0847] 3.2.2 Experimental Groups were as Follows:

    [0848] 1) naive group: referred to untreated THP-1 cells, and this group served as a blank control group.

    [0849] 2) RNAiMAX treatment group: 2 l Lipofectamine RNAimax transfection reagent (Invitrogen, Thermo Fisher Scientific) and nucleic acid solution (TNF siRNA) were diluted in 100 l opti-MEM medium (Invitrogen, Thermo Fisher Scientific) respectively and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of nucleic acid was 400 nM; this group served as a positive control group.

    [0850] 3) Free uptake group: nucleic acid solution (TNF siRNA) was directly added (the final concentration was 400 nM), the group served as a negative control group.

    [0851] 4) Lipid nucleic acid mixture: the mixture of lipid and nucleic acid prepared from the step 2 were added into cells and mixed, and the final concentration of nucleic acid was to 400 nM.

    [0852] 3.2.3 after 24 Hours of Treatment, the Cells were Stimulated with 1 g/mL E. coli LPS (Lipopolysaccharide, LPS, Escherichia coli 0111:B4, L4391, Sigma-Aldrich), and Harvested Using TRIzol Lysis Buffer after 9 Hours to Extract Total RNA. The mRNA Expression Level of TNF- (the Target Genes of the Subsequent Examples Varied Case by Case and were Indicated in the Figures) was Determined by RT-qPCR (SYBR Green Dye Method), and the Protocols were as Follows:

    [0853] 1) Extraction of the total RNA from cells: the procedures were the same as the method of extracting total RNA in Section 3.1.3.

    [0854] 2) Total RNA was reverse transcribed to cDNA: Reverse Transcription Kit (High-Capacity cDNA Reverse Transcription Kits, Applied Biosystems, cat. no. 4368813) was used to reverse transcribe the total RNA to cDNA. The reverse transcription system was as follows: template RNA (150 ng/L) 10 L, 10RT buffer 2.0 L, 25dNTP Mix (100 mM) 0.8 L, random primers 2.0 L, MultiScribe reverse transcriptase 1.0 L, RNase inhibitor 1.0 L, nuclease-free H.sub.2O 3.2 L, loaded into a PCR reactor after brief centrifugation. The reaction conditions were as follows: (1) 25 C., 10 min; (2) 37 C., 120 min; (3) 85 C., 5 min; (4) 4 C., termination of reaction. 20 l RNase-free dd H.sub.2O was added to make up the final volume to 40 l after the reaction.

    [0855] 3) Quantitative PCR amplification reaction: the total volume of qPCR reaction system was 10 l, containing: 5 L 2SYBR Green Master Mix, 0.5 l forward primer (10 M), 0.5 l reverse primer (10 M), 1 l cDNA by reverse transcription, 3 l RNase-free dH2O. LightCycler 480 fluorescence quantitative PCR instrument was used, the PCR reaction conditions were: 95 C., pre-denaturation for 5 min, followed by PCR amplification cycle: (1) 95 C., 10 s; (2) 55 C., 10 s; (3) 72 C., 20 s; a total of 40 cycles; 40 C. for 10 s in the end to cool down. Both the forward and reverse primers of the amplification reaction were designed and synthesized by Beijing Qingke Biotechnology Co., Ltd. The primer sequences were as follows: forward primer for internal reference gene UBC: CTGGAAGATGGTCGTACCCTG (SEQ ID NO: 101), reverse primer for internal reference gene UBC: GGTCTTGCCAGTGAGTGTCT (SEQ ID NO: 102); forward primer for target gene TNF-: CTGCCCCAATCCCTTTATT (SEQ ID NO: 107): reverse primer for target gene TNF-: CCCAATTCTCTTTTTGAGCC (SEQ ID NO: 108).

    [0856] 4) The relative expression level was calculated 2-Ct method as described above.

    [0857] 3.3 Western Blot Detection of Protein Expression Levels

    [0858] 3.3.1 MRC-5 Cell (Pulmonary Embryonic Fibroblast), and A549 Cell (Human Lung Adenocarcinoma Cell) were Cultured to Logarithmic Growth Phase, and then Plated into 12-Well Plates at a Cell Density of 6105/1 mL Medium/Well; MRC-5 Cells were Cultured in Eagle's MEM Medium (MEM, Gibco); A549 Cells were Cultured in Ham's F-12 Medium (HyClone); Followed by Incubation Overnight at 37 C., and the Follow-Up Experiments were Performed after the Cells were Attached to the Walls.

    [0859] 3.3.2 Experimental Groups were as Follows:

    [0860] 1) Naive group: it referred to the untreated cells, and this group served as a blank control group.

    [0861] 2) RNAiMAX treatment group: 2 l Lipofectamine RNAimax transfection reagent (Invitrogen, Thermo Fisher Scientific) and nucleic acid solution were diluted in 100 l opti-MEM medium (Invitrogen, Thermo Fisher Scientific) respectively and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of nucleic acid was 400 nM; this group served as a positive control group.

    [0862] 3) Free uptake group: the nucleic acid solution was directly added (the final concentration was 400 nM), and the group served as a negative control group.

    [0863] 4) Lipid nucleic acid mixture: the mixture of lipid and nucleic acid prepared from the step 2 were added into cells and mixed, and the final concentration of nucleic acid was 400 nM.

    [0864] 3.3.3 after 24 Hours of Treatment, the Cells were Stimulated with the Stimulant (1 g/mL Poly (I:C) (P1530, Sigma-Aldrich) as Double-Stranded RNA Viruses Mimetics) or 3 ng/mL Transforming Growth Factor TGF1 (Pepro Tech)). The Cells were Harvested Using Strong RIPA Lysis Buffer, and after Incubation for Some Time, Western Blot was Used to Detect the Protein Expression Level of the Related Genes (the Types of the Related Gene Varied Case by Case and were Indicated in the Corresponding Figures) (the Protein Expression Level of REL-A was Detected 24 Hours after the A549 Cells were Stimulated by Poly(I:C) with -Actin as the Internal Reference Protein; the Protein Expression Levels of Fibronectin and -SMA were Detected 72 Hours after MRC-5 Cells were Stimulated with TGF-1 with GAPDH as the Internal Reference Protein; the Protein Expression of the Corresponding Knockdown Genes was Detected in the siRNA Delivery Assay with -Actin as the Internal Reference Protein). The Protocols were as Follows:

    [0865] 1) Collection of protein samples and determination of the concentration by BCA method.

    [0866] H. Discard the medium, add 1 mL PBS buffer into each well of the 12-well plate to wash the cells once, add 100 L precooled strong RIPA lysis buffer into each cell, scrap off the cells with a pipette tip and transfer to a centrifuge tube, place and keep on ice for 20 min for lysis;

    [0867] I. Centrifuge at 4 C., 12,000 rpm for 10 min, transfer the supernatant to a frech centrifuge tube;

    [0868] J. Mix BCA reagent A and B (50:1, v/v) thoroughly to prepare a BCA working solution;

    [0869] K. Add 25 L of the freshly prepared BSA standard solution and the samples to be tested to a 96-well plate, add 200 L BCA working solution to each well and mix well; incubate at 37 C. for 30 min;

    [0870] L. Measure the absorbance at 562 nm using an ultraviolet spectrophotometer (Synergy 4 multi-function microplate reader), and calculate the protein concentration in the samples according to the standard curve;

    [0871] M. Adjust the concentration of the samples with RIPA lysis buffer and loading buffer so that the concentration of each sample was the same;

    [0872] N. Denaturation at 95 C. for 10 min.

    [0873] 2) Western blot

    [0874] E. Gel preparation: a resolving gel (lower layer gel) with a concentration of 10% and stacking gel (upper layer gel) with a concentration of 5% were used. The lanes were made with a 15-well comb, and equal amounts of protein were loaded in each lane;

    [0875] F. Protein electrophoresis: add electrophoresis buffer and use an initial voltage of 80 V for electrophoresis; when the bromophenol blue dye reach the resolving gel, increase the voltage to 120 V and continue electrophoresis until the bromophenol blue dye reach the bottom or completely out of the resolving gel;

    [0876] G. Wet transfer: make the assembly in the following order: transfer pad (anode)-sponge-filter paper-gel-PVDF membrane-filter paper-sponge-transfer pad(cathode); install the assembly and put the whole transfer device at 4 C. cold chamber; set constant current at 300 mA for a 120 min transfer;

    [0877] H. Blocking: place the membrane in a 3% BSA blocking solution after the transfer and block at room temperature for 1 hour;

    [0878] I. Primary antibody incubation: transfer the blocked PVDF membrane to the hybridization bag, add 3% BSA blocking solution containing the corresponding primary antibody (the primary antibody informations were as follows), remove the bubbles in the bag, and incubate overnight at 4 C.

    [0879] J. Membrane wash: take out the PVDF membrane and wash the membrane 3 times with TBST for 10 min each time;

    [0880] K. Secondary antibody incubation: discard TBST, add 3% BSA blocking solution containing goat anti-rabbit or goat anti-mouse secondary antibody with horseradish peroxidase (HRP) (purchased from Hangzhou Lianke Biotechnology Co., Ltd.) (dilution ratio of secondary antibody was 1:5000), incubate for 1 hour at room temperature;

    [0881] L. Membrane wash: wash the membrane 3 times with TBST for 10 min each time;

    [0882] M. Developing: prepare Western developing solution (1:1, V/V, Merck Millipore, ECL chemiluminescence developing solution purchased from Millipore), and add the prepared developing solution evenly to the side the membrane that is bound to the proteins; carefully wrap the film with plastic wrap and observe after developing;

    [0883] N. Analysis: analysis was performed using Image J software.

    [0884] 4. In Vivo Delivery Experiments of Lipid Nucleic Acid Mixture

    [0885] 4.1 Experimental Steps:

    [0886] 1) Preparation of lipid nucleic acid mixture: boiling method was used. To 400 L HJT-sRNA-m7 (5 nmol) single-stranded RNA in DEPC-treated solution was added 9 L or 18 L lipid combinations (lipid PE (No. 38) & LPC (No. 37) & TG (No. 32), 4:2:3, V/V/V) respectively, mixed and heated at 100 C. for 30 min.

    [0887] 2) Intragastric administration of RNA in 6-8 weeks old male C57BL/6J wild type mice: HJT-sRNA-m7 aqueous solution or the mixture solution of lipid and HJT-sRNA-m7 were administered using a gavage needle, 400 L/animal (HJT)-sRNA-m7, 5 nmol/animal). The groups were as follows:

    [0888] A. Control group (naive group): mice that did not receive any treatment;

    [0889] B. Negative control group (lipid group): intragastric administration of 9 L lipid combinations (lipid PE (No. 38) & LPC (No. 37) & TG (No. 32), 4:2:3, V/V/V);

    [0890] C. Free uptake group: direct intragastric administration of HJT-sRNA-m7 single-stranded RNA solution;

    [0891] D. Lipid and nucleic acid mixture group: intragastric administration of the mixture of lipid combination and HJT-sRNA-m7 single-stranded RNA.

    [0892] 3) Sample collection: 3 hours after intragastric administration, the mouse whole lung was lysed with 3 mL TRIzol, homogenized and frozen at 80 C.

    [0893] 4) Total RNA extraction:

    [0894] A. Add 3.0 mL TRIzol lysis buffer to mouse lung tissue, grind with a homogenizer, centrifuge at 12,000 rpm, 4 C., for 10 min, remove the tissue precipitate that failed to homogenize;

    [0895] B. Add chloroform at a ratio of 200 l/mL TRIzol, shake well to mix, and keep at room temperature for 15 min.

    [0896] C. centrifuge at 12,000 rpm, 4 C., for 15 min, pipette the upper aqueous phase to another centrifuge tube;

    [0897] D. Repeat the above step, add equal amount of chloroform to the upper aqueous phase, mix well, and keep for 10 min at room temperature;

    [0898] E. 12,000 rpm, 4 C., centrifuge for 15 min;

    [0899] F. Draw the upper aqueous phase to a fresh EP tube, add isopropanol a ratio of 0.5 ml/mL TRIzol, mix and keep at room temperature for 5-10 min;

    [0900] G. 12,000 rpm, 4 C., centrifuge for 15 min, discard the supernatant;

    [0901] H. Add 1 mL 75% ethanol, gently shake the centrifuge tube, and suspend the precipitate;

    [0902] I. 12,000 rpm, 4 C., centrifuge for 10 min, discard the supernatant as much as possible;

    [0903] J. Dry at room temperature for 5-10 min and dissolve the RNA sample with 50 l DEPC-treated H.sub.2O.

    [0904] 5) Detection of the abundance of HJT-sRNA-m7 by RT-qPCR (SYBR Green universal dye method).

    [0905] Unless otherwise indicated, the single stranded HJT-sRNA-m7 solution refers to single-stranded HJT-sRNA-m7 in DEPC-treated aqueous solution. The double-stranded HJT-sRNA-m7 solution refers to a double-stranded HJT-sRNA-m7 in DEPC-treated aqueous solution.

    Example 1-1: Delivery of Single-Stranded Nucleic Acids into MRC-5 Cell by Different Types of Lipid Combination

    [0906] 1. Experimental Groups:

    [0907] 1) Naive group: untreated MRC-5 cell;

    [0908] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 in DEPC-treated aqueous solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 200 nM;

    [0909] 3) Free uptake group: single-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 200 nM);

    [0910] 4) Lipid nucleic acid mixture: mixtures of 3 L single lipid or lipid combination and HJT-sRNA-m7 single-stranded nucleic acid solution treated by boiling method were added to the cells and mixed. The final concentration of RNA was 200 nM.

    [0911] 2. Experimental procedures

    [0912] 1) Boiling method conditions: to 100 L single-stranded HJT-sRNA-m7 solution was added 3 L single lipid or lipid combination in chloroform solution (lipid No. 1/2/4/9/14/18/19/20/21/22/23/24/25/26/27/28/29/30/32 in chloroform solution having a concentration of 5 mg/mL, lipid No. 3/8/10/11/12/13/33/34/35/36 in chloroform solution having a concentration of 10 mg/mL, lipid No. 6/15/16/17/31 in chloroform solution having a concentration of 1 mg/mL), and heated at 100 C. for 30 min;

    [0913] a) Lipid combination:

    [0914] b) MG (monoglyceride): 3 L lipid No. 34;

    [0915] c) DG (diglyceride): 3 L mixture of equal volume of lipids No. 1/2/3/19/35 in chloroform solution;

    [0916] d) TG (triglyceride): 3 L mixture of equal volume of lipids No. 6/9/10/13/15/16/18/20/21/22/23/24/25/26/27/28/32/33 in chloroform solution;

    [0917] e) LPC (Lysophosphatidylcholine): 3 L mixture of equal volume of lipids No. 36/37 in chloroform solution;

    [0918] f) PC (phosphatidylcholine): 3 L mixture of equal volume of lipids No. 11/12 in chloroform solution;

    [0919] g) PE (phosphatidylethanolamine): 3 L mixture of equal volume of lipids No. 8/38 in chloroform solution;

    [0920] h) Cer (Ceramides): 3 L mixture of equal volume of lipids No. 4/14 in chloroform solution;

    [0921] i) So (Sphingoshine): 3 L mixture of equal volume of lipids No. 17/30/31 in chloroform solution;

    [0922] j) FA (fatty acid): 3 L lipid No. 29;

    [0923] k) Mixture: 3 L mixture of equal volume of lipids No. 1-36 (without No. 5/7) in chloroform solution;

    [0924] l) Mixture 1: 3 L mixture of equal volume of lipids No. 1-36 (without No. 5/7/34) in chloroform solution;

    [0925] m) Mixture 2: 3 L mixture of equal volume of lipids No. 1-36 (without No. 5/7/1/2/3/19/35) in chloroform solution;

    [0926] n) Mixture 3: 3 L mixture of equal volume of lipids No. 1-36 (without No. 5/7/6/9/10/13/15/16/18/20/21/22/23/24/25/26/27/28/32/33) in chloroform solution;

    [0927] o) Mixture 4: 3 L mixture of equal volume of lipids No. 1-36 (without No. 5/7/36/37) in chloroform solution;

    [0928] p) Mixture 5: 3 L mixture of equal volume of lipids No. 1-36 (without No. 5/7/11/12) in chloroform solution;

    [0929] q) Mixture 6: 3 L mixture of equal volume of lipids No. 1-36 (without No. 5/7/8) in chloroform solution;

    [0930] r) Mixture 7: 3 L mixture of equal volume of lipids No. 1-36 (without No. 5/7/4/14) in chloroform solution;

    [0931] s) Mixture 8: 3 L mixture of equal volume of lipids No. 1-36 (without No. 5/7/29) in chloroform solution;

    [0932] 2) Experimental conditions: the final concentration of HJT-sRNA-m7 was 200 nM. 12 hours after being added to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method (SYBR Green Universal dye method). For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipid. The experiments were all performed in triplicates.

    [0933] Conclusions: The results showed that the above lipid combinations were all effective in delivering nucleic acids into cells as compared to the free uptake group (see FIG. 48), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings. Nucleic acids that were mediated by the mixture 2, mixture 3, mixture 5, mixture 7, mixture 8 entered into MRC-5 cells in higher amounts.

    Example 1-2: Delivery of Single-Stranded Nucleic Acids into MRC-5 Cell and Caco-2 Cell by Lipid Combination

    [0934] 1. Experimental groups:

    [0935] Cells to be tested were MRC-5 cell and Caco-2 cell.

    [0936] 1) Naive group: untreated cell;

    [0937] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 200 nM;

    [0938] 3) Free uptake group: single-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 200 nM);

    [0939] 4) Treatment group with single lipid and nucleic acid: a mixture of 3 L single lipid (No. 1 or 8 or 12) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 200 nM;

    [0940] 5) Treatment group with lipid combination mixture and nucleic acid mixture: a mixture of 3 L lipid combination (No. 1/8/12 mixed in equal volumes) and HJT-sRNA-m7 single-stranded nucleic acid solution treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 200 nM;

    [0941] 6) Treatment group with lipid combination and nucleic acid mixture: a mixture of 3 L lipid combination (a mixture of 2 L single lipid No. 1 or No. 8 or No. 12 and 1 L of the following types of lipids (MG, DG, TG, LPC, Cer, So, or FA)) and HJT-sRNA-m7 single-stranded nucleic acid solution that were treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 200 nM. In FIGS. 49A and 49B, the treatment groups were collectively represented as No. 1 2 L+mix 1 L, No. 8 2 L+mix 1 L, and No. 12 2 L+mix 1 L, wherein, within the horizontal line, MG represented 2 L single lipid of No. 1 or No. 8 or No. 12+1 L MG, DG represented 2 L single lipid of No. 1 or No. 8 or No. 12+1 L DG, TG represented 2 L single lipid of No. 1 or No. 8 or No. 12+1 L TG, LPC represented 2 L single lipid of No. 1 or No. 8 or No. 12+1 L LPC, Cer represented 2 L single lipid of No. 1 or No. 8 or No. 12+1 L Cer, So represented 2 L single lipid of No. 1 or No. 8 or No. 12+1 L So, FA represented 2 L single lipid of No. 1 or No. 8 or No. 12+1 L FA.

    [0942] 2. Experimental procedures

    [0943] 1) Conditions of the boiling method: to 100 L single-stranded HJT-sRNA-m7 solution was added 3 L single lipid (lipid No. 1 in chloroform solution having a concentration of 5 mg/mL, lipids No. 8/12 in chloroform solution having a concentration of 10 mg/mL) or lipid combination, and heated at 100 C. for 30 min;

    [0944] MG (monoglyceride): 2 L lipid No. 34;

    [0945] DG (diglyceride): 2 L mixture of equal volume of lipids No. 1/2/3/19/35 in chloroform solution;

    [0946] TG (triglyceride): 2 L mixture of equal volume of lipids No. 6/9/10/13/15/16/18/20/21/22/23/24/25/26/27/28/32/33 in chloroform solution;

    [0947] LPC (Lysophosphatidylcholine): 2 L mixture of equal volume of lipids No. 36/37 in chloroform solution;

    [0948] Cer (Ceramides): 2 L mixture of equal volume of lipids No. 4/14 in chloroform solution;

    [0949] So (Sphingoshine): 2 L mixture of equal volume of lipids No. 17/30/31 in chloroform solution;

    [0950] FA (fatty acid): 2 L lipid No. 29;

    [0951] 2) Experimental conditions: the final concentration of HJT-sRNA-m7 was 200 nM. 24 hours after being added to the cells, the amount of HJT-sRNA-m7 that entered into the cells was detected by RT-qPCR method (SYBR Green Universal dye method). For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipid. All experiments were performed in triplicates.

