VARIANTS OF CAS12A NUCLEASES AND METHODS OF MAKING AND USE THEREOF
20210115421 ยท 2021-04-22
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C07K14/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C07K2319/70
CHEMISTRY; METALLURGY
International classification
C12N9/22
CHEMISTRY; METALLURGY
C07K14/20
CHEMISTRY; METALLURGY
C12N15/10
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
This invention relates to variants of Cas12a nucleases having altered protospacer adjacent motif recognition specificity. The invention further relates to methods of making CRISPR-CAS nuclease variants and methods of modifying nucleic acids using the variants.
Claims
1. A modified Lachnospiraceae bacterium CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) Cas12a (LbCas12a) polypeptide, wherein the modified LbCas12a polypeptide comprises an amino acid sequence having at least 80% identity to the amino acid sequence of SEQ ID NO:1 (LbCas12a) and a mutation at one or more than one of the following positions of K116, K120, K121, D122, E125, T148, T149, T152, D156, E159, Q529, D535, K538, D541, Y542, L585, K591, M592, K595, V596, S599, K600, K601, Y616, Y646, W649 with reference to position numbering of SEQ ID NO:1, optionally a mutation at one or more than one of the following positions of K116, K120, K121, D122, E125, T152, D156, E159, G532, D535, K538, D541, and/or K595 with reference to position numbering of SEQ ID NO:1.
2. The modified LbCas12a polypeptide of claim 1, wherein the modified LbCas12a polypeptide comprises one or more than one or the amino acid mutations of K116R, K116N, K120R, K120H, K120N, K120T, K120Y, K120Q, K121S, K121T, K121H, K121R, K121G, K121D, K121Q, D122R, D122K, D122H, D122E, D122N, E125R, E125K, E125Q, E125Y, T148H, T148S, T148A, T148C, T149A, T149C, T149S, T149G, T149H, T149P, T149F, T149N, T149D, T149V, T152R, T152K, T152W, T152Y, T152H, T152Q, T152E, T152L, T152F, D156R, D156K, D156Y, D156W, D156Q, D156H, D156I, D156V, D156L, D156E, E159K, E159R, E159H, E159Y, E159Q, Q529N, Q529T, Q529H, Q529A, Q529F, Q529G, Q529G, Q529S, Q529P, Q529W, Q529D, G532D, G532N, G532S, G532H, G532F, G532K, G532R, G532Q, G532A, G532L, G532C, D535N, D535H, D535V, D535T, D535,S D535A, D535W, D535K, K538R K538V, K538Q, K538W, K538Y, K538F, K538H, K538L, K538M, K538C, K538G, K538A, K538P, D541N, D541H, D541R, D541K, D541Y, D541I, D541A, D541S, D541E, Y542R, Y542K, Y542H, Y542Q, Y542F, Y542L, Y542M, Y542P, Y542V, Y542N, Y542T, L585G, L585H, L585F, K591W, K591F, K591Y, K591H, K591R, K591S, K591A, K591G, K591P, M592R, M592K, M592Q, M592E, M592A, K595R, K595Q, K595Y, K595L, K595W, K595H, K595E, K595S, K595D, K595M, V596T, V596H, V596G, V596A, S599G, S599H, S599N, S599D, K600R, K600H, K600G, K601R, K601H, K601Q, K601T, Y616K, Y616R, Y616E, Y616F, Y616H, Y646R, Y646E, Y646K, Y646H, Y646Q, Y646W, Y646N, W649H, W649K, W649Y, W649R, W649E, W649S, W649V, and/or W649T with reference to position numbering of SEQ ID NO:1, optionally comprises one or more than one of the amino acid mutations of K116R, K116N, K120Y, K121S, K121R, D122H, D122N, E125K, T152R, T152K, T152Y, T152Q, T152E, T152F, D156R, D156W, D156Q, D156H, D156I, D156V, D156L, D156E, E159K, E159R, G532N, G532S, G532H, G532K, G532R, G532L, D535N, D535H, D535T, D535,S D535A, D535W, K538R K538V, K538Q, K538W, K538Y, K538F, K538H, K538L, K538M, K538C, K538G, K538A, D541E, K595R, K595Q, K595Y, K595W, K595H, K595S, and/or K595M with reference to position numbering of SEQ ID NO:1.
3. The modified LbCas12a polypeptide of claim 1, wherein the modified LbCas12a polypeptide has an altered PAM (protospacer adjacent motif) specificity.
4. The modified LbCas12a polypeptide of claim 1, further comprising a mutation in the nuclease active site (e.g., RuvC domain) (e.g., dead LbCas12a, dLbCas12a).
5-6. (canceled)
7. A fusion protein comprising the modified LbCas12a polypeptide of claim 1, and a polypeptide of interest.
8. The fusion protein of claim 7, wherein the polypeptide of interest is linked to the modified LbCas12a polypeptide.
9-10. (canceled)
11. The fusion protein of claim 7, wherein the polypeptide of interest comprises at least one polypeptide or protein domain having deaminase (deamination) activity, nickase activity, recombinase activity, transposase activity, methylase activity, glycosylase (DNA glycosylase) activity, glycosylase inhibitor activity (e.g., uracil-DNA glycosylase inhibitor (UGI)), demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nuclease activity, single-strand RNA cleavage activity, double-strand RNA cleavage activity, restriction endonuclease activity (e.g., Fok1), nucleic acid binding activity, methyltransferase activity, DNA repair activity, DNA damage activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, polymerase activity, ligase activity, helicase activity, and/or photolyase activity.
12. The fusion protein of claim 7, wherein the polypeptide of interest comprises at least one polypeptide or protein domain having deaminase activity.
13. The fusion protein of claim 12, wherein the at least one polypeptide or protein domain having deaminase activity is a cytosine deaminase domain or an adenine deaminase domain.
14-15. (canceled)
16. The fusion protein of claim 7, wherein the at least one polypeptide has glycosylase inhibitor activity, optionally wherein the at least one polypeptide is a uracil-DNA glycosylase inhibitor (UGI).
17. A polynucleotide encoding the modified LbCas12a polypeptide of claim 1.
18. The polynucleotide of claim 17, wherein the polynucleotide encoding the modified LbCas12a polypeptide or the polynucleotide encoding the fusion protein is operatively associated with a promoter, optionally wherein the promoter is a promoter region comprising an intron.
19. The polynucleotide of claim 17, wherein the polynucleotide is codon optimized for expression in an organism.
20-23. (canceled)
24. An expression cassette or vector comprising the polynucleotide claim 17, or the nucleic acid construct of claim 22.
25. A Type V Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated (Cas) (CRISPR-Cas) system comprising: (a) a fusion protein comprising (i) the modified LbCas12a polypeptide of claim 1 or a nucleic acid encoding the modified LbCas12a polypeptide of claim 1, and (ii) a polypeptide of interest or a nucleic acid encoding the polypeptide of interest; and (b) a guide nucleic acid (CRISPR RNA, CRISPR DNA, crRNA, crDNA) comprising a spacer sequence and a repeat sequence, wherein the guide nucleic acid is capable of forming a complex with the modified LbCas12a polypeptide or the fusion protein and the spacer sequence is capable of hybridizing to a target nucleic acid, thereby guiding the modified LbCas12a polypeptide and the polypeptide of interest to the target nucleic acid, whereby the target nucleic acid is modified (e.g., cleaving or editing) or modulated (e.g., modulating transcription).
26-35. (canceled)
36. A cell comprising the polynucleotide of claim 17.
37. A method of modifying a target nucleic acid, comprising: contacting the target nucleic acid with: (a)(i) the modified LbCas12a polypeptide of claim 1, and (ii) a guide nucleic acid (e.g., CRISPR RNA, CRISPR DNA, crRNA, crDNA); (b) a composition comprising (i) the modified LbCas12a polypeptide of claim 1, and (ii) a guide nucleic acid; and/or (c) a Type V CRISPR-Cas system comprising: (a) a fusion protein comprising (i) the modified LbCas12a polypeptide of claim 1 or a nucleic acid encoding the modified LbCas12a polypeptide of claim 1, and (ii) a polypeptide of interest or a nucleic acid encoding the polypeptide of interest; and (b) a guide nucleic acid (CRISPR RNA, CRISPR DNA, crRNA, crDNA) comprising a spacer sequence and a repeat sequence, wherein the guide nucleic acid is capable of forming a complex with the modified LbCas12a polypeptide or the fusion protein and the spacer sequence is capable of hybridizing to a target nucleic acid, thereby guiding the modified LbCas12a polypeptide and the polypeptide of interest to the target nucleic acid, whereby the target nucleic acid is modified (e.g., cleaving or editing) or modulated (e.g., modulating transcription), thereby modifying the target nucleic acid.
38. A method of modifying a target nucleic acid, comprising contacting a cell or a cell free system comprising the target nucleic acid with (i) a polynucleotide encoding the modified LbCas12a polypeptide of claim 1, or an expression cassette or vector comprising the same, and (ii) a guide nucleic acid, or an expression cassette or vector comprising the same, thereby modifying the target nucleic acid.
39. A method of editing a target nucleic acid, comprising: contacting the target nucleic acid with: (a)(i) a fusion protein comprising the modified LbCas12a polypeptide of claim 1 and a polypeptide of interest, and (a)(ii) a guide nucleic acid; (b) a complex or a composition comprising a fusion protein comprising the modified LbCas12a polypeptide of claim 1 and a polypeptide of interest, and a guide nucleic acid; and/or (c) a Type V CRISPR-Cas system comprising: (i) a fusion protein comprising (i) the modified LbCas12a polypeptide of claim 1 or a nucleic acid encoding the modified LbCas12a polypeptide of claim 1, and (ii) a polypeptide of interest or a nucleic acid encoding the polypeptide of interest and (ii) a guide nucleic acid (CRISPR RNA, CRISPR DNA, crRNA, crDNA) comprising a spacer sequence and a repeat sequence, wherein the guide nucleic acid is capable of forming a complex with the modified LbCas12a polypeptide or the fusion protein and the spacer sequence is capable of hybridizing to a target nucleic acid, thereby guiding the modified LbCas12a polypeptide and the polypeptide of interest to the target nucleic acid, whereby the target nucleic acid is modified (e.g., cleaving or editing) or modulated (e.g., modulating transcription), thereby editing the target nucleic acid.
40. A method of editing a target nucleic acid, comprising contacting a cell or a cell free system comprising the target nucleic acid with: (a)(i) a polynucleotide encoding a fusion protein comprising the modified LbCas12a polypeptide of claim 1 and a polypeptide of interest, or an expression cassette or vector comprising the same, and (a)(ii) a guide nucleic acid, or an expression cassette or vector comprising the same; and/or (b) a nucleic acid construct encoding a complex comprising a fusion protein comprising the modified LbCas12a polypeptide of claim 1 and a polypeptide of interest, and a guide nucleic acid, or an expression cassette or vector comprising the same; and/or (c) a Type V CRISPR-Cas system comprising: (i) a fusion protein comprising (i) the modified LbCas12a polypeptide of claim 1 or a nucleic acid encoding the modified LbCas12a polypeptide of claim 1, and (ii) a polypeptide of interest or a nucleic acid encoding the polypeptide of interest; and (ii) a guide nucleic acid (CRISPR RNA, CRISPR DNA, crRNA, crDNA) comprising a spacer sequence and a repeat sequence, wherein the guide nucleic acid is capable of forming a complex with the modified LbCas12a polypeptide or the fusion protein and the spacer sequence is capable of hybridizing to a target nucleic acid, thereby guiding the modified LbCas12a polypeptide and the polypeptide of interest to the target nucleic acid, whereby the target nucleic acid is modified (e.g., cleaving or editing) or modulated (e.g., modulating transcription), thereby editing the target nucleic acid, thereby editing the target nucleic acid.
41-60. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
DETAILED DESCRIPTION
[0051] The present invention now will be described hereinafter with reference to the accompanying drawings and examples, in which embodiments of the invention are shown. This description is not intended to be a detailed catalog of all the different ways in which the invention may be implemented, or all the features that may be added to the instant invention. For example, features illustrated with respect to one embodiment may be incorporated into other embodiments, and features illustrated with respect to a particular embodiment may be deleted from that embodiment. Thus, the invention contemplates that in some embodiments of the invention, any feature or combination of features set forth herein can be excluded or omitted. In addition, numerous variations and additions to the various embodiments suggested herein will be apparent to those skilled in the art in light of the instant disclosure, which do not depart from the instant invention. Hence, the following descriptions are intended to illustrate some particular embodiments of the invention, and not to exhaustively specify all permutations, combinations and variations thereof.
[0052] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
[0053] All publications, patent applications, patents and other references cited herein are incorporated by reference in their entireties for the teachings relevant to the sentence and/or paragraph in which the reference is presented.
[0054] Unless the context indicates otherwise, it is specifically intended that the various features of the invention described herein can be used in any combination. Moreover, the present invention also contemplates that in some embodiments of the invention, any feature or combination of features set forth herein can be excluded or omitted. To illustrate, if the specification states that a composition comprises components A, B and C, it is specifically intended that any of A, B or C, or a combination thereof, can be omitted and disclaimed singularly or in any combination.
[0055] As used in the description of the invention and the appended claims, the singular forms a, an and the are intended to include the plural forms as well, unless the context clearly indicates otherwise.
[0056] Also as used herein, and/or refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (or).
[0057] The term about, as used herein when referring to a measurable value such as an amount or concentration and the like, is meant to encompass variations of 10%, 5%, 1%, 0.5%, or even 0.1% of the specified value as well as the specified value. For example, about X where X is the measurable value, is meant to include X as well as variations of 10%, 5%, 1%, 0.5%, or even 0.1% of X. A range provided herein for a measureable value may include any other range and/or individual value therein.
[0058] As used herein, phrases such as between X and Y and between about X and Y should be interpreted to include X and Y. As used herein, phrases such as between about X and Y mean between about X and about Y and phrases such as from about X to Y mean from about X to about Y.
[0059] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if the range 10 to 15 is disclosed, then 11, 12, 13, and 14 are also disclosed.
[0060] The term comprise, comprises and comprising as used herein, specify the presence of the stated features, integers, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and/or groups thereof.
[0061] As used herein, the transitional phrase consisting essentially of means that the scope of a claim is to be interpreted to encompass the specified materials or steps recited in the claim and those that do not materially affect the basic and novel characteristic(s) of the claimed invention. Thus, the term consisting essentially of when used in a claim of this invention is not intended to be interpreted to be equivalent to comprising.
[0062] As used herein, the terms increase, increasing, enhance, enhancing, improve and improving (and grammatical variations thereof) describe an elevation of at least about 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400%, 500% or more as compared to a control.
[0063] As used herein, the terms reduce, reduced, reducing, reduction, diminish, and decrease (and grammatical variations thereof), describe, for example, a decrease of at least about 5%, 10%, 15%, 20%, 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% as compared to a control. In particular embodiments, the reduction can result in no or essentially no (i.e., an insignificant amount, e.g., less than about 10% or even 5%) detectable activity or amount.
[0064] A heterologous or a recombinant nucleotide sequence is a nucleotide sequence not naturally associated with a host cell into which it is introduced, including non-naturally occurring multiple copies of a naturally occurring nucleotide sequence.
[0065] A native or wild type nucleic acid, nucleotide sequence, polypeptide or amino acid sequence refers to a naturally occurring or endogenous nucleic acid, nucleotide sequence, polypeptide or amino acid sequence. Thus, for example, a wild type mRNA is an mRNA that is naturally occurring in or endogenous to the organism. A homologous nucleic acid sequence is a nucleotide sequence naturally associated with a host cell into which it is introduced.
[0066] As used herein, the terms nucleic acid, nucleic acid molecule, nucleotide sequence and polynucleotide refer to RNA or DNA that is linear or branched, single or double stranded, or a hybrid thereof. The term also encompasses RNA/DNA hybrids. When dsRNA is produced synthetically, less common bases, such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine and others can also be used for antisense, dsRNA, and ribozyme pairing. For example, polynucleotides that contain C-5 propyne analogues of uridine and cytidine have been shown to bind RNA with high affinity and to be potent antisense inhibitors of gene expression. Other modifications, such as modification to the phosphodiester backbone, or the 2-hydroxy in the ribose sugar group of the RNA can also be made.
[0067] As used herein, the term nucleotide sequence refers to a heteropolymer of nucleotides or the sequence of these nucleotides from the 5 to 3 end of a nucleic acid molecule and includes DNA or RNA molecules, including cDNA, a DNA fragment or portion, genomic DNA, synthetic (e.g., chemically synthesized) DNA, plasmid DNA, mRNA, and anti-sense RNA, any of which can be single stranded or double stranded. The terms nucleotide sequence nucleic acid, nucleic acid molecule, nucleic acid construct, oligonucleotide and polynucleotide are also used interchangeably herein to refer to a heteropolymer of nucleotides. Nucleic acid molecules and/or nucleotide sequences provided herein are presented herein in the 5 to 3 direction, from left to right and are represented using the standard code for representing the nucleotide characters as set forth in the U.S. sequence rules, 37 CFR 1.821-1.825 and the World Intellectual Property Organization (WIPO) Standard ST.25. A 5 region as used herein can mean the region of a polynucleotide that is nearest the 5 end of the polynucleotide. Thus, for example, an element in the 5 region of a polynucleotide can be located anywhere from the first nucleotide located at the 5 end of the polynucleotide to the nucleotide located halfway through the polynucleotide. A 3 region as used herein can mean the region of a polynucleotide that is nearest the 3 end of the polynucleotide. Thus, for example, an element in the 3 region of a polynucleotide can be located anywhere from the first nucleotide located at the 3 end of the polynucleotide to the nucleotide located halfway through the polynucleotide.
[0068] As used herein, the term gene refers to a nucleic acid molecule capable of being used to produce mRNA, antisense RNA, miRNA, anti-microRNA antisense oligodeoxyribonucleotide (AMO) and the like. Genes may or may not be capable of being used to produce a functional protein or gene product. Genes can include both coding and non-coding regions (e.g., introns, regulatory elements, promoters, enhancers, termination sequences and/or 5 and 3 untranslated regions). A gene may be isolated by which is meant a nucleic acid that is substantially or essentially free from components normally found in association with the nucleic acid in its natural state. Such components include other cellular material, culture medium from recombinant production, and/or various chemicals used in chemically synthesizing the nucleic acid.
[0069] The term mutation refers to point mutations (e.g., missense, or nonsense, or insertions or deletions of single base pairs that result in frame shifts), insertions, deletions, and/or truncations. When the mutation is a substitution of a residue within an amino acid sequence with another residue, or a deletion or insertion of one or more residues within a sequence, the mutations are typically described by identifying the original residue followed by the position of the residue within the sequence and by the identity of the newly substituted residue.
[0070] The terms complementary or complementarity, as used herein, refer to the natural binding of polynucleotides under permissive salt and temperature conditions by base-pairing. For example, the sequence A-G-T (5 to 3) binds to the complementary sequence T-C-A (3 to 5). Complementarity between two single-stranded molecules may be partial, in which only some of the nucleotides bind, or it may be complete when total complementarity exists between the single stranded molecules. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands.
[0071] Complement as used herein can mean 100% complementarity with the comparator nucleotide sequence or it can mean less than 100% complementarity (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and the like, complementarity).