    [0952] Conclusion: The results showed that for MRC-5 cells, the mixture (No. 1/8/12 mixed in equal volume), No. 1 2 L+No. 8 1 L, No. 1 2 L+No. 12 1 L, No. 1 2 L+MG 1 L, No. 8 2 L+MG 1 L, No. 12 2 L+No. 8 1 L and No. 12 2 L+So 1 L, delivered nucleic acid more efficiently.

    [0953] For Caco-2 cells, the mixtures (No. 1/8/12 in equal volume), No. 1 2 L+No. 8 1 L, No. 1 2 L+No. 12 1 L, No. 1 2 L+MG 1 L, No. 8 2 L+MG 1 L, No. 12 2 L+No. 8 1 L, No. 12 2 L+LPC 1 L and No. 12 2 L+So 1 L, delivered nucleic acid more efficiently.

    Example 1-3: Delivery of Single-Stranded Nucleic Acid into Cell by Lipid Combination

    [0954] Cell types: A549, MRC-5 and Caco-2 cells.

    [0955] 1. Experimental groups:

    [0956] 1) Naive group: untreated cell;

    [0957] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 100 nM;

    [0958] 3) Free uptake group: single-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [0959] 4) Treatment group by single lipid and nucleic acid: a mixture of 3 L single lipid (No. 8 or No. 12) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM;

    [0960] 5) Treatment group by lipid combination PC (No. 12) & PE (No. 8) and nucleic acid mixture: a mixture of 2.25 L lipid combination (PC (No. 12) & PE (No. 8), 2:1, V/V) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM;

    [0961] 6) Treatment group by lipid combination and nucleic acid mixture: a mixture of 3 L lipid combination (mixture of 2.25 L lipid combination PC (No. 12) & PE (No. 8) and 0.75 L of the following types of lipid, DG, TG, LPC, PC, Cer, So or FA) and the HJT-sRNA-m7 single-stranded nucleic acid solution that were treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM. In FIG. 50, the mixture treatment group corresponds to the treatment groups within the horizontal line above 2.25 L+0.75 L.

    [0962] 2. Experimental procedures

    [0963] 1) Boiling method conditions: to 100 L single-stranded HJT-sRNA-m7 solution was added single lipid (lipids No. 8/12 in chloroform solution having a concentration of 10 mg/mL) or lipid combination, and heated at 100 C. for 30 min;

    [0964] DG (diglyceride): 0.75 L mixture of equal volume of lipids No. 1/2 in chloroform solution;

    [0965] TG (triglyceride): 0.75 L lipid No. 15 in chloroform solution;

    [0966] LPC (Lysophosphatidylcholine): 0.75 L mixture of equal volume of lipids No. 36/37 in chloroform solution;

    [0967] PC (Lysophosphatidylcholine): 0.75 L lipid No. 12 in chloroform solution;

    [0968] Cer (Ceramides): 0.75 L lipid No. 4 in chloroform solution;

    [0969] So (Sphingoshine): 0.75 L lipid No. 31 in chloroform solution;

    [0970] FA (fatty acid): 0.75 L lipid No. 29;

    [0971] 2) Experimental conditions: the final concentration of HJT-sRNA-m7 was 100 nM. 24 hours after being added to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method (SYBR Green Universal dye method). For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [0972] Conclusions: The results indicated that the above single lipids and lipid combinations were effective in delivering nucleic acids into cells as compared to the free uptake group (see FIG. 50), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings.

    [0973] For A549, MRC-5 and Caco-2 cells, 2.25 L PC (No. 12) & PE (No. 8)+0.75 L DG (mixture of equal volume of lipids No. 1/2 in chloroform solutions) achieved the best efficiency of delivery.

    Example 1-4: Delivery of Single-Stranded Nucleic Acid into Cells by Lipid Combination

    [0974] Cell types: A549, MRC-5 and Caco-2 cells.

    [0975] 1. Experimental groups:

    [0976] 1) Naive group: untreated cell;

    [0977] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 100 nM;

    [0978] 3) Free uptake group: single-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [0979] 4) Treatment group of single lipid and nucleic acid: a mixture of 3 L single lipid (No. 8 or No. 12) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM;

    [0980] 5) Treatment group of lipid combination DG (No. 1) & PE (No. 8) & PC (No. 12) and nucleic acid mixture: a mixture of 3 L lipid combination (DG (No. 1) & PE (No. 8) & PC (No. 12), 1:1:1, V/V/V) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM;

    [0981] 6) Treatment group of lipid combination and nucleic acid mixture: a mixture of 3 L lipid combination (mixture of 2 L lipid combination DG (No. 1) & PE (No. 8) & PC (No. 12) and 1 L of the following types of lipids, DG, TG, LPC, PC, Cer, So or FA) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM. In FIG. 51, the mixture treatment groups correspond to the treatment groups within the horizontal line above 2 L lipid combination DG (No. 1) & PE (No. 8) & PC (No. 12))+1 L.

    [0982] 2. Experimental procedures

    [0983] 1) Boiling method conditions: to 100 L single-stranded HJT-sRNA-m7 solution was added 3 L single lipid (lipid No. 1 in chloroform solution having a concentration of 5 mg/mL, lipids No. 8/12 in chloroform solution having a concentration of 10 mg/mL) or lipid combination, and heated at 100 C. for 30 min;

    [0984] DG (diglyceride): 1 L mixture of equal volume of lipids No. 1/2 in chloroform solution;

    [0985] TG (triglyceride): 1 L lipid No. 15 in chloroform solution;

    [0986] LPC (Lysophosphatidylcholine): 1 L mixture of equal volume of lipids No. 36/37 in chloroform solution;

    [0987] PC (Lysophosphatidylcholine): 1 L lipid No. 12 in chloroform solution;

    [0988] Cer (Ceramides): 1 L lipid No. 4 in chloroform solution;

    [0989] So (Sphingoshine): 1 L lipid No. 31 in chloroform solution;

    [0990] FA (fatty acid): 1 L lipid No. 29;

    [0991] 2) Experimental conditions: the final concentration of HJT-sRNA-m7 was 100 nM. 24 hours after being added to the cells, the amount of HJT-sRNA-m7 was detected by RT-qPCR method (SYBR Green Universal dye method). For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [0992] Conclusions: The results indicated that the above lipid combinations were effective in delivering nucleic acids into cells as compared to the free uptake group (see FIG. 51), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings.

    [0993] For A549, MRC-5 and Caco-2 cells, 2 L DG (No. 1) & PE (No. 8) & PC (No. 12)+1 L TG (No. 15) achieved the best efficiency of delivery.

    Example 1-5: Delivery of Single-Stranded Nucleic Acid into Cell by Lipid Combination

    [0994] Cell types: A549, MRC-5 and Caco-2 cells.

    [0995] 1. Experimental groups:

    [0996] 1) Naive group: untreated cell;

    [0997] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 100 nM;

    [0998] 3) Free uptake group: single-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [0999] 4) Treatment group of single lipid and nucleic acid: a mixture of 3 L single lipid of No. 8 and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM;

    [1000] 5) Treatment group of lipid combination PE (No. 8) & MG (No. 34) and nucleic acid mixture: a mixture of 2.25 L lipid combination (PE (No. 8) & MG (No. 34), 2:1, V/V) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM;

    [1001] 6) Treatment group of lipid combination and nucleic acid mixture: a mixture of 3 L lipid combination (mixture of 2.25 L lipid combination PE (No. 8) & MG (No. 34) and 0.75 L of the following types of lipid, DG, TG, LPC, PC, Cer, So or FA) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM. In FIG. 52, the mixture treatment group corresponds to the treatment groups within the horizontal line above 2.25 L [lipid combination PE (No. 8) & MG (No. 34)]+0.75 L.

    [1002] 2. Experimental procedures

    [1003] 1) Boiling method conditions: to 100 L single-stranded HJT-sRNA-m7 solution was added single lipid (lipid No. 8 in chloroform solution having a concentration of 10 mg/mL) or lipid combination, and heated at 100 C. for 30 min;

    [1004] DG (diglyceride): 0.75 L mixture of equal volume of lipids No. 1/2 in chloroform solution;

    [1005] TG (triglyceride): 0.75 L lipid No. 15 in chloroform solution;

    [1006] LPC (Lysophosphatidylcholine): 0.75 L mixture of equal volume of lipids No. 36/37 in chloroform solution;

    [1007] PC (Lysophosphatidylcholine): 0.75 L lipid No. 12 in chloroform solution;

    [1008] Cer (Ceramides): 0.75 L lipid No. 4 in chloroform solution;

    [1009] So (Sphingoshine): 0.75 L lipid No. 31 in chloroform solution;

    [1010] FA (fatty acid): 0.75 L lipid No. 29;

    [1011] 2) Experimental conditions: the final concentration of HJT-sRNA-m7 was 100 nM. 24 hours after being added to the cells, the amount of HJT-sRNA-m7 that entered in to cells was detected by RT-qPCR method (SYBR Green Universal dye method). For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1012] Conclusions: The results indicated that the above single lipid and lipid combinations were effective in delivering nucleic acids into cells as compared to the free uptake group (see FIG. 52), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings.

    [1013] For A549, MRC-5 and Caco-2 cells, 2.25 L PE (No. 8) & MG (No. 34)+0.75 L So (No. 31) achieved the best efficiency of delivery.

    Example 1-6: Delivery of Single-Stranded Nucleic Acid into A549 Cells by Lipid Combination

    [1014] 1. Experimental groups:

    [1015] 1) Naive group: untreated A549 cell;

    [1016] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 100 nM;

    [1017] 3) Free uptake group: single-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1018] 4) Treatment group of single lipid and nucleic acid: a mixture of 3 L single lipid No. 38 and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cell, and mixed, and the final concentration of RNA was 100 nM;

    [1019] 5) Treatment group of lipid combination and nucleic acid mixture: a mixture of 3 L lipid combination (mixture of 2 L single lipid No. 38 and 1 L of the following types of lipid, MG, DG, TG, LPC, PC, PE, Cer, So or FA) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM;

    [1020] 2. Experimental procedures

    [1021] 1) Boiling method conditions: to 100 L single-stranded HJT-sRNA-m7 solution was added 3 L single lipid (lipid No. 38 in chloroform solution having a concentration of 10 mg/mL) or lipid combination, and heated at 100 C. for 30 min;

    [1022] MG (monoglyceride): 1 L lipid No. 34;

    [1023] DG (diglyceride): 1 L lipid No. 1 in chloroform solution;

    [1024] TG (triglyceride): 1 L lipid No. 15 in chloroform solution;

    [1025] LPC (Lysophosphatidylcholine): 1 L lipid No. 37 in chloroform solution;

    [1026] PC (Lysophosphatidylcholine): 1 L lipid No. 12 in chloroform solution;

    [1027] PE (phosphatidylethanolamine): 1 L lipid No. 8 in chloroform solution;

    [1028] Cer (Ceramides): 1 L lipid No. 4 in chloroform solution;

    [1029] So (Sphingoshine): 1 L lipid No. 31 in chloroform solution;

    [1030] FA (fatty acid): 1 L lipid No. 29 in chloroform solution;

    [1031] 2) Experimental conditions: the final concentration of HJT-sRNA-m7 was 100 nM. 24 hours after being added to the cell, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method (SYBR Green Universal dye method). For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1032] Conclusions: The results indicated that for A549 cells, the above 2 L single lipid No. 38 and 1 L LPC (No. 37), TG (No. 15), PC (No. 12), DG (No. 1) were effective in delivering nucleic acids into cells as compared to the free uptake group (see FIG. 53).

    Example 1-7: Delivery of Single-Stranded Nucleic Acid into A549 Cells by Lipid Combination

    [1033] 1. Experimental groups:

    [1034] 1) Naive group: untreated A549 cell;

    [1035] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 100 nM;

    [1036] 3) Free uptake group: single-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1037] 4) Treatment group of lipid combination DG (No. 1) & PE (No. 38) & PC (No. 12) and nucleic acid mixture: a mixture of 3 L lipid combination (DG (No. 1) & PE (No. 38) & PC (No. 12), 1:1:1, V/V/V) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM;

    [1038] 5) Treatment group of lipid combination and nucleic acid mixture: a mixture of 3 L lipid combination (mixture of 2 L lipid combination DG (No. 1) & PE (No. 38) & PC (No. 12) and 1 L of the following types of lipid, MG, TG, LPC, PE, Cer, So or FA) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM.

    [1039] 2. Experimental procedures

    [1040] 1) Boiling method conditions: to 100 L single-stranded HJT-sRNA-m7 solution was added 3 L lipid combination, and heated at 100 C. for 30 min;

    [1041] MG (monoglyceride): 1 L lipid No. 34;

    [1042] TG (triglyceride): 1 L lipid No. 15 in chloroform solution;

    [1043] LPC (Lysophosphatidylcholine): 1 L lipid No. 37 in chloroform solution;

    [1044] PE (phosphatidylethanolamine): 1 L lipid No. 8 in chloroform solution;

    [1045] Cer (Ceramides): 1 L lipid No. 4 in chloroform solution;

    [1046] So (Sphingoshine): 1 L lipid No. 31 in chloroform solution;

    [1047] FA (fatty acid): 1 L lipid No. 29 in chloroform solution;

    [1048] 2) Experimental conditions: the final concentration of HJT-sRNA-m7 was 100 nM. 24 hours after being added to the cells, the amount of HJT-sRNA-m7 was detected by RT-qPCR method (SYBR Green Universal dye method). For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1049] Conclusions: The results indicated that the above 2 L lipid combination DG (No. 1) & PE (No. 38) & PC (No. 12) and 1 L TG (No. 15), Cer (No. 4), So (No. 31), FA (No. 29), LPC (No. 37), PE (No. 8) were all effective in delivering nucleic acids into A549 cells as compared to the free uptake group (see FIG. 54), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings.

    Example 1-8: Delivery of Single-Stranded Nucleic Acid into A549 Cells by Lipid Combination

    [1050] 1. Experimental groups:

    [1051] 1) Naive group: untreated A549 cell;

    [1052] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 100 nM;

    [1053] 3) Free uptake group: single-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1054] 4) Treatment group of lipid combination PE (No. 38) & MG (No. 34) and nucleic acid mixture: a mixture of 3 L lipid combination (PE (No. 38) & MG (No. 34), 2:1, V/V) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM;

    [1055] 5) Treatment group of lipid combination and nucleic acid mixture: a mixture of 3 L lipid combination (mixture of 2 L lipid combination PE (No. 38) & MG (No. 34) and 1 L of the following types of lipid, DG, TG, LPC, PC, PE, Cer, So or FA) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells and mixed, and the final concentration of RNA was 100 nM;

    [1056] 2. Experimental procedures

    [1057] 1) Boiling method conditions: to 100 L single-stranded HJT-sRNA-m7 solution was added 3 L lipid combination, and heated at 100 C. for 30 min;

    [1058] DG (diglyceride): 1 L lipid No. 1 in chloroform solution;

    [1059] TG (triglyceride): 1 L lipid No. 15 in chloroform solution;

    [1060] LPC (Lysophosphatidylcholine): 1 L lipid No. 37 in chloroform solution;

    [1061] PC (phosphatidylcholine): 1 L lipid No. 12 in chloroform solution;

    [1062] PE (phosphatidylethanolamine): 1 L lipid No. 8 in chloroform solution;

    [1063] Cer (Ceramides): 1 L lipid No. 4 in chloroform solution;

    [1064] So (Sphingoshine): 1 L lipid No. 31 in chloroform solution;

    [1065] FA (fatty acid): 1 L lipid No. 29 in chloroform solution;

    [1066] 2) Experimental conditions: the final concentration of HJT-sRNA-m7 was 100 nM. 24 hours after being added to the cells, the amount of HJT-sRNA-m7 was detected by RT-qPCR method (SYBR Green Universal dye method). For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1067] Conclusions: The results indicated that the above lipid combinations were all effective in delivering nucleic acids into cells (see FIG. 55), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings, wherein 2 L lipid combination PE (No. 38) & MG (No. 34) and 1 L LPC (No. 37) achieved the best delivery effect.

    Example 1-9: Delivery of Single-Stranded Nucleic Acid into A549 Cells by Lipid Combination

    [1068] 1. Experimental groups:

    [1069] 1) Naive group: untreated cell;

    [1070] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 100 nM;

    [1071] 3) Free uptake group: single-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1072] 4) Treatment group of lipid combination PE (No. 38) & PC (No. 12) and nucleic acid mixture: a mixture of 3 L lipid combination (PE (No. 38) & PC (No. 12), 2:1, V/V) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1073] 5) Treatment group of lipid combination and nucleic acid mixture: a mixture of 3 L lipid combination (mixture of 2 L lipid combination PE (No. 38) & PC (No. 12) and 1 L of the following types of lipid, MG, DG, TG, LPC, PE, Cer, So or FA) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1074] 2. Experimental procedures

    [1075] 1) Boiling method conditions: to 100 L single-stranded HJT-sRNA-m7 solution was added 3 L lipid combination, and heated at 100 C. for 30 min;

    [1076] MG (monoglyceride): 1 L lipid No. 34;

    [1077] DG (diglyceride): 1 L lipid No. 1 in chloroform solution;

    [1078] TG (triglyceride): 1 L lipid No. 15 in chloroform solution;

    [1079] LPC (Lysophosphatidylcholine): 1 L lipid No. 37 in chloroform solution;

    [1080] PE (phosphatidylethanolamine): 1 L lipid No. 8 in chloroform solution;

    [1081] Cer (Ceramides): 1 L lipid No. 4 in chloroform solution;

    [1082] So (Sphingoshine): 1 L lipid No. 31 in chloroform solution;

    [1083] FA (fatty acid): 1 L lipid No. 29;

    [1084] 2) Experimental conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after being added to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method (SYBR Green Universal dye method). For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1085] Conclusions: The results indicated that the above lipid combinations were effective in delivering nucleic acids into cells (see FIG. 56), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings, wherein 2 L lipid combination PE (No. 38) & PC (No. 12) and 1 L Cer (No. 4) achieved the best effect.

    Example 1-10: Delivery of Single-Stranded Nucleic Acid into A549 Cells by Lipid Combination

    [1086] 1. Experimental groups:

    [1087] 1) Naive group: untreated cell;

    [1088] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 100 nM;

    [1089] 3) Free uptake group: single-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1090] 4) Treatment group of lipid combination PE (No. 38) & PC (No. 12) & DG (No. 1) & TG (No. 15) and nucleic acid mixture: a mixture of 3 L lipid combination (PE (No. 38) & PC (No. 12) & DG (No. 1) & TG (No. 15), 2:2:2:3, V/V/V/V) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1091] 5) Treatment group of lipid combination and nucleic acid mixture: a mixture of 3 L lipid combination (mixture of 2.2 L lipid combination PE (No. 38) & PC (No. 12) & DG (No. 1) & TG (No. 15) and 0.8 L of the following types of lipid, MG, LPC, Cer, So or FA) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM.

    [1092] 2. Experimental procedures

    [1093] 1) Boiling method conditions: to 100 L single-stranded HJT-sRNA-m7 solution was added 3 L lipid combination, and heated at 100 C. for 30 min;

    [1094] MG (monoglyceride): 0.8 L lipid No. 34;

    [1095] LPC (Lysophosphatidylcholine): 0.8 L lipid No. 37 in chloroform solution;

    [1096] Cer (Ceramides): 0.8 L lipid No. 4 in chloroform solution;

    [1097] So (Sphingoshine): 0.8 L lipid No. 31 in chloroform solution;

    [1098] FA (fatty acid): 0.8 L lipid No. 29;

    [1099] 2) Experimental conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method (SYBR Green Universal dye method). For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1100] Conclusions: The results indicated that the above lipid combinations were effective in delivering nucleic acids into cells (see FIG. 57), wherein 2.2 L lipid combination PE (No. 38) & PC (No. 12) & DG (No. 1) & TG (No. 15), 2.2 L lipid combination PE (No. 38) & PC (No. 12) & DG (No. 1) & TG (No. 15) and 0.8 L LPC (No. 37) or So (No. 31) achieved relative better efficiency of delivery.