[0072] A portion or fragment of a nucleotide sequence of the invention will be understood to mean a nucleotide sequence of reduced length relative (e.g., reduced by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides) to a reference nucleic acid or nucleotide sequence and comprising, consisting essentially of and/or consisting of a nucleotide sequence of contiguous nucleotides identical or almost identical (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical) to the reference nucleic acid or nucleotide sequence. Such a nucleic acid fragment or portion according to the invention may be, where appropriate, included in a larger polynucleotide of which it is a constituent. As an example, a repeat sequence of guide nucleic acid of this invention may comprise a portion of a wild type CRISPR-Cas repeat sequence (e.g., a wild type Cas9 repeat, wild type Cas12a repeat, and the like).
[0073] Different nucleic acids or proteins having homology are referred to herein as homologues. The term homologue includes homologous sequences from the same and other species and orthologous sequences from the same and other species. Homology refers to the level of similarity between two or more nucleic acid and/or amino acid sequences in terms of percent of positional identity (i.e., sequence similarity or identity). Homology also refers to the concept of similar functional properties among different nucleic acids or proteins. Thus, the compositions and methods of the invention further comprise homologues to the nucleotide sequences and polypeptide sequences of this invention. Orthologous, as used herein, refers to homologous nucleotide sequences and/or amino acid sequences in different species that arose from a common ancestral gene during speciation. A homologue of a nucleotide sequence of this invention has a substantial sequence identity (e.g., at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100%) to said nucleotide sequence of the invention.
[0074] As used herein sequence identity refers to the extent to which two optimally aligned polynucleotide or polypeptide sequences are invariant throughout a window of alignment of components, e.g., nucleotides or amino acids. Identity can be readily calculated by known methods including, but not limited to, those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, D. W., ed.) Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., eds.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton Press, New York (1991).
[0075] As used herein, the term percent sequence identity or percent identity refers to the percentage of identical nucleotides in a linear polynucleotide sequence of a reference (query) polynucleotide molecule (or its complementary strand) as compared to a test (subject) polynucleotide molecule (or its complementary strand) when the two sequences are optimally aligned. In some embodiments, percent identity can refer to the percentage of identical amino acids in an amino acid sequence as compared to a reference polypeptide.
[0076] As used herein, the phrase substantially identical, or substantial identity in the context of two nucleic acid molecules, nucleotide sequences or protein sequences, refers to two or more sequences or subsequences that have at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection. In some embodiments of the invention, the substantial identity exists over a region of consecutive nucleotides of a nucleotide sequence of the invention that is about 10 nucleotides to about 20 nucleotides, about 10 nucleotides to about 25 nucleotides, about 10 nucleotides to about 30 nucleotides, about 15 nucleotides to about 25 nucleotides, about 30 nucleotides to about 40 nucleotides, about 50 nucleotides to about 60 nucleotides, about 70 nucleotides to about 80 nucleotides, about 90 nucleotides to about 100 nucleotides, or more nucleotides in length, and any range therein, up to the full length of the sequence. In some embodiments, the nucleotide sequences can be substantially identical over at least about 20 nucleotides (e.g., about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 nucleotides). In some embodiments, a substantially identical nucleotide or protein sequence performs substantially the same function as the nucleotide (or encoded protein sequence) to which it is substantially identical.
[0077] For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
[0078] Optimal alignment of sequences for aligning a comparison window are well known to those skilled in the art and may be conducted by tools such as the local homology algorithm of Smith and Waterman, the homology alignment algorithm of Needleman and Wunsch, the search for similarity method of Pearson and Lipman, and optionally by computerized implementations of these algorithms such as GAP, BESTFIT, FASTA, and TFASTA available as part of the GCG Wisconsin Package (Accelrys Inc., San Diego, Calif.). An identity fraction for aligned segments of a test sequence and a reference sequence is the number of identical components which are shared by the two aligned sequences divided by the total number of components in the reference sequence segment, i.e., the entire reference sequence or a smaller defined part of the reference sequence. Percent sequence identity is represented as the identity fraction multiplied by 100. The comparison of one or more polynucleotide sequences may be to a full-length polynucleotide sequence or a portion thereof, or to a longer polynucleotide sequence. For purposes of this invention percent identity may also be determined using BLASTX version 2.0 for translated nucleotide sequences and BLASTN version 2.0 for polynucleotide sequences.
[0079] Two nucleotide sequences may also be considered substantially complementary when the two sequences hybridize to each other under stringent conditions. In some representative embodiments, two nucleotide sequences considered to be substantially complementary hybridize to each other under highly stringent conditions.
[0080] Stringent hybridization conditions and stringent hybridization wash conditions in the context of nucleic acid hybridization experiments such as Southern and Northern hybridizations are sequence dependent, and are different under different environmental parameters. An extensive guide to the hybridization of nucleic acids is found in Tijssen Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes part I chapter 2 Overview of principles of hybridization and the strategy of nucleic acid probe assays Elsevier, New York (1993). Generally, highly stringent hybridization and wash conditions are selected to be about 5 C. lower than the thermal melting point (T.sub.m) for the specific sequence at a defined ionic strength and pH.
[0081] The T.sub.m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Very stringent conditions are selected to be equal to the T.sub.m for a particular probe. An example of stringent hybridization conditions for hybridization of complementary nucleotide sequences which have more than 100 complementary residues on a filter in a Southern or northern blot is 50% formamide with 1 mg of heparin at 42 C., with the hybridization being carried out overnight. An example of highly stringent wash conditions is 0.15 M NaCl at 72 C. for about 15 minutes. An example of stringent wash conditions is a 0.2SSC wash at 65 C. for 15 minutes (see, Sambrook, infra, for a description of SSC buffer). Often, a high stringency wash is preceded by a low stringency wash to remove background probe signal. An example of a medium stringency wash for a duplex of, e.g., more than 100 nucleotides, is 1SSC at 45 C. for 15 minutes. An example of a low stringency wash for a duplex of, e.g., more than 100 nucleotides, is 4-6SSC at 40 C. for 15 minutes. For short probes (e.g., about 10 to 50 nucleotides), stringent conditions typically involve salt concentrations of less than about 1.0 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is typically at least about 30 C. Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide. In general, a signal to noise ratio of 2 (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization. Nucleotide sequences that do not hybridize to each other under stringent conditions are still substantially identical if the proteins that they encode are substantially identical. This can occur, for example, when a copy of a nucleotide sequence is created using the maximum codon degeneracy permitted by the genetic code.
[0082] Any nucleotide sequence, polynucleotide and/or recombinant nucleic acid construct of this invention can be codon optimized for expression in any organism of interest. Codon optimization is well known in the art and involves modification of a nucleotide sequence for codon usage bias using species specific codon usage tables. The codon usage tables are generated based on a sequence analysis of the most highly expressed genes for the organism/species of interest. When the nucleotide sequences are to be expressed in the nucleus, the codon usage tables are generated based on a sequence analysis of highly expressed nuclear genes for the species of interest. The modifications of the nucleotide sequences are determined by comparing the species specific codon usage table with the codons present in the native polynucleotide sequences. As is understood in the art, codon optimization of a nucleotide sequence results in a nucleotide sequence having less than 100% identity (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9%, and any range or value therein) to the native nucleotide sequence but which still encodes a polypeptide having the same function as that encoded by the original, native nucleotide sequence. Thus, in some embodiments of the invention, the polynucleotides, nucleic acid constructs, expression cassettes, and/or vectors of the invention (e.g., comprising/encoding a polypeptide, fusion protein, complex of the invention, e.g., a modified CRISPR-Cas nuclease) are codon optimized for expression in a particular species of interest, e.g., a particular plant species, a particular bacterial species, a particular animal species, and the like. In some embodiments, the codon optimized nucleic acid constructs, polynucleotides, expression cassettes, and/or vectors of the invention have about 70% to about 99.9% (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%. 99.9% or 100%) identity or more to the polynucleotides, nucleic acid constructs, expression cassettes, and/or vectors of the invention that have not been codon optimized
[0083] In any of the embodiments described herein, a polynucleotide or nucleic acid construct of the invention may be operatively associated with a variety of promoters and/or other regulatory elements for expression in a plant and/or a cell of a plant. Thus, in some embodiments, a polynucleotide or nucleic acid construct of this invention may further comprise one or more promoters, introns, enhancers, and/or terminators operably linked to one or more nucleotide sequences. In some embodiments, a promoter may be operably associated with an intron (e.g., Ubi1 promoter and intron). In some embodiments, a promoter associated with an intron maybe referred to as a promoter region (e.g., Ubi1 promoter and intron).
[0084] By operably linked or operably associated as used herein in reference to polynucleotides, it is meant that the indicated elements are functionally related to each other, and are also generally physically related. Thus, the term operably linked or operably associated as used herein, refers to nucleotide sequences on a single nucleic acid molecule that are functionally associated. Thus, a first nucleotide sequence that is operably linked to a second nucleotide sequence means a situation when the first nucleotide sequence is placed in a functional relationship with the second nucleotide sequence. For instance, a promoter is operably associated with a nucleotide sequence if the promoter effects the transcription or expression of said nucleotide sequence. Those skilled in the art will appreciate that the control sequences (e.g., promoter) need not be contiguous with the nucleotide sequence to which it is operably associated, as long as the control sequences function to direct the expression thereof. Thus, for example, intervening untranslated, yet transcribed, nucleic acid sequences can be present between a promoter and the nucleotide sequence, and the promoter can still be considered operably linked to the nucleotide sequence.
[0085] As used herein, the term linked, in reference to polypeptides, refers to the attachment of one polypeptide to another. A polypeptide may be linked to another polypeptide (at the N-terminus or the C-terminus) directly (e.g., via a peptide bond) or through a linker.
[0086] The term linker is art-recognized and refers to a chemical group, or a molecule linking two molecules or moieties, e.g., two domains of a fusion protein, such as, for example, a LbCas12a CRISPR-Cas nuclease domain and a polypeptide of interest (e.g., a nucleic acid-editing domain, a deaminase domain, an adenosine deaminase, a cytosine deaminase). A linker may be comprised of a single linking molecule or may comprise more than one linking molecule. In some embodiments, the linker can be an organic molecule, group, polymer, or chemical moiety such as a bivalent organic moiety. In some embodiments, the linker may be an amino acid or a peptide. In some embodiments, a peptide linker may be about 4 to about 100 or more amino acids in length, for example, about 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more amino acids in length (e.g., about 4 to about 40, about 4 to about 50, about 4 to about 60, about 5 to about 40, about 5 to about 50, about 5 to about 60, about 9 to about 40, about 9 to about 50, about 9 to about 60, about 10 to about 40, about 10 to about 50, about 10 to about 60, or about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 amino acids to about 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more amino acids in length. In some embodiments, a peptide linker may be a GS linker. A promoter is a nucleotide sequence that controls or regulates the transcription of a nucleotide sequence (e.g., a coding sequence) that is operably associated with the promoter. The coding sequence controlled or regulated by a promoter may encode a polypeptide and/or a functional RNA. Typically, a promoter refers to a nucleotide sequence that contains a binding site for RNA polymerase II and directs the initiation of transcription. In general, promoters are found 5, or upstream, relative to the start of the coding region of the corresponding coding sequence. A promoter may comprise other elements that act as regulators of gene expression; e.g., a promoter region. These include a TATA box consensus sequence, and often a CAAT box consensus sequence (Breathnach and Chambon, (1981) Annu. Rev. Biochem. 50:349). In plants, the CAAT box may be substituted by the AGGA box (Messing et al., (1983) in Genetic Engineering of Plants, T. Kosuge, C. Meredith and A. Hollaender (eds.), Plenum Press, pp. 211-227). In some embodiments, a promoter region may comprise at least one intron (e.g., SEQ ID NO:40 or SEQ ID NO:41).
[0087] Promoters useful with this invention can include, for example, constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-preferred and/or tissue-specific promoters for use in the preparation of recombinant nucleic acid molecules, e.g., synthetic nucleic acid constructs or protein-RNA complex. These various types of promoters are known in the art.
[0088] The choice of promoter may vary depending on the temporal and spatial requirements for expression, and also may vary based on the host cell to be transformed. Promoters for many different organisms are well known in the art. Based on the extensive knowledge present in the art, the appropriate promoter can be selected for the particular host organism of interest. Thus, for example, much is known about promoters upstream of highly constitutively expressed genes in model organisms and such knowledge can be readily accessed and implemented in other systems as appropriate.
[0089] In some embodiments, a promoter functional in a plant may be used with the constructs of this invention. Non-limiting examples of a promoter useful for driving expression in a plant include the promoter of the RubisCo small subunit gene 1 (PrbcS1), the promoter of the actin gene (Pactin), the promoter of the nitrate reductase gene (Pnr) and the promoter of duplicated carbonic anhydrase gene 1 (Pdca1) (See, Walker et al. Plant Cell Rep. 23:727-735 (2005); Li et al. Gene 403:132-142 (2007); Li et al. Mol Biol. Rep. 37:1143-1154 (2010)). PrbcS1 and Pactin are constitutive promoters and Pnr and Pdca1 are inducible promoters. Pnr is induced by nitrate and repressed by ammonium (Li et al. Gene 403:132-142 (2007)) and Pdca1 is induced by salt (Li et al. Mol Biol. Rep. 37:1143-1154 (2010)).
[0090] Examples of constitutive promoters useful for plants include, but are not limited to, cestrum virus promoter (cmp) (U.S. Pat. No. 7,166,770), the rice actin 1 promoter (Wang et al. (1992) Mol. Cell. Biol. 12:3399-3406; as well as U.S. Pat. No. 5,641,876), CaMV 35S promoter (Odell et al. (1985) Nature 313:810-812), CaMV 19S promoter (Lawton et al. (1987) Plant Mol. Biol. 9:315-324), nos promoter (Ebert et al. (1987) Proc. Natl. Acad. Sci USA 84:5745-5749), Adh promoter (Walker et al. (1987) Proc. Natl. Acad. Sci. USA 84:6624-6629), sucrose synthase promoter (Yang & Russell (1990) Proc. Natl. Acad. Sci. USA 87:4144-4148), and the ubiquitin promoter. The constitutive promoter derived from ubiquitin accumulates in many cell types. Ubiquitin promoters have been cloned from several plant species for use in transgenic plants, for example, sunflower (Binet et al., 1991. Plant Science 79: 87-94), maize (Christensen et al., 1989. Plant Molec. Biol. 12: 619-632), and arabidopsis (Norris et al. 1993. Plant Molec. Biol. 21:895-906). The maize ubiquitin promoter (UbiP) has been developed in transgenic monocot systems and its sequence and vectors constructed for monocot transformation are disclosed in the patent publication EP 0 342 926. The ubiquitin promoter is suitable for the expression of the nucleotide sequences of the invention in transgenic plants, especially monocotyledons. Further, the promoter expression cassettes described by McElroy et al. (Mol. Gen. Genet. 231: 150-160 (1991)) can be easily modified for the expression of the nucleotide sequences of the invention and are particularly suitable for use in monocotyledonous hosts.
[0091] In some embodiments, tissue specific/tissue preferred promoters can be used for expression of a heterologous polynucleotide in a plant cell. Tissue specific or preferred expression patterns include, but are not limited to, green tissue specific or preferred, root specific or preferred, stem specific or preferred, flower specific or preferred or pollen specific or preferred. Promoters suitable for expression in green tissue include many that regulate genes involved in photosynthesis and many of these have been cloned from both monocotyledons and dicotyledons. In one embodiment, a promoter useful with the invention is the maize PEPC promoter from the phosphoenol carboxylase gene (Hudspeth & Grula, Plant Molec. Biol. 12:579-589 (1989)). Non-limiting examples of tissue-specific promoters include those associated with genes encoding the seed storage proteins (such as -conglycinin, cruciferin, napin and phaseolin), zein or oil body proteins (such as oleosin), or proteins involved in fatty acid biosynthesis (including acyl carrier protein, stearoyl-ACP desaturase and fatty acid desaturases (fad 2-1)), and other nucleic acids expressed during embryo development (such as Bce4, see, e.g., Kridl et al. (1991) Seed Sci. Res. 1:209-219; as well as EP Patent No. 255378). Tissue-specific or tissue-preferential promoters useful for the expression of the nucleotide sequences of the invention in plants, particularly maize, include but are not limited to those that direct expression in root, pith, leaf or pollen. Such promoters are disclosed, for example, in WO 93/07278, herein incorporated by reference in its entirety. Other non-limiting examples of tissue specific or tissue preferred promoters useful with the invention the cotton rubisco promoter disclosed in U.S. Pat. No. 6,040,504; the rice sucrose synthase promoter disclosed in U.S. Pat. No. 5,604,121; the root specific promoter described by de Framond (FEBS 290:103-106 (1991); EP 0 452 269 to Ciba-Geigy); the stem specific promoter described in U.S. Pat. No. 5,625,136 (to Ciba-Geigy) and which drives expression of the maize trpA gene; the cestrum yellow leaf curling virus promoter disclosed in WO 01/73087; and pollen specific or preferred promoters including, but not limited to, ProOsLPS10 and ProOsLPS11 from rice (Nguyen et al. Plant Biotechnol. Reports 9(5):297-306 (2015)), ZmSTK2_USP from maize (Wang et al. Genome 60(6):485-495 (2017)), LAT52 and LAT59 from tomato (Twell et al. Development 109(3):705-713 (1990)), Zm13 (U.S. Pat. No. 10,421,972), PLA.sub.2- promoter from arabidopsis (U.S. Pat. No. 7,141,424), and/or the ZmC5 promoter from maize (International PCT Publication No. WO1999/042587.
[0092] Additional examples of plant tissue-specific/tissue preferred promoters include, but are not limited to, the root hair-specific cis-elements (RREs) (Kim et al. The Plaid Cell 18:2958-2970 2006)), the root-specific promoters RCc3 (Jeong et al. Plant Physiol. 153:185-197 (2010)) and RB7 (U.S. Pat. No. 5,459,252), the lectin promoter (Lindstrom et al. (1990) Der. Genet. 11:160-167; and Vodkin (1983) Prog. Clin. Biol. Res. 138:87-98), corn alcohol dehydrogenase 1 promoter (Dennis et al. (1984) Nucleic Acids Res. 12:3983-4000), S-adenosyl-L-methionine synthetase (SAMS) (Vander Mijnsbrugge et al. (1996) Plant and Cell Physiology, 37(8):1108-1115), corn light harvesting complex promoter (Bansal et al. (1992) Proc. Natl. Acad. Sci. USA 89:3654-3658), corn heat shock protein promoter (O'Dell et al. (1985) EMBO J. 5:451-458; and Rochester et al. (1986) EMBO J. 5:451-458), pea small subunit RuBP carboxylase promoter (Cashmore, Nuclear genes encoding the small subunit of ribulose-1,5-bisphosphate carboxylase pp. 29-39 In: Genetic Engineering of Plants (Hollaender ed., Plenum Press 1983; and Poulsen et al. (1986) Mol. Gen. Genet. 205:193-200), Ti plasmid mannopine synthase promoter (Langridge et al. (1989) Proc. Natl. Acad. Sci. USA 86:3219-3223), Ti plasmid nopaline synthase promoter (Langridge et al. (1989), supra), petunia chalcone isomerase promoter (van Tunen et al. (1988) EMBO J. 7:1257-1263), bean glycine rich protein 1 promoter (Keller et al. (1989) Genes Dev. 3:1639-1646), truncated CaMV 35S promoter (O'Dell et al. (1985) Nature 313:810-812), potato patatin promoter (Wenzler et al. (1989) Plant Mol. Biol. 13:347-354), root cell promoter (Yamamoto et al. (1990) Nucleic Acids Res. 18:7449), maize zein promoter (Kriz et al. (1987) Mol. Gen. Genet. 207:90-98; Langridge et al. (1983) Cell 34:1015-1022; Reina et al. (1990) Nucleic Acids Res. 18:6425; Reina et al. (1990) Nucleic Acids Res. 18:7449; and Wandelt et al. (1989) Nucleic Acids Res. 17:2354), globulin-1 promoter (Belanger et al. (1991) Genetics 129:863-872), -tubulin cab promoter (Sullivan et al. (1989) Mol. Gen. Genet. 215:431-440), PEPCase promoter (Hudspeth & Grula (1989) Plant Mol. Biol. 12:579-589), R gene complex-associated promoters (Chandler et al. (1989) Plant Cell 1:1175-1183), and chalcone synthase promoters (Franken et al. (1991) EMBO J. 10:2605-2612).