    Example 1-11: Delivery of Single-Stranded Nucleic Acid into A549 Cells by Lipid Combination

    [1101] 1. Experimental groups:

    [1102] 1) Naive group: untreated cell;

    [1103] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 100 nM;

    [1104] 3) Free uptake group: single-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1105] 4) Treatment group of lipid combination PE (No. 38) & MG (No. 34) & LPC (No. 37) and nucleic acid mixture: a mixture of 3 L lipid combination (PE (No. 38) & MG (No. 34) & LPC (No. 37), 4:2:3, V/V/V) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1106] 5) Treatment group of lipid combination and nucleic acid mixture: a mixture of 3

    [1107] L lipid combination (mixture of 2.2 L lipid combination PE (No. 38) & MG (No. 34) & LPC (No. 37) and 0.8 L of the following types of lipid, DG, TG, PC, Cer, or So) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1108] 2. Experimental procedures

    [1109] 1) Boiling method conditions: to 100 L single-stranded HJT-sRNA-m7 solution was added 3 L lipid combination, and heated at 100 C. for 30 min;

    [1110] DG (diglyceride): 0.8 L lipid No. 1 in chloroform solution;

    [1111] TG (triglyceride): 0.8 L lipid No. 15 in chloroform solution;

    [1112] PC (phosphatidylcholine): 0.8 L lipid No. 12 in chloroform solution;

    [1113] Cer (Ceramides): 0.8 L lipid No. 4 in chloroform solution;

    [1114] So (Sphingoshine): 0.8 L lipid No. 31 in chloroform solution;

    [1115] 2) Experimental conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method (SYBR Green Universal dye method). For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1116] Conclusions: The results indicated that the above lipid combinations were effective in delivering nucleic acids into cells (see FIG. 58), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings.

    Example 1-12: Delivery of Single-Stranded Nucleic Acid into A549 Cells by Lipid Combination

    [1117] 1. Experimental groups:

    [1118] 1) Naive group: untreated cell;

    [1119] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 100 nM;

    [1120] 3) Free uptake group: single-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1121] 4) Treatment group of lipid combination PE (No. 38) & PC (No. 12) & Cer (No. 4) and nucleic acid mixture: a mixture of 3 L lipid combination (PE (No. 38) & PC (No. 12) & Cer (No. 4), 4:2:3, V/V/V) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1122] 5) Treatment group of lipid combination and nucleic acid mixture: a mixture of 3 L lipid combination (mixture of 2.2 L lipid combination PE (No. 38) & PC (No. 12) & Cer (No. 4) and 0.8 L of the following types of lipid, MG, DG, TG, LPC, So or FA) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM.

    [1123] 2. Experimental procedures

    [1124] 1) Boiling method conditions: to 100 L single-stranded HJT-sRNA-m7 solution was added 3 L lipid combination, and heated at 100 C. for 30 min;

    [1125] MG (monoglyceride): 0.8 L lipid No. 34;

    [1126] DG (diglyceride): 0.8 L lipid No. 1 in chloroform solution;

    [1127] TG (triglyceride): 0.8 L lipid No. 15 in chloroform solution;

    [1128] LPC (lysophosphatidylcholine): 0.8 L lipid No. 37 in chloroform solution;

    [1129] So (Sphingoshine): 0.8 L lipid No. 31 in chloroform solution;

    [1130] FA (fatty acid): 0.8 L lipid No. 29 in chloroform solution;

    [1131] 2) Experimental conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method (SYBR Green Universal dye method). For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1132] Conclusions: The results indicated that the above lipid combinations were effective in delivering nucleic acids into cells (see FIG. 59), wherein 2.2 L lipid combination PE (No. 38) & PC (No. 12) & Cer (No. 4) and 0.8 L FA (No. 29) achieved the best efficiency of delivery.

    Example 1-13: Delivery of Single-Stranded Nucleic Acid into A549 Cells by Lipid Combination

    [1133] 1. Experimental groups:

    [1134] 1) Naive group: untreated cell;

    [1135] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 100 nM;

    [1136] 3) Free uptake group: single-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1137] 4) Treatment group of lipid combination PE (No. 38) & PC (No. 12) & Cer (No. 4) & FA (No. 29) and nucleic acid mixture: a mixture of 3 L lipid combination (PE (No. 38) & PC (No. 12) & Cer (No. 4) & FA (No. 29), 44:22:33:36, V/V/V/V) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1138] 5) Treatment group of lipid combination and nucleic acid mixture: a mixture of 3 L lipid combination (mixture of PE (No. 38) & PC (No. 12) & Cer (No. 4) & FA (No. 29) and 1 L of the following types of lipid) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM.

    [1139] 2. Experimental procedures

    [1140] 1) Boiling method conditions: to 100 L single-stranded HJT-sRNA-m7 solution was added 3 L lipid combination, and heated at 100 C. for 30 min;

    [1141] MG (monoglyceride): 1 L lipid No. 34;

    [1142] DG (diglyceride): 1 L lipid No. 1 in chloroform solution;

    [1143] TG (triglyceride): 1 L lipid No. 15 in chloroform solution;

    [1144] LPC (lysophosphatidylcholine): 1 L lipid No. 37 in chloroform solution;

    [1145] So (Sphingoshine): 1 L lipid No. 31 in chloroform solution;

    [1146] 2) Experimental conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method (SYBR Green Universal dye method). For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1147] Conclusions: The results indicated that the above lipid combinations were effective in delivering nucleic acids into cells (see FIG. 60), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings.

    Example 1-14: Delivery of Single-Stranded Nucleic Acid into A549 Cells by Lipid Combination

    [1148] 1. Experimental groups:

    [1149] 1) Naive group: untreated cell;

    [1150] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 100 nM;

    [1151] 3) Free uptake group: single-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1152] 4) Treatment group of lipid combination PE (No. 38) & PC (No. 12) & So (No. 31) and nucleic acid mixture: a mixture of 3 L lipid combination (PE (No. 38) & PC (No. 12) & So (No. 31), 2:1:3, V/V/V) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1153] 5) Treatment group of lipid combination and nucleic acid mixture: a mixture of 3 L lipid combination (mixture of 2 L PE (No. 38) & PC (No. 12) & So (No. 31) and 1 L of the following types of lipid, MG, DG, TG, LPC, Cer or FA) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM.

    [1154] 2. Experimental procedures

    [1155] 1) Boiling method conditions: to 100 L Single-stranded HJT-sRNA-m7 solution was added 3 L lipid combination, and heated at 100 C. for 30 min;

    [1156] DG (diglyceride): 1 L lipid No. 1 in chloroform solution;

    [1157] TG (triglyceride): 1 L lipid No. 15 in chloroform solution;

    [1158] PC (phosphatidylcholine): 1 L lipid No. 12 in chloroform solution;

    [1159] Cer (Ceramides): 1 L lipid No. 4 in chloroform solution;

    [1160] FA (fatty acid): 1 L lipid No. 29 in chloroform solution;

    [1161] 2) Experimental conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method (SYBR Green Universal dye method). For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1162] Conclusions: The results indicated that the above lipid combinations were effective in delivering nucleic acids into cells (see FIG. 61), wherein 2 L lipid combination PE (No. 38) & PC (No. 12) & So (No. 31) and 1 L FA (No. 29) achieved the best delivery effect.

    Example 1-15: Delivery of Single-Stranded Nucleic Acid into A549 Cells by Lipid Combination

    [1163] 1. Experimental groups:

    [1164] 1) Naive group: untreated cell;

    [1165] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 100 nM;

    [1166] 3) Free uptake group: single-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1167] 4) Treatment group of lipid combination PE (No. 38) & MG (No. 34) & LPC (No. 37) & So (No. 31) and nucleic acid mixture: a mixture of 3 L lipid combination (PE (No. 38) & MG (No. 34) & LPC (No. 37) & So (No. 31), 44:22:33:36, V/V/V/V) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1168] 5) Treatment group of lipid combination and nucleic acid mixture: a mixture of 3 L lipid combination (mixture of 2 L PE (No. 38) & MG (No. 34) & LPC (No. 37) & So (No. 31) and 1 L of the following types of lipid, DG, TG, PC, Cer or FA) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM.

    [1169] 2. Experimental procedures

    [1170] 1) Boiling method conditions: to 100 L single-stranded HJT-sRNA-m7 solution was added 3 L lipid combination, and heated at 100 C. for 30 min;

    [1171] DG (diglyceride): 1 L lipid No. 1 in chloroform solution;

    [1172] TG (triglyceride): 1 L lipid No. 15 in chloroform solution;

    [1173] PC (phosphatidylcholine): 1 L lipid No. 12 in chloroform solution;

    [1174] Cer (Ceramides): 1 L lipid No. 4 in chloroform solution;

    [1175] FA (fatty acid): 1 L lipid No. 29 in chloroform solution;

    [1176] 2) Experiment conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method (SYBR Green Universal dye method). For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1177] Conclusions: The results indicated that as compared to the free uptake group, the addition of 1 L DG (No. 1), TG (No. 15), PC (No. 12), Cer (No. 4) or FA (No. 29) to 2 LPE (No. 38) & MG (No. 34) & LPC (No. 37) & So (No. 31), could efficiently deliver nucleic acids into cells (see FIG. 62), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings. The addition of 1 L PC (No. 12) achieved the best efficiency in nucleic acid delivery and could enhance the efficiency of delivery.

    Example 1-16: Delivery of Single-Stranded Nucleic Acid into A549 Cells by Lipid Combination

    [1178] 1. Experimental groups:

    [1179] 1) Naive group: untreated cell;

    [1180] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 100 nM;

    [1181] 3) Free uptake group: single-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1182] 4) Treatment group of lipid combination PE (No. 38) & LPC (No. 37) and nucleic acid mixture: a mixture of 3 L lipid combination (PE (No. 38) & LPC (No. 37), 2:1, V/V) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1183] 5) Treatment group of lipid combination and nucleic acid mixture: a mixture of 3 L lipid combination (mixture of 2 L PE (No. 38) & LPC (No. 37) and 1 L of the following types of lipid, MG, DG, TG, PC, Cer, So or FA) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1184] 2. Experimental procedures

    [1185] 1) Boiling method conditions: to 100 L single-stranded HJT-sRNA-m7 solution was added 3 L lipid combination, and heated at 100 C. for 30 min;

    [1186] MG (monoglyceride): 1 L lipid No. 34;

    [1187] DG (diglyceride): 1 L lipid No. 1 in chloroform solution;

    [1188] TG (triglyceride): 1 L lipid No. 15 in chloroform solution;

    [1189] PC (phosphatidylcholine): 1 L lipid No. 12 in chloroform solution;

    [1190] Cer (Ceramides): 1 L lipid No. 4 in chloroform solution;

    [1191] So (Sphingoshine): 1 L lipid No. 31 in chloroform solution;

    [1192] FA (fatty acid): 1 L lipid No. 29 in chloroform solution;

    [1193] 2) Experiment conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method (SYBR Green Universal dye method). For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1194] Conclusions: The results indicated that as compared to the free uptake group, the above lipid combinations were effective in delivering nucleic acids into cells (see FIG. 63), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings. The addition of 1 L TG (No. 15) to 2 L lipid combination PE (No. 38) & LPC (No. 37) achieved the best effect in nucleic acid delivery.

    Example 1-17: Delivery of Single-Stranded Nucleic Acid into A549 Cells by Lipid Combination

    [1195] 1. Experimental groups:

    [1196] 1) Naive group: untreated cell;

    [1197] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 100 nM;

    [1198] 3) Free uptake group: single-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1199] 4) Treatment group of lipid combination PE (No. 38) & LPC (No. 37) & TG (No. 15) and nucleic acid mixture: a mixture of 3 L lipid combination (PE (No. 38) & LPC (No. 37) & TG (No. 15), 32:8:5, V/V/V) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1200] 5) Treatment group of lipid combination and nucleic acid mixture: a mixture of 3 L lipid combination (mixture of 2 L PE (No. 38) & LPC (No. 37) & TG (No. 15) and 1 L of the following types of lipid, MG, DG, PC, Cer, So or FA) and the HJT-sRNA-m7 single-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1201] 2. Experimental procedures

    [1202] 1) Boiling method conditions: to 100 L single-stranded HJT-sRNA-m7 solution was added 3 L lipid combination, and heated at 100 C. for 30 min;

    [1203] MG (monoglyceride): 1 L lipid No. 34;

    [1204] DG (diglyceride): 1 L lipid No. 1 in chloroform solution;

    [1205] PC (phosphatidylcholine): 1 L lipid No. 12 in chloroform solution;

    [1206] Cer (Ceramides): 1 L lipid No. 4 in chloroform solution;

    [1207] So (Sphingoshine): 1 L lipid No. 31 in chloroform solution;

    [1208] FA (fatty acid): 1 L lipid No. 29 in chloroform solution;

    [1209] 2) Experiment conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method (SYBR Green Universal dye method). For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1210] Conclusions: The results indicated that the above lipid combinations were effective in delivering nucleic acids into cells (see FIG. 64), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings. The lipid combination PE (No. 38) & LPC (No. 37) & TG (No. 15) efficiently delivered nucleic acids into cells. Further addition of other types of lipid to the lipid combination PE (No. 38) & LPC (No. 37) & TG (No. 15) did not enhance this effect.

    Example 2-1: Delivery of Double-Stranded Nucleic Acid into MRC-5 Cells by Lipid Combination

    [1211] 1. Experimental groups:

    [1212] 1) Naive group: untreated cell;

    [1213] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and double-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of double-stranded HJT-sRNA-m7 was 100 nM;

    [1214] 3) Free uptake group: double-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1215] 4) Treatment group of single lipid and nucleic acid: a mixture of 3 L single lipid No. 38 and the HJT-sRNA-m7 double-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1216] 5) Treatment group of lipid combination and nucleic acid mixture: a mixture of 3 L lipid combination (mixture of 2 L single lipid No. 38 and 1 L lipid No. 8, 1, 2, 11, 12, 34, 37, 4, 30, 31, 29, 32, 1+2 (mixed in equal volume) or 11+12 (mixed in equal volume) in chloroform solution) and the HJT-sRNA-m7 double-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1217] 2. Experimental procedures

    [1218] 1) Boiling method conditions: to 100 L double-stranded HJT-sRNA-m7 solution was added 3 L single lipid (lipid No. 38 in chloroform solution having a concentration of 10 mg/mL) or lipid combination, and heated at 100 C. for 30 min;

    [1219] 2) Experiment conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method (SYBR Green Universal dye method). For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1220] Conclusions: The results indicated that the above single lipids and lipid combinations were effective in delivering nucleic acids into cells (see FIG. 65), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings. The single lipid No. 38 effectively delivered nucleic acids into MRC-5 cells, showing an effect close to the transfection reagent RNAiMAX. The addition of other lipids to it did not further enhance the effect.

    Example 2-2: Delivery of Double-Stranded Nucleic Acid into MRC-5 Cells by Lipid Combination

    [1221] 1. Experimental groups:

    [1222] 1) Naive group: untreated cell;

    [1223] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and double-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of double-stranded HJT-sRNA-m7 was 100 nM;

    [1224] 3) Free uptake group: double-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1225] 4) Treatment group of lipid combination (No. 38 & No. 37, 2:1, V/V) and nucleic acid: a mixture of 3 L lipid combination and the HJT-sRNA-m7 double-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1226] 5) Treatment group of lipid combination and nucleic acid mixture: a mixture of 3 L lipid combination (mixture of 2 L lipid combination No. 38 & No. 37 and 1 L lipid No. 8, 1, 2, 11, 12, 34, 37, 4, 30, 31, 29, 32, 1+2 (mixed in equal volume) or 11+12 (mixed in equal volume) in chloroform solution) and the HJT-sRNA-m7 double-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1227] 2. Experimental procedures

    [1228] 1) Boiling method conditions: to 100 L double-stranded HJT-sRNA-m7 solution was added to 3 L lipid combination, and heated at 100 C. for 30 min;

    [1229] 2) Experiment conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method (SYBR Green Universal dye method). For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1230] Conclusions: The results indicated that the above single lipids and lipid combinations were effective in delivering nucleic acids into cells (see FIG. 66), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings. Lipid No. 38 & No. 37 mixture efficiently delivered nucleic acids into MRC-5 cells. To addition of 1 L lipids, except No. 11 and 34, to 2 L No. 38 & No. 37 mixture could enhance this effect. In addition, unexpectedly, the addition of 1 L lipid No. 32 to 2 L No. 38 & No37 mixture achieved the best effect, even better than the effect of RNAiMAX.

    Example 2-3: Delivery of Double-Stranded Nucleic Acid into A549 Cells by Lipid Combination

    [1231] 1. Experimental groups:

    [1232] 1) Naive group: untreated cell;

    [1233] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and double-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of double-stranded HJT-sRNA-m7 was 100 nM;

    [1234] 3) Free uptake group: double-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1235] 4) Treatment group of lipid combination (PE (No. 38) & PC (No. 12) & Cer (No. 4)) and nucleic acid: a mixture of 3 L lipid combination (PE (No. 38) & PC (No. 12) & Cer (No. 4), 4:2:3, V/V/V) and the HJT-sRNA-m7 double-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1236] 5) Treatment group of lipid combination and nucleic acid mixture: a mixture of 3 L lipid combination (mixture of 2.5 L PE (No. 38) & PC (No. 12) & Cer (No. 4) and 0.5 L lipids (DG (No. 2), TG (No. 6), So (No. 17), FA (No. 29), MG (No. 34) and LPC (No. 37)) and the HJT-sRNA-m7 double-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1237] 2. Experimental procedures

    [1238] 1) Boiling method conditions: to 100 L HJT-sRNA-m7 double-stranded solution was added 3 L lipid combination, and heated at 100 C. for 30 min;

    [1239] 2) Experiment conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method (SYBR Green Universal dye method). For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1240] Conclusions: The results indicated that the above single lipids and lipid combinations were effective in delivering nucleic acids into cells (see FIG. 67), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings. The addition of 1/5 LPC (No. 37) to PE (No. 38) & PC (No. 12) & Cer (No. 4) mixture could significantly enhance the effect in delivery of the nucleic acid. In addition, the addition of DG (No. 2) and TG (No. 16) could also further enhance the effect in delivery.

    Example 2-4: Delivery of Double-Stranded Nucleic Acid into A549 Cells by Lipid Combination

    [1241] 1. Experimental groups:

    [1242] 1) Naive group: untreated cell;

    [1243] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and double-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of double-stranded HJT-sRNA-m7 was 100 nM;

    [1244] 3) Free uptake group: double-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1245] 4) Treatment group of lipid combination (PE (No. 38) & DG (No. 2)) and nucleic acid: a mixture of 3 L lipid combination (PE (No. 38) & DG (No. 2), 2:1, V/V) and the HJT-sRNA-m7 double-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1246] 5) Treatment group of lipid combination and nucleic acid mixture: a mixture of 3 L lipid combination (mixture of 2 L PE (No. 38) & DG (No. 2) mixture and 1 L other lipid of No. 37, 31, 29, 34, 12 or 4) and the HJT-sRNA-m7 double-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1247] 2. Experimental procedures

    [1248] 1) Boiling method conditions: to 100 L double-stranded HJT-sRNA-m7 solution was added 3 L lipid combination, and heated at 100 C. for 30 min;

    [1249] 2) Experiment conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method (SYBR Green Universal dye method). For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1250] Conclusions: The results indicated that the above single lipids and lipid combinations were effective in delivering nucleic acids into cells (see FIG. 68), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings. Lipid combination (2 L PE (No. 38) & DG (No. 2) mixture) could effectively deliver the double stranded nucleic acid into the A549 cells. As compared with this lipid combination, the lipid combination of 2 L PE (No. 38) & DG (No. 2) and No. 37, 31, 12 or 4 mixed at a ratio of 2:1 could enhance the efficiency of delivery.

    Example 2-5: Delivery of Double-Stranded Nucleic Acid into A549 Cells by Lipid Combination

    [1251] 1. Experimental groups:

    [1252] 1) Naive group: untreated cell;

    [1253] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and double-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of double-stranded HJT-sRNA-m7 was 100 nM;

    [1254] 3) Free uptake group: double-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1255] 4) A mixture of lipid combination (PE (No. 38) & LPC (No. 37), 4:1, V/V) and the HJT-sRNA-m7 double-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1256] 2. Experimental procedures

    [1257] 1) Boiling method conditions: to 100 L double-stranded HJT-sRNA-m7 solution was added 3 L lipid combination, and heated at 70 C. for 30 min;

    [1258] 2) Experiment conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method. For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1259] Conclusions: The results indicated that the above lipid combinations were effective in delivering nucleic acids into cells (see FIG. 69), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings, with an effect close to the transfection reagent RNAiMAX.