[0093] Useful for seed-specific expression is the pea vicilin promoter (Czako et al. (1992) Mol. Gen. Genet. 235:33-40; as well as the seed-specific promoters disclosed in U.S. Pat. No. 5,625,136. Useful promoters for expression in mature leaves are those that are switched at the onset of senescence, such as the SAG promoter from Arabidopsis (Gan et al. (1995) Science 270:1986-1988).
[0094] In addition, promoters functional in chloroplasts can be used. Non-limiting examples of such promoters include the bacteriophage T3 gene 9 5 UTR and other promoters disclosed in U.S. Pat. No. 7,579,516. Other promoters useful with the invention include but are not limited to the S-E9 small subunit RuBP carboxylase promoter and the Kunitz trypsin inhibitor gene promoter (Kti3).
[0095] Additional regulatory elements useful with this invention include, but are not limited to, introns, enhancers, termination sequences and/or 5 and 3 untranslated regions.
[0096] An intron useful with this invention can be an intron identified in and isolated from a plant and then inserted into an expression cassette to be used in transformation of a plant. As would be understood by those of skill in the art, introns can comprise the sequences required for self-excision and are incorporated into nucleic acid constructs/expression cassettes in frame. An intron can be used either as a spacer to separate multiple protein-coding sequences in one nucleic acid construct, or an intron can be used inside one protein-coding sequence to, for example, stabilize the mRNA. If they are used within a protein-coding sequence, they are inserted in-frame with the excision sites included. Introns may also be associated with promoters to improve or modify expression. As an example, a promoter/intron combination useful with this invention includes but is not limited to that of the maize Ubi1 promoter and intron.
[0097] Non-limiting examples of introns useful with the present invention include introns from the ADHI gene (e.g., Adh1-S introns 1, 2 and 6), the ubiquitin gene (Ubi1), the RuBisCO small subunit (rbcS) gene, the RuBisCO large subunit (rbcL) gene, the actin gene (e.g., actin-1 intron), the pyruvate dehydrogenase kinase gene (pdk), the nitrate reductase gene (nr), the duplicated carbonic anhydrase gene 1 (Tdca1), the psbA gene, the atpA gene, or any combination thereof. As a non-limiting example, a nucleic acid construct of the present invention may encode a base editor comprising an optimized CRISPR-Cas nuclease (e.g., SEQ ID NOs:1-11 or 23-25) and a deaminase, wherein the nucleic acid construct further comprises a promoter comprising/associated with an intron. As a further non-limiting example, a nucleic acid construct of the present invention may encode a base editor comprising an optimized CRISPR-Cas nuclease (e.g., SEQ ID NOs:1-11 or 23-25) and a deaminase, wherein the nuclease and/or the deaminase comprises one or more introns and optionally, the nucleic acid construct further comprises a promoter comprising/associated with an intron.
[0098] In some embodiments, a polynucleotide and/or a nucleic acid construct of the invention can be an expression cassette or can be comprised within an expression cassette. As used herein, expression cassette means a recombinant nucleic acid molecule comprising, for example, a nucleic acid construct of the invention (e.g., encoding a modified LbCas12a of the invention), wherein the nucleic acid construct is operably associated with at least a control sequence (e.g., a promoter). Thus, some embodiments of the invention provide expression cassettes designed to express, for example, a nucleic acid construct of the invention (e.g., a nucleic acid construct of the invention encoding a modified LbCas12a of the invention).
[0099] An expression cassette comprising a nucleic acid construct of the invention may be chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components (e.g., a promoter from the host organism operably linked to a polynucleotide of interest to be expressed in the host organism, wherein the polynucleotide of interest is from a different organism than the host or is not normally found in association with that promoter). An expression cassette may also be one that is naturally occurring but has been obtained in a recombinant form useful for heterologous expression.
[0100] An expression cassette can optionally include a transcriptional and/or translational termination region (i.e., termination region) and/or an enhancer region that is functional in the selected host cell. A variety of transcriptional terminators and enhancers are known in the art and are available for use in expression cassettes. Transcriptional terminators are responsible for the termination of transcription and correct mRNA polyadenylation. The termination region and/or the enhancer region may be native to the transcriptional initiation region, may be native to a gene encoding, e.g., a LbCas12a nuclease encoded by a nucleic acid construct of the invention, may be native to a host cell, or may be native to another source (e.g., foreign or heterologous to the promoter, to a gene encoding a LbCas12a nuclease encoded by a nucleic acid construct of the invention, to a host cell, or any combination thereof). The enhancer region may be native to a gene encoding a LbCas12a nuclease encoded by a nucleic acid construct of the invention, may be native to a host cell, or may be from another source (e.g., foreign or heterologous to the promoter, to the gene encoding the LbCas12a nuclease encoded by a nucleic acid construct of the invention, to the host cell, or any combination thereof).
[0101] An expression cassette of the invention also can include a nucleotide sequence encoding a selectable marker, which can be used to select a transformed host cell. As used herein, selectable marker means a nucleotide sequence that when expressed imparts a distinct phenotype to the host cell expressing the marker and thus allows such transformed cells to be distinguished from those that do not have the marker. Such a nucleotide sequence may encode either a selectable or screenable marker, depending on whether the marker confers a trait that can be selected for by chemical means, such as by using a selective agent (e.g., an antibiotic and the like), or whether the marker is simply a trait that one can identify through observation or testing, such as by screening (e.g., fluorescence). Many examples of suitable selectable markers are known in the art and can be used in the expression cassettes described herein.
[0102] In addition to expression cassettes, the nucleic acid molecules/constructs and polynucleotide sequences described herein can be used in connection with vectors. The term vector refers to a composition for transferring, delivering or introducing a nucleic acid (or nucleic acids) into a cell. A vector comprises a nucleic acid construct comprising the nucleotide sequence(s) to be transferred, delivered or introduced. Vectors for use in transformation of host organisms are well known in the art. Non-limiting examples of general classes of vectors include viral vectors, plasmid vectors, phage vectors, phagemid vectors, cosmid vectors, fosmid vectors, bacteriophages, artificial chromosomes, minicircles, or Agrobacterium binary vectors in double or single stranded linear or circular form which may or may not be self transmissible or mobilizable. In some embodiments, a viral vector can include, but is not limited, to a retroviral, lentiviral, adenoviral, adeno-associated, or herpes simplex viral vector. A vector as defined herein can transform a prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally (e.g. autonomous replicating plasmid with an origin of replication). Additionally included are shuttle vectors by which is meant a DNA vehicle capable, naturally or by design, of replication in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eukaryotic (e.g. higher plant, mammalian, yeast or fungal cells). In some embodiments, the nucleic acid in the vector is under the control of, and operably linked to, an appropriate promoter or other regulatory elements for transcription in a host cell. The vector may be a bi-functional expression vector which functions in multiple hosts. In the case of genomic DNA, this may contain its own promoter and/or other regulatory elements and in the case of cDNA this may be under the control of an appropriate promoter and/or other regulatory elements for expression in the host cell. Accordingly, a nucleic acid construct of this invention and/or expression cassettes comprising the same may be comprised in vectors as described herein and as known in the art. In some embodiments, the vector may be a high copy number vector (e.g., a high copy number E. coli vector; e.g., pUC, pBluescript, pGEM and the like). Thus, for example, a library of the present invention may be constructed using a high copy number vector.
[0103] As used herein, contact, contacting, contacted, and grammatical variations thereof, refers to placing the components of a desired reaction together under conditions suitable for carrying out the desired reaction (e.g., transformation, transcriptional control, genome editing, nicking, and/or cleavage). Thus, for example, a target nucleic acid may be contacted with (a) a polynucleotide and/or nucleic acid construct of the invention encoding a modified LbCas12a nuclease of the invention and (b) a guide nucleic acid, under conditions whereby the polynucleotide/nucleic acid construct is expressed and the modified LbCas12a nuclease is produced, wherein the nuclease forms a complex with the guide nucleic acid and the complex hybridizes to the target nucleic acid, thereby modifying the target nucleic acid. In some embodiments, a target nucleic acid may be contacted with (a) a modified LbCas12a nuclease of the invention and/or a fusion protein comprising the same (e.g., the modified LbCas12a nuclease of the invention and a polypeptide of interest (e.g., a deaminase)) and (b) a guide nucleic acid, wherein the modified LbCas12a nuclease forms a complex with the guide nucleic acid and the complex hybridizes to the target nucleic acid, thereby modifying the target nucleic acid. As described herein, the target nucleic acid may be contacted with the polynucleotides/nucleic acid constructs/polypeptides of the invention prior to, concurrently with, or after contact with the guide nucleic acid.
[0104] As used herein, modifying or modification in reference to a target nucleic acid includes editing (e.g., mutating), covalent modification, exchanging/substituting nucleic acids/nucleotide bases, deleting, cleaving, nicking, and/or transcriptional control of a target nucleic acid.
[0105] Introducing, introduce, introduced (and grammatical variations thereof) in the context of a polynucleotide of interest means presenting a nucleotide sequence of interest (e.g., polynucleotide, a nucleic acid construct, and/or a guide nucleic acid) to a host organism or cell of said organism (e.g., host cell; e.g., a plant cell) in such a manner that the nucleotide sequence gains access to the interior of a cell. Thus, for example, a polynucleotide of the invention encoding a modified LbCas12a nuclease as described herein and guide nucleic acid may be introduced into a cell of an organism, thereby transforming the cell with modified LbCas12a nuclease and guide nucleic acid.
[0106] The term transformation as used herein refers to the introduction of a heterologous nucleic acid into a cell. Transformation of a cell may be stable or transient. Thus, in some embodiments, a host cell or host organism may be stably transformed with a polynucleotide/nucleic acid molecule of the invention. In some embodiments, a host cell or host organism may be transiently transformed with a polynucleotide/nucleic acid construct of the invention.
[0107] Transient transformation in the context of a polynucleotide means that a polynucleotide is introduced into the cell and does not integrate into the genome of the cell.
[0108] By stably introducing or stably introduced in the context of a polynucleotide introduced into a cell is intended that the introduced polynucleotide is stably incorporated into the genome of the cell, and thus the cell is stably transformed with the polynucleotide.
[0109] Stable transformation or stably transformed as used herein means that a nucleic acid molecule is introduced into a cell and integrates into the genome of the cell. As such, the integrated nucleic acid molecule is capable of being inherited by the progeny thereof, more particularly, by the progeny of multiple successive generations. Genome as used herein includes the nuclear and the plastid genome, and therefore includes integration of the nucleic acid into, for example, the chloroplast or mitochondrial genome. Stable transformation as used herein can also refer to a transgene that is maintained extrachromasomally, for example, as a minichromosome or a plasmid.
[0110] Transient transformation may be detected by, for example, an enzyme-linked immunosorbent assay (ELISA) or Western blot, which can detect the presence of a peptide or polypeptide encoded by one or more transgene introduced into an organism. Stable transformation of a cell can be detected by, for example, a Southern blot hybridization assay of genomic DNA of the cell with nucleic acid sequences which specifically hybridize with a nucleotide sequence of a transgene introduced into an organism (e.g., a plant). Stable transformation of a cell can be detected by, for example, a Northern blot hybridization assay of RNA of the cell with nucleic acid sequences which specifically hybridize with a nucleotide sequence of a transgene introduced into a host organism. Stable transformation of a cell can also be detected by, e.g., a polymerase chain reaction (PCR) or other amplification reactions as are well known in the art, employing specific primer sequences that hybridize with target sequence(s) of a transgene, resulting in amplification of the transgene sequence, which can be detected according to standard methods Transformation can also be detected by direct sequencing and/or hybridization protocols well known in the art.
[0111] Accordingly, in some embodiments, nucleotide sequences, polynucleotides, and/or nucleic acid constructs of the invention and/or expression cassettes and/or vectors comprising the same may be expressed transiently and/or they can be stably incorporated into the genome of the host organism. Thus, in some embodiments, a nucleic acid construct of the invention (e.g., encoding a modified LbCas12a nuclease of the invention, or a fusion protein thereof; e.g., a fusion protein comprising the modified LbCas12a nuclease linked to e.g., a polynucleotide of interest, e.g., a deaminase domain), wherein the nucleic acid construct encoding the modified LbCas12a nuclease is codon optimized for expression in an organism (e.g., a plant, a mammal, a fungus, a bacterium, and the like) may be transiently introduced into a cell of the organism along with a guide nucleic acid and as such no DNA maintained in the cell.
[0112] A polynucleotide/nucleic acid construct of the invention can be introduced into a cell by any method known to those of skill in the art. In some embodiments of the invention, transformation of a cell comprises nuclear transformation. In other embodiments, transformation of a cell comprises plastid transformation (e.g., chloroplast transformation). In still further embodiments, a polynucleotide/nucleic acid construct of the invention can be introduced into a cell via conventional breeding techniques.
[0113] Procedures for transforming both eukaryotic and prokaryotic organisms are well known and routine in the art and are described throughout the literature (See, for example, Jiang et al. 2013. Nat. Biotechnol. 31:233-239; Ran et al. Nature Protocols 8:2281-2308 (2013)).
[0114] A nucleotide sequence therefore can be introduced into a host organism or its cell in any number of ways that are well known in the art. The methods of the invention do not depend on a particular method for introducing one or more nucleotide sequences into the organism, only that they gain access to the interior of at least one cell of the organism. Where more than one nucleotide sequence is to be introduced, they can be assembled as part of a single nucleic acid construct, or as separate nucleic acid constructs, and can be located on the same or different nucleic acid constructs. Accordingly, the nucleotide sequences can be introduced into the cell of interest in a single transformation event, and/or in separate transformation events, or, alternatively, where relevant, a nucleotide sequence may be incorporated into a plant, for example, as part of a breeding protocol.
[0115] The present invention is directed to Cas12a nucleases modified to include non-natural PAM recognition sites/sequences (e.g., a Cas12a nuclease that comprises non-natural PAM recognition specificity in addition to or instead of the natural PAM recognition specificity for that particular Cas12a nuclease). In addition, the present invention is directed to methods for designing, identifying and selecting Cas12a nucleases having desirable characteristics including improved PAM recognition specificity.
[0116] As used herein, in reference to a modified Cas12a polypeptide, altered PAM specificity means that the PAM specificity of the nuclease is altered from that of the wild type nuclease (e.g., non-native PAM sequences are recognized in addition to and/or instead of the native PAM sequence. For example, a modified Cas12a nuclease would be altered in its PAM specificity if it recognizes a PAM sequence other than and/or in addition to the native Cas12 a PAM sequence of TTTV, wherein V is A, C or G.
[0117] The present invention is directed to LbCas12a nucleases having modified PAM recognition specificities. In some embodiments, the present invention provides a modified Lachnospiraceae bacterium CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) Cas12a (LbCas12a) polypeptide, wherein the modified LbCas12a polypeptide comprises an amino acid sequence having at least 80% identity (e.g., about 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% identity; e.g., about 80% to about 100%, about 85% to about 100%, about 90% to about 100% about 95% to about 100%) to the amino acid sequence of SEQ ID NO:1 (LbCas12a) and a mutation at one or more than one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or more) of the following positions of K116, K120, K121, D122, E125, T148, T149, T152, D156, E159, Q529, G532, D535, K538, D541, Y542, L585, K591, M592, K595, V596, 5599, K600, K601, Y616, Y646, and/or W649 with reference to the position numbering of SEQ ID NO:1, optionally a mutation at one or more than one of the following positions of K116, K120, K121, D122, E125, T152, D156, E159, G532, D535, K538, D541, and/or K595 with reference to the position numbering of SEQ ID NO:1. In some embodiments, a mutation of a Cas12a (LbCas12a) polypeptide comprises, consists essentially of, or consists of a mutation at one or more than one of the following positions of K116, K120, K121, D122, E125, T152, D156, E159, G532, D535, K538, D541, and/or K595 with reference to the position numbering of SEQ ID NO:1 in any combination. Thus, a modified LbCas12a polypeptide of this invention may comprise a single mutation at any one of the positions of K116, K120, K121, D122, E125, T148, T149, T152, D156, E159, Q529, G532, D535, K538, D541, Y542, L585, K591, M592, K595, V596, 5599, K600, K601, Y616, Y646, and/or W649 with reference to the position numbering of SEQ ID NO:1 or may comprise a combination of mutations any two or more positions of K116, K120, K121, D122, E125, T148, T149, T152, D156, E159, Q529, G532, D535, K538, D541, Y542, L585, K591, M592, K595, V596, S599, K600, K601, Y616, Y646, and/or W649 with reference to the position numbering of SEQ ID NO:1.
[0118] In some embodiments, a mutation of a Cas12a (LbCas12a) polypeptide comprises, consists essentially of or consists of one or more than one of the following mutations of K116N, K116R, K120H, K120N, K120Q, K120R, K120T, K121D, K121G, K121H, K121Q, K121R, K121S, K121T, D122H, D122K, D122N, D122R, E125K, E125Q, E125R, E125Y, T148A, T148C, T148H, T148S, T149C, T149F, T149G, T149H, T149N, T149P, T149S, T149V, T152E, T152F, T152H, T152K, T152L, T152Q, T152R, T152W, T152Y, D156E, D156H, D156I, D156K, D156L, D156Q, D156R, D156W, D156Y, E159K, E159Q, E159R, E159Y, Q529A, Q529D, Q529F, Q529G, Q529H, Q529N, Q529P, Q529S, Q529T, Q529W, G532A, G532C, G532D, G532F, G532H, G532K, G532L, G532N, G532Q, G532S, D535A, D535H, D535K, D535N, D535S, D535T, D535V, K538C, K538F, K538G, K538H, K538L, K538M, K538Q, K538R, K538V, K538W, K538Y, D541A, D541E, D541H, D541I, D541N, D541R, D541Y, Y542F, Y542H, Y542K, Y542L, Y542M, Y542N, Y542R, Y542T, Y542V, L585F, L585G, L585H, K591A, K591F, K591G, K591H, K591R, K591S, K591W, K591Y, M592A, M592E, M592Q, K595H, K595L, K595M, K595Q, K595R, K595S, K595W, K595Y, V596H, V596T, S599G, S599H, S599N, K600G, K600H, K600R, K601H, K601Q, K601R, K601T, Y616E, Y616F, Y616H, Y616K, Y616R, Y646E, Y646H, Y646K, Y646N, Y646Q, Y646R, Y646W, W649H, W649K, W649R, W649S and/or W649Y with reference to the position numbering of SEQ ID NO:1. As would be understood, any single Cas12a polypeptide having two or more mutations would comprise only a single mutation at any given position. Thus, for example, a polypeptide may have mutation at position D535 of any one of D535A, D535H, D535K, D535N, D535S, D535T, or D535V, but the same polypeptide may further comprise a mutation at one or more than one of any of the other positions as described herein. In some embodiments, a mutation of a Cas12a (LbCas12a) polypeptide comprises, consists essentially of or consists of one or more than one mutation of K116N, K116R, K120H, K120N, K120Q, K120R, K120T, K121D, K121G, K121H, K121Q, K121R, K121S, K121T, D122H, D122K, D122N, D122R, E125K, E125Q, E125R, E125Y, T152E, T152F, T152H, T152K, T152L, T152Q, T152R, T152W, T152Y, D156E, D156H, D156I, D156K, D156L, D156Q, D156R, D156W, D156Y, E159K, E159Q, E159R, E159Y, G532A, G532C, G532D, G532F, G532H, G532K, G532L, G532N, G532Q, G532S, D535A, D535H, D535K, D535N, D535S, D535T, D535V, K538C, K538F, K538G, K538H, K538L, K538M, K538Q, K538R, K538V, K538W, K538Y, D541A, D541E, D541H, D541I, D541N, D541R, D541Y, K595H, K595L, K595M, K595Q, K595R, K595S, K595W, and/or K595Y with reference to the residue position numbering of SEQ ID NO:1 in any combination. In some embodiments, a mutation of a Cas12a (LbCas12a) polypeptide comprises, consists essentially of or consists of one or more than one mutation of K116R, K116N, K120Y, K121S, K121R, D122H, D122N, E125K, T152R, T152K, T152Y, T152Q, T152E, T152F, D156R, D156W, D156Q, D156H, D156I, D156V, D156L, D156E, E159K, E159R, G532N, G532S, G532H, G532K, G532R, G532L, D535N, D535H, D535T, D535,SD535A, D535W, K538R K538V, K538Q, K538W, K538Y, K538F, K538H, K538L, K538M, K538C, K538G, K538A, D541E, K595R, K595Q, K595Y, K595W, K595H, K595S, and/or K595M with reference to the position numbering of SEQ ID NO:1. As would be understood, any single Cas12a polypeptide having two or more mutations would comprise a single mutation at any given position. Thus, for example, a polypeptide may have a mutation at position D535 of any one of D535A, D535H, D535K, D535N, D535S, D535T, or D535V, and may further comprise a mutation at one or more than one at any other position as described herein.
[0119] In some embodiments, the mutation does not comprise, consist essentially of or consist of a mutation of D156R, G532R, K538R, K538V, Y542R or K595R with reference to position numbering of SEQ ID NO:1. In some embodiments, the mutation of the Cas12a (LbCas12a) polypeptide does not comprise, consist essentially of or consist of the combination of mutations of G532R and K595R, of G532R, K538V and Y542R, or of D156R, G532R and K532R with reference to position numbering of SEQ ID NO:1.
[0120] In some embodiments, the modified LbCas12a polypeptide may comprise one or more amino acid mutations of SEQ ID NO:1 as set forth in Table 2 (in Example 2).
[0121] In some embodiments, the modified LbCas12a polypeptide may comprise an altered protospacer adjacent motif (PAM) specificity as compared to wild type LbCas12a (e.g., SEQ ID NO:1). A modified LbCas12a polypeptide of the present invention may comprise an altered PAM specificity, wherein the altered PAM specificity includes, but is not limited to, NNNG, NNNT, NNNA, NNNC, NNG, NNT, NNC, NNA, NG, NT, NC, NA, NN, NNN, NNNN, wherein each N of each sequence is independently selected from any of T, C, G, or A. In some embodiments, the altered PAM specificity may include, but is not limited to, TTTA, TTTC, TTTG, TTTT, TTCA, TTCC, TTCG, TTCT, ATTC, CTTA, CTTC, CTTG, GTTC, TATA, TATC, CTCC, TCCG, TACA, TCCG, TACA, TCCG, TCCC, TCCA, and/or TATG. In some embodiments, the altered PAM specificity may be NNNN, wherein each N of each sequence is independently selected from any of T, C, G, or A.
[0122] In addition to having an altered PAM recognition specificity a modified LbCas12a nuclease may further comprise a mutation in the nuclease active site (e.g., RuvC domain) (e.g., deadLbCas12a, dLbCas12a). Such modifications may result in the LbCas12a polypeptide having reduced nuclease activity (e.g., nickase activity) or no nuclease activity.
[0123] In some embodiments, a Type V Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated (Cas) (CRISPR-Cas) system is provided, the system comprising: (a) a fusion protein comprising (i) a modified LbCas12a nuclease of the invention or a nucleic acid encoding the modified LbCas12a nuclease of the invention, and (ii) a polypeptide of interest or a nucleic acid encoding the polypeptide of interest; and (b) a guide nucleic acid (CRISPR RNA, CRISPR DNA, crRNA, crDNA) comprising a spacer sequence and a repeat sequence, wherein the guide nucleic acid is capable of forming a complex with the modified LbCas12a nuclease or the fusion protein and the spacer sequence is capable of hybridizing to a target nucleic acid, thereby guiding modified LbCas12a nuclease and the polypeptide of interest to the target nucleic acid, whereby the system is capable of modifying (e.g., cleaving or editing) or modulating (e.g., modulating transcription) the target nucleic acid. In some embodiments, the system comprises a polypeptide of interest linked to the C-terminus and/or the N-terminus of the modified LbCas12a nuclease (e.g., a fusion protein), optionally via a peptide linker.
[0124] Additionally, provided herein are fusion proteins that comprise a modified Cas12a nuclease of the invention. In some embodiments, the fusion protein may comprise a polypeptide of interest linked to the C-terminus and/or to the N-terminus of the modified LbCas12a. In some embodiments, the present invention provides a fusion protein comprising a modified LbCas12a and an optional intervening linker linking the polypeptide of interest.
[0125] Any linker known in the art or later identified that does not interfere with the activity of the fusion protein may be used. A linker that does not interfere with the activity of a fusion protein is a linker that does not reduce or eliminate the activity of the polypeptides of the fusion protein (e.g., the nuclease and/or the polypeptide of interest); that is, the nuclease activity, nucleic acid binding activity, editing activity, and/or any other activity of the nuclease or peptide of interest is maintained in a fusion protein in which the nuclease and the polypeptide of interest are tethered to one another via the linker. In some embodiments, a peptide linker may be linked (e.g., at its N-terminus) to the C-terminus of a modified LbCas12a, optionally wherein the fusion protein may further comprise a polypeptide of interest linked to the C-terminus of the linker. In some embodiments, a peptide linker may be linked (e.g., at its C-terminus) to the N-terminus of a modified LbCas12a, optionally wherein the fusion protein may further comprise a polypeptide of interest linked to the N-terminus of the linker. In some embodiments, a modified LbCas12a of the invention may be linked at both its C-terminus and N-terminus to a linker and/or a polypeptide of interest (directly or via a linker).
[0126] In some embodiments, a linker useful with the invention may be an amino acid or a peptide. In some embodiments, a peptide linker useful with this invention may be about 4 to about 100 or more amino acids in length, for example, about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more amino acids in length (e.g., about 4 to about 40, about 4 to about 50, about 4 to about 60, about 5 to about 40, about 5 to about 50, about 5 to about 60, about 9 to about 40, about 9 to about 50, about 9 to about 60, about 10 to about 40, about 10 to about 50, about 10 to about 60, or about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 amino acids to about 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more amino acids in length). In some embodiments, a peptide linker may be a GS linker.
[0127] A polypeptide of interest useful with this invention can include, but is not limited to, a polypeptide or protein domain having deaminase (deamination) activity, nickase activity, recombinase activity, transposase activity, methylase activity, glycosylase (DNA glycosylase) activity, glycosylase inhibitor activity (e.g., uracil-DNA glycosylase inhibitor (UGI)). demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nuclease activity, single-strand RNA cleavage activity, double-strand RNA cleavage activity, restriction endonuclease activity (e.g., Fok1), nucleic acid binding activity, methyltransferase activity, DNA repair activity, DNA damage activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, polymerase activity, ligase activity, helicase activity, and/or photolyase activity.
[0128] In some embodiments, a polypeptide of interest may comprise at least one polypeptide or protein domain having deaminase activity. In some embodiments, the at least one polypeptide or protein domain may be an adenine deaminase domain. An adenine deaminase (or adenosine deaminase) useful with this invention may be any known or later identified adenine deaminase from any organism (see, e.g., U.S. Pat. No. 10,113,163, which is incorporated by reference herein for its disclosure of adenine deaminases). An adenine deaminase can catalyze the hydrolytic deamination of adenine or adenosine. In some embodiments, the adenine deaminase may catalyze the hydrolytic deamination of adenosine or deoxyadenosine to inosine or deoxyinosine, respectively. In some embodiments, the adenosine deaminase may catalyze the hydrolytic deamination of adenine or adenosine in DNA. In some embodiments, an adenine deaminase encoded by a nucleic acid construct of the invention may generate an A.fwdarw.G conversion in the sense (e.g., +; template) strand of the target nucleic acid or a T.fwdarw.C conversion in the antisense (e.g., , complementary) strand of the target nucleic acid.
[0129] In some embodiments, an adenosine deaminase may be a variant of a naturally-occurring adenine deaminase. Thus, in some embodiments, an adenosine deaminase useful with the invention may be about 70% to 100% identical to a wild type adenine deaminase (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical, and any range or value therein, to a naturally occurring adenine deaminase). In some embodiments, the deaminase or deaminase does not occur in nature and may be referred to as an engineered, mutated or evolved adenosine deaminase. Thus, for example, an engineered, mutated or evolved adenine deaminase polypeptide or an adenine deaminase domain may be about 70% to 99.9% identical to a naturally occurring adenine deaminase polypeptide/domain (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identical, and any range or value therein, to a naturally occurring adenine deaminase polypeptide or adenine deaminase domain). In some embodiments, the adenosine deaminase may be from a bacterium, (e.g., Escherichia coli, Staphylococcus aureus, Haemophilus influenzae, Caulobacter crescentus, and the like). In some embodiments, a polynucleotide encoding an adenine deaminase polypeptide/domain may be codon optimized for expression in an organism.
[0130] In some embodiments, an adenine deaminase domain may be a wild type tRNA-specific adenosine deaminase domain, e.g., a tRNA-specific adenosine deaminase (TadA) and/or a mutated/evolved adenosine deaminase domain, e.g., mutated/evolved tRNA-specific adenosine deaminase domain (TadA*). In some embodiments, a TadA domain may be from E. coli. In some embodiments, the TadA may be modified, e.g., truncated, missing one or more N-terminal and/or C-terminal amino acids relative to a full-length TadA (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 6, 17, 18, 19, or 20 N-terminal and/or C terminal amino acid residues may be missing relative to a full length TadA. In some embodiments, a TadA polypeptide or TadA domain does not comprise an N-terminal methionine. In some embodiments, a wild type E. coli TadA comprises the amino acid sequence of SEQ ID NO:18. In some embodiments, a mutated/evolved E. coli TadA* comprises the amino acid sequence of SEQ ID NOs:19-22. In some embodiments, a polynucleotide encoding a TadA/TadA* may be codon optimized for expression in an organism.
[0131] A cytosine deaminase (or cytidine deaminase) useful with this invention may be any known or later identified cytosine deaminase from any organism (see, e.g., U.S. Pat. No. 10,167,457, which is incorporated by reference herein for its disclosure of cytosine deaminases). In some embodiments, the at least one polypeptide or protein domain may be a cytosine deaminase polypeptide or domain. In some embodiments, a cytosine deaminase polypeptide/domain may be an apolipoprotein B mRNA editing catalytic polypeptide-like (APOBEC) domain. In some embodiments, a polypeptide of interest may comprise at least one polypeptide or protein domain having glycosylase inhibitor activity. In some embodiments, the polypeptide of interest may be a uracil-DNA glycosylase inhibitor (UGI) polypeptide/domain. In some embodiments, a nucleic acid construct encoding a modified LbCas12a nuclease of this invention and a cytosine deaminase domain (e.g., encoding a fusion protein comprising a modified LbCas12a nuclease and a cytosine deaminase domain) may further encode a uracil-DNA glycosylase inhibitor (UGI), wherein the UGI is codon optimized for expression in an organism. In some embodiments, the invention provides a fusion protein comprising a modified LbCas12a nuclease, a cytosine deaminase domain, and a UGI and/or one or more polynucleotides encoding the same, optionally wherein the one or more polynucleotides may be codon optimized for expression in an organism.
[0132] A cytosine deaminase catalyzes the hydrolytic deamination of cytidine or deoxycytidine to uridine or deoxyuridine, respectively. In some embodiments, a deaminase or deaminase domain may be a cytidine deaminase domain, catalyzing the hydrolytic deamination of cytosine to uracil. In some embodiments, a cytosine deaminase may be a variant of a naturally-occurring cytosine deaminase, including but not limited to a primate (e.g., a human, monkey, chimpanzee, gorilla), a dog, a cow, a rat or a mouse. Thus, in some embodiments, an cytosine deaminase useful with the invention may be about 70% to about 100% identical to a wild type cytosine deaminase (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical, and any range or value therein, to a naturally occurring cytosine deaminase). In some embodiments, a polynucleotide encoding a cytosine deaminase polypeptide/domain may be codon optimized for expression in an organism.
[0133] In some embodiments, a cytosine deaminase useful with the invention may be an apolipoprotein B mRNA-editing complex (APOBEC) family deaminase. In some embodiments, the cytosine deaminase may be an APOBEC1 deaminase, an APOBEC2 deaminase, an APOBEC3A deaminase, an APOBEC3B deaminase, an APOBEC3C deaminase, an APOBEC3D deaminase, an APOBEC3F deaminase, an APOBEC3G deaminase, an APOBEC3H deaminase, an APOBEC4 deaminase, a human activation induced deaminase (hAID), an rAPOBEC1, FERNY, and/or a CDA1, optionally a pmCDA1, an atCDA1 (e.g., At2g19570), and evolved versions of the same. In some embodiments, the cytosine deaminase may be an APOBEC1 deaminase having the amino acid sequence of SEQ ID NO:23, SEQ ID NO:44 or SEQ ID NO:46. In some embodiments, the cytosine deaminase may be an APOBEC3A deaminase having the amino acid sequence of SEQ ID NO:24. In some embodiments, the cytosine deaminase may be an CDA1 deaminase, optionally a CDA1 having the amino acid sequence of SEQ ID NO:25 or SEQ ID NO:43. In some embodiments, the cytosine deaminase may be a FERNY deaminase, optionally a FERNY having the amino acid sequence of SEQ ID NO:42 or SEQ ID NO:45. In some embodiments, the cytosine deaminase may be a human activation induced deaminase (hAID) having the amino acid sequence of SEQ ID NO:47 or SEQ ID NO:48. In some embodiments, a cytosine deaminase useful with the invention may be about 70% to about 100% identical (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identical) to the amino acid sequence of a naturally occurring cytosine deaminase (e.g., an evolved deaminase). In some embodiments, a cytosine deaminase useful with the invention may be about 70% to about 99.5% identical (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical) to the amino acid sequence of SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 or SEQ ID NOs:42-48 (e.g., at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the amino acid sequence of SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 or SEQ ID NOs:42-48). In some embodiments, a polynucleotide encoding a cytosine deaminase may be codon optimized for expression in an organism and the codon optimized polypeptide may be about 70% to 99.5% identical to the reference polynucleotide.
[0134] A uracil glycosylase inhibitor (UGI) useful with the invention may be any protein that is capable of inhibiting a uracil-DNA glycosylase base-excision repair enzyme. In some embodiments, a UGI domain comprises a wild type UGI or a fragment thereof. In some embodiments, a UGI domain useful with the invention may be about 70% to about 100% identical (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identical and any range or value therein) to the amino acid sequence of a naturally occurring UGI domain. In some embodiments, a UGI domain may comprise the amino acid sequence of SEQ ID NO:26 or a polypeptide having about 70% to about 99.5% identity to the amino acid sequence of SEQ ID NO:26 (e.g., at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the amino acid sequence of SEQ ID NO:26). For example, in some embodiments, a UGI domain may comprise a fragment of the amino acid sequence of SEQ ID NO:26 that is 100% identical to a portion of consecutive nucleotides (e.g., about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 consecutive nucleotides; e.g., about 10, 15, 20, 25, 30, 35, 40, 45, to about 50, 55, 60, 65, 70, 75, 80 consecutive nucleotides) of the amino acid sequence of SEQ ID NO:26. In some embodiments, a UGI domain may be a variant of a known UGI (e.g., SEQ ID NO:26) having 70% to about 99.5% identity (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% identity, and any range or value therein) to the known UGI. In some embodiments, a polynucleotide encoding a UGA may be codon optimized for expression in an organism and the codon optimized polypeptide may be about 70% to about 99.5% identical to the reference polynucleotide.
[0135] In some embodiments, a modified LbCas12a nuclease may comprise a mutation in its nuclease active site (e.g., RuvC). A modified LbCas12a nuclease having a mutation in its nuclease active site(s) and no longer comprising nuclease activity are commonly referred to as dead, e.g., dLbCas12a. In some embodiments, a modified LbCas12a domain or polypeptide having a mutation in its nuclease active site(s) may have impaired activity or reduced activity (e.g., nickase activity) as compared to the same LbCas12a nuclease without the mutation.
[0136] The modified LbCas12a nucleases of the invention may be used in combination with a guide RNA (gRNA, CRISPR array, CRISPR RNA, crRNA), designed to function with the modified LbCas12a nuclease, to modify a target nucleic acid. A guide nucleic acid useful with this invention comprises at least a spacer sequence and a repeat sequence. The guide nucleic acid is capable of forming a complex with the LbCas12a nuclease domain encoded and expressed by a polynucleotide/nucleic acid construct of the invention encoding a modified LbCas12a nuclease and the spacer sequence is capable of hybridizing to a target nucleic acid, thereby guiding the nucleic acid construct (e.g., the modified LbCas12a nuclease (and/or a polypeptide of interest)) to the target nucleic acid, wherein the target nucleic acid may be modified (e.g., cleaved or edited) or modulated (e.g., modulating transcription) by the modified LbCas12a nuclease (and/or an encoded deaminase domain and/or polypeptide of interest). As an example, a nucleic acid construct encoding an LbCas12a domain linked to a cytosine deaminase domain (e.g., a fusion protein) may be used in combination with an LbCas12a guide nucleic acid to modify a target nucleic acid, wherein the cytosine deaminase domain of the fusion protein deaminates a cytosine base in the target nucleic acid, thereby editing the target nucleic acid. In a further example, a nucleic acid construct encoding an LbCas12a domain linked to an adenine deaminase domain (e.g., a fusion protein) may be used in combination with an LbCas12a guide nucleic acid to modify a target nucleic acid, wherein the adenine deaminase domain of the fusion protein deaminates an adenosine base in the target nucleic acid, thereby editing the target nucleic acid.
[0137] A guide nucleic acid, guide RNA, gRNA, CRISPR RNA/DNA crRNA or crDNA as used herein means a nucleic acid that comprises at least one spacer sequence, which is complementary to (and hybridizes to) a target nucleic acid (e.g., protospacer), and at least one repeat sequence (e.g., a repeat of a Type V Cas12a CRISPR-Cas system, or a fragment or portion thereof), wherein the repeat sequence may be linked to the 5 end and/or the 3 end of the spacer sequence. The design of a gRNA of this invention may be based on a Type V Cas12a system.