    Example 2-6: Delivery of Double-Stranded Nucleic Acid into A549 Cells by Lipid Combination

    [1260] 1. Experimental groups:

    [1261] 1) Naive group: untreated cell;

    [1262] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and double-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of double-stranded HJT-sRNA-m7 was 100 nM;

    [1263] 3) Free uptake group: double-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1264] 4) A mixture of lipid combination (PE (No. 38) & PC (No. 12), 4:1, V/V) and the HJT-sRNA-m7 double-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1265] 2. Experimental procedures

    [1266] 1) Boiling method conditions: to 100 L double-stranded HJT-sRNA-m7 solution was added 3 L lipid combination, and heated at 70 C. for 30 min;

    [1267] 2) Experiment conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method. For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1268] Conclusions: The results indicated that the above lipid combinations were effective in delivering nucleic acids into cells (see FIG. 70), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings. The effect is better than or the same as that of RNAiMAX.

    Example 2-7: Delivery of Double-Stranded Nucleic Acid into A549 Cells by Lipid Combination

    [1269] 1. Experimental groups:

    [1270] 1) Naive group: untreated cell;

    [1271] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and double-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of double-stranded HJT-sRNA-m7 was 100 nM;

    [1272] 3) Free uptake group: double-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1273] 4) A mixture of lipid combination (PE (No. 38) & PC (No. 12) & DG (No. 2), 4:1:5, V/V/V) and the double-stranded HJT-sRNA-m7 nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1274] 2. Experimental procedures

    [1275] 1) Boiling method conditions: to 100 L double-stranded HJT-sRNA-m7 solution was added 2 L lipid combination, and heated at 80 C. for 30 min;

    [1276] 2) Experiment conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method. For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1277] Conclusions: The results indicated that the above lipid combinations were effective in delivering nucleic acids into cells (see FIG. 71), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings. Lipid combination (PE (No. 38) & PC (No. 12) & DG (No. 2), 4:1:5, V/V/V) showed better effect in the delivery of double-stranded nucleic acid into A549 cells than RNAiMAX.

    Example 2-8: Delivery of Double-Stranded Nucleic Acid into A549 Cells by Lipid Combination

    [1278] 1. Experimental groups:

    [1279] 1) Naive group: untreated cell;

    [1280] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and double-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of double-stranded HJT-sRNA-m7 was 100 nM;

    [1281] 3) Free uptake group: double-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1282] 4) A mixture of lipid combination (PE (No. 38) & LPC (No. 37) & DG (No. 2), 32:8:5, V/V/V) and the HJT-sRNA-m7 double-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1283] 2. Experimental procedures

    [1284] 1) Boiling method conditions: to 100 L double-stranded HJT-sRNA-m7 solution was added 2 L lipid combination, and heated at 80 C. for 30 min;

    [1285] 2) Experiment conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method. For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1286] Conclusions: The results indicated that the above lipid combinations were effective in delivering nucleic acids into cells (see FIG. 72), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings. The effect was similar to that of RNAiMAX.

    Example 2-9: Delivery of Double-Stranded Nucleic Acid into A549 Cells by Lipid Combination

    [1287] 1. Experimental groups:

    [1288] 1) Naive group: untreated cell;

    [1289] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and double-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of double-stranded HJT-sRNA-m7 was 100 nM;

    [1290] 3) Free uptake group: double-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1291] 4) A mixture of lipid combination (PE (No. 8) & PC (No. 12), 1:2, V/V) and the HJT-sRNA-m7 double-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1292] 2. Experimental procedures

    [1293] 1) Boiling method conditions: to 100 L double-stranded HJT-sRNA-m7 solution was added to 2 L lipid combination, and heated at 80 C. for 30 min;

    [1294] 2) Experiment conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method. For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1295] Conclusions: The results indicated that the above lipid combinations were effective in delivering nucleic acids into cells (see FIG. 73), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings. Lipid combination (PE (No. 8) & PC (No. 12), 1:2, V/V) showed better effect in the delivery of double-stranded nucleic acid into A549 cells than RNAiMAX.

    Example 2-10: Delivery of Double-Stranded Nucleic Acid into A549 Cells by Lipid Combination

    [1296] 1. Experimental groups:

    [1297] 1) Naive group: untreated cell;

    [1298] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and double-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of double-stranded HJT-sRNA-m7 was 100 nM;

    [1299] 3) Free uptake group: double-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1300] 4) A mixture of lipid combination (PE (No. 8) & LPC (No. 37), 4:1, V/V) and the HJT-sRNA-m7 double-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1301] 2. Experimental procedures

    [1302] 1) Boiling method conditions: to 100 L double-stranded HJT-sRNA-m7 solution was added 2 L lipid combination, and heated at 80 C. for 30 min;

    [1303] 2) Experiment conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method. For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1304] Conclusions: The results indicated that the above lipid combinations were effective in delivering nucleic acids into cells (see FIG. 74), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings.

    Example 2-11: Delivery of Double-Stranded Nucleic Acid into MRC-5 Cells by Lipid Combination

    [1305] 1. Experimental groups:

    [1306] 1) Naive group: untreated cell;

    [1307] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and double-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of double-stranded HJT-sRNA-m7 was 100 nM;

    [1308] 3) Free uptake group: double-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1309] 4) A mixture of Lipid combination (PE (No. 8) & PC (No. 12), 1:2, V/V) and the HJT-sRNA-m7 double-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1310] 5) Treatment group of lipid combination and double-stranded HJT-sRNA-m7 mixture: a mixture of 3 L lipid combination (mixture of 2 L PE (No. 8) & PC (No. 12) and 1 L other type of lipids(MG (No. 34), DG (No. 2), TG (No. 32), LPC (No. 37), PC (No. 11), PE (No. 38), Cer (No. 4), So (No. 31) or FA (No. 29)) and the double-stranded HJT-sRNA-m7 nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1311] 2. Experimental procedures

    [1312] 1) Boiling method conditions: to 100 L double-stranded HJT-sRNA-m7 solution was added to 3 L lipid combination, and heated at 80 C. for 30 min;

    [1313] 2) Experiment conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method. For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1314] Conclusions: The results indicated that the above lipid combinations were effective in delivering nucleic acids into cells (see FIG. 75), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings. PE (No. 8) & PC (No. 12) could effectively deliver nucleic acids into cells with significantly better effect than RNAiMAX. Compared to PE (No. 8) & PC (No. 12), a mixture of PE (No. 8) & PC (No. 12) and Cer (No. 4) or PE (No. 38) at a ratio of 2:1 could enhance this effect.

    Example 2-12: Delivery of Double-Stranded Nucleic Acid into MRC-5 Cells by Lipid Combination

    [1315] 1. Experimental groups:

    [1316] 1) Naive group: untreated cell;

    [1317] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and double-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of double-stranded HJT-sRNA-m7 was 100 nM;

    [1318] 3) Free uptake group: double-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1319] 4) A mixture of lipid combination (PE (No. 8) & PC (No. 12) &DG (No. 2), 8:16:3, V/V/V) and the HJT-sRNA-m7 double-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1320] 5). Experimental procedures

    [1321] 1) Boiling method conditions: to 100 L double-stranded HJT-sRNA-m7 solution was added 2 L lipid combination, and heated at 80 C. for 30 min;

    [1322] 2) Experiment conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method. For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1323] Conclusions: The results indicated that as compared with the free uptake group and RNAiMAX group, the lipid combination (PE (No. 8) & PC (No. 12) &DG (No. 2), 8:16:3, V/V/V) showed better effect in delivery than RNAiMAX (see FIG. 76), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings.

    Example 2-13: Delivery of Double-Stranded Nucleic Acid into MRC-5 Cells by Lipid Combination

    [1324] 1. Experimental groups:

    [1325] 1) Naive group: untreated cell;

    [1326] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and double-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of double-stranded HJT-sRNA-m7 was 100 nM;

    [1327] 3) Free uptake group: double-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1328] 4) A mixture of lipid combination and the HJT-sRNA-m7 double-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1329] Mixture 1: PE (No. 8):LPC (No. 37):TG (No. 32)-4:1:2

    [1330] Mixture 2: PE (No. 8):LPC(No. 37):DG (No. 2)-4:1:2

    [1331] Mixture 3: PE (No. 8):PC (No. 12): So (No. 31):FA (No. 29)-1:2:1:1

    [1332] 5). Experimental procedures

    [1333] 1) Boiling method conditions: to 100 L double-stranded HJT-sRNA-m7 solution was added 2.5 L lipid combination, and heated at 90 C. for 15 min;

    [1334] 2) Experiment conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method. For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1335] Conclusions: The results indicated that the above lipid combinations were effective in delivering nucleic acids into cells (see FIG. 77), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings. As compared with RNAiMAX group, mixture 1: PE (No. 8):LPC (No. 37):TG (No. 32)-4:1:2, and mixture 2: PE (No. 8):LPC(No. 37):DG (No. 2)-4:1:2 showed comparable effect in delivery, whereas mixture 3: PE (No. 8):PC (No. 12):So (No. 31):FA (No. 29)-1:2:1:1 showed better effect.

    Example 2-14: Delivery of Double-Stranded Nucleic Acid into MRC-5 Cells by Lipid Combination

    [1336] 1. Experimental groups:

    [1337] 1) Naive group: referred to untreated cell;

    [1338] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and double-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of double-stranded HJT-sRNA-m7 was 100 nM;

    [1339] 3) Free uptake group: double-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1340] 4) Treatment group of lipid combination mixture and double-stranded HJT-sRNA-m7 mixture: a mixture of 3 L lipid combination (PE (No. 8):PC (No. 12):So (No. 31):FA (No. 29)-1:2:1:1) and the HJT-sRNA-m7 double-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1341] 5) Treatment group of lipid combination and double-stranded HJT-sRNA-m7 mixture: a mixture of 3 L lipid combination (mixture of 2 L lipid combination mix and 1 L other type of lipid shown in FIG. 78, i.e. lipids No. 34, 2, 32, 11, 37, 38 or 4) and the HJT-sRNA-m7 double-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1342] 2. Experimental procedures

    [1343] 1) Boiling method conditions: to 100 L double-stranded HJT-sRNA-m7 solution was added 3 L lipid combination, and heated at 90 C. for 15 min;

    [1344] 2) Experiment conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method. For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1345] Conclusions: The results indicated that the above lipid combinations were effective in delivering nucleic acids into cells (see FIG. 78), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings. The mixture (PE (No. 8):PC (No. 12): So (No. 31):FA (No. 29)-1:2:1:1) showed better effect in delivery than RNAiMAX. Compared to mixture (PE (No. 8):PC (No. 12): So (No. 31):FA (No. 29)-1:2:1:1), the addition of mixture PE (No. 8):PC (No. 12):So (No. 31):FA (No. 29)-1:2:1:1) to lipids No. 2, 38 or 4 at a ratio of 2:1 could enhance the delivery effect.

    Example 2-15: Delivery of Double-Stranded Nucleic Acid into MRC-5 Cells by Lipid Combination

    [1346] 1. Experimental groups:

    [1347] 1) Naive group: untreated cell;

    [1348] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and double-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of double-stranded HJT-sRNA-m7 was 100 nM;

    [1349] 3) Free uptake group: double-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1350] 4) A mixture of lipid combination (PE (No. 8) & So (No. 31), 6:1, V/V) and the HJT-sRNA-m7 double-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1351] 5). Experimental procedures

    [1352] 1) Boiling method conditions: to 100 L double-stranded HJT-sRNA-m7 solution was added 2 L lipid combination, and heated at 90 C. for 15 min;

    [1353] 2) Experiment conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 24 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method. For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1354] Conclusions: The results indicated that the lipid combination (PE (No. 8) & So (No. 31), 6:1, V/V) showed better effect in delivery than RNAiMAX (see FIG. 79), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings.

    Example 2-16: Delivery of Double-Stranded Nucleic Acid into MRC-5 Cells by Lipid Combination

    [1355] 1. Experimental groups:

    [1356] 1) Naive group: untreated cell;

    [1357] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and double-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of double-stranded HJT-sRNA-m7 was 100 nM;

    [1358] 3) Free uptake group: double-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1359] 4) Treatment group of lipid combination (PE (No. 8) & So (No. 31), 4:1, V/V) and the HJT-sRNA-m7 mixture: a mixture of 2 L the lipid combination and the HJT-sRNA-m7 double-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1360] 5) Treatment group of lipid combination and double-stranded HJT-sRNA-m7 mixture: a mixture of lipid combination (a mixture of PE (No. 8) & So (No. 31), 4:1, V/V) and other types of lipid (MG (No. 34), DG (No. 2), LPC (No. 37), PC (No. 12), PC (No. 11), Cer (No. 4), FA (No. 29) or TG (No. 32), 12:3:5, V/V, FIG. 80) and the HJT-sRNA-m7 double-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1361] 2. Experimental procedures

    [1362] 1) Boiling method conditions: to 100 L double-stranded HJT-sRNA-m7 solution was added 2 L lipid combination, and heated at 90 C. for 15 min;

    [1363] 2) Experiment conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 12 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method. For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1364] Conclusions: The results indicated that the above lipid combinations were effective for delivering nucleic acids into cells (see FIG. 80), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings. PE (No. 8):So (No. 31) (4:1, V/V) could effectively deliver nucleic acids into cells with an effect close to RNAiMAX. Compared to PE (No. 8): So (No. 31), the mixture of PE (No. 8): So (No. 31) and MG (No. 34), DG (No. 2), PC (No. 12), PC (No. 11), or TG (No. 32) at a ratio of 12:3:5 could enhance the effect in delivery of nucleic acid, and PE (No. 8): So (No. 31):PC (No. 11) showed the best effect, significantly better than RNAiMAX.

    Example 2-17: Delivery of Double-Stranded Nucleic Acid into MRC-5 Cells by Lipid Combination

    [1365] 1. Experimental groups:

    [1366] 1) Naive group: untreated cell;

    [1367] 2) RNAiMAX treatment group: 2 l RNAiMAX transfection reagent and double-stranded HJT-sRNA-m7 solution were diluted in 100 l opti-MEM medium, respectively, and then the two were mixed, allowed to stand for 15 min, added into cells, and then mixed. The final concentration of double-stranded HJT-sRNA-m7 was 100 nM;

    [1368] 3) Free uptake group: double-stranded HJT-sRNA-m7 solution was directly added (the final concentration was 100 nM);

    [1369] 4) Treatment group of lipid combination (PE (No. 8):Cer (No. 4), 4:1, V/V) and the HJT-sRNA-m7 mixture: a mixture of 2 L lipid combination and the HJT-sRNA-m7 double-stranded nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1370] 5) Treatment group of lipid combination and double-stranded HJT-sRNA-m7 mixture: a mixture of lipid combination (mixture of PE (No. 8):Cer (No. 4) and other types of lipids MG (No. 34), DG (No. 2), LPC (No. 37), PC (No. 12), PC (No. 31), FA (No. 29) or TG (No. 32), 12:3:5, V/V, FIG. 81) and the double-stranded HJT-sRNA-m7 nucleic acid solution that was treated by boiling method was added to the cells, and mixed, and the final concentration of RNA was 100 nM;

    [1371] 2. Experimental procedures

    [1372] 1) Boiling method conditions: to 100 L double-stranded HJT-sRNA-m7 solution was added 2 L lipid combination, and heated at 90 C. for 15 min;

    [1373] 2) Experiment conditions: the final concentration of HJT-sRNA-m7 was 100 nM, 12 hours after the addition to the cells, the amount of HJT-sRNA-m7 that entered the cells was detected by RT-qPCR method. For the protocols, see Real-time quantitative PCR detection of intracellular expression of nucleic acids delivered by lipids. All experiments were performed in triplicates.

    [1374] Conclusions: The results indicated that the above lipid combinations were effective for delivering nucleic acids into cells (see FIG. 81), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings. Lipid combination PE (No. 8): Cer (No. 4) could effectively deliver nucleic acids into cells with an effect close to RNAiMAX. Compared to PE (No. 8): So (No. 31), the mixture of PE (No. 8): So (No. 31) and DG (No. 2), FA (No. 29) or TG (No. 32) at a ratio of 12:3:5 could enhance the effect in delivery of nucleic acid, and FA (No. 29) could significantly improve the effect (significantly better than RNAiMAX) of PE (No. 8): So (No. 31) in delivery.

    Example 3: Lipid Combination Promotes Nucleic Acid Entry into the Lung Through Digestive Tract

    [1375] The lipid combination was as follow:

    [1376] Lipids PE (No. 38) & LPC (No. 37) & TG (No. 32), 4:2:3, V/V/V

    [1377] 1. Preparation of lipid nucleic acid mixture:

    [1378] Method: boiling method

    [1379] To 400 L of HJT-sRNA-m7 (5 nmol) single-stranded RNA in DEPC-treated aqueous solution was added 9 L or 18 L lipid combination (lipid PE (No. 38) & LPC (No. 37) & TG (No. 32), 4:2:3, V/V/V), mixed and heated at 100 C. for 30 min.

    [1380] 2. Delivery experiment of nucleic acid via digestive tract

    [1381] RNA was administered via gavage to 6-8 weeks old male C57 mice: HJT-sRNA-m7 in aqueous solution or a mixture solution of lipid and HJT-sRNA-m7 was administered via gavage needle, 400 L/animal (HJT-sRNA-m7, 5 nmol/animal). Groups were as follows:

    [1382] (1) Control group (naive group): mice that did not receive any treatment;

    [1383] (2) Negative control group (lipid group): administration of 9 L lipid combinations (lipid PE (No. 38) & LPC (No. 37) & TG (No. 32), 4:2:3, V/V/V) via gavage;

    [1384] (3) Free uptake group: direct administration of single-stranded HJT-sRNA-m7 RNA via gavage;

    [1385] (4) Lipid and nucleic acid mixture group: administration of a mixture of lipid combination and single-stranded HJT-sRNA-m7 RNA via gavage.

    [1386] 3 hours after administration via gavage, the mouse whole lung was lysed with 3 mL TRIzol, the total RNA was extracted and the abundance of HJT-sRNA-m7 was detected by RT-qPCR.

    [1387] Conclusion: As shown in FIG. 82, 9 L or 18 L lipid combination (lipid PE (No. 38) & LPC (No. 37) & TG (No. 32), 4:2:3, V/V/V) significantly promoted the entry of small fragments of nucleic acids into lung tissue (* indicating a P value of less than 0.05) as compared to the free uptake group. With this (non-invasive) administration via gavage, the lipid combination (lipid PE (No. 38) & LPC (No. 37) & TG (No. 32), 4:2:3, V/V/V) could promote small fragments of nucleic acids entering the lung tissue, which could be used as a means of nucleic acid drug delivery.

    Example 4: Function Experiments of Delivery of Double-Stranded Nucleic Acid into Cells Mediated by Lipid Mixture

    [1388] 1. No. 8 (PE):No. 12 (PC) (v:v=1:2) lipid mixture mediated the entry of nucleic acids into cells to function

    [1389] Experimental method: Western blot, see above Western blot detection of protein expression level.

    [1390] 1) No. 8 (PE):No. 12 (PC) (v:v=1:2) lipid mixture mediated anti-fibrotic double-stranded HJT-sRNA-m7 entry into MRC-5 cells.

    [1391] As shown in FIG. 83, by boiling method and reverse evaporation method, No. 8 (PE):No. 12 (PC) (V:V=1:2) lipid mixture could effectively deliver nucleic acid into cells to function.

    [1392] Naive group: untreated MRC-5 cells, i.e., a blank control group;

    [1393] TGF G1 group: MRC-5 cells were stimulated with TGF 1 protein (final concentration of 3 ng/mL), and the samples were collected after 72 hours.

    [1394] NC group: the mixture of lipid combination of No. 8 (PE):No. 12 (PC) (V:V=1:2) and double-stranded NC mimics was added to the MRC-5 cells and mixed well, and the final concentration of nucleic acid was 200 nM. After 24 hours, the cells were stimulated with TGF1 protein (final concentration of 3 ng/mL), and samples were collected 72 hours after the stimulation with TGF1.

    [1395] M7 group: the mixture of lipid combination of No. 8 (PE):No. 12 (PC) (V:V=1:2) with double-stranded HJT-sRNA-m7 was added to the MRC-5 cells and mixed, and the final concentration of nucleic acid was 200 nM. After 24 hours, the cells were stimulated with TGF1 protein (final concentration of 3 ng/mL), and samples were collected after 72 hours.

    [1396] 2) No. 8 (PE):No. 12 (PC) (v:v=1:2) lipid mixture mediated siRNA entry into A549 cells.

    [1397] As shown in FIGS. 84 and 85, by the boiling method, lipid No. 8 (PE):No. 12 (PC) (v:v=1:2) lipid mixture could effectively deliver nucleic acid into cells to knockdown protein expression.