[0138] In some embodiments, a Cas12a gRNA may comprise, from 5 to 3, a repeat sequence (full length or portion thereof (handle); e.g., pseudoknot-like structure) and a spacer sequence.
[0139] In some embodiments, a guide nucleic acid may comprise more than one repeat sequence-spacer sequence (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more repeat-spacer sequences) (e.g., repeat-spacer-repeat, e.g., repeat-spacer-repeat-spacer-repeat-spacer-repeat-spacer-repeat-spacer, and the like). The guide nucleic acids of this invention are synthetic, human-made and not found in nature. A gRNA can be quite long and may be used as an aptamer (like in the MS2 recruitment strategy) or other RNA structures hanging off the spacer.
[0140] A repeat sequence as used herein, refers to, for example, any repeat sequence of a wild-type Cas12a locus (e.g., a LbCas12a locu.) or a repeat sequence of a synthetic crRNA that is functional with the LbCas12a nuclease encoded by the nucleic acid constructs of the invention. A repeat sequence useful with this invention can be any known or later identified repeat sequence of a Cas12a locus or it can be a synthetic repeat designed to function in a Cas12a Type V CRISPR-Cas system. A repeat sequence may comprise a hairpin structure and/or a stem loop structure. In some embodiments, a repeat sequence may form a pseudoknot-like structure at its 5 end (i.e., handle). Thus, in some embodiments, a repeat sequence can be identical to or substantially identical to a repeat sequence from a wild-type V CRISPR-Cas locus (e.g., a wild type Cas12a locus). A repeat sequence from a wild-type Cas12a locus may be determined through established algorithms, such as using the CRISPRfinder offered through CRISPRdb (see, Grissa et al. Nucleic Acids Res. 35(Web Server issue):W52-7). In some embodiments, a repeat sequence or portion thereof is linked at its 3 end to the 5 end of a spacer sequence, thereby forming a repeat-spacer sequence (e.g., guide RNA, crRNA).
[0141] In some embodiments, a repeat sequence comprises, consists essentially of, or consists of at least 10 nucleotides depending on the particular repeat and whether the guide RNA comprising the repeat is processed or unprocessed (e.g., about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 to 100 or more nucleotides, or any range or value therein; e.g., about). In some embodiments, a repeat sequence comprises, consists essentially of, or consists of about 10 to about 20, about 10 to about 30, about 10 to about 45, about 10 to about 50, about 15 to about 30, about 15 to about 40, about 15 to about 45, about 15 to about 50, about 20 to about 30, about 20 to about 40, about 20 to about 50, about 30 to about 40, about 40 to about 80, about 50 to about 100, or more nucleotides.
[0142] A repeat sequence linked to the 5 end of a spacer sequence can comprise a portion of a repeat sequence (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or more consecutive nucleotides of a wild type repeat sequence). In some embodiments, a portion of a repeat sequence linked to the 5 end of a spacer sequence can be about five to about ten consecutive nucleotides in length (e.g., about 5, 6, 7, 8, 9, 10 nucleotides) and have at least 90% identity (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) to the same region (e.g., 5 end) of a wild type CRISPR Cas repeat nucleotide sequence. In some embodiments, a portion of a repeat sequence may comprise a pseudoknot-like structure at its 5 end (e.g., handle).
[0143] A spacer sequence as used herein is a nucleotide sequence that is complementary to a target nucleic acid (e.g., target DNA) (e.g, protospacer). The spacer sequence can be fully complementary or substantially complementary (e.g., at least about 70% complementary (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, and any range or value therein)) to a target nucleic acid. Thus, in some embodiments, the spacer sequence can have one, two, three, four, or five mismatches as compared to the target nucleic acid, which mismatches can be contiguous or noncontiguous. In some embodiments, the spacer sequence can have about 70% complementarity to a target nucleic acid. In other embodiments, the spacer nucleotide sequence can have about 80% complementarity to a target nucleic acid. In still other embodiments, the spacer nucleotide sequence can have about 85%, 90%, 95%, 96%, 97%, 98%, 99% or 99.5% complementarity, and the like, to the target nucleic acid (protospacer). In some embodiments, the spacer sequence is 100% complementary to the target nucleic acid. A spacer sequence may have a length from about 15 nucleotides to about 30 nucleotides (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, or any range or value therein). Thus, in some embodiments, a spacer sequence may have complete complementarity or substantial complementarity over a region of a target nucleic acid (e.g., protospacer) that may be at least about 15 nucleotides to about 30 nucleotides in length. In some embodiments, the spacer may be about 20, 21, 22, 23, 24, or 25 nucleotides in length. In some embodiments, the spacer may be 23 nucleotides in length.
[0144] In some embodiments, the 5 region of a spacer sequence of a guide RNA may be identical to a target nucleic acid, while the 3 region of the spacer may be substantially complementary to the target nucleic acid (e.g., Type V CRISPR-Cas), or the 3 region of a spacer sequence of a guide RNA may be identical to a target nucleic acid, while the 5 region of the spacer may be substantially complementary to the target nucleic acid (e.g., Type II CRISPR-Cas), and therefore, the overall complementarity of the spacer sequence to the target nucleic acid may be less than 100%. Thus, for example, in a guide for a Type V CRISPR-Cas system, the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides in the 5 region (i.e., seed region) of, for example, a 20 nucleotide spacer sequence, may be 100% complementary to the target nucleic acid, while the remaining nucleotides in the 3 region of the spacer sequence may be substantially complementary (e.g., at least about 70% complementary) to the target nucleic acid. In some embodiments, the first 1 to 8 nucleotides (e.g., the first 1, 2, 3, 4, 5, 6, 7, 8, nucleotides, and any range therein) of a 5 end of the spacer sequence may be 100% complementary to the target nucleic acid, while the remaining nucleotides in the 3 region of the spacer sequence may be substantially complementary (e.g., at least about 50% complementary (e.g., about 50%, 55%, 60%, 65%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more)) to the target nucleic acid.
[0145] In some embodiments, a seed region of a spacer may be about 8 to about 10 nucleotides in length, about 5 to about 6 nucleotides in length, or about 6 nucleotides in length.
[0146] As used herein, a target nucleic acid, target DNA, target nucleotide sequence, target region, or a target region in the genome refer to a region of an organism's genome that is fully complementary (100% complementary) or substantially complementary (e.g., at least 70% complementary (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more, and any range or value therein)) to a spacer sequence in a guide RNA of this invention. In some embodiments, a target region useful for a Type V CRISPR-Cas system (e.g., LbCas12a) is located immediately 3 to a PAM sequence in the genome of the organism (e.g., a plant genome, an animal genome, a bacterial genome). In some embodiments, a target region may be selected from any at least 15 consecutive nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides, and any range or value therein; e.g., about 19 to about 25 nucleotides, about 20 to about 24 nucleotides in length, and the like) located immediately adjacent to a PAM sequence.
[0147] A protospacer sequence refers to the target nucleic acid and specifically to the portion of the target nucleic acid (e.g., or target region in the genome) that is fully or substantially complementary (and hybridizes) to the spacer sequence of the CRISPR repeat-spacer sequences (e.g., guide RNAs, CRISPR arrays, crRNAs).
[0148] In the case of Type V CRISPR-Cas Cas12a systems, the protospacer sequence is flanked (immediately adjacent to) a protospacer adjacent motif (PAM). The PAM is located at the 5 end on the non-target strand and at the 3 end of the target strand (see below, as an example).
TABLE-US-00001 5-NNNNNNNNNNNNNNNNNNN-3RNASpacer(SEQIDNO:27) |||||||||||||||||||| 3AAANNNNNNNNNNNNNNNNNNN-5Targetstrand(SEQIDNO:28) |||| 5TTTNNNNNNNNNNNNNNNNNNN-3Non-targetstrand(SEQIDNO:29)
[0149] Canonical Cas12a PAMs are T rich. In some embodiments, a canonical Cas12a PAM sequence may be 5-TTN, 5-TTTN, or 5-TTTV.
[0150] The polypeptides, fusion proteins and/or systems of the invention may be encoded by polynucleotides or nucleic acid constructs. In some embodiments, a polynucleotide/nucleic acid construct encoding the polypeptides, fusion proteins and/or systems of the invention may be operably associated with regulatory elements (e.g., promotors, terminators and the like) for expression in an organism of interest and/or a cell of an organism of interest as described herein. In some embodiments, a polynucleotide/nucleic acid construct encoding a polypeptide, fusion protein and/or system of the invention may be codon optimized for expression in an organism.
[0151] In some embodiments, the present invention provides a complex comprising (a) a modified LbCas12a polypeptide of the invention or a fusion protein of the invention and (b) a guide nucleic acid (e.g., CRISPR RNA, CRISPR DNA, crRNA, crDNA).
[0152] In some embodiments, the present invention provides a composition comprising (a) a modified LbCas12a polypeptide of the invention or a fusion protein of the invention and (b) a guide nucleic acid.
[0153] In some embodiments, the present invention provides expression cassettes and/or vectors comprising the polynucleotides/nucleic acid constructs of the invention. In some embodiments, expression cassettes and/or vectors comprising the polynucleotides/nucleic acid constructs of the invention and/or one or more guide nucleic acids may be provided. In some embodiments, a nucleic acid construct encoding a modified CRISPR-Cas nuclease and/or a fusion protein comprising a modified CRISPR-Cas nuclease of the invention may be comprised in the same or a separate expression cassette or vector from that comprising the guide nucleic acid. When the nucleic acid construct is comprised in a separate expression cassette or vector from that comprising the guide nucleic acid, a target nucleic acid may be contacted with (e.g., provided with) the expression cassette or vector comprising the nucleic acid construct of the invention prior to, concurrently with, or after the expression cassette comprising the guide nucleic acid is provided (e.g., contacted with the target nucleic acid).
[0154] In some embodiments, the present invention provides expression cassettes and/or vectors encoding compositions and/or complexes of the invention or comprising systems of the invention.
[0155] In some embodiments, the polynucleotides, nucleic acid constructs, expression cassettes and/or vectors of the invention that are optimized for expression in an organism may be about 70% to about 100% identical (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100%, and any value or range therein) to the polynucleotides, nucleic acid constructs, expression cassettes and/or vectors encoding the same modified CRISPR-Cas nuclease or fusion protein of the invention but which has not been codon optimized for expression in an organism. An organism for which a polynucleotide or nucleic acid construct may be optimized may include but is not limited to, an animal, a plant, a fungus, an archaeon, or a bacterium. In some embodiments, a polynucleotide or nucleic acid construct of the invention is codon optimized for expression in a plant.
[0156] In some embodiments, the invention provides cells comprising one or more polynucleotides, guide nucleic acids, nucleic acid constructs, systems, expression cassettes and/or vectors of the invention.
[0157] The nucleic acid constructs of the invention (e.g., encoding a modified CRISPR-Cas nuclease of the invention and/or a fusion protein comprising a modified CRISPR-Cas nuclease of the invention) and expression cassettes/vectors comprising the same may be used for modifying target nucleic acids and/or their expression in vivo (e.g., in an organism or the cell of an organism; e.g., a plant) and in vitro (e.g., in a cell or a cell free system).
[0158] The present invention further provides methods for altering the PAM specificity of a Cas12a polypeptide. In some embodiments, a method for altering PAM specificity is provided that comprises introducing a mutation into the Cas12a polypeptide wherein the mutation is at amino acid residue K116, K120, K121, D122, E125, T148, T149, T152, D156, E159, Q529, D535, K538, D541, Y542, L585, K591, M592, K595, V596, 5599, K600, K601, Y616, Y646, W649 with reference to the position numbering of SEQ ID NO:1. In some embodiments, the mutation that is introduced into the Cas12a polypeptide is K116R, K116N, K120R, K120H, K120N, K120T, K120Y, K120Q, K121S, K121T, K121H, K121R, K121G, K121D, K121Q, D122R, D122K, D122H, D122E, D122N, E125R, E125K, E125Q, E125Y, T148H, T148S, T148A, T148C, T149A, T149C, T149S, T149G, T149H, T149P, T149F, T149N, T149D, T149V, T152R, T152K, T152W, T152Y, T152H, T152Q, T152E, T152L, T152F, D156R, D156K, D156Y, D156W, D156Q, D156H, D156I, D156V, D156L, D156E, E159K, E159R, E159H, E159Y, E159Q, Q529N, Q529T, Q529H, Q529A, Q529F, Q529G, Q529G, Q529S, Q529P, Q529W, Q529D, G532D, G532N, G532S, G532H, G532F, G532K, G532R, G532Q, G532A, G532L, G532C, D535N, D535H, D535V, D535T, D535,S D535A, D535W, D535K, K538R K538V, K538Q, K538W, K538Y, K538F, K538H, K538L, K538M, K538C, K538G, K538A, K538P, D541N, D541H, D541R, D541K, D541Y, D541I, D541A, D541S, D541E, Y542R, Y542K, Y542H, Y542Q, Y542F, Y542L, Y542M, Y542P, Y542V, Y542N, Y542T, L585G, L585H, L585F, K591W, K591F, K591Y, K591H, K591R, K591S, K591A, K591G, K591P, M592R, M592K, M592Q, M592E, M592A, K595R, K595Q, K595Y, K595L, K595W, K595H, K595E, K595S, K595D, K595M, V596T, V596H, V596G, V596A, S599G, S599H, S599N, S599D, K600R, K600H, K600G, K601R, K601H, K601Q, K601T, Y616K, Y616R, Y616E, Y616F, Y616H, Y646R, Y646E, Y646K, Y646H, Y646Q, Y646W, Y646N, W649H, W649K, W649Y, W649R, W649E, W649S, W649V, and/or W649T with reference to the position numbering of SEQ ID NO:1. In some embodiments, the mutation that is introduced into the Cas12a polypeptide is at amino acid residue position K116, K120, K121, D122, E125, T152, D156, E159, G532, D535, K538, D541, and/or K595 with reference to position numbering of SEQ ID NO:1, optionally wherein the mutation is K116R, K116N, K120Y, K121S, K121R, D122H, D122N, E125K, T152R, T152K, T152Y, T152Q, T152E, T152F, D156R, D156W, D156Q, D156H, D156I, D156V, D156L, D156E, E159K, E159R, G532N, G532S, G532H, G532K, G532R, G532L, D535N, D535H, D535T, D535,S D535A, D535W, K538R K538V, K538Q, K538W, K538Y, K538F, K538H, K538L, K538M, K538C, K538G, K538A, D541E, K595R, K595Q, K595Y, K595W, K595H, K595S, and/or K595M with reference to position numbering of SEQ ID NO:1. The mutation that is introduced may be a single mutation or it may be a combination of two or more mutations. As would be understood, any single Cas12a polypeptide having two or more mutations would comprise only a single mutation at any given position. In some embodiments, the Cas12a polypeptide that is altered in PAM specificity by the methods of this invention is a LbCas12a polypeptide (Lachnospiraceae bacterium).
[0159] Modified Cas12a polypeptides or nucleases (e.g., LbCas12a nucleases) of the invention may be used for modifying a target nucleic acid in a cell or a cell free system (e.g., altering the target nucleic acid, altering the genome of the cell/organism). Accordingly, in some embodiments, a method of modifying a target nucleic acid is provided, the method comprising: contacting the target nucleic acid with: (a)(i) a modified LbCas12a polypeptide of the invention, or a fusion protein of the invention (e.g., a modified LbCas12a polypeptide of the invention and a polypeptide of interest (e.g., a deaminase)), and (ii) a guide nucleic acid; (b) a complex of the invention comprising (i) a modified LbCas12a polypeptide or a fusion protein of the invention, and (ii) a guide nucleic acid; (c) a composition comprising (i) a modified LbCas12a polypeptide of the invention, or a fusion protein of the invention, and (ii) a guide nucleic acid; and/or (d) a system of the invention, thereby modifying the target nucleic acid. In some embodiments, a method of modifying/altering the genome of a cell or organism is provided, the method comprising: contacting a target nucleic acid in the genome of the cell/organism with: (a)(i) a modified LbCas12a polypeptide of the invention, or a fusion protein of the invention (e.g., a modified LbCas12a polypeptide of the invention and a polypeptide of interest (e.g., a deaminase)), and (ii) a guide nucleic acid; (b) a complex of the invention comprising (i) a modified LbCas12a polypeptide or a fusion protein of the invention, and (ii) a guide nucleic acid; (c) a composition comprising (i) a modified CRISPR-Cas nuclease (e.g., a modified LbCas12a polypeptide) of the invention, or a fusion protein of the invention, and (ii) a guide nucleic acid; and/or (d) a system of the invention, thereby modifying/altering the genome of a cell or organism. In some embodiments, the cell or organism is a plant cell or a plant.
[0160] In some embodiments, a method of modifying a target nucleic acid is provided, the method comprising: contacting a cell or a cell free system comprising the target nucleic acid with: (a)(i) a polynucleotide of the invention (e.g., encoding a modified LbCas12a polypeptide of the invention, or encoding fusion protein comprising a modified LbCas12a polypeptide of the invention and a polypeptide of interest (e.g., a deaminase)), or an expression cassette or vector comprising the same, and (ii) a guide nucleic acid, or an expression cassette and/or vector comprising the same; and/or (b) a nucleic acid construct encoding a complex of the invention comprising a modified LbCas12a polypeptide of the invention, or fusion protein comprising a modified LbCas12a polypeptide of the invention and a polypeptide of interest (e.g., a deaminase), or an expression cassette and/or vector comprising the same, wherein the contacting is carried out under conditions whereby the polynucleotide and/or nucleic acid construct is/are expressed and the modified LbCas12a polypeptide and/or fusion protein is/are produced, which forms a complex with the guide nucleic acid, thereby modifying the target nucleic acid. In some embodiments, a method of modifying/altering the genome of a cell and/or organism is provided, the method comprising: contacting a cell and/or cell in an organism comprising the target nucleic acid with: (a)(i) a polynucleotide of the invention (e.g., encoding a modified LbCas12a polypeptide of the invention, or encoding fusion protein comprising a modified LbCas12a polypeptide of the invention and a polypeptide of interest (e.g., a deaminase)), or an expression cassette or vector comprising the same, and (ii) a guide nucleic acid, or an expression cassette and/or vector comprising the same; and/or (b) a nucleic acid construct encoding a complex of the invention comprising a modified LbCas12a polypeptide of the invention, or fusion protein comprising a modified LbCas12a polypeptide of the invention and a polypeptide of interest (e.g., a deaminase), or an expression cassette and/or vector comprising the same, wherein the contacting is under conditions whereby the polynucleotide and/or nucleic acid construct is/are expressed and the modified LbCas12a polypeptide and/or fusion protein is/are produced, which form(s) a complex with the guide nucleic acid, thereby modifying the target nucleic acid.
[0161] In some embodiments, the present invention provides a method of editing a target nucleic acid, the method comprising: contacting the target nucleic acid with: (a)(i) a fusion protein of the present invention (comprising a modified LbCas12a polypeptide of the invention and a polypeptide of interest (e.g., a deaminase), and (a)(ii) a guide nucleic acid; (b) a complex comprising a fusion protein of the present invention, and a guide nucleic acid; (c) a composition comprising the fusion protein of the present invention and a guide nucleic acid; and/or (d) a system of the invention, thereby editing the target nucleic acid.
[0162] In some embodiments, the present invention provides a method of editing a target nucleic acid, the method comprising: contacting a cell or a cell free system comprising the target nucleic acid with: (a)(i) a polynucleotide encoding a fusion protein of the invention (e.g., a modified LbCas12a polypeptide of the invention and a polypeptide of interest (e.g. a deaminase)) or an expression cassette and/or vector comprising the same, and (a)(ii) a guide nucleic acid, or an expression cassette and/or vector comprising the same; (b) a nucleic acid construct encoding a complex comprising a fusion protein of the present invention, and a guide nucleic acid, or an expression cassette and/or vector comprising the same; and/or (c) a system of the present invention wherein the contacting is carried out under conditions whereby the polynucleotide and/or nucleic acid construct is/are expressed and the modified CRISPR-Cas nuclease and/or fusion protein is/are produced, which form(s) a complex with the guide nucleic acid, thereby editing the target nucleic acid.
[0163] The CRISPR-Cas nucleases having modified PAM recognition specificities may be utilized in many ways including, but not limited to, creating indels (NHEJ), in homology directed repair, as a genome recognition element without a nuclease function (dead Cpf1), as a genome recognition element with a partially functional nuclease (nickase Cpf1), in fusion proteins for catalytic editing of genomic DNA (DNA base editors), in fusions proteins for catalytic editing of RNA (RNA base editors), for targeting of other macromolecules to specific genomic regions; for targeting of small chemicals to specific genomic regions, for labeling of specific genomic regions and/or for CRISPR-directed genomic recombination strategies.
[0164] When provided on different nucleic acid constructs, expression vectors, and/or vectors, a nucleic acid construct of the invention may be contacted with a target nucleic acid prior to, concurrently with or after contacting the target nucleic acid with a guide nucleic acid.
[0165] The modified CRISPR-Cas nucleases of the invention and polypeptides and nucleic acid constructs encoding the same may be used for modifying a target nucleic acid in any organism, including but not limited to, an animal, a plant, a fungus, an archaeon, or a bacterium. An animal can include, but is not limited to, a mammal, an insect, a fish, a bird, and the like. Exemplary mammals for which this invention may be useful include, but are not limited to, primates (human and non-human (e.g., a chimpanzee, baboon, monkey, gorilla, etc.)), cats, dogs, mice, rats, ferrets, gerbils, hamsters, cows, pigs, horses, goats, donkeys, or sheep.
[0166] A target nucleic acid of any plant or plant part may be modified and/or edited (e.g., mutated, e.g., base edited, cleaved, nicked, and the like) using the nucleic acid constructs of the invention. Any plant (or groupings of plants, for example, into a genus or higher order classification) may be modified using the nucleic acid constructs of this invention including an angiosperm, a gymnosperm, a monocot, a dicot, a C3, C4, CAM plant, a bryophyte, a fern and/or fern ally, a microalgae, and/or a macroalgae. A plant and/or plant part useful with this invention may be a plant and/or plant part of any plant species/variety/cultivar. The term plant part, as used herein, includes but is not limited to, embryos, pollen, ovules, seeds, leaves, stems, shoots, flowers, branches, fruit, kernels, ears, cobs, husks, stalks, roots, root tips, anthers, plant cells including plant cells that are intact in plants and/or parts of plants, plant protoplasts, plant tissues, plant cell tissue cultures, plant calli, plant clumps, and the like. As used herein, shoot refers to the above ground parts including the leaves and stems. Further, as used herein, plant cell refers to a structural and physiological unit of the plant, which comprises a cell wall and also may refer to a protoplast. A plant cell can be in the form of an isolated single cell or can be a cultured cell or can be a part of a higher-organized unit such as, for example, a plant tissue or a plant organ.
[0167] Non-limiting examples of plants useful with the present invention include turf grasses (e.g., bluegrass, bentgrass, ryegrass, fescue), feather reed grass, tufted hair grass, miscanthus, arundo, switchgrass, vegetable crops, including artichokes, kohlrabi, arugula, leeks, asparagus, lettuce (e.g., head, leaf, romaine), malanga, melons (e.g., muskmelon, watermelon, crenshaw, honeydew, cantaloupe), cole crops (e.g., brussels sprouts, cabbage, cauliflower, broccoli, collards, kale, chinese cabbage, bok choy), cardoni, carrots, napa, okra, onions, celery, parsley, chick peas, parsnips, chicory, peppers, potatoes, cucurbits (e.g., marrow, cucumber, zucchini, squash, pumpkin, honeydew melon, watermelon, cantaloupe), radishes, dry bulb onions, rutabaga, eggplant, salsify, escarole, shallots, endive, garlic, spinach, green onions, squash, greens, beet (e.g., sugar beet and fodder beet), sweet potatoes, chard, horseradish, tomatoes, turnips, and spices; a fruit crop such as apples, apricots, cherries, nectarines, peaches, pears, plums, prunes, cherry, quince, fig, nuts (e.g., chestnuts, pecans, pistachios, hazelnuts, pistachios, peanuts, walnuts, macadamia nuts, almonds, and the like), citrus (e.g., clementine, kumquat, orange, grapefruit, tangerine, mandarin, lemon, lime, and the like), blueberries, black raspberries, boysenberries, cranberries, currants, gooseberries, loganberries, raspberries, strawberries, blackberries, grapes (e.g., wine and table), avocados, bananas, kiwi, persimmons, pomegranate, pineapple, tropical fruits, pomes, melon, mango, papaya, and lychee, a field crop plant such as clover, alfalfa, timothy, evening primrose, meadow foam, corn/maize (e.g., field, sweet, popcorn), hops, jojoba, buckwheat, safflower, quinoa, wheat, rice, barley, rye, millet, sorghum, oats, triticale, sorghum, tobacco, kapok, a leguminous plant (beans (e.g., green and dried), lentils, peas, soybeans), an oil seed plant (e.g., rape, canola, mustard, poppy, olive, sunflower, coconut, castor oil plant, cocoa bean, groundnut, oil palm, soybean, Camelina, and the like), duckweed, Arabidopsis, a fiber plant (cotton, flax, hemp, jute), Cannabis (e.g., Cannabis sativa, Cannabis indica, and Cannabis ruderalis), lauraceae (e.g., cinnamon, camphor), or a plant such as coffee, sugar cane, tea, and natural rubber plants; and/or a bedding plant such as a flowering plant, a cactus, a succulent and/or an ornamental plant (e.g., roses, tulips, violets), as well as trees such as forest trees (broad-leaved trees and evergreens, such as conifers; e.g., elm, ash, oak, maple, fir, spruce, cedar, pine, birch, cypress, eucalyptus, willow), as well as shrubs and other nursery stock. In some embodiments, the nucleic acid constructs of the invention and/or expression cassettes and/or vectors encoding the same may be used to modify maize, soybean, wheat, canola, rice, tomato, pepper, sunflower, raspberry, blackberry, black raspberry and/or cherry.
[0168] The present invention further comprises a kit to carry out methods of this invention. A kit of this invention can comprise reagents, buffers, and/or apparatus for mixing, measuring, sorting, labeling, etc, as well as instructions and the like as would be appropriate for modifying a target nucleic acid.
[0169] In some embodiments, the invention provides a kit comprising one or more polynucleotides and/or nucleic acid constructs of the invention, and/or expression cassettes and/or vectors comprising the same, with optional instructions for the use thereof. In some embodiments, a kit may further comprise a polypeptide of interest and/or polynucleotide encoding the same and expression cassette and/or vector comprising the same. In some embodiments, a guide nucleic acid may be provided on the same expression cassette and/or vector as a nucleic acid construct of the invention. In some embodiments, a guide nucleic acid may be provided on a separate expression cassette or vector from that comprising the nucleic acid construct of the invention.
[0170] Accordingly, in some embodiments, kits are provided comprising a nucleic acid construct comprising (a) a polynucleotide encoding a modified CRISPR-Cas nuclease as provided herein and (b) a promoter that drives expression of the polynucleotide of (a). In some embodiments, the kit may further comprise a nucleic acid construct encoding a guide nucleic acid, wherein the construct comprises a cloning site for cloning into the backbone of the guide nucleic acid a nucleic acid sequence that is identical or complementary to a target nucleic acid sequence.
[0171] In some embodiments, the kit may comprise a nucleic acid construct comprising/encoding one or more nuclear localization signals, wherein the nuclear localization signals are fused to the CRISPR-Cas nuclease. In some embodiments, kits are provided comprising a nucleic acid construct of the invention encoding a modified CRISPR-Cas nuclease of the invention or, and/or an expression cassette and/or vector comprising the same, wherein the nucleic acid constructs, expression cassettes and/or vectors may further encode one or more selectable markers useful for identifying transformants (e.g., a nucleic acid encoding an antibiotic resistance gene, herbicide resistance gene, and the like). In some embodiments, the nucleic acid construct may be an mRNA that encodes one or more introns within the encoded CRISPR-Cas nuclease. In some embodiments, a kit may comprise promoters and promoters with introns for use in expression of the polypeptides and nucleic acid constructs of the invention.
Methods for Modifying PAM Specificities of CRISPR-Cas Nucleases and Related Compositions
[0172] CRISPR-Cas systems are directed towards target nucleic acids using two major criteria: homology of the guide RNA to the targeted DNA sequence, and presence of a protospacer adjacent motif (PAM) of a particular sequence. Different CRISPR-Cas nucleases have different PAM sequence requirements, such as NGG for SpCas9 or TTTV (where V is any non-thymidine nucleotide) for LbCas12a (Cpf1). Screening new CRISPR nucleases or mutants thereof for their PAM requirements can be complicated and unpredictable because so many iterations are possible. In vitro assays, particularly PAM Determination Assays (PAMDA), may be used to screen PAM specificity for any particular CRISPR nuclease or mutant thereof. These assays rely on a randomized portion of DNA that is adjacent to a defined/known protospacer sequence. Guide RNAs can be designed to target the known protospacer sequence and if the randomized PAM region contains the appropriate DNA sequence (e.g., recognized by the CRISPR nuclease or mutants thereof), then the CRISPR nuclease can bind and cut the target.
[0173] The PAM recognition sites for CRISPR-Cas nucleases may be assessed using PAM site-depletion assays (e.g., PAM depletion assays) or PAM Determination Assays (PAMDA) (Kleinstiver et al. Nat Biotechnol 37: 276-282 (2019)). For PAM depletion assays, a library of plasmids bearing randomized nucleotides (base pairs) adjacent to a protospacer is tested for cleavage by a CRISPR nuclease in a bacterium (e.g., E. coli). The plasmids may comprise, for example, polynucleotides conferring antibiotic resistance that are adjacent to randomized PAM sequences. Those sequences which are not cut upon exposure to a CRISPR-Cas nuclease enable a cell to survive in the presence of an antibiotic due to the presence of the antibiotic resistance gene, whereas plasmids bearing targetable PAMs are cleaved and depleted from the library due to cell death. Sequencing of the surviving (uncleaved) population of plasmids enables the calculation of a post-selection PAM depletion value, which is compared to a library that has not been exposed to the CRISPR-Cas nuclease. Those sequences which are depleted from the pool of sequences in the experimental library contain the PAM sequence(s) recognized by the CRISPR-Cas nuclease.
[0174] Another method that may be used to identify PAM sequences is a PAM Determination Assay (PAMDA) (Kleinstiver et al. Nat Biotechnol 37: 276-282 (2019)). In this case, cleavage is performed outside of living cells. In PAMDA, a single DNA strand is synthesized with a randomized portion of nucleotides next to a defined protospacer sequence. An oligonucleotide is annealed to the 3-end of the synthesized DNA strand and extended using an exonuclease minus (-exo) Klenow fragment, polymerizing over the defined and random sequences. This generates a duplex library that is then cut with restriction endonucleases and cloned into bacteria in order to amplify the total DNA. The plasmids are extracted and linearized with another restriction endonuclease to make a linear template. The template is contacted with a CRISPR-Cas nuclease-guide RNA complex. Only those sequences containing a PAM that is recognized by the CRISPR-Cas nuclease will be cleaved. Both the experimental library and the control library (not exposed to the CRISPR-Cas nuclease) are then amplified via PCR. Only the sequences that are not cleaved by the CRISPR-Cas nuclease will be amplified. The PCR amplified sequences from the control library and the experimental library (treated with CRISPR-Cas nuclease) are sequenced and compared. The PAM sequences that are present in the control (not exposed to CRISPR-Cas nuclease) library but not in the experimental library are the PAM sequences that are recognized by the CRISPR-Cas nuclease (thereby, allowing the protospacer to be cleaved).
[0175] For the assessment of nuclease requirements in vitro, a randomized PAM library is prepared. Steps described for this method involve preparation of an unbiased randomized DNA library containing all PAM sequences to be evaluated, cloning into a plasmid, introduction of the library into bacteria to increase the total amount of starting DNA, extraction of the plasmids, linearization of the plasmids with a restriction enzyme to remove supercoiling, exposing the linearized molecules to the CRIPSR-Cas nuclease, amplifying the fragments (e.g., PCR), and finally sequencing analysis (e.g., next generation sequencing, NGS). The initial steps of generating an unbiased library and restriction digests require at least two restriction enzymes, Klenow extension, and cleaning of the products before ligating into a vector. Using two to three restriction enzymes typically eliminates some PAM sequences from the library, which introduces bias into the library. In addition, subsequent Klenow extension and cleanup steps can also eliminate PAM sequences, thereby introducing further bias into the library. In order to avoid the loss of PAM sequences and to generate a more complete and unbiased library, the present invention provides a new method for generating randomized PAM libraries using overlapping solid-state synthesized oligonucleotides (e.g., annealed oligonucleotides) with overhangs (see, e.g.,
[0176] Accordingly, in some embodiments, the present invention provides a method of constructing a randomized DNA library comprising double stranded nucleic acid molecules for determining protospacer adjacent motif (PAM) requirements/specificity of a CRISPR-Cas nuclease having a PAM recognition site at the 5 end of the protospacer, the method comprising: preparing two or more double stranded nucleic acid molecules comprising the following steps: (a) synthesizing a non-target oligonucleotide (first) strand and a target oligonucleotide (second) strand for each of the two or more double stranded nucleic acid molecules, wherein the non-target oligonucleotide strand comprises, 5 to 3: (i) a first sequence having about 5 to about 15 nucleotides (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides, and any range therein), (ii) (ii) a second sequence having at least four randomized nucleotides (e.g., at least 4, 5, 6, 7, 8, 9, 10, or more, and any range therein), (ii) a protospacer sequence comprising about 16 to about 25 nucleotides (e.g., about 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, and any range therein), and (iv) a third sequence having about 5 to about 20 nucleotides (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleotides, and any range therein), wherein the first sequence having about 5 to 15 nucleotides of (i) is immediately adjacent to the 5 end of the second sequence of (ii), the second sequence of (ii) is immediately adjacent to the 5 end of the protospacer sequence of (iii), and the protospacer sequence is immediately adjacent to the 5 end of the third sequence of (iv); and the target oligonucleotide (second) strand is complementary to the non-target oligonucleotide strand; and (b) annealing the non-target oligonucleotide strand to the complementary target oligonucleotide strand to produce a double stranded nucleic acid molecule, wherein the first sequence comprises a restriction site (at its 5 end) and the third sequence comprises a restriction site (at its 3 end), wherein the first sequence (i), the protospacer sequence (iii) and the third sequence (iv) of each of the two or more double stranded nucleic acid molecules is identical, thereby constructing the randomized DNA library comprising double stranded nucleic acid molecules. In some embodiments, the target strand and/or the non-target strand may be 5 phosphorylated.
[0177] In some embodiments, the present invention provides a method of constructing a randomized DNA library comprising double stranded nucleic acid molecules for determining protospacer adjacent motif (PAM) requirements/specificity of a CRISPR-Cas nuclease having a PAM recognition site at the 3 end of the protospacer, the method comprising: preparing two or more double stranded nucleic acid molecules comprising the following steps: (a) synthesizing a non-target oligonucleotide (first) strand and a target oligonucleotide (second) strand for each of the two or more double stranded nucleic acid molecules, wherein the non-target oligonucleotide strand comprises, 5 to 3: (i) a first sequence having about 5 to about 20 nucleotides (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleotides, and any range therein), (ii) a protospacer sequence comprising about 16 to about 25 nucleotides (e.g., about 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, and any range therein), (iii) a second sequence having at least four randomized nucleotides (e.g., at least 4, 5, 6, 7, 8, 9, 10, or more, and any range therein), and (iv) a third sequence having about 5 to about 15 nucleotides (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 nucleotides, and any range therein), wherein the first sequence having about 5 to 20 nucleotides of (i) is immediately adjacent to the 5 end of the protospacer sequence of (ii), the second sequence of (iii) is immediately adjacent to the 3 end of the protospacer sequence of (iii), and the third sequence of (iv) is immediately adjacent to the 3 end of the second sequence of (iii); and the target oligonucleotide (second) strand is complementary to the non-target oligonucleotide strand; and (b) annealing the non-target oligonucleotide strand to the complementary target oligonucleotide strand to produce a double stranded nucleic acid molecule, wherein the first sequence (i) comprises a restriction site (at its 5 end) and the third sequence (iv) comprises a restriction site (at its 3 end), wherein the first sequence (i), the protospacer sequence (ii) and the third sequence (iv) of each of the two or more double stranded nucleic acid molecules is identical, thereby constructing the randomized DNA library comprising double stranded nucleic acid molecules. In some embodiments, the target strand and/or the non-target strand may be 5 phosphorylated.
[0178] In some embodiments, the double stranded nucleic acid molecules may be ligated into a vector to produce a vector comprising the randomized DNA library. In some embodiments, the vector may be a high copy number vector. In some embodiments, the randomized DNA library may be amplified by, for example, introducing the vector comprising the randomized DNA library into one or more bacterial cells and culturing the one or more bacterial cells. In some embodiments, the vector comprising the randomized DNA library may be isolated from the one or more bacterial cells after culturing. The isolated vector may then be linearized (e.g., by contacting the vector with one or more restriction enzymes; e.g., ScaI or PfoI) for use in, for example, the analysis of the PAM recognition specificity of a CRISPR-Cas nuclease. In some embodiments, Pfo1 may be used to linearize the isolated vector.
[0179] In some embodiments, a randomized DNA library may be provided for determining protospacer adjacent motif (PAM) requirements/specificity of a CRISPR-Cas nuclease having a PAM recognition site on the 5 end of protospacer, the randomized DNA library comprising two or more double stranded nucleic acid molecules each of which comprises: (a) a non-target oligonucleotide (first) strand and a target oligonucleotide (second) strand, wherein the non-target oligonucleotide strand comprises, 5 to 3: (i) a first sequence having about 5 to about 15 nucleotides (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides, and any range therein), (ii) a second sequence having at least four randomized nucleotides (e.g., at least 4, 5, 6, 7, 8, 9, 10, or more, and any range therein), (iii) a protospacer sequence comprising about 16 to about 25 nucleotides (.g., about 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, and any range therein), and (iv) a third sequence having about 5 to about 20 nucleotides (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleotides, and any range therein), wherein the first sequence having about 5 to 15 nucleotides of (i) is immediately adjacent to the 5 end of the second sequence of (ii), the second sequence of (ii) is immediately adjacent to the 5 end of the protospacer sequence of (iii), and the protospacer sequence is immediately adjacent to the 5 end of the third sequence of (iv); and the target oligonucleotide (second) strand is complementary to the non-target oligonucleotide strand; and (b) the non-target oligonucleotide strand is annealed to the complementary target oligonucleotide strand to produce a double stranded nucleic acid molecule, wherein the first sequence comprises a restriction site (at its 5 end) and the third sequence comprises a restriction site (at its 3 end), wherein the first sequence (i), the protospacer sequence (iii) and the third sequence (iv) of each of the two or more double stranded nucleic acid molecules are identical. In some embodiments, the target strand and/or the non-target strand may be 5 phosphorylated.