    [1398] The naive group in FIG. 84: untreated cells, i.e., a blank control group;

    [1399] si-NC: the mixture of lipid combination of No. 8 (PE):No. 12 (PC) (v:v=1:2) and si-NC (synthesized by Guangzhou Ribobio Co., Ltd., unknown sequences) was added to A549 cells and mixed, and the final concentration was 400 nM; the cells were harvested after 48 hours, and lysed by RIPA strong lysis buffer to collect protein samples.

    [1400] si-CPSF30: the mixture of lipid combination of No. 8 (PE):No. 12 (PC) (v:v=1:2) and si-CPSF30 was added to A549 cells and mixed, and the final concentration was 400 nM; the cells were harvested after 48 hours, and lysed by RIPA strong lysis buffer to collect protein samples.

    [1401] si-LAMP1: the mixture of lipid combination of No. 8 (PE):No. 12 (PC) (v:v=1:2) and si-LAMP1 was added to A549 cells and mixed, the final concentration was 400 nM; the cells were harvested after 48 hours, and lysed by RIPA strong lysis buffer to collect protein samples.

    [1402] si-LAMP2: the mixture of lipid combination of No. 8 (PE):No. 12 (PC) (v:v=1:2) and si-LAMP2 was added to A549 cells and mixed, and the final concentration was 400 nM; the cells were harvested after 48 hours, and lysed by RIPA strong lysis buffer to collect protein samples.

    [1403] Free uptake group as shown in FIG. 85: the nucleic acid solution was added directly.

    [1404] Lipo 2000 group: 2 L Lipofectamine 2000 transfection reagent (Invitrogen, Thermo Fisher Scientific) and si-NF-B solution were diluted in 100 L opti-MEM medium, respectively, and the two were mixed, allowed to stay for 15 min, added to the cells and mixed, and the final concentration of nucleic acid solution was 400 nM; after 24 hours, the cells were stimulated with polyI:C (the concentration was 1 g/mL), and the protein samples were collected after 6 hours.

    [1405] No. 8 (PE):No. 12 (PC) (1:2): No. 8 (PE):No. 12 (PC) (1:2) was mixed with the si-NF-B solution by heating method, then added to the cells, and the final concentration of the nucleic acid solution was 400 nM; after 24 hours, the cells were stimulated with polyI:C (the concentration was 1 g/mL), and the protein samples were collected after 6 hours.

    [1406] See Table 2 for the types and sequences of the above nucleic acids.

    [1407] 3) No. 8 (PE):No. 12 (PC) (v:v=1:2) lipid mixture mediated siRNA entry into THP-1 cells.

    [1408] As shown in FIG. 86, by boiling method, No. 8 (PE):No. 12 (PC) (v:v=1:2) lipid mixture could effectively deliver nucleic acid into cells to function.

    [1409] Naive group: untreated cells, i.e., a blank control group;

    [1410] LPS group: no siRNA, but only LPS was added for stimulation, and the final concentration was 1 g/mL. The RNA samples and cell supernatants were harvested after 9 hours;

    [1411] si-NC group: the mixture of lipid combination of No. 8 (PE):No. 12 (PC) (v:v=1:2) and si-NC was added to THP-1 cells and mixed, and the final concentration was 400 nM; LPS was added after 24 hours at a final concentration of 1 g/mL for stimulation, and the TRIzol lysate of the cells were collected 9 hours after the stimulation, and the supernatants were collected for ELISA detection.

    [1412] si-TNF group: the mixture of lipid combination of No. 8 (PE):No. 12 (PC) (v:v=1:2) and si-TNF was added to THP-1 cells and mixed, and the final concentration was 400 nM; LPS was added after 24 hours at a final concentration of 1 g/mL for stimulation, the TRIzol lysate of the cells were collected 9 hours after the stimulation, and the supernatants were collected for ELISA detection.

    [1413] 2. No. 8 (PE):No. 12 (PC):No. 2 (DG) (v:v:v=2:4:3) lipid mixture mediated entry of nucleic acids into cells to function.

    [1414] 1) No. 8 (PE):No. 12 (PC):No. 2 (DG) (v:v:v=2:4:3) lipid mixture mediated anti-fibrotic HJT-sRNA-m7 entry into MRC-5 cells.

    [1415] As shown in FIG. 87, by boiling method, No. 8 (PE):No. 12 (PC):No. 2 (DG) (v:v:v=2:4:3) lipid mixture could effectively deliver anti-fibrotic HJT-sRNA-m7 into MRC-5 cells to reduce fibronectin protein expression.

    [1416] 2) No. 8 (PE):No. 12 (PC):No. 2 (DG) (v:v:v=2:4:3) lipid mixture mediated XRN2 siRNA entry into A549 cells to inhibit gene expression.

    [1417] As shown in FIG. 88, by boiling method, the addition of No. 2 (DG) to the mixture of No. 8 (PE): No. 12(PC): No. 20 (DG), V:V:V=2:4:3 could effectively deliver nucleic acid into the cells to function.

    [1418] Naive group: untreated A549 cells;

    [1419] NC siRNA group: the mixture of lipid mixture of No. 8 (PE):No. 12 (PC):No. 2 (DG) (v:v:v=2:4:3) and si-NC that was prepared by boiling method was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1420] XRN2 siRNA group: the mixture of lipid mixture of No. 8 (PE):No. 12 (PC):No. 2 (DG) (v:v:v=2:4:3) and XRN2 siRNA that was prepared by boiling method was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM.

    [1421] 3. No. 8 (PE):No. 12 (PC):No. 4 (Cer) (v:v:v=1:2:1) lipid mixture mediated entry of nucleic acids into cells to function.

    [1422] 1) No. 8 (PE):No. 12 (PC): No. 4 (Cer) (v:v:v=1:2:1) lipid mixture mediated anti-fibrotic HJT-sRNA-m7 entry into MRC-5 cells (boiling method).

    [1423] As shown in FIG. 89, by boiling method, the addition of No. 4 (Cer) to the lipid mixture of No. 8 (PE), No. 12 (PC) (V:V=1:2), v:v:v=1:2:1, could effectively deliver anti-fibrotic HJT-sRNA-m7 into MRC-5 cells to reduce fibronectin protein expression.

    [1424] Naive group: untreated cells;

    [1425] TGF-1 group: TGF-1 protein was added at a final concentration of 3 ng/mL for stimulation, and the samples were collected after 72 hours.

    [1426] NC group: lipid combination of No. 38 (PE):No. 37 (LPC):No. 32 (TG) (V:V:V=32:8:5) was used to deliver NC mimics. After 24 hours, TGF-1 TGFb1 protein (final concentration of 3 ng/mL) was added for stimulation, and the samples were collected after 72 hours.

    [1427] m7 group: the mixture of lipid combination of No. 8 (PE):No. 12 (PC):No. 4 (Cer) (V:V:V=1:2:1) with double-stranded HJT-sRNA-m7 was added to the MRC-5 cells and mixed, and the final concentration of nucleic acid was 400 nM. After 24 hours, TGF-1 protein (final concentration of 3 ng/mL) was added for stimulation, and the samples were collected after 72 hours.

    [1428] 2) No. 8 (PE):No. 12 (PC):No. 4 (Cer) (v:v:v=1:2:1) lipid mixture mediated NF-B siRNA entry into A549 cells to inhibit gene expression (boiling method).

    [1429] As shown in FIG. 90, the addition of No. 4 (Cer) to a lipid mixture of No. 8 (PE), No. 12 (PC) (V:V=1:2), v:v:v=1:2:1, could effectively deliver nucleic acids into cells to function.

    [1430] Naive group: untreated cells;

    [1431] si-NC group: the mixture of lipid mixture of No. 8 (PE):No. 12 (PC):No. 4 (Cer) (v:v:v=1:2:1) and si-NC siNC was added to cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1432] si-NF-B group: the mixture of lipid mixture of No. 8 (PE):No. 12 (PC):No. 4 (Cer) (v:v:v=1:2:1) and NF-B siRNA was added to cells and mixed, the final concentration of the nucleic acid was 400 nM;

    [1433] 4. No. 8 (PE):No. 12 (PC):No. PC (11) (v:v:v=1:2:1) lipid mixture mediated entry of nucleic acids into cells to function.

    [1434] 1) No. 8 (PE):No. 12 (PC):No. PC (11) (v:v:v=1:2:1) lipid mixture mediated XRN2 siRNA entry into A549 cells to inhibit gene expression.

    [1435] As shown in FIG. 91, the addition of No. 11 (PC) to the mixture of No. 8 (PE), No. 12 (PC) (V:V=1:2), V:V:V=1:2:1, could effectively deliver nucleic acid into the cells to function.

    [1436] Naive group: untreated cells;

    [1437] si-NC siNC group: the mixture of lipid mixture of No. 8 (PE):No. 12 (PC):No. PC (11) (v:v:v=1:2:1) and si-NC was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1438] si-XRN2 group: the mixture of lipid mixture of No. 8 (PE):No. 12 (PC): No. PC (11) (v:v:v=1:2:1) and XRN2 siRNA was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM.

    [1439] 5. No. 8 (PE):No. 12 (PC):No. LPC (37) (v:v:v=1:2:1) lipid mixture mediated entry of nucleic acids into cells to function.

    [1440] 1) No. 8 (PE):No. 12 (PC):No. LPC (37) (v:v:v=1:2:1) lipid mixture mediated XRN2 siRNA entry into A549 cells to inhibit gene expression.

    [1441] As shown in FIG. 92, based on the addition of No. 37 (LPC) to the lipid mixture of No. 8 (PE), No. 12 (PC) (V:V=1:2), V:V:V=1:2:1, could effectively deliver nucleic acid into the cells to function.

    [1442] Naive group: untreated cells;

    [1443] si-NC group: the mixture of lipid mixture of No. 8 (PE):No. 12 (PC):No. LPC (37) (v:v:v=1:2:1) and si-NC was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1444] si-XRN2 group: the mixture of lipid mixture of No. 8 (PE):No. 12 (PC): No. LPC (37) (v:v:v=1:2:1) and XRN2 siRNA was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM.

    [1445] 6. No. 8 (PE):No. 12 (PC):No. MG (34) (v:v:v=2:3:1) lipid mixture mediated entry of nucleic acids into cells to function.

    [1446] 1) No. 8 (PE):No. 12 (PC):No. MG (34) (v:v:v=2:3:1) lipid mixture mediated CPSF4 siRNA entry into A549 cells to inhibit gene expression.

    [1447] Naive group: untreated cells;

    [1448] si-NC siNC group: the mixture of lipid mixture of No. 8 (PE):No. 12 (PC):No. MG (34) (v:v:v=2:3:1) and si-NCsiNC was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1449] si-CPSF4 group: the mixture of lipid mixture of No. 8 (PE):No. 12 (PC): No. MG (34) (v:v:v=2:3:1) and CPSF4 siRNA was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM.

    [1450] As shown in FIG. 93, No. 8 (PE):No. 12 (PC):No. MG (34) (v:v:v=2:3:1) lipid mixture could effectively deliver nucleic acid into the cells to function.

    [1451] 7. No. 38 (PE):No. 37 (LPC):No. 32 (TG) (v:v:v=32:8:5) lipid mixture mediated entry of nucleic acids into cells to function.

    [1452] 1) No. 38 (PE):No. 37 (LPC):No. 32 (TG) (v:v:v=32:8:5) lipid mixture mediated anti-fibrotic HJT-sRNA-m7 entry into MRC-5 cells (boiling method).

    [1453] As shown in FIG. 94, the m7 band was lighter compared to control. The effect of M7 was not sufficient to restore cells to unstimulated levels.

    [1454] Naive group: untreated cells, i.e., a blank control group;

    [1455] TGF-1 group: cells were stimulated with TGF-1 protein (final concentration of 3 ng/mL), and the samples were collected after 72 hours.

    [1456] NC group: lipid combination of No. 38 (PE):No. 37 (LPC):No. 32 (TG) (V:V:V=32:8:5) was used to deliver NC mimics. After 24 hours, the cells were stimulated with TGF-1 protein (final concentration of 3 ng/mL), and the samples were collected after 72 hours.

    [1457] M7 group: the mixture of lipid combination of No. 38 (PE):No. 37 (LPC):No. 32 (TG) (V:V:V=32:8:5) with double-stranded HJT-sRNA-m7 was added to the MRC-5 cells and mixed, and the final concentration of nucleic acid was 400 nM. After 24 hours, the cells were stimulated with TGF-1 protein (final concentration of 3 ng/mL), and the samples were collected after 72 hours.

    [1458] 2) No. 38 (PE):No. 37 (LPC):No. 32 (TG) (V:V:V=32:8:5) lipid mixture mediated XRN2 siRNA entry into A549 cells to inhibit gene expression.

    [1459] As shown in FIG. 95, No. 38 (PE):No. 37 (LPC):No. 32 (TG) (V:V:V=32:8:5) lipid mixture could effectively deliver nucleic acid entering the cells to function.

    [1460] si-NC group: the mixture of lipid mixture of No. 38 (PE):No. 37 (LPC):No. 32 (TG) (V:V:V=32:8:5) and si-NC was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1461] si-XRN2 group: the mixture of the lipid mixture of No. 38 (PE):No. 37 (LPC):No. 32 (TG) (V:V:V=32:8:5) and XRN2 siRNA was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM.

    [1462] 8. No. 1 (DG):No. 8 (PE):No. 12 (PC):No. 4 (Cer):No. 31 (So):No. 29 (FA):No. 16 (TG) (v:v:v:v:v:v:v=2:1:2:2:3:1:3) lipid mixture mediated entry of nucleic acids into cells to function.

    [1463] 1) As shown in FIG. 96, No. 1 (DG):No. 8 (PE):No. 12 (PC):No. 4 (Cer):No. 31 (So):No. 29 (FA):No. 16 (TG) (v:v:v:v:v:v:v=2:1:2:2:3:1:3) lipid mixture mediated anti-fibrotic HJT-sRNA-m7 entry into MRC-5 cells (boiling method).

    [1464] Naive group: untreated cells, i.e., a blank control group;

    [1465] TGF-1 group: cells were stimulated with TGF-1 protein (final concentration of 3 ng/mL), and the samples were collected after 72 hours.

    [1466] NC group: lipid combination of No. 1 (DG):No. 8 (PE):No. 12 (PC):No. 4 (Cer):No. 31 (So):No. 29 (FA):No. 16 (TG) (v:v:v:v:v:v:v=2:1:2:2:3:1:3) was used to was used to deliver NC mimics. After 24 hours, TGF-1 protein (final concentration of 3 ng/mL) was added for stimulation, and the samples were collected after 72 hours.

    [1467] M7 group: the mixture of lipid combination of No. 1 (DG):No. 8 (PE):No. 12 (PC):No. 4 (Cer):No. 31 (So):No. 29 (FA):No. 16 (TG) (v:v:v:v:v:v:v=2:1:2:2:3:1:3) with single-stranded HJT-sRNA-m7 was added to the MRC-5 cells, and mixed, and the final concentration of nucleic acid was 400 nM. After 24 hours, TGF-1 protein (final concentration of 3 ng/mL) was added for stimulation, and the samples were collected after 72 hours.

    [1468] 2) As shown in FIG. 97, No. 1 (DG):No. 8 (PE):No. 12 (PC):No. 4 (Cer):No. 31 (So):No. 29 (FA):No. 16 (TG) (v:v:v:v:v:v:v=2:1:2:2:3:1:3) lipid mixture mediated XRN2 siRNA entry into A549 cells to inhibit gene expression (boiling method).

    [1469] No. 1 (DG):No. 8 (PE):No. 12 (PC):No. 4 (Cer):No. 31 (So):No. 29 (FA):No. 16 (TG) (v:v:v:v:v:v:v=2:1:2:2:3:1:3) lipid mixture could effectively deliver nucleic acid entering the cells to function.

    [1470] si-NC group: the mixture of lipid mixture of No. 1 (DG):No. 8 (PE):No. 12 (PC):No. 4 (Cer):No. 31 (So):No. 29 (FA):No. 16 (TG) (v:v:v:v:v:v:v=2:1:2:2:3:1:3) and si-NC was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1471] si-XRN2 group: the mixture of lipid mixture of No. 1 (DG):No. 8 (PE):No. 12 (PC):No. 4 (Cer):No. 31 (So):No. 29 (FA):No. 16 (TG) (v:v:v:v:v:v:v=2:1:2:2:3:1:3) and XRN2 siRNA was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM.

    [1472] No. 8 (PE):No. 12 (PC):No. 31 (So):No. 29 (FA):No. 4 (Cer) (v:v:v:v:v=2:4:2:2:5) lipid mixture mediated entry of nucleic acids into cells to function.

    [1473] 1) As shown in FIG. 98, No. 8 (PE):No. 12 (PC):No. 31 (So):No. 29 (FA):No. 4 (Cer) (v:v:v:v:v=2:4:2:2:5) lipid mixture mediated anti-fibrotic HJT-sRNA, HJT-sRNA-3, HJT-sRNA-a2, HJT-sRNA-h3, HJT-sRNA-m7 entry into MRC-5 cells (boiling method).

    [1474] Naive group: untreated cells, i.e., a blank control group;

    [1475] TGF-1 group: cells were stimulated with TGF-1 protein (final concentration of 3 ng/mL), and the samples were collected after 72 hours.

    [1476] NC group: lipid combination of No. 8 (PE):No. 12 (PC):No. 31 (So):No. 29 (FA):No. 4 (Cer) (v:v:v:v:v=2:4:2:2:5) was used to deliver NC mimics. After 24 hours, the cells were stimulated with TGF-1 protein (final concentration of 3 ng/mL), and the samples were collected after 72 hours.

    [1477] M7 group: the mixture of lipid combination of No. 8 (PE):No. 12 (PC):No. 31 (So):No. 29 (FA):No. 4 (Cer) (v:v:v:v:v=2:4:2:2:5) with HJT-sRNA-m7 single-stranded was added to the MRC-5 cells, mixed, and the final concentration of nucleic acid was 400 nM. After 24 hours, the cells were stimulated with TGF-1 protein (final concentration of 3 ng/mL), and the samples were collected after 72 hours.

    [1478] 2) As shown in FIG. 99, No. 8 (PE):No. 12 (PC):No. 31 (So):No. 29 (FA):No. 4 (Cer) (v:v:v:v:v=2:4:2:2:5) lipid mixture mediated XRN2 siRNA entry into A549 cells to inhibit gene expression (boiling method).

    [1479] No. 8 (PE):No. 12 (PC):No. 31 (So):No. 29 (FA):No. 4 (Cer) (v:v:v:v:v=2:4:2:2:5) lipid mixture could effectively deliver nucleic acid into the cells to function.

    [1480] si-NC group: the mixture of lipid mixture of No. 8 (PE):No. 12 (PC):No. 31 (So):No. 29 (FA):No. 4 (Cer) (v:v:v:v:v=2:4:2:2:5) and si-NC was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1481] si-XRN2 group: the mixture of lipid mixture of No. 8 (PE):No. 12 (PC):No. 31 (So):No. 29 (FA):No. 4 (Cer) (v:v:v:v:v=2:4:2:2:5) and XRN2 siRNA was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM.

    [1482] 10. No. 38 (PE):No. 37 (LPC) (v:v=4:1) lipid mixture mediated entry of nucleic acids into cells to function.

    [1483] 1) As shown in FIG. 100, No. 38 (PE):No. 37 (LPC) (v:v=4:1) lipid mixture mediated anti-fibrotic HJT-sRNA, HJT-sRNA-3, HJT-sRNA-a2, HJT-sRNA-h3, HJT-sRNA-m7 entry into MRC-5 cells (boiling method).

    [1484] Naive group: untreated cells, i.e., a blank control group;

    [1485] TGF-1 group: cells were stimulated with TGF-1 protein (final concentration of 3 ng/mL), and the samples were collected after 72 hours.

    [1486] NC group: lipid combination of No. 38 (PE):No. 37 (LPC) (v:v=4:1) was used to was used to deliver NC mimics. After 24 hours, the cells were stimulated with TGF-1 protein (final concentration of 3 ng/mL), and the samples were collected after 72 hours.

    [1487] M7 group: the mixture of lipid combination of No. 38 (PE):No. 37 (LPC) (v:v=4:1) with HJT-sRNA-3, HJT-sRNA-a2, HJT-sRNA-h3, HJT-sRNA-m7 was added to the MRC-5 cells, and mixed, and the final concentration of nucleic acid was 400 nM. After 24 hours, the cells were stimulated with TGF-1 protein (final concentration of 3 ng/mL), and the samples were collected after 72 hours.

    [1488] 2) As shown in FIG. 101, No. 38 (PE):No. 37 (LPC) (v:v=4:1) lipid mixture mediated XRN2 siRNA entry into A549 cells to inhibit gene expression (boiling method).

    [1489] No. 38 (PE):No. 37 (LPC) (v:v=4:1) lipid mixture could effectively deliver nucleic acid entering the cells to function.

    [1490] si-NC group: the mixture of lipid mixture of No. 38 (PE):No. 37 (LPC) (v:v=4:1) and si-NC was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1491] si-XRN2 group: the mixture of lipid mixture of No. 38 (PE):No. 37 (LPC) (v:v=4:1) and XRN2 siRNA was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM.

    [1492] 11. No. 38 (PE):No. 12 (PC):No. 2 (DG) (v:v:v=4:1:3) lipid mixture mediated entry of nucleic acids into cells to function.

    [1493] As shown in FIG. 102, No. 38 (PE):No. 12 (PC):No. 2 (DG) (v:v:v=4:1:3) lipid mixture mediated XRN2 siRNA entry into A549 cells to inhibit gene expression.

    [1494] The lipid mixture of No. 38 (PE), in place of No. 8 (PE), with No. 12 (PC), No. 2 (DG) (v:v:v=4:1:3) could effectively deliver nucleic acid entering the cells to function.

    [1495] si-NC group: the mixture of lipid mixture of No. 38 (PE):No. 12 (PC):No. 2 (DG) (v:v:v=4:1:3) and si-NC was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1496] si-XRN2 group: the mixture of lipid mixture of No. 38 (PE):No. 12 (PC):No. 2 (DG) (v:v:v=4:1:3) and XRN2 siRNA was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM.

    [1497] 12. No. 38 (PE):No. 37 (LPC):No. 12 (PC) (v:v:v=4:1:1) lipid mixture mediated entry of nucleic acids into cells to function.

    [1498] As shown in FIG. 103, No. 38 (PE):No. 37 (LPC):No. 12 (PC) (v:v:v=4:1:1) lipid mixture mediated XRN2 siRNA entry into A549 cells to inhibit gene expression (reverse evaporation method).

    [1499] The addition of No. 12 (PC) (v:v:v=4:1:1) to the lipid mixture of No. 38 (PE):No. 37 (LPC) (v:v=4:1), could effectively deliver nucleic acid into cells to inhibit gene expression.

    [1500] si-NC group: the mixture of lipid mixture of No. 38 (PE):No. 37 (LPC):No. 12 (PC) (v:v:v=4:1:1) and si-NC was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1501] si-RNA group: the mixture of lipid mixture of No. 38 (PE):No. 37 (LPC):No. 12 (PC) (v:v:v=4:1:1) and XRN2 siRNA, -actin siRNA, Ssu 72 siRNA or CPSF4 siRNA was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM.

    [1502] 13. No. 4 (Cer):No. 12 (PC):No. 38 (PE):No. 37 (LPC) (v:v:v:v=5:2:8:3) lipid mixture mediated entry of nucleic acids into cells to function.

    [1503] 1) As shown in FIG. 104, the addition of No. 4 (Cer) to the lipid mixture of No. 38 (PE), No. 37 (LPC), No. 12 (PC) led to the lipid mixture of No. 4 (Cer):No. 12 (PC):No. 38 (PE):No. 37 (LPC) (v:v:v:v=5:2:8:3), which mediated anti-fibrotic HJT-sRNA, HJT-sRNA-3, HJT-sRNA-a2, HJT-sRNA-h3, HJT-sRNA-m7 double-stranded RNA entry into MRC-5 cells to reduce fibronectin expression levels (boiling method).

    [1504] Naive group: untreated cells, i.e., a blank control group;

    [1505] TGF-1 group: cells were stimulated with TGF-1 protein (final concentration of 3 ng/mL), and the samples were collected after 72 hours.

    [1506] NC group: lipid combination of No. 4 (Cer):No. 12 (PC):No. 38 (PE):No. 37 (LPC) (v:v:v:v=5:2:8:3) was used to deliver NC mimics, after 24 hours, TGF-1 protein (final concentration of 3 ng/mL) was added for stimulation, and the samples were collected after 72 hours.

    [1507] HJT-3 & a2 & h3 group: the mixture of lipid mixture of No. 4 (Cer):No. 12 (PC):No. 38 (PE):No. 37 (LPC) (v:v:v:v=5:2:8:3) with HJT-sRNA-3, HJT-sRNA-a2, HJT-sRNA-h3 and HJT-sRNA-m7 double-strand, was added to the cells, and mixed and the final concentration of nucleic acid was 400 nM.

    [1508] m7 group: the mixture of lipid combination of No. 4 (Cer):No. 12 (PC):No. 38 (PE):No. 37 (LPC) (v:v:v:v=5:2:8:3) with HJT-sRNA-m7 was added to the cells, and mixed, and the final concentration of nucleic acid was 400 nM.

    [1509] 2) As shown in FIG. 105, No. 4 (Cer):No. 12 (PC):No. 38 (PE):No. 37 (LPC) (v:v:v:v=5:2:8:3) lipid mixture mediated XRN2 siRNA entry into cells to inhibit gene expression.

    [1510] si-NC group: the mixture of lipid mixture of No. 4 (Cer):No. 12 (PC):No. 38 (PE):No. 37 (LPC) (v:v:v:v=5:2:8:3) and si-NC was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1511] si-XRN2 group: the mixture of lipid mixture of No. 4 (Cer):No. 12 (PC):No. 38 (PE):No. 37 (LPC) (v:v:v:v=5:2:8:3) and XRN2 siRNA was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM.

    [1512] 14. No. 38 (PE):No. 2 (DG):No. 31 (So) (v:v:v=4:2:3) lipid mixture mediated entry of nucleic acids into cells to function.

    [1513] 1) As shown in FIG. 106, No. 38 (PE):No. 2 (DG):No. 31 (So) (v:v:v=4:2:3) lipid mixture mediated anti-fibrotic HJT-sRNA, HJT-sRNA-3, HJT-sRNA-a2, HJT-sRNA-h3, HJT-sRNA-m7 double-stranded RNA entry into MRC-5 cells to reduce fibronectin expression levels (boiling method).

    [1514] Naive group: untreated cells, i.e., a blank control group;

    [1515] TGF-1 group: cells were stimulated with TGF-1 protein (final concentration of 3 ng/mL), and the samples were collected after 72 hours.

    [1516] NC group: lipid combination of No. 38 (PE):No. 2 (DG):No. 31 (So) (v:v:v=4:2:3) was used to deliver NC mimics. After 24 hours, TGF-1 protein (final concentration of 3 ng/mL) was added for stimulation, and the samples were collected after 72 hours.

    [1517] HJT-3 & a2 & h3 group: the mixture of lipid mixture of No. 38 (PE):No. 37 (LPC) (v:v:v=4:1) with HJT-sRNA-3, HJT-sRNA-a2 and HJT-sRNA-h3, was added to the cells, and mixed and the final concentration of nucleic acid was 400 nM.

    [1518] M7 group: the mixture of lipid combination of No. 38 (PE):No. 37 (LPC) (v:v=4:1) with HJT-sRNA-m7 was added to the cells, and mixed, and the final concentration of nucleic acid was 400 nM.

    [1519] 2) As shown in FIG. 107, No. 38 (PE):No. 2 (DG):No. 31 (So) (v:v:v=4:2:3) lipid mixture mediated XRN2 siRNA entry into A549 cells to inhibit gene expression (boiling method).

    [1520] No. 38 (PE):No. 2 (DG):No. 31 (So) (v:v:v=4:2:3) lipid mixture effectively delivered XRN2 siRNA into A549 cells to function.

    [1521] si-NC group: the mixture of lipid mixture of No. 38 (PE):No. 2 (DG):No. 31 (So) (v:v:v=4:2:3) and si-NC was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1522] si-XRN2 group: the mixture of lipid mixture of No. 38 (PE):No. 2 (DG):No. 31 (So) (v:v:v=4:2:3) and XRN2 siRNA was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM.

    Example 5: Validation of the Effects of Lipid No. 41 and its Composition

    [1523] I. Single Lipids Delivered Nucleic Acids (Double-Stranded RNA and Single-Stranded RNA) into Cells by Different Preparation Methods (Reverse Evaporation and Boiling Method)

    [1524] Lipid No. 41. Sphinganine (d22:0)

    ##STR00073##

    [1525] 1. Quantitative Real-Time PCR (Real-Time PCR) Detection of the Efficiency of Nucleic Acid Delivery by Lipid.

    [1526] As shown in FIG. 108, lipid No. 41 prepared by different methods (boiling or reverse evaporation method) delivered HJT-sRNA-m7 double-stranded RNA into A549 cells. For A549 cells, in the case of the boiling method, the delivery effect of lipid No. 41 was about twice that of RNAiMAX, and in the case of the reverse evaporation method, the delivery effect of lipid No. 41 was also significantly higher than that of RNAiMAX.

    [1527] As shown in FIG. 109, lipid No. 41 prepared by different methods (boiling or reverse evaporation method) delivered HJT-sRNA-m7 double-stranded RNA into MRC-5 cells. For MRC-5 cells, in the case of the boiling method, lipid No. 41 delivered double-stranded RNA into MRC-5 cells, and in the case of the reverse evaporation method, the delivery effect of lipid No. 41 was significantly higher than that of RNAiMAX.

    [1528] As shown in FIG. 110, lipid No. 41 delivered HJT-sRNA-m7 single-stranded RNA into A549 and MRC-5 cells by the boiling method.

    [1529] 2. Digital PCR (ddPCR) Detection of the Efficiency of Nucleic Acid Delivery by Lipid

    [1530] 2.1 Experimental materials: A549 cells were purchased from the Cell Center of the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, TRIzol lysis buffer was purchased from Sigma, High capacity cRNA Reverse Transcription Kit was purchased from ABI, USA, and the digital PCR related reagents were purchased from Bio-Rad USA.

    [1531] 2.3 Experimental method: the total cellular RNA was collected and extracted by TRIzol lysis buffer according to the above methods, and reverse transcribed to cDNA using High capacity cRNA Reverse Transcription Kit, and the cDNA from different groups was subject to digital PCR reaction. Referring to the QX200 Droplet Reader and QuantaSoft Software manual for the protocols, the results were analyzed using QuantaSoft software. The groups were as follows: (1) naive group: A549 cells without treatment; (2) free uptake group: the cells were directly incubated with HJT-sRNA-m7 dsRNA for 6 hours; (3) RNAiMAX group: A549 cells were transfected with the HJT-sRNA-m7 dsRNA by RNAiMAX, and the samples were collected for detection after 6 hours; (4) No. 41 group: lipid No. 41 prepared by different methods (boiling method or reverse evaporation method) delivered double-stranded RNA into A549 cells, and samples were collected for detection after 6 hours.

    [1532] Experimental results and analysis: as shown in FIG. 111, by both the boiling method and reverse evaporation method, lipid No. 41 could effectively deliver HJT-sRNA-m7 dsRNA into A549 cells, and the boiling method had better effects than reverse evaporation method.

    [1533] 3. Flow Cytometry Detection of the Efficiency of Nucleic Acid Delivery by Lipid

    [1534] Experimental materials: A549 cells (purchased from the Cell Center of the Chinese Academy of Medical Sciences), FAM-sRNA (purchased from Ribobio Biotechnology Co., Ltd.), lipid No. 41, Accuri C6 instrument (purchased from BD, USA).

    [1535] Experimental methods: PGY-sRNA-6-FAM was dissolved in 100 l water, mixed with 4 l lipid, and prepared by boiling method. Then the mixture was dropped into A549 cells, and after 6 hours of co-incubation, the samples were collected for detection as follows: firstly wash three times with PBS, then digest with trypsin for 3 minutes and remove trypsin, wash with PBS again and then blow down the cells. The detection was performed using Accuri C6 instrument.

    [1536] Experimental results as shown in FIG. 112: lipid No. 41 had an efficiency of 94.1% in delivering PGY-sRNA-6 single-stranded RNA, which was higher than 69.4% of the positive control RNAiMAX. And lipid No. 41 had an efficiency of 96.7% in delivering PGY-sRNA-6 double-stranded RNA, which was also higher than 94.9% of the positive control RNAiMAX. Lipids 41 could efficiently deliver single-stranded and double-stranded nucleic acids into A549 cells.

    [1537] 4. Observation of the Localization of the Nucleic Acid Delivered by Lipid in Cells by Confocal Fluorescence Microscopy

    [1538] Experimental materials: A549 cells (purchased from the Cell Center of the Chinese Academy of Medical Sciences), PGY-sRNA-6-Cy3 (purchased from Ribobio Biotechnology Co., Ltd.), lipid No. 41, Zeiss LSM780 (purchased from Zeiss, Germany), Alexa Fluor 488 phalloidin (purchased from Invitrogen, USA), DAPI (purchased from Invitrogen, USA), paraformaldehyde (purchased from sigma, USA).

    [1539] Experimental methods: PGY-sRNA-6-FAM was dissolved in 100 l water, mixed with 4 l lipid, and prepared by the boiling method. Then the mixture was dropped into A549 cells, and after 6 hours of co-incubation, the samples were washed three times with PBS, fixed with 4% paraformaldehyde, washed three times with PBS, stained with Alexa Fluor 488 phalloidin for 30 min, washed 3 times with PBS, and stained with DAPI for 5 min, washed with PBS, and then sealed.

    [1540] Experimental results as shown in FIG. 113: the entry of red PGY-sRNA-6-Cy3 could be obviously observed under the confocal microscopy. Lipid No. 41 could effectively deliver double-stranded nucleic acid into A549 cells.

    [1541] 5. Western Blot Detection of the Efficiency of Nucleic Acid Delivery by Lipid

    [1542] As shown in FIG. 114, single lipid No. 41 mediated sRNAi entry into MRC-5 549 cells to knockdown protein expression (by reverse evaporation method). At protein level, the protein knockdown effect mediated by the single lipid No. 41 was significantly higher than the inhibitory effect of HJT-sRNA-m7 mediated by RNAiMAX.

    [1543] Naive group: untreated MRC-5A549 cells.

    [1544] siNC group: the mixture of single lipid No. 41 and siNC was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1545] siRNA group: the mixture of single lipid No. 41 and LAMP2, XPN2, Ssu72, CPSF4 or -actin siRNA was added to the cells, mixed, and the final concentration of the nucleic acid was 400 nM;

    [1546] Free uptake group: the test substance was directly added;

    [1547] RNAiMAX group: 2 ul RNAiMAX transfection reagent and nucleic acid solution were diluted with 100 ul opti-MEM medium, respectively, and the two were mixed, allowed to stay for 15 min, added to the cells, and then mixed, and the final concentration of nucleic acid was 400 nM;

    [1548] So (41) group (reverse evaporation method): the mixture of lipid No. 41 and the nucleic acid was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1549] As shown in FIG. 115, single lipid No. 41 mediated anti-fibrotic HJT-sRNA-m7 double-strand entry into MRC-5 cells (reverse evaporation method). At protein level, single lipid No. 41 mediated HJT-sRNA-m7 inhibition was higher than RNAiMAX mediated HJT-sRNA-m7 inhibition.

    [1550] TGF 1 group: TGF- 1 protein (final concentration was 3 ng/mL) was added for stimulation, and the samples were collected after 72 hours;

    [1551] NC group: single lipid No. 41 delivered NC mimics. After 24 hours, the cells were stimulated with TGF-1 TGFb1 protein (final concentration was 3 ng/mL), and the samples were collected after 72 hours;

    [1552] HJT-3 & a2 & H3 group: the mixture of single lipid No. 41 and HJT-sRNA-3, HJT-sRNA-a2 and HJT-sRNA-h3 were added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1553] m7 group: the mixture of single lipid No. 41 and HJT-sRNA-m7 was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1554] 6. Summary of In Vivo Results of Lipid No. 41

    [1555] [Experimental method] 6-8 weeks old mice, 22-24 g, were raised in SPF room of the Animal Center of the Institute of Basic Medical Sciences of Chinese Academy of Medical Sciences. The mice were fasted for 12 hours before intragastric administration. The mice were randomly divided into 3 groups: (1) control group, 400 l DEPC-treated water, intragastric administration; (2) free uptake group, small RNA (PGY-sRNA-26, PGY-sRNA-32 and PGY-sRNA-23), each small RNA 1 nmol/animal, dissolved in 400 l DEPC-treated water, intragastric administration; (3) lipid No. 41 group: a mixture of small RNA (PGY-sRNA-26 and PGY-sRNA-32) and lipid No. 41 prepared by heating method was intragastrically administered, each small RNA 1 nmol/animal, lipid No. 41 10 l/animal, dissolved in 400 l DEPC-treated water. All tissue and organ samples were collected after 6 hours of intragastric administration. All small RNAs were single-stranded RNA modified by 3p-terminal 2-O-methylation.

    [1556] [Experimental Results]

    [1557] As shown in FIG. 140, lipid No. 41 could promote the entry of small RNA into the blood, protecting it from degradation in the blood.

    [1558] As shown in FIG. 141, lipid No. 41 could promote the entry of small RNA into the stomach cells, protecting it from degradation in the stomach.

    [1559] As shown in FIG. 142, lipid No. 41 could promote the entry of small RNA into small intestinal cells, protecting it from degradation in the small intestine.

    [1560] As shown in FIG. 143, lipid No. 41 could promote the entry of small RNA into the liver, protecting it from degradation in the liver.

    [1561] 7. Effect of Lipid Combination Containing Lipid No. 41 on Nucleic Acid Delivery

    [1562] 1) Effect of lipid combination 1 (No. 8+No. 41=6:1) and lipid combination 2 (No. 38+No. 41=6:1) on nucleic acid delivery.

    [1563] As shown in FIG. 116, lipid combination 1 (No. 8+No. 41=6:1) and lipid combination 2 (No. 38+No. 41=6:1) mediated anti-fibrotic HJT-3 & a2 & H3, HJT-sRNA-m7 entry into MRC-5 cells (heating method), and mediated a significant inhibitory effect of the HJT-sRNA-m7 at protein level.

    [1564] TGF: TGF-1 protein (final concentration was 3 ng/mL) was added for stimulation, and the samples were collected after 72 hours;

    [1565] NC group: single lipid No. 41 was used to deliver NC mimics. After 24 hours, TGF-1 TGF-b 1 protein (final concentration was 3 ng/mL) was added for stimulation, and the samples were collected after 72 hours;

    [1566] HJT-3 & a2 & H3 group: the mixture of the lipid mixture with HJT-sRNA-3, HJT-sRNA-a2 and HJT-sRNA-h3 was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1567] HJT-m7: the mixture of the lipid mixture and HJT-sRNA-m7 was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1568] 2) Effects of lipid combination 3 (No. 39+No. 41=6:1) and lipid combination 4 (No. 40+No. 41=6:1) on nucleic acid delivery.

    [1569] As shown in FIG. 117, lipid combination 3 (No. 39+No. 41=6:1) and lipid combination 4 (No. 40+No. 41=6:1) mediated anti-fibrotic HJT-3 & a2 & H3, HJT-sRNA-m7 entering into MRC-5 cells (heating method), and mediated a significant inhibitory effect of HJT-sRNA-m7 at protein the level.

    [1570] TGF: TGF-1 protein (final concentration was 3 ng/mL) was added for stimulation, and the samples were collected after 72 hours;

    [1571] NC group: lipid mix was used to deliver NC mimics. After 24 hours, the TGF-1 protein (final concentration was 3 ng/mL) was added for stimulation, and the samples were collected after 72 hours;

    [1572] HJT-3 & a2 & H3 group: the mixture of the lipid mixture with HJT-sRNA-3, HJT-sRNA-a2 and HJT-sRNA-H3was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1573] HJT-m7: the mixture of the lipid mixture and HJT-sRNA-m7 was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1574] 3) Effect of lipid combination 5 (No. 38+12+41+29=1:2:1:1) on nucleic acid delivery.

    [1575] As shown in FIG. 118, lipid combination 5 (No. 38+12+41+29=1:2:1:1) mediated anti-fibrotic HJT-3 & a2 & H3 and HJT-sRNA-m7 entering into MRC-5 cells (heating method), and mediated a significant inhibitory effect of HJT-sRNA-m7 at the protein level.

    [1576] TGF: TGF-1 protein (final concentration was 3 ng/mL) was added for stimulation, and samples were collected after 72 hours;

    [1577] NC group: lipid mixture was used to deliver NC mimics. After 24 hours TGF-1 protein (final concentration was 3 ng/mL) was added for stimulation, and the samples were collected after 72 hours;

    [1578] HJT-3 & a2 & H3 group: the mixture of the lipid mixture with HJT-sRNA-3, HJT-sRNA-a2 and HJT-sRNA-H3 mixture was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1579] HJT-m7: a mixture of the lipid mixture and HJT-sRNA-m7 was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1580] 4) Effect of lipid combination 6 (No. 40 (PE)+No. 12 (PC)+No. 41 (So)=2:4:3) on nucleic acid delivery.