[0180] In some embodiments, a randomized DNA library may be provided for determining protospacer adjacent motif (PAM) requirements/specificity of a CRISPR-Cas nuclease having a PAM recognition site on the 3 end of protospacer, the randomized DNA library comprising two or more double stranded nucleic acid molecules each of which comprises: (a) a non-target oligonucleotide (first) strand and a target oligonucleotide (second) strand, wherein the non-target oligonucleotide strand comprises, 5 to 3: (i) a first sequence having about 5 to about 20 nucleotides (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleotides, and any range therein), (ii) a protospacer sequence comprising about 16 to about 25 nucleotides (e.g., about 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, and any range therein), (iii) a second sequence having at least four randomized nucleotides (e.g., at least 4, 5, 6, 7, 8, 9, 10, or more, and any range therein), and (iv) a third sequence having about 5 to about 15 nucleotides (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 nucleotides, and any range therein), wherein the first sequence having about 5 to 20 nucleotides of (i) is immediately adjacent to the 5 end of the protospacer sequence of (ii), the second sequence of (iii) is immediately adjacent to the 3 end of the protospacer sequence of (iii), and the third sequence of (iv) is immediately adjacent to the 3 end of the second sequence of (iii); and the target oligonucleotide (second) strand is complementary to the non-target oligonucleotide strand; and (b) the non-target oligonucleotide strand is annealed to the complementary target oligonucleotide strand to produce a double stranded nucleic acid molecule, wherein the first sequence comprises a restriction site (at its 5 end) and the third sequence comprises a restriction site (at its 3 end), wherein the first sequence (i), the protospacer sequence (ii) and the third sequence (iv) of each of the two or more double stranded nucleic acid molecules are identical. In some embodiments, the target strand and/or the non-target strand may be 5 phosphorylated.
[0181] In some embodiments, the present invention provides a method of determining protospacer adjacent motif (PAM) specificity of a CRISPR-Cas nuclease, the method comprising: contacting the CRISPR-Cas nuclease with a randomized DNA library of the present invention; and sequencing the double stranded nucleic acid molecules of the randomized DNA library before (e.g., the control) and after contact with the CRISPR-Cas nuclease, wherein double stranded nucleic acid molecules present in the randomized DNA library prior to contact with the CRISPR-Cas nuclease but absent in the randomized DNA library after contact with the CRISPR-Cas nuclease identifies the PAM recognition sequence of the CRISPR-Cas nuclease, thereby determining the PAM specificity of the CRISPR-Cas nuclease.
[0182] In some embodiments, a method of determining protospacer adjacent motif (PAM) specificity of a CRISPR-Cas nuclease, comprises: contacting the CRISPR-Cas nuclease with a randomized DNA library of the present invention; sequencing the double stranded nucleic acid molecules of the randomized DNA library before (e.g., the control) and after contact with the CRISPR-Cas nuclease, and identifying the PAM recognition sequence of the nuclease, wherein identifying comprises comparing the double stranded nucleic acid molecules present in the library before contact with the CRISPR-Cas nuclease to the double stranded nucleic acid molecules present in the library after contact with the CRISPR-Cas nuclease and wherein the double stranded nucleic acid molecules present in the randomized DNA library before contact with the CRISPR-Cas nuclease but absent from the randomized DNA library after contact with the CRISPR-Cas nuclease identifies the PAM specificity of the CRISPR-Cas nuclease.
[0183] The results of sequencing of the randomized library prior to contact can serve as a control to the results of sequencing after contact. In some embodiments, determining the PAM specificity of a CRISPR-Cas nuclease may comprise performing nucleic acid sequencing. In some embodiments, the sequence may comprise next generation sequencing (NGS).
[0184] Any CRISPR-Cas nuclease may be used with the methods of this invention for modifying PAM recognition specificity. Accordingly, a CRISPR-Cas nuclease that may be modified to have a different PAM specificity as compared to wild type can include, but is not limited, to a Cas9, C2c1, C2c3, Cas12a (also referred to as Cpf1), Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, Cas13c, Cas13d, Cas1, Cas1B, Cas2, Cas3, Cas3, Cas3, Cas4, Cas5, Cash, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4 (dinG), and/or Csf5 polypeptide or domain.
[0185] Cas12a is a Type V Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas nuclease originally identified in Prevotella spp. and Francisella spp. Cas12a (previously referred to as Cpf1) differs in several respects from the more well-known Type II CRISPR Cas9 nuclease. For example, Cas9 recognizes a G-rich protospacer adjacent motif (PAM) that is 3 to its guide RNA (gRNA, sgRNA) binding site (protospacer, target nucleic acid, target DNA) (3-NGG), while Cas12a recognizes a T-rich PAM that is located 5 to the binding site (protospacer, target nucleic acid, target DNA) (5-TTN, 5-TTTN). In fact, the orientations in which Cas9 and Cas12a bind their guide RNAs are very nearly reversed in relation to their N and C termini. Furthermore, Cas12a enzymes use a single guide RNA (gRNA, CRISPR array, crRNA) rather than the dual guide RNA (sgRNA (e.g., crRNA and tracrRNA)) found in natural Cas9 systems, and Cas12a processes its own gRNAs. Additionally, Cas12a nuclease activity produces staggered DNA double stranded breaks instead of blunt ends produced by Cas9 nuclease activity, and Cas12a relies on a single RuvC domain to cleave both DNA strands, whereas Cas9 utilizes an HNH domain and a RuvC domain for cleavage.
[0186] A CRISPR Cas12a polypeptide or CRISPR Cas12a domain useful with this invention may be any known or later identified Cas12a nuclease (see, e.g., U.S. Pat. No. 9,790,490, which is incorporated by reference for its disclosures of Cpf1 (Cas12a) sequences). The term Cas12a, Cas12a polypeptide or Cas12a domain refers to an RNA-guided nuclease comprising a Cas12a polypeptide, or a fragment thereof, which comprises the guide nucleic acid binding domain of Cas12a and/or an active, inactive, or partially active DNA cleavage domain of Cas12a. In some embodiments, a Cas12a useful with the invention may comprise a mutation in the nuclease active site (e.g., RuvC site of the Cas12a domain). A Cas12a domain or Cas12a polypeptide having a mutation in its nuclease active site, and therefore, no longer comprising nuclease activity, is commonly referred to as deadCas12a (e.g., dCas12a). In some embodiments, a Cas12a domain or Cas12a polypeptide having a mutation in its nuclease active site may have impaired/reduced activity as compared to the same Cas12a polypeptide without the same mutation (e.g., nickase activity).
[0187] In some embodiments, a Cas12a domain can include, but is not limited to, the amino acid sequence of any one of SEQ ID NOs:1-17 (e.g., SEQ ID NOs:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 and/or 17) or a polynucleotide encoding the same. In some embodiments, a fusion protein of the invention may comprise a Cas12a domain from Lachnospiraceae bacterium ND2006 Cas12a (LbCas12a) (e.g., SEQ ID NO:1).
[0188] A CRISPR Cas9 polypeptide or CRISPR Cas9 domain useful with this invention may be any known or later identified Cas9 nuclease. In some embodiments, a Cas9 polypeptide useful with this invention comprises at least 70% identity (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and the like) to an amino acid sequence of any known Cas9. CRISPR-Cas9 systems are well known in the art and include, but are not limited to, Cas9 polypeptides from Legionella pneumophila str. Paris, Streptococcus thermophilus CNRZ1066, Streptococcus pyogenes MI, or Neisseria lactamica 020-06, and the like.
[0189] Other nucleases that may be useful with this invention for identifying novel PAM recognition sequence include but are not limited to, C2c1, C2c3, Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, Cas13c, Cas13d, Cas1, Cas1B, Cas2, Cas3, Cas3, Cas3, Cas4, Cas5, Cash, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4 (dinG), and/or Csf5
[0190] The invention will now be described with reference to the following examples. It should be appreciated that these examples are not intended to limit the scope of the claims to the invention, but are rather intended to be exemplary of certain embodiments. Any variations in the exemplified methods that occur to the skilled artisan are intended to fall within the scope of the invention.
EXAMPLES
Example 1
Randomized Library
[0191] An example is provided of the method of this invention for the efficient and cost-effective generation of libraries for in vitro cleavage assays (PAM Determination Assays (PAMDA)). Two libraries were generated for protospacers 1 and 2 (see Table 1). Oligonucleotides with a randomized 5 nucleotide sequence at the 5r-end were synthesized and verified (Integrated DNA Technologies) so that each protospacer sequence occupies an equal molar ratio (Table 1). The oligonucleotides for protospacer 1 (PM0518, PM0519) and for protospacer 2 (PM0520, PM0521) were annealed by placing the mixture in a thermal cycler at 95 C. for 5 mins with a cool down for 0.1 C./sec to 25 C./room temperature.
TABLE-US-00002 TABLE1 Protospacer name Oligonumber Sequence PAMDA Protospacer1 GGAATCCCTTCTGCAGCACCTGG(SEQIDNO:30) library1 PAMDA Protospacer2 CTGATGGTCCATGTCTGTTACTC(SEQIDNO:31) library2 Protospacer PM0518 /5Phos/CGATGTNNNNNGGAATCCCTTCTGCAGCACCTGGGCG 1topstrand CAGGTCACGAGG(SEQIDNO:32) Protospacer PM0519 /5Phos/AATTCCTCGTGACCTGCGCCCAGGTGCTGCAGAAGGG 1bottom ATTCCNNNNNACATCGCATG(SEQIDNO:33) strand Protospacer PM0520 /5Phos/CGATGTNNNNNCTGATGGTCCATGTCTGTTACTCGCG 2topstrand CAGGTCACGAGG(SEQIDNO:34) Protospacer PM0521 /5Phos/AATTCCTCGTGACCTGCGCGAGTAACAGACATGGACC 2bottom ATCAGNNNNNACATCGCATG(SEQIDNO:35) strand
[0192] The annealed double stranded fragments were ligated directly to a SphI and EcoRI digested pUC19 vector. The ligated protospacer constructs were used to transform XL1-blue Electro competent E. coli cells (Agilent) and recovered in 1 ml SOC media at 37 C. for 1 hr. Carbenicillin plates were used to check for the presence of the ligated products in the E. coli cells. The transformed E. coli cells were grown in LB broth supplemented (200 ml) with carbenicillin (50 mg/mL) for 16 hrs. The plasmids comprising the protospacer constructs were purified using Zymo midiprep kit. The plasmids/vectors were subjected to deep sequencing analysis to calculate the frequency of A/T/G/C at each PAM position using an Illumina Miseq.
[0193] This method can be used to generate libraries for PAM determination using any protospacer oligonucleotide(s) of choice wherein the annealed oligonucleotides may comprise any appropriate restriction site selected so as to retain the full complement of PAM sequences in the library.
Example 2
[0194] Lachnospiraceae bacterium ND2006 Cpf1 (LbCpf1) requires a highly specific protospacer adjacent motif (PAM). The TTTV sequence occurs only about 1 in 85 bases in comparison to random nucleotides. This is contrast to the relative promiscuity of NGG for SpCas9 which occurs about 1 in 16 bases in random DNA, TTN for AaC2c1 which occurs about 1 in 16 bases in random DNA, and xCas9/Cas9-NG whose NG PAM requirements occur about 1 in 4 bases. Cpf1 PAMs are far less abundant in corn and soy genes than Cas9 PAMs (
[0195] Such stringency as that shown in
PAMDA Assay
[0196] PAM Determination Assays (PAMDAs) are useful for testing PAM requirements for CRISPR enzymes with unknown PAM recognition. These are in vitro assays which take advantage of the ability of CRISPR-Cas nucleases to cleave target sequences only after successful PAM binding. Briefly, a library of DNA substrates with randomized PAM sequences are incubated with the CRISPR nuclease and then DNA is amplified via PCR. Only intact fragments (e.g., those not recognized by the nuclease) are amplified. Cleaved fragments (those that are recognized by the nuclease) are not amplified. The DNA from both the library that is exposed to the nuclease and a control library (not exposed to the nuclease) are sequenced. The two sets of sequencing results are compared to determine which sequences were cleaved, and thus, not present in the sequencing assemblies post exposure to the nuclease (see, as an example,
LbCpf1 Mutagenesis
[0197] One hundred and eighty six (186) point mutations (Table 2) were designed and individually tested in a PAMDA assay as described herein. Successful engineering may change the PAM recognition sequence generating novel PAM recognizing LbCpf1s or may relax PAM stringency resulting in a more promiscuous LbCpf1.
TABLE-US-00003 TABLE 2 Residues for substitution in SEQ ID NO: 1 K116R K120R K121S D122R E125R T148H T149A K116N K120H K121T D122K E125K T148S T149C K120N K121H D122H E125Q T148A T149S K120T K121R D122E E125Y T148C T149G K120Y K121G D122N T149H K120Q K121D T149P K121Q T149F T149N T149D T149V T152R D156R E159K Q529N G532D D535N K538R T152K D156K E159R Q529T G532N D535H K538V T152W D156Y E159H Q529H G532S D535V K538Q T152Y D156W E159Y Q529A G532H D535T K538W T152H D156Q E159Q Q529F G532F D535S K538Y T152Q D156H Q529G G532K D535A K538F T152E D156I Q529S G532R D535W K538H T152L D156V Q529P G532Q D535K K538L T152F D156L Q529W G532A K538M D156E Q529D G532L K538C G532C K538G K538A K538P D541N Y542R L585G K591W M592R K595R V596T D541H Y542K L585H K591F M592K K595Q V596H D541R Y542H L585F K591Y M592Q K595Y V596G D541K Y542Q K591H M592E K595L V596A D541Y Y542F K591R M592A K595W D541I Y542L K591S K595H D541A Y542M K591A K595E D541S Y542P K591G K595S D541E Y542V K591P K595D Y542N K595M Y542T S599G K600R K601R Y616K Y646R W649H S599H K600H K601H Y616R Y646E W649K S599N K600G K601Q Y616E Y646K W649R S599D K601T Y616F Y646H W649Y Y616H Y646Q W649E Y646W W649S Y646N W649V W649T
[0198] In addition to the individual mutations, combinations of mutations which alter the PAM recognition are combined and evaluated via PAMDA to provide a second generation of LbCpf1 mutations.
Example 3
[0199] Three methods were used to test the 186 mutations:
[0200] (1) An in vitro method, known as a PAMDA assay (Kleinstiver et al. Nat Biotechnol 37:276-282 (2019)), which uses purified protein and a plasmid library to test each point mutation across the library. A depletion of a library member was scored using next generation sequencing (NGS). Depletions were calculated either to the library itself (to determine absolute activity against a particular PAM) or against cleavage by wild-type LbCas12a (to determine if the mutation imparted new PAM recognition as compared to wild-type).
[0201] (2) A bacterial method, known as PAM-SCALAR (Leenay et al. Mol Cell 62:137-147 (2016)), which uses a library in Escherichia coli to test binding of Cas12a mutations to the 256 possible PAM NNNN variants. It does not test cleavage, just binding. Since the mutations made were nowhere near the catalytic region, binding is expected to reflect cleavage as well (verified later in the 293T assay). The advantage to PAM-SCALAR is the ability to rapidly test not only point mutations, but combinations of amino acid point mutations in a quick and accurate way. This assay can be more stringent than in vitro cleavage assays.
[0202] (3) An INDEL assay in human HEK293T cells. This assay is provides valuable eukaryotic INDEL data. In order to get insertions and deletions in eukaryotes, a number of criteria have to be met: the CRISPR enzyme needs to be expressed and stable in the cell, the crRNA needs to be expressed and correctly processed, the protein:RNA complex needs to form, the complex needs to be stable, the complex needs to translocate in sufficient quantities into the nucleus, the target DNA needs to be accessible, the DNA has to be well-targeted by the particular guide-RNA design, and double-stranded breaks need to occur at a rate high enough to yield the occasional DNA repair mistake via an insertion or deletion (INDEL). This makes eukaryotic assays the most stringent assays in this study. A few dozen PAMs were tested for each of the 3 point mutants described below, rather than all 256 due to the experiment being low-throughput. Three different targets were chosen for each PAM-mutant combination to try to avoid false-negatives since often a particular guide is ineffective due to target accessibility.
1. Determining PAM Binding and Cleavage In Vitro
Building a PAM Plasmid-Based Library
[0203] A DNA library consisting of 5 random nucleotides directly 5 to a 23 nucleotide spacer sequence was prepared. LbCas12.a is known to have a 4 nucleotide Protospacer Adjacent Motif (PAM), however we chose to use 5 random nucleotides rather than 4 to allow for replication within the experiment. The spacer sequence used was 5-GGAATCCCTTCTGCAGCACCTGG (SEQ ID NO:30). The library contained the sequence 5-NNNNNGGAATCCCTTCTGCAGCACCTGG (SEQ ID NO:36). Having 5 random nucleotides yield 1024 possible PAMs assayed in this library.
[0204] We used a novel way to generate this library. Rather than using a single randomized pool of PAM-spacer fusions and using a polymerase to generate the complimentary strand as has been previously described (Kleinstiver et al. Nat Biotechnol 37:276-282 (2019)), we chose a more direct method. Two 5-phosphorylated sequences were synthesized:
TABLE-US-00004 (SEQIDNO:32) 5phos/CGATGTNNNNNGGAATCCCTTCTGCAGCACCTGGGCGCAGGTC ACGAGG and (SEQIDNO:35) AATTCCTCGTGACCTGCGCCCAGGTGCTGCAGAAGGGATTCCNNNNNACA TCGCATG/5phos
[0205] When heated and annealed, complimentary sequences between the two NNNNN sequences anneal and the resulting ends have overhangs corresponding to overhangs generated by SphI and EcoRI restriction endonucleases. The two oligonucleotides were annealed at an equal molar ratio in a thermal cycler at 95 C. for 5 min, and cooled for 0.1 C./sec to 25 C./room temperature.
[0206] The annealed double stranded fragments were ligated directly to SphI and EcoRI digested pUC19 vector. The ligated spacer constructs were used to transform XL1-blue Electro competent E. coli cells (Agilent) and recovered in 1 mi Super Optimal broth with glucose (SOC) media at 37 degree for 1 hr. A proportion of aliquot was plated on carbenicillin plates to check for the presence of the ligated products. The remaining transformed cells were grown in 200 ml Luria broth (LB) supplemented with 50 mg/mL carbenicillin for 16 hrs. The spacer plasmids were purified using plasmid midiprep kit (Zymo Research).
Verification of PAM Library
[0207] The spacer vectors were subjected to deep sequencing analysis to calculate the frequency of A/T/G/C at each position of PAM using an Illumina MiSeq according to manufacturer's protocols. Briefly, 10 ng of DNA was used as template for PCR. Phasing gene specific forward and reverse PCR primers were designed to amplify across the target site. Amplicon libraries were generated using a two-step PCR method, where primary PCR with 5 tails allow a secondary PCR to add Illumina i5 and i7 adapter sequences and barcodes for sorting multiplexed samples. PCR amplifications were performed using the following parameters: 98 C. for 30 s; 25 cycles for PCR1 and 8 cycles for PCR2 (98 C. 10 s, 55 C. 20 s, 72 C. 30 s); 72 C. for 5 min; hold at 12 C. The PCR reactions were performed with Q5 High-Fidelity DNA Polymerase (New England BioLabs, Beverly, Mass., United States). The secondary PCR amplicon samples were individually purified using AMPure XP beads according to manufacturer's instruction (Beckman Coulter, Brea, Calif., United States); all purified samples were quantified using a plate reader, pooled with an equal molar ratio, and run on AATI fragment analyzer (Agilent Technologies, Palo Alto, Calif., United States). The pooled amplicon libraries were sequenced on an Illumina MiSeq (2250 paired end) using a MiSeq Reagent kit v2 (Illumina, San Diego, Calif., United States).
[0208] Three separate reads were generated for the library and averaged. The resulting 1024 library members had an average read count of 39 reads and a standard deviation of 11.9 reads. The maximum number of average reads for any PAM sequence was 74 and the minimum was 12. PAM counts followed a normal distribution (
Cloning LbCas12a Mutations
[0209] A DNA cassette composed of an LbCas12a sequence, followed by a nucleoplasmin NLS and a 6 histidine tag was synthesized (GeneWiz) (SEQ ID NO:52) and cloned into a pET28a vector between NcoI and XhoI, generating pWISE450 (SEQ ID NO:53). An additional glycine was added to the sequence between Met-1 and Ser-2 to facilitate cloning. Numbering throughout this document excludes this extra glycine. Then, 186 different amino acid point mutations (Table 2) were made using a similar strategy yielding 186 different plasmid vectors.
Expression and Purification of LbCas12a Mutations
[0210] Glycerol stocks of each mutant in BL21 Star (DE3) cells (ThermoFisher Scientific) were used to inoculate one mL of media with 50 g/mL of kanamycin in a 24-well block. Cultures were sealed with AirPore tape sheets (Qiagen) and grown overnight at 37 C. with shaking. The next morning four mL of ZYP autoinduction media with kanamycin were inoculated with 100 L of overnight culture and incubated at 37 C. with shaking until OD 600 nm range of 0.2-0.5. The temperature was reduced to 18 C. and cultures were grown overnight for protein expression. Cells were harvested by centrifugation and pellets were stored at 80 C.
[0211] The following buffers were used for cell lysis and purification. A lysis buffer comprising non-ionic detergents, lysing agents, reducing agents, protease inhibitors, buffers, and salts. This solution was able to lyse bacteria, reduce viscosity, and allow for downstream purification of enzymes free from interfering nucleases. Buffer A composed of 20 mM Hepes-KOH pH 7.5, 0.5 M NaCl, 10% glycerol, 2 mM TCEP and 10 mM Imidazole pH 7.5. Buffer B was the same as buffer A but also included Imidazole at 20 mM. Buffer C contained 20 mM Hepes-KOH pH 7.5, 150 mM NaCl, 10% glycerol, 0.5 mM TCEP, and 200 mM Imidazole pH 7.5.
[0212] Purification was performed using a multi-well format. Two stainless steel 5/32 BBs were added to all wells containing cell pellets. Pellets were resuspended in 0.5 mL cold lysis buffer and incubated at room temperature for 30 minutes with orbital mixing. The crude lysates, 0.5 mL, were added to pre-equilibrated His MultiTrap plates (Cytiva LifeSciences). The plates were incubated for five minutes at room temperature to allow for protein binding. The remaining steps were performed per manufacturer's instructions. Briefly, plates were washed two times with 0.5 mL buffer A followed by one wash with 0.5 mL buffer B before eluting in 0.2 mL of buffer C. Protein concentrations were determined using Pierce Coomassie Plus (Bradford) Assay Reagent. The protein eluates were stored at 4 C.
Test Cleavage of PAM Library by wtLbCas12a
[0213] A pre-test was performed to assess three aspects of the experiment: ensure the experiment was free from non-specific nucleases, ensure that there was depletion at NTTTV PAMs from the library upon addition of crRNA guides, and to see the extent of depletion at 15 minutes for a spiked sample of CTTTA.
[0214] Reaction conditions for the test depletions were: 27 L total volume of containing nuclease-free water, 3 L NEB buffer 2.1 (New England Biolabs), 3 L stock of the crRNA at 300 nM (5-AAUUUCUACUAAGUGUAGAUGGAAUCCCUUCUGCAGCACCUGG-3 (SEQ ID NO:62), Synthego Corporation), and 1 L of the purified wtLbCas12a at 1 M stock were incubated at room temperature for 10 minutes. 3 L of a 10 ng/L stock was added to start the reaction. The library was either added as-is or 1 L of the CTTTA-containing plasmid was added first at 0.75 ng/L. Total volumes were all 30 L. The reaction was incubated at 37 C. for 15 minutes.
[0215] Table 3 provides the results of the experiment. The library counts for TTTV sequences were between 219 and 515 counts (column 2), adding the wildtype protein which was purified as described in the absence of a crRNA did not result in depletion of the library members (column 3), addition of a crRNA and the protein resulted in depletion of all the NTTTV containing PAMs (column 4), spiking the library with CTTTA resulted in approximately 35 times as many CTTTA NGS counts (column 5), addition of wtLbCas12a and the crRNA resulted in a depletion of all library members, including CTTTA decreasing from 10,776 to 193 counts. Also shown are NACGA PAM-containing library members which show no depletion under the conditions tested, as is expected since ACGA is not a PAM recognized by LbCas12a. Thus, as shown in Table 3, NTTTV PAM library members are efficiently cleaved and depleted by wtLbCas12a, whereas PAMs not recognized by wtLbCas12a (NACGA) are not.
TABLE-US-00005 TABLE 3 PAM library cleavage and depletion. Library spiked Library + Library with Library Library + wtLbCas12a + spiked with CTTTA + member wtLbCas12a crRN CTTTA wtLbCas12a + PAM NGS count NO crRNA A (15 min) (15 min) crRNA (substrate) ATTTG 314 336 13 294 30 CTTTC 219 245 13 225 15 ATTTC 317 392 22 294 22 ATTTA 515 490 37 396 37 TTTTC 359 382 33 286 28 TTTTA 489 666 46 446 32 GTTTG 330 438 34 297 30 GTTTA 395 492 41 378 31 CTTTG 299 333 35 263 28 TTTTG 348 430 41 343 24 CTTTA 293 379 35 10776 193 GTTTC 299 349 39 269 14 (non- substrate) AACGA 215 271 237 197 211 GACGA 273 282 274 251 282 CACGA 264 294 253 194 235 TACGA 302 268 255 225 243
[0216] The results in Table 3 show that (1) effective and nuclease-free purification of wtLbCAs12a was achieved, (2) the library can be depleted under conditions tested for members containing a PAM-substrate, (3) the depletion results upon the addition of a spacer-targeting crRNA, and (4) the enzyme-crRNA complex is in vast-excess of the individual library members since large amounts of CTTTA substrate does not alter the depletion of the substrates.
Cleavage of PAM Library by LbCas12a Mutants
[0217] Identical reaction conditions were tested for each of the 186 PAM mutations as were shown in the test example of wtLbCas12a. Three time points were chosen for each mutation: 75, 435, and 900 seconds at 37 C. Multiple library-only controls were included. The products were subjected to Illumina HiSeq analysis (Genewiz). The data are reported in Table 4.
Absolute Depletion Scores Processing
[0218] We observed little difference in depletion between the four possibilities for any 5 nucleotide PAM. In other words: ANNNN, CNNNN, GNNNN, and TNNNN for any 4 nucleotide sequence had similar PAM depletions. This was in-line with what we observed in the wildtype LbCAs12a experiment which showed NTTTV sequences were all depleted at a similar amount regardless if the N was A, C, G, or T (Table 3). Secondly, we observed the three time points of 75, 435, and 900 seconds all had similar depletions. This indicated that the reaction was nearly complete after just 75 seconds at 37 C. We, therefore, were able to average all four 4nt PAMs from the 5nt library and average all three time points, effectively resulting in 12 data points for each PAM. We then took that average and divided it by the median library values for each PAM. This gave us a depletion score for each 4 nucleotide PAM against all 186 mutants. A depletion of 10 indicates 90% of the 4 parental plasmid library members with that 4 nt PAM were depleted, while a score of 20 indicates 95% depletion.
[0219] The depletion score for wildtype LbCas12a was 9.2 for TTTV sequences, so any mutant which cleaved a PAM at or better than this 9.2 score was considered efficacious using wild type as a benchmark. For example, Table 4 shows the mutant LbCas12a-K595Y depleting in vitro 45 different PAM 4mers from the library at or better than wtLbCas12a cleaves TTTV-containing sequences. This analysis was used to score each of the 186 mutations to determine in vitro PAM recognition and cleavage by each of the mutants. The data containing recognition sequences are shown in Table 4, which shows LbCas12a-K595Y PAMDA depletion scores at or better than wtLbCas12a scores against TTTV-containing sequences of 9.2.
TABLE-US-00006 TABLE 4 PAM depletion data Mutant 4mer Depletion D122H TCCC 18.76 D122H ATTC 17.15 D122H GTTC 16.7 D122H TCCG 15.92 D122H TTCA 14.95 D122H TCGC 14.8 D122H TTCT 14.68 D122H CCCC 14.61 D122H CTTG 14.37 D122H GTTG 14.14 D122H ATTA 13.66 D122H TCTA 12.99 D122H CCTG 12.96 D122H GTTA 12.87 D122H CCTA 12.77 D122H TTCG 12.68 D122H CCTC 12.5 D122H ATTG 12.43 D122H TTGA 12.14 D122H TTAC 11.87 D122H GCGC 11.86 D122H CTTA 11.78 D122H CTCA 11.77 D122H TCTC 11.75 D122H TCCA 11.74 D122H CCGC 11.64 D122H TCGG 11.3 D122H CCCG 11.05 D122H CTTC 11.01 D122H TCAC 10.9 D122H TTTT 10.85 D122H TTTC 10.27 D122H TTTA 10.18 D122H ACTC 10.17 D122H GCTC 10.01 D122H TTGC 9.8 D122H TTCC 9.8 D122H TTGG 9.66 D122H CCCA 9.34 D122K TCCC 13.07 D122K TCCG 13.02 D122K TCTA 12.97 D122K GTTA 11.7 D122K TCTC 11.54 D122K CCCC 11.24 D122K TCTG 10.77 D122K GTTC 10.77 D122K TTAC 10.53 D122K ATTC 10.5 D122K CCGC 10.33 D122K TTCT 10.1 D122K CTCC 10.09 D122K GTTG 10.04 D122K ATTG 10.02 D122K TCGC 9.84 D122K TCGG 9.84 D122K ATTA 9.76 D122K TTCA 9.46 D122K CTTG 9.44 D122K CTTC 9.39 D122K CCTA 9.34 D122K TTTT 9.23 D122K TCCA 9.11 D122K TCAC 8.97 D122K GCTA 8.88 D122K TTCC 8.77 D122K GCGC 8.76 D122K CCTC 8.6 D122K TTGC 8.56 D122K TTCG 8.43 D122K TTTC 8.41 D122N TCCC 11.48 D122N TTTT 11 D122N TCTA 10.38 D122N GTTG 10.31 D122N ATTC 10.27 D122N CCCC 10.22 D122N TTCA 10.16 D122N TCCG 10.02 D122N TTCT 9.86 D122N CTTG 9.79 D122N TCGC 9.72 D122N TCTG 9.66 D122N ATTA 9.62 D122N CTTA 9.61 D122N CTTC 9.49 D122N TCCA 9.46 D122N TTCC 9.44 D122N TTGC 9.39 D122N TTAC 9.36 D122N GTTC 9.22 D122N CCTA 9.18 D122N CCTC 9.16 D122N GTTA 9.14 D122N TTCG 9.04 D122N TCTC 9.01 D122N TTGG 8.97 D122N ATTG 8.7 D122R TCCC 10.09 D122R GTTC 9.87 D122R CCCC 9.85 D122R ATTG 9.82 D122R TTGC 9.8 D122R GTTA 9.53 D122R TTAC 8.94 D122R TTCG 8.87 D122R CTTA 8.8 D122R GCGC 8.73 D122R TTCT 8.6 D122R CCGC 8.6 D122R CCTC 8.53 D122R ATTA 8.25 D122R TCAC 8.17 D122R TTTT 8.09 D122R GTTG 7.81 D122R TTCG 14.53 D156E TTTT 14.35 D156E CTTA 13.86 D156E TTGC 13.64 D156E ATTC 13.58 D156E TTCT 13.51 D156E TTCA 13.24 D156E TCTG 13.06 D156E TCCC 13.05 D156E CTTG 13 D156E TTCC 12.52 D156E ATTG 12.43 D156E TCTA 12.35 D156E TTAC 12.06 D156E TCTC 11.97 D156E GTTG 11.9 D156E ATTA 11.88 D156E CCCG 11.88 D156E CTTC 11.51 D156E TTTC 11.46 D156E CCTG 11.34 D156E CCTA 11.19 D156E GTTA 11.16 D156E GTTC 10.73 D156E TTTG 10.61 D156E TTTA 10.25 D156E CCCC 10.16 D156E CCTC 9.91 D156E CTCC 9.83 D156E CTCA 9.57 D156E TTGG 8.81 D156E GCTC 8.57 D156H CCTG 13.3 D156H TCTG 12.9 D156H TTCC 12.22 D156H TTAC 12.08 D156H ATTC 12.04 D156H CCTC 11.12 D156H CCCA 10.92 D156H TCGC 10.89 D156H TTGC 10.87 D156H GCTA 10.68 D156H GTTG 10.6 D156H CCCG 10.37 D156H CCTA 10.3 D156H GTTA 10.27 D156H GCTC 10.15 D156H CTCC 10.03 D156H GCGC 10 D156H ATTA 10 D156H TCCG 9.99 D156H TCAC 9.98 D156H TCTA 9.95 D156H TCTC 9.74 D156H TTCT 9.69 D156H GTTC 9.51 D156H CCGC 9.45 D156H TTCA 9.4 D156H CCCC 9.28 D156H TCGA 9.14 D156H TTTT 9.13 D156H GCCC 9.1 D156H TCCA 9.05 D156H ACTC 8.98 D156H TTCG 8.89 D156H ATTG 8.88 D156H ACTA 8.4 D156H CTCG 8.13 D156I CCGC 10.23 D156I TCAG 9.16 D156I TCGA 8.68 D156I ACCC 8.52 D156I GCGC 8.42 D156I ATTC 8.37 D156I TCCC 8.33 D156I ACTC 8.31 D156I GCCC 8.05 D156I GTTG 7.84 D156K TTCC 12.11 D156K TTCT 12.02 D156K ATTA 11.58 D156K CCTG 11.51 D156K CCTA 11.41 D156K TCCC 11.39 D156K TCCG 11.32 D156K GTTC 11.24 D156K TTGA 11.23 D156K ATTC 11.16 D156K ATTG 10.87 D156K GCTC 10.8 D156K GTTA 10.77 D156K TTGC 10.71 D156K CTTC 10.65 D156K TTCA 10.57 D156K TCTG 10.41 D156K CCCC 10.25 D156K TCGC 10.15 D156K CTCC 10 D156K TCTA 9.99 D156K TTCG 9.98 D156K TTAC 9.83 D156K CCTC 9.73 D156K TCCA 9.65 D156K TTTT 9.64 D156K ACTA 9.56 D156K GTTG 9.44 D156K TCTC 9.37 D156K CCCG 9.21 D156K TCAC 9.18 D156K TTTC 9.13 D156K CTTG 9.05 D156K CTCA 9 D156K TTTG 8.92 D156K GCTG 8.91 D156K TTGG 8.53 D156K ACTC 8.42 D156L GTTG 15.01 D156L ATTC 14.48 D156L CTTC 14.39 D156L TCCC 14.28 D156L ATTA 13.69 D156L TCCG 13.57 D156L CCCG 13.52 D156L TTAC 13.32 D156L CCTG 13.25 D156L TCGC 13.04 D156L TTCT 12.9 D156L CCTC 12.55 D156L ATTG 12.52 D156L CCCCC 12.48 D156L TTGC 12.37 D156L GTTC 12.31 D156L ACTA 12.29 D156L TCTC 11.89 D156L TCTA 11.73 D156L CCTA 11.49 D156L TTTT 11.47 D156L CTTA 11.36 D156L CTTG 11.36 D156L TTCG 11.36 D156L TCTG 11.07 D156L GTTA 11.02 D156L CCCA 10.93 D156L GCTA 10.87 D156L TTTG 10.8 D156L TTCC 10.73 D156L TCCA 10.63 D156L CTCC 10.14 D156L TTCA 10.07 D156L TTTC 9.96 D156L CTCA 9.82 D156L TCAC 9.8 D156L TTTA 9.69 D156L ACTG 9.67 D156L GCGC 9.08 D156L CCGC 8.68 D156L GCTC 8.48 D156L TCAG 8.46 D156L CTCG 8.35 D156Q GTTC 15.61 D156Q TCCC 15.02 D156Q ATTC 14.2 D156Q TCCA 14.13 D156Q TCTA 13.69 D156Q CCTA 13.4 D156Q CCTG 13.17 D156Q ATTG 12.94 D156Q TCTG 12.76 D156Q TCTC 12.71 D156Q CTCC 12.58 D156Q CCCC 12.54 D156Q CTTG 12.5 D156Q GTTG 12.46 D156Q CCTC 11.6 D156Q CTCA 11.56 D156Q TTTT 11.44 D156Q CCCG 11.41 D156Q ACTG 11.38 D156Q ATTA 11.35 D156Q GTTA 11.2 D156Q CTTA 11.06 D156Q TTCA 10.96 D156Q CTTA 10.86 D156Q TTCG 10.7 D156Q TTGC 10.65 D156Q TTAC 10.6 D156Q ACTA 10.58 D156Q TCGC 10.58 D156Q TTCT 10.47 D156Q TTGA 10.35 D156Q TCCG 10.31 D156Q GCTA 10.26 D156Q GCTG 10.21 D156Q TTTG 10.17 D156Q GCTC 10.12 D156Q TTTC 10.01 D156Q TCAC 9.87 D156Q CCCA 9.86 D156Q CTCG 9.78 D156Q GCGC 9.58 D156Q TTCC 9.43 D156Q TTTA 9.38 D156Q CTTT 9.36 D156Q TTAG 9.1 D156R CCTG 11.46 D156R GCTA 11.19 D156R TTCT 11.15 D156R CCGC 11.01 D156R CCTC 10.98 D156R TCCA 10.93 D156R CCCC 10.57 D156R TCTG 10.53 D156R TTGC 10.34 D156R CTTC 9.92 D156R TCGC 9.46 D156R ACTA 9.41 D156R GTTG 9.21 D156R TCTA 9.19 D156R TTTT 9.1 D156R TCCC 8.96 D156R CTCA 8.63 D156W ACTA 13.47 D156W CCTG 12.62 D156W CCCA 11.99 D156W GTTG 11.77 D156W TCTG 11.72 D156W CCTA 11.4 D156W CCCG 11.4 D156W GCTA 11.28 D156W TCGC 11.27 D156W CCTC 11.21 D156W CCCC 11.16 D156W TTGC 10.91 D156W TCCG 10.66 D156W ATTG 10.65 D156W GTTC 10.5 D156W TCCA 10.43 D156W TCTC