    [1581] As shown in FIG. 119, lipid combination 6 (No. 40 (PE)+No. 12 (PC)+No. 41 (So)=2:4:3) mediated anti-fibrotic HJT-3 & a2 & H3, HJT-sRNA-m7 entering into MRC-5 cells (boiling and reverse evaporation method), and mediated a significant inhibitory effect of the HJT-3 & a2 & H3, HJT-sRNA-m7 at the protein level.

    [1582] TGF: TGF-1 protein (final concentration was 3 ng/mL) was added for stimulation, and samples were collected after 72 hours;

    [1583] 3-NC group: lipid mixture was used to deliver NC mimics, and after 24 hours TGF-1 TGFb1 protein (final concentration was 3 ng/mL) was added for stimulation, and samples were collected after 72 hours;

    [1584] 3-3 & a2 & H3 group: the mixture of lipid mixture with HJT-sRNA-3, HJT-sRNA-a2, HJT-sRNA-H3 was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1585] 3-m7: a mixture of lipid mixture and HJT-sRNA-m7 was added to the cells, mixed, and the final concentration of the nucleic acid was 400 nM;

    [1586] Right Figure: lipid-RNA mixture was prepared by reverse evaporation. Lipid combination 6 (No. 40 (PE)+No. 12 (PC)+No. 41 (So)=2:4:3) could effectively deliver XRN2, Ssu72, CPSF4 siRNA into A549 Cells, which significantly reduce expression levels at the protein level.

    [1587] siNC: the mixture of lipid mixture and siNC was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1588] siRNA: the mixture of lipid mixture and XRN2, Ssu72, CPSF4 siRNA were added to the cells, mixed, and the final concentration of the nucleic acid was 400 nM;

    [1589] 5) Effect of lipid combination 7 (No. 12 (PC)+No. 41 (So)=1:6) and lipid combination 8 (No. 12 (PC)+No. 41 (So)=1:1) on nucleic acid delivery.

    [1590] As shown in FIG. 120, by the reverse evaporation method, lipid combination 7 (No. 12 (PC)+No. 41 (So)=1:6) and lipid combination 8 (No. 12 (PC)+No. 41 (So)=1:1) could effectively deliver Ssu72, CPSF4 siRNA into A549 Cells, which significantly reduced the expression levels at the protein level.

    [1591] siNC: the mixture of lipid mixture and siNC was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1592] siRNA: the mixture of lipid mixture and XRN2, Ssu72, CPSF4 siRNA was added to the cells, mixed, and the final concentration of the nucleic acid was 400 nM;

    [1593] 6) Effect of lipid combination 9 (No. 12 (PC)+No. 41 (So)=6:1) and lipid combination 10 (No. 40 (PE)+No. 12 (PC)+No. 41 (So)=2:2:2) on nucleic acid delivery.

    [1594] As shown in FIG. 121, by the reverse evaporation method, lipid combination 9 (No. 12 (PC)+No. 41 (So)=6:1) and lipid combination 10 (No. 40 (PE)+No. 12 (PC)+No. 41 (So)=2:2:2) could effectively deliver XRN2, Ssu72, CPSF4 siRNA into A549 Cells, which significantly reduced the expression levels at the protein level.

    [1595] siNC: the mixture of lipid mixture and siNC was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1596] siRNA: the mixture of lipid mixture and XRN2, Ssu72, CPSF4 siRNA was added to the cells, mixed, and the final concentration of the nucleic acid was 400 nM;

    [1597] 7) Effect of lipid combination 11 (No. 4 (Cer)+No. 12 (PC)+No. 41 (So)=1:1:1) on nucleic acid delivery.

    [1598] As shown in FIG. 122, by the reverse evaporation method, lipid combination 11 (No. 4 (Cer)+No. 12 (PC)+No. 41 (So)=1:1:1) could effectively deliver Ssu72 siRNA into A549 Cells, which significantly reduced the expression levels at protein level.

    [1599] siNC: the mixture of lipid mixture and siNC was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    [1600] siSsu72: the mixture of lipid mixture and Ssu72 siRNA was added to the cells, mixed, and the final concentration of the nucleic acid was 400 nM;

    Example 6: Validation of the Effect of Lipid No. 38 and its Combination

    [1601] Lipid No. 38 PE (16:0/16:1)

    ##STR00074##

    [1602] 1. Quantitative Real-Time PCR (Real-Time PCR) Detection of the Efficiency of the Nucleic Acid Delivery by Lipid

    [1603] (1) Lipid No. 38 by boiling method delivered double-stranded RNA into A549 and MRC-5 cells.

    [1604] As shown in FIG. 123, lipid No. 38 by heating method delivered double-stranded RNA into A549 and MRC-5 cells. For MRC-5 cells, in the case of the heating method, the delivery effect of lipid No. 38 on double-stranded RNA was about twice that of RNAiMAX.

    [1605] 1) Naive group: untreated A549 cells;

    [1606] 2) Free uptake group: HJT-sRNA-m7 dsRNA was directly incubated with cells for 12 hours; the final concentration of nucleic acid was 100 nM;

    [1607] 3) RNAiMAX group: 2 L RNAiMAX transfection reagent and double-stranded HJT-sRNA-m7 solution were diluted in 100 L opti-MEM medium respectively, and then the two were mixed, allowed to stay for 15 min, added into the cells, and then mixed. The final concentration of HJT-sRNA-m7 double-strand was 100 nM;

    [1608] 4) Treatment group of lipid and nucleic acid: a mixture of 2.5 L single lipid No. 38 and HJT-sRNA-m7 double-stranded nucleic acid solution was prepared by boiling method or reverse evaporation method, and then added to A549 cells. The final concentration of RNA was 100 nM. After 12 hours, the sample was collected to detect the amount of entry.

    [1609] (2) Lipid No. 38 by boiling method delivered HJT-sRNA-m7 single-stranded RNA into A549 and MRC-5 cells.

    [1610] As shown in FIG. 124, lipid No. 38 by heating method delivered HJT-sRNA-m7 single-stranded RNA into A549 and MRC-5 cells, where the efficiency of delivery was much higher than that of RNAiMAX.

    [1611] 1) Naive group: untreated A549 cells;

    [1612] 2) Free uptake group: HJT-sRNA-m7 single stranded RNA was directly incubated with cells for 12 hours; the final concentration of nucleic acid was 100 nM;

    [1613] 3) RNAiMAX group: 2 L RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 L opti-MEM medium respectively, and then the two were mixed, allowed to stay for 15 min, added into the cells, and then mixed, and the final concentration of single-stranded HJT-sRNA-m7 was 100 nM;

    [1614] 4) Treatment group of lipid and nucleic acid: a mixture of 2.5 L single lipid No. 64 and HJT-sRNA-m7 double-stranded nucleic acid solution was prepared by boiling method or reverse evaporation method, and added to A549 cells, the final concentration of RNA was 100 nM. After 12 hours, the sample was collected to detect the amount of entry.

    [1615] 2. Digital PCR (ddPCR) Detection of the Efficiency of Nucleic Acid Delivery by Lipid

    [1616] 2.1 Experimental Materials: A549 Cells were Purchased from the Cell Center of the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, TRIzol Lysis Buffer was Purchased from Sigma, High Capacity cRNA Reverse Transcription Kit was Purchased from ABI, USA, and Digital PCR Related Reagents were Purchased from Bio-Rad.

    [1617] 2.2 Experimental Method: Total RNA was Collected and Extracted by TRIzol Lysis Buffer According to the Above Method, and Reverse Transcribed to cDNA Using High Capacity cRNA Reverse Transcription Kit, and the cDNA from Different Groups was Subjected to Digital PCR Reaction. Refer to the QX200 Droplet Reader and QuantaSoft Software Manual for the Protocols; the Results were Analyzed Using QuantaSoft Software.

    [1618] (1) Naive group: A549 cells without any treatment;

    [1619] (2) Free uptake group: the cells were directly co-incubated with HJT-sRNA-m7 dsRNA for 6 hours;

    [1620] (3) RNAiMAX group: the HJT-sRNA-m7 dsRNA was transfected into A549 cells by RNAiMAX, and the samples were collected for detection after 6 hours;

    [1621] (4) No. 38 group: lipid No. 38 delivered double-stranded RNA into A549 cells by different prepration methods (boiling or evaporation method), and the samples were collected for detection after 6 hours;

    [1622] Experimental results and analysis: As shown in FIG. 125, in the boiling or reverse evaporation method, lipid No. 38 could effectively deliver HJT-sRNA-m7 dsRNA into A549 cells.

    [1623] 3. Flow Cytometry Detection of the Efficiency of Nucleic Acid Delivery by Lipid

    [1624] Experimental materials: A549 cells (purchased from the Cell Center of the Chinese Academy of Medical Sciences), FAM-sRNA (purchased from Ribobio Biotechnology Co., Ltd.), lipid No. 38, Accuri C6 instrument (purchased from BD, USA).

    [1625] Experimental Method: PGY-sRNA-6-FAM was dissolved in 100 l water, and mixed with 4 l lipid, and prepared into lipid-sRNA mixture by boiling method. Then, the mixture was dropped into A549 cells, and after 6 hours of co-incubation, the samples were collected and washed three times with PBS, then digested with trypsin into single cells, washed with re-suspended with PBS and then blown down for Accuri C6 instrument detection.

    [1626] Experimental results (shown in FIG. 126): lipid No. 38 delivered PGY-sRNA-6 single-stranded RNA at an efficiency of 72.5%, which was close to that of the positive control RNAiMAX.

    [1627] 4. Confocal Fluorescence Microscopy to Observe the Location of the Nucleic Acid Delivered by Lipids in Cells

    [1628] Experimental materials: A549 cells (purchased from the Cell Center of the Chinese Academy of Medical Sciences), PGY-sRNA-6-Cy3 (purchased from Ribobio Biotechnology Co., Ltd.), lipid No. 38, Zeiss LSM780 (purchased from Zeiss, Germany), Alexa Fluor 488 phalloidin (purchased from Invitrogen, USA), DAPI (purchased from Invitrogen, USA), paraformaldehyde (purchased from sigma, USA).

    [1629] Experimental method: PGY-sRNA-6-FAM was dissolved in 100 l water, and mixed with 4 l lipid, and prepared by boiling method. Then, the mixture was dropped into A549 cells, and after 6 hours of co-incubation, the samples were washed three times with PBS, fixed with 4% paraformaldehyde, washed three times with PBS, stained with Alexa Fluor 488 phalloidin for 30 min, washed 3 times with PBS, and stained with DAPI for 5 min, PBS washed, and then sealed.

    [1630] Experimental results (shown in FIG. 127): the entry of red PGY-sRNA-6-Cy3 could be obviously observed under the confocal microscopy. Lipid No. 38-sRNA mixture prepared by boiling method could effectively deliver double-stranded nucleic acid into A549 cells.

    Example 7: Validation of the Effect of Lipid No. 64 and its Composition

    [1631] Lipid No. 64 PE (15:0/24:1 (15Z))

    ##STR00075##

    [1632] 1. Quantitative real-time PCR (Real-Time PCR) detection of the efficiency of the nucleic acid delivery by lipid

    [1633] (1) Lipid No. 64 prepared by different methods (boiling or reverse evaporation method) delivered HJT-sRNA-m7 double-stranded RNA into A549 cells.

    [1634] As shown in FIG. 128, lipid No. 64 delivered HJT-sRNA-m7 double-stranded RNA into A549 cells by different prepration methods (boiling or reverse evaporation method). For A549 cells, in the case of the boiling method, the delivery effect of lipid No. 64 was about 3 times that of RNAiMAX.

    [1635] 1) Naive group: untreated A549 cells;

    [1636] 2) Free uptake group: HJT-sRNA-m7 dsRNA was directly incubated with cells for 12 hours; the final concentration of nucleic acid was 100 nM;

    [1637] 3) RNAiMAX group: 2 L RNAiMAX transfection reagent and double-stranded HJT-sRNA-m7 solution were diluted in 100 L opti-MEM medium respectively, mixed, and allowed to stay for 15 min, added into the cells and mixed, and the final concentration of HJT-sRNA-m7 double-strand was 100 nM;

    [1638] 4) Treatment group of lipid and nucleic acid: a mixture of 2.5 L single lipid No. 64 and HJT-sRNA-m7 double-stranded nucleic acid solution was prepared by boiling method or reverse evaporation method and added to A549 cells, the final concentration of RNA was 100 nM. After 12 hours, the sample was collected to detect the amount of entry.

    [1639] 2. Flow Cytometry Detection of the Efficiency of Nucleic Acid Delivery by Lipid

    [1640] Experimental materials: A549 cells (purchased from the Cell Center of the Chinese Academy of Medical Sciences), FAM-sRNA (purchased from Ribobio Biotechnology Co., Ltd.), lipid No. 64, Accuri C6 instrument (purchased from BD, USA).

    [1641] Experimental Method: FAM-sRNA was dissolved in 100 l water, and mixed with 4 l lipid, prepared by boiling method. Then, the lipid-sRNA mixture was dropped into A549 cells, and after 6 hours of co-incubation, the samples were collected and washed three times with PBS, then digested into single cells with trypsin, re-suspended with PBS and then used Accuri C6 instrument to detect relative entry amount.

    [1642] Experimental results (shown in FIG. 129): lipid No. 64 deliverED PGY-sRNA-6 single-stranded RNA with an efficiency of about a half () of efficiency the positive control RNAiMAX.

    [1643] 3. Confocal Fluorescence Microscopy to Observe the Location of the Nucleic Acid Delivered by Lipids in Cells

    [1644] Experimental materials: A549 cells (purchased from the Cell Center of the Chinese Academy of Medical Sciences), PGY-sRNA-6-Cy3 (purchased from Ribobio Biotechnology Co., Ltd.), lipid No. 64, Zeiss LSM780 (purchased from Zeiss, Germany), Alexa Fluor 488 phalloidin (purchased from Invitrogen, USA), DAPI (purchased from Invitrogen, USA), paraformaldehyde (purchased from sigma, USA).

    [1645] Experimental method: PGY-sRNA-6-FAM was dissolved in 100 l water, and mixed with 4 l lipid, and prepared by boiling method. Then, the mixture was dropped into A549 cells, and after 6 hours of co-incubation, the samples were washed three times with PBS, fixed with 4% paraformaldehyde, washed three times with PBS, stained with Alexa Fluor 488 phalloidin for 30 min, washed 3 times with PBS, and stained with DAPI for 5 min, PBS washed, and then sealed.

    [1646] Experimental results (shown in FIG. 130): the entry of red PGY-sRNA-6-Cy3 could be obviously observed under the confocal microscopy. Lipid No. 64 could effectively deliver single-stranded RNA into A549 cells.

    Example 8: Validation of the Effect of Lipid No. 40 and its Composition

    [1647] Lipid No. 40 PE (16:0/22:1)

    ##STR00076##

    [1648] 1. Quantitative Real-Time PCR (Real-Time PCR) Detection of the Efficiency of the Nucleic Acid Delivery by Lipid

    [1649] (1) Lipid No. 40 prepared by different methods (boiling or reverse evaporation method) delivered double-stranded RNA into A549 cells.

    [1650] As shown in FIG. 131, lipid No. 40 by prepared by different methods (boiling or reverse evaporation method) delivered double-stranded RNA into A549 cells. For A549 cells, in the case of the reverse evaporation method, delivery effect of lipid No. 40 was about a half () of that of RNAiMAX.

    [1651] 1) Naive group: untreated A549 cells;

    [1652] 2) Free uptake group: HJT-sRNA-m7 dsRNA was directly incubated with cells for 12 hours; the final concentration of nucleic acid was 100 nM;

    [1653] 3) RNAiMAX group: 2 L RNAiMAX transfection reagent and double-stranded HJT-sRNA-m7 solution were diluted in 100 L opti-MEM medium respectively, and then the two were mixed, allowed to stay for 15 min, added into the cells, mixed, and the final concentration of HJT-sRNA-m7 double-strand was 100 nM;

    [1654] 4) Treatment group of lipid and nucleic acid: a mixture of 2.5 L single lipid No. 40 and HJT-sRNA-m7 double-stranded nucleic acid solution was prepared by boiling method or reverse evaporation method, and added to A549 cells. The final concentration of RNA was 100 nM. After 12 hours, the sample was collected to detect the amount of entry.

    [1655] 2. Digital PCR (ddPCR) Detection of the Efficiency of Nucleic Acid Delivery by Lipid

    [1656] 2.1 Experimental Materials: A549 Cells were Purchased from the Cell Center of the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, TRIzol Lysis Buffer was Purchased from Sigma, TaqMan MicroRNA Reverse Transcription KitHigh was Purchased from Thermo Fisher Technology, and Digital PCR Related Reagents were Purchased from Bio-Rad.

    [1657] 2.2 Experimental Method: Total RNA was Collected and Extracted by TRIzol Lysis Buffer According to the Above Method, and Reverse Transcribed to cDNA Using TaqMan MicroRNA Reverse Transcription KitHigh, and the cDNA from Different Groups was Subjected to Digital PCR Reaction. Refer to the QX200 Droplet Reader and QuantaSoft Software Manual for the Protocols; the Results were Analyzed Using QuantaSoft Software.

    [1658] (1) Naive group: A549 cells without any treatment

    [1659] (2) Free uptake group: the cells were directly co-incubated with HJT-sRNA-m7 dsRNA for 6 hours;

    [1660] (3) RNAiMAX group: the HJT-sRNA-m7 dsRNA was transfected into A549 cells by RNAiMAX, and the samples were collected for detection after 6 hours;

    [1661] (4) No. 40 group: lipid No. 40 prepared by different methods (boiling or evaporation method) delivered double-stranded RNA into A549 cells, and the samples were collected for detection after 6 hours;

    [1662] Experimental results and analysis: As shown in FIG. 132, in the boiling or reverse evaporation method, lipid No. 40 could effectively deliver HJT-sRNA-m7 dsRNA into A549 cells.

    [1663] 3. Confocal Fluorescence Microscopy to Observe the Location of the Nucleic Acid Delivered by Lipids in Cells

    [1664] Experimental materials: A549 cells (purchased from the Cell Center of the Chinese Academy of Medical Sciences), PGY-sRNA-6-Cy3 (purchased from Ribobio Biotechnology Co., Ltd.), lipid No. 40, Zeiss LSM780 (purchased from Zeiss, Germany), Alexa Fluor 488 phalloidin (purchased from Invitrogen, USA), DAPI (purchased from Invitrogen, USA), paraformaldehyde (purchased from sigma, USA).

    [1665] Experimental method: PGY-sRNA-6-FAM was dissolved in 100 l water, and mixed with 4 l lipid, and prepared by boiling method. Then, the mixture was dropped into A549 cells, and after 6 hours of co-incubation, the samples were washed three times with PBS, fixed with 4% paraformaldehyde, washed three times with PBS, stained with Alexa Fluor 488 phalloidin for 30 min, washed 3 times with PBS, and stained with DAPI for 5 min, PBS washed, and then sealed.

    [1666] Experimental results (shown in FIG. 133): the entry of red PGY-sRNA-6-Cy3 could be obviously observed under the confocal microscopy. Lipid No. 40 could effectively deliver single-stranded RNA into A549 cells.

    [1667] 4. Western Blotting Detection of the Efficiency of Nucleic Acid Delivery by Lipid

    [1668] As shown in FIG. 134, phosphatidylethanolamine single lipid No. 40 mediated anti-fibrotic double-stranded RNA HJT-sRNA-m7 entry into MRC-5 cells to down-regulate fibronectin protein expression.

    [1669] TGF: TGF-1 protein (final concentration was 3 ng/mL) was added for stimulation, and the samples were collected after 72 hours;

    [1670] 3-NC group: lipid mixture was used to deliver NC mimics and after 24 hours, the cells were stimulated with TGF- 1 protein (final concentration was 3 ng/mL), and the samples were collected after 72 hours;

    [1671] 3-m7 group: a mixture of lipid mixture and HJT-sRNA-m7 double-stranded nucleic acid solution was added to the cells and mixed, and the final concentration of the nucleic acid was 400 nM;

    Example 8: Validation of the Effect of Lipid No. 37

    [1672] Lipid No. 37 LPC (18:3)

    ##STR00077##

    [1673] 1. Quantitative Real-Time PCR (Real-Time PCR) Detection of the Efficiency of the Nucleic Acid Delivery by Lipid

    [1674] (1) Lipid No. 37 delivered single-stranded RNA into A549 and MRC-5 cells by boiling method.

    [1675] As shown in FIG. 135, single-stranded RNA was delivered to A549 and MRCS cells by boiling method.

    [1676] 1) Naive group: untreated A549 cells;

    [1677] 2) Free uptake group: HJT-sRNA-m7 dsRNA was directly incubated with cells for 3 hours; the final concentration of nucleic acid was 100 nM;

    [1678] 3) RNAiMAX group: 2 L RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 L opti-MEM medium respectively, mixed, and allowed to stay for 15 min, added into the cells, mixed, and the final concentration of HJT-sRNA-m7 single-strand was 100 nM;

    [1679] 4) Treatment group of lipid and nucleic acid: a mixture of 2.5 L single lipid No. 39 and HJT-sRNA-m7 single-stranded nucleic acid solution was prepared by boiling method or reverse evaporation method and added to A549 cells, the final concentration of RNA was 100 nM. After 3 hours, the sample was collected to detect the amount of entry.

    Example 9: Validation of the Effect of Lipid No. 39

    [1680] Lipid No. 39 PE (16:1-18:1)

    ##STR00078##

    [1681] 1. Quantitative Real-Time PCR (Real-Time PCR) Detection of the Efficiency of the Nucleic Acid Delivery by Lipid

    [1682] As shown in FIG. 136, Lipid No. 39 prepared by different methods (boiling or reverse evaporation method) delivered double-stranded RNA into A549 cells

    [1683] 1) Naive group: untreated A549 cells;

    [1684] 2) Free uptake group: HJT-sRNA-m7 dsRNA was directly incubated with cells for 6 hours; the final concentration of nucleic acid was 100 nM;

    [1685] 3) RNAiMAX group: 2 L RNAiMAX transfection reagent and double-stranded HJT-sRNA-m7 solution were diluted in 100 L opti-MEM medium respectively, mixed, and allowed to stay for 15 min, added into the cells and mixed, and the final concentration of HJT-sRNA-m7 double-strand was 100 nM;

    [1686] 4) Treatment group of lipid and nucleic acid: a mixture of 2.5 L single lipid No. 39 and HJT-sRNA-m7 double-stranded nucleic acid solution was prepared by boiling method or reverse evaporation method and added to A549 cells, the final concentration of RNA was 100 nM. After 12 hours, the sample was collected to detect the amount of entry.

    [1687] 2. Digital PCR (ddPCR) Detection of the Efficiency of Nucleic Acid Delivery by Lipid

    [1688] 2.1 Experimental Materials: A549 Cells were Purchased from the Cell Center of the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, TRIzol Lysis Buffer was Purchased from Sigma, High Capacity cRNA Reverse Transcription Kit was Purchased from ABI, USA, and Digital PCR Related Reagents were Purchased from Bio-Rad.

    [1689] 2.2 Experimental Method: Total RNA was Collected and Extracted by TRIzol Lysis Buffer According to the Above Method, and Reversed to cDNA Using High Capacity cRNA Reverse Transcription Kit, and the cDNA from Different Groups was Subjected to Digital PCR Reaction. Refer to the QX200 Droplet Reader and QuantaSoft Software Manual for the Protocols; the Results were Analyzed Using QuantaSoft Software.

    [1690] (1) Naive group: A549 cells without any treatment;

    [1691] (2) Free uptake group: the cells were directly co-incubated with HJT-sRNA-m7 dsRNA for 6 hours; 12 hours;

    [1692] (3) RNAiMAX group: the HJT-sRNA-m7 dsRNA was transfected into A549 cells by RNAiMAX, and the samples were collected for detection after 6 hours, 12 hours;

    [1693] (4) No. 39 group: lipid No. 39 delivered double-stranded RNA into A549 cells by reverse evaporation method, and the samples were collected for detection after 6 hours, 12 hours;

    [1694] As shown in FIG. 137, by the reverse evaporation method, lipid No. 39 could effectively deliver HJT-sRNA-m7 dsRNA into A549 cells.

    Example 10: Validation of the Effect of Lipid No. 60 and No. 62

    [1695] Lipid No. 60 dMePE (16:1/16:1)

    ##STR00079##

    [1696] 1. Quantitative Real-Time PCR (Real-Time PCR) Detection of the Efficiency of the Nucleic Acid Delivery by Lipid

    [1697] As shown in FIG. 138, Lipid No. 60 prepared by different methods (boiling or reverse evaporation method) delivered double-stranded RNA into A549 cells 7) Naive group: untreated A549 cells;

    [1698] 8) Free uptake group: HJT-sRNA-m7 dsRNA was directly incubated with cells for 6 hours; the final concentration of nucleic acid was 100 nM;

    [1699] RNAiMAX group: 2 L RNAiMAX transfection reagent and double-stranded HJT-sRNA-m7 solution were diluted in 100 L opti-MEM medium respectively, and then the two were mixed, allowed to stay for 15 min, added into the cells, and then mixed, the the final concentration of double-stranded HJT-sRNA-m7 was 100 nM;

    [1700] 4) Lipid and nucleic acid: a mixture of 2.5 L single lipid No. 60 and HJT-sRNA-m7 double-stranded nucleic acid solution was prepared by boiling method or reverse evaporation method and added to cells, the final concentration of RNA was 100 nM. After 12 hours, the sample was collected to detect the amount of entry.

    [1701] Lipid No. 62 dMePE (16:1/18:1) 1. Quantitative real-time PCR (Real-Time PCR) detection of the efficiency of the nucleic acid delivery by lipid

    [1702] As shown in FIG. 139, Lipid No. 62 prepared by different methods (boiling or reverse evaporation method) delivered double-stranded RNA into A549 cells 1) Naive group: untreated A549 cells;

    [1703] 2) Free uptake group: HJT-sRNA-m7 dsRNA was directly incubated with cells for 6 hours; the final concentration of nucleic acid was 100 nM;

    [1704] 3) RNAiMAX group: 2 L RNAiMAX transfection reagent and double-stranded HJT-sRNA-m7 solution were diluted in 100 L opti-MEM medium respectively, and then the two were mixed, allowed to stay for 15 min, added into the cells, and then mixed, and the final concentration of HJT-sRNA-m7 double-strand was 100 nM;

    [1705] 4) Treatment group of lipid and nucleic acid: a mixture of 2.5 L single lipid No. 62 and HJT-sRNA-m7 double-stranded nucleic acid solution was prepared by boiling method or reverse evaporation method and added to cells, and the final concentration of RNA was 100 nM. After 12 hours, the sample was collected to detect the amount of entry.

    [1706] In Vivo Delivery Experiment of Lipid Nucleic Acid Mixture

    [1707] 1. Experimental animals: C57 mice, male, approximately 6 weeks old.

    [1708] 2. Manufacture of lipid mixture: the prepration was conducted on the basis of a dose of 10 l lipid-1 nmol sRNA per mouse as follows: dissolve 1 nmol of each sRNA in 500 l DEPC water, add 10 l of the corresponding lipid, pipette to mix thoroughly, and then naturally cool down after water bath for 15 min at 90 C., and administer via gavage.

    [1709] 3. sRNA: PGY-sRNA-26, PGY-sRNA-32

    [1710] 4. Experimental groups:

    [1711] 1) Naive group: intragastric administration of 500 l saline;

    [1712] 2) RNAiMAX treatment group: 10 l RNAiMAX-1 nmol sRNA was mixed thoroughly and intragastrically administered to each mouse. This group served as a positive control group. RNAiMAX was purchased from Invitrogen.

    [1713] 3) Free uptake group: sRNA solution (1 nmol/animal, 500 L) was directly added, and the group served as a negative control;

    [1714] 4) Treatment group of lipid nucleic acid mixture: the lipid-sRNA mixture prepared in the step 2 was intragastrically administrated.

    [1715] 5. Detection of the relative amount of entry:

    [1716] 1) Tissue sampling and extraction of RNA: 6 hours after gavage in mice, take 500 l of blood from the eyeball, add 1.5 ml Trizol Reagent LS to thoroughly mix and lyse, add 3 ml Trizol Reagent (purchased from Invitrogen) to the tissue samples and homogenize until complete lysis. Tissues sampled: live/stomach/small intestine.

    [1717] 2) Reverse transcription of sRNA to cDNA: Reverse Transcription Kit (High-Capacity cDNA Reverse Transcription Kits, Applied Biosystems, cat. no. 4368813), was used to reverse transcribe the total RNA to cDNA, and the reverse system was as follows: template RNA (150 ng/L) 10 L, 10RT buffer, 2.0 L, 25dNTP Mix (100 mM) 0.8 L, random primers 2.0 L, the Multi Scribe reverse Transcriptase 1.0 L, RNase inhibitor 1.0 L, nuclease-free H.sub.2O 3.2 L. After a brief centrifugation, the reaction was loaded in a PCR reactor. The reaction conditions were as follows: (1) 25 C., 10 min; (2) 37 C., 120 min; (3) 85 C., 5 min; (4) 4 C., termination of the reaction. After the reaction, 20 L RNase-free ddH.sub.2O was added to make up the final volume to 40 L.

    [1718] 3) Quantitative PCR amplification reactions: the qPCR reaction system had a total volume of 10 l, containing: 5 l 2SYBR Green Master Mix, 0.5 l forward primer (10 M), 0.5 L reverse primer, 1 l cDNA by reverse transcription, 3 l RNase-free dH2O. LightCycler 480 fluorescence quantitative PCR instrument was used, and the PCR reaction conditions were: 95 C., 5 min for pre-denaturation, followed by the PCR amplification cycle: (1) 95 C., 10 s; (2) 55 C., 10 s; (3) 72 C., 20 s; a total of 40 cycles; 40 C. for 10 s in the end to cool down. The forward primer and reverse primer of the amplification reaction was designed and synthesized by Beijing Qing Ke New Industrial Biotechnology Co., Ltd. (U6 F primer: GCGCGTCGTGAAGCGTTC (SEQ ID NO: 113), U6R primer: GTGCAGGGTCCGAGGT (SEQ ID NO: 114)).

    [1719] 3) The relative expression amount was calculated by the 2-Ct method.

    Example 11-1: Delivery of Single-Stranded Nucleic Acids by Single Lipid No. 41 In Vivo

    [1720] 1. Experimental animals: C57 mice, male, approximately 6 weeks old.

    [1721] 1) Naive group: intragastric administration of 500 l saline;

    [1722] 2) RNAiMAX treatment group: 10 l RNAiMAX-1 nmol sRNA was mixed and intragastrically administered to each mouse. This group served as a positive control group. RNAiMAX was purchased from Invitrogen.

    [1723] 3) Free uptake group: single-stranded sRNA mixture solution (1 nmol each) was directly added (1 nmol each);

    [1724] 4) Treatment group of POPC and nucleic acid: a mixture of 10 L of POPC with single-stranded sRNA mixture solution (1 nmol) was treated by heating method and then given to mice by intragastric administration.

    [1725] 5) Treatment group of single lipid and nucleic acid mixture: a mixture of 10 L of single lipid (No. 41) with single-stranded sRNA mixture solution (PGY-sRNA-23, PGY-sRNA-26 and PGY-sRNA-32, 1 nmol each) was treated by heating method and then given to mice by intragastric administration.

    [1726] 2. 12 hours after intragastric administration, the blood was taken from the eyeball, and various tissues (liver/stomach/small intestine) was sampled. TRIzol was used for full lysis and the RNA was extracted to detect the amount of entry.

    [1727] Conclusion:

    [1728] As shown in FIG. 140, single PE (No. 41) could effectively deliver sRNA single-stranded nucleic acid into the mouse blood via oral administration to protect sRNA from degradation, and the delivery effect was better than POPC and Lipofectamine RNAiMAX.

    [1729] As shown in FIG. 141, single PE (No. 41) could effectively deliver sRNA single-stranded nucleic acid into the mouse stomach via oral administration to protect sRNA from degradation.

    [1730] As shown in FIG. 142, single PE (No. 41) could effectively deliver sRNA single-stranded nucleic acid into the mouse small intestine via oral administration to protect sRNA from degradation.

    [1731] As shown in FIG. 143, single PE (No. 41) could effectively deliver sRNA single-stranded nucleic acid into the mouse liver via oral administration to protect sRNA from degradation.

    Example 11-2: Delivery of Single-Stranded Nucleic Acids by Single Lipid No. 38 In Vivo

    [1732] 1. Experimental animals: C57 mice, male, approximately 6 weeks old.

    [1733] 1) Naive group: intragastric administration of 500 l saline;

    [1734] 2) RNAiMAX treatment group: 10 l RNAiMAX-1 nmol sRNA was mixed and intragastrically administered to each mouse. This group served as a positive control group. RNAiMAX was purchased from Invitrogen.

    [1735] 3) Free uptake group: single-stranded sRNA mixture solution (1 nmol each) was directly added (each 1 nmol);

    [1736] 4) Treatment group of POPC and nucleic acid: a mixture of 10 L POPC and single-stranded PGY-sRNA-32 sRNA (each 1 nmol) mixture solution that was treated by heating method was given to mice by gavage.

    [1737] 5) Treatment group of single lipid and nucleic acid mixture: a mixture of a 10 L single lipid (No. 38) and single-stranded sRNA (PGY-sRNA-32) mixture solution (each 1 nmol) that was treated by heating method was given to mice by gavage.

    [1738] 2. 12 hours after gavage, the blood was taken from the eyeball and lysed by TRIzol to extract RNA for the dection of the amount of entry.

    [1739] Conclusion:

    [1740] As shown in FIG. 144, single PE (No. 38) could effectively deliver sRNA single-stranded nucleic acid into mouse blood via oral administration, and the delivery effect was better than POPC and Lipofectamine RNAiMAX.

    Example 11-3: Delivery of Single-Stranded Nucleic Acids by Single Lipid No. 40 In Vivo

    [1741] 1. Experimental animals: C57 mice, male, approximately 6 weeks old.

    [1742] 1) Naive group: intragastric administration of 500 l saline;

    [1743] 2) RNAiMAX treatment group: 10 l RNAiMAX-1 nmol sRNA was mixed and intragastrically administered to each mouse. This group served as a positive control group. RNAiMAX was purchased from Invitrogen.

    [1744] 3) Free uptake group: single-stranded sRNA mixture solution was directly added (each 1 nmol);

    [1745] 4) Treatment group of POPC and nucleic acid: a mixture of 10 L POPC and single-stranded sRNA (each 1 nmol) mixture solution that was treated by heating method was given to mice by gavage.

    [1746] 5) Treatment group of single lipid and nucleic acid mixture: a mixture of a 10 L single lipid (No. 40) and single-stranded sRNA (PGY-sRNA-32 and PGY-sRNA-26, 1 nmol each) mixture solution that was treated by heating method was given to mice by gavage.

    [1747] 2. 12 hours after gavage, the blood was taken from the eyeball and lysed by TRIzol to extract RNA for the dection of the amount of entry.

    [1748] Conclusion:

    [1749] As shown in FIG. 145, single PE (No. 40) could effectively deliver sRNA single-stranded nucleic acid into mouse blood via oral administration, and the delivery effect was better than POPC and Lipofectamine RNAiMAX.

    Example 11-4: Delivery of Single-Stranded Nucleic Acids by Single Lipid No. 64 In Vivo

    [1750] 1. Experimental animals: C57 mice, male, approximately 6 weeks old.

    [1751] 1) Naive group: intragastric administration of 500 l saline;

    [1752] 2) RNAiMAX treatment group: 10 l RNAiMAX-1 nmol sRNA was mixed and intragastrically administered to each mouse. This group served as a positive control group. RNAiMAX was purchased from Invitrogen.

    [1753] 3) Free uptake group: single-stranded sRNA mixture solution was directly added (each 1 nmol);

    [1754] 4) Treatment group of POPC and nucleic acid: a mixture of 10 L POPC and single-stranded sRNA (each 1 nmol) mixture solution that was treated by heating method was given to mice by gavage.

    [1755] 5) Treatment group of single lipid and nucleic acid mixture: a mixture of a 10 L single lipid (No. 64) and single-stranded sRNA (PGY-sRNA-32, 1 nmol each) mixture solution that was treated by heating method was given to mice by gavage.

    [1756] 2. 12 hours after gavage, the blood was taken from the eyeball and lysed by TRIzol to extract RNA for the dection of the amount of entry.

    [1757] Conclusion:

    [1758] As shown in FIG. 146, single PE (No. 64) could effectively deliver sRNA single-stranded nucleic acid into mouse blood via oral administration, and the delivery effect was better than POPC and Lipofectamine RNAiMAX.

    Example 11-5: Delivery of Single-Stranded Nucleic Acids by Single Lipid No. 71 In Vivo

    [1759] 1. Experimental animals: C57 mice, male, approximately 6 weeks old.

    [1760] 1) Naive group: intragastric administration of 500 l saline;

    [1761] 2) RNAiMAX treatment group: 10 l RNAiMAX-1 nmol sRNA was mixed and intragastrically administered to each mouse. This group served as a positive control group. RNAiMAX was purchased from Invitrogen.

    [1762] 3) Free uptake group: single-stranded sRNA mixture solution was directly added (each 1 nmol);

    [1763] 4) Treatment group of POPC and nucleic acid: a mixture of 10 L POPC and single-stranded sRNA (each 1 nmol) mixture solution that was treated by heating method was given to mice by gavage.

    [1764] 5) Treatment group of single lipid and nucleic acid mixture: a mixture of a 10 L single lipid (No. 71) and single-stranded sRNA mixture (PGY-sRNA-32, 1 nmol each) solution that was treated by heating method was given to mice by gavage.

    [1765] 2. 12 hours after gavage, the blood was taken from the eyeball and lysed by TRIzol to extract RNA for the dection of the amount of entry.

    [1766] Conclusion:

    [1767] As shown in FIG. 147, single PE (No. 71) could effectively deliver sRNA single-stranded nucleic acid into mouse blood via oral administration, and the delivery effect was better than POPC and Lipofectamine RNAiMAX.

    Example 12: Lipids Effectively Deliver Single-Stranded Nucleic Acids into MRC-5 Cell at Different Temperature Gradients

    [1768] 1. Experimental groups:

    [1769] 1) Naive group: untreated cells;

    [1770] 2) RNAiMAX treatment group: 2 L RNAiMAX transfection reagent and single-stranded HJT-sRNA-m7 solution were diluted in 100 L opti-MEM medium respectively, and then the two were mixed, allowed to stay for 15 min, added into the cells, and then mixed, and the final concentration of single-stranded HJT-sRNA-m7 was 100 nM;

    [1771] 3) Treatment group of single lipid and nucleic acid mixture: mixtures of 2.5 L single lipid (No. 38) and HJT-sRNA-m7 double-stranded nucleic acid solution that were treated by boiling method at different temperatures was added to the cells and then mixed, and the final concentration of RNA was 100 nM.

    [1772] 4 C.: to 100 L single-stranded HJT-sRNA-m7 solution was added 2.5 L single lipid and placed at 4 C. for 15 min; 6 hours after the addition of the cells, the expression level of HJT-sRNA-m7 in cells was detected by RT-qPCR.

    [1773] 37 C.: to 100 L single-stranded HJT-sRNA-m7 solution was added 2.5 L single lipid and placed at 37 C. for 15 min. 6 hours after the addition of the cells, the expression level of HJT-sRNA-m7 in cells was detected by RT-qPCR.

    [1774] 60 C.: to 100 L single-stranded HJT-sRNA-m7 solution was added 2.5 L single lipid and heated at 50 C. for 15 min. 6 hours after the addition of the cells, the expression level of HJT-sRNA-m7 in cells was detected by RT-qPCR.

    [1775] 80 C.: to 100 L single-stranded HJT-sRNA-m7 solution was added 2.5 L single lipid and heated at 80 C. for 15 min. 6 hours after the addition of the cells, the expression level of HJT-sRNA-m7 in cells was detected by RT-qPCR.

    [1776] 100 C.: to 100 L HJT-sRNA-m7 single-stranded solution was added 2.5 L single lipid and heated at 100 C. for 15 min. 6 hours after the addition of the cells, the expression level of HJT-sRNA-m7 in cells was detected by RT-qPCR.

    [1777] Conclusion:

    [1778] As shown in FIG. 148, results showed that the lipids by the boiling method at different temperate conditions could effectively deliver nucleic acids into cells (statistically significant, p<0.01), having the potential of improving the efficiency of the delivery of nucleic acid drug in clinical settings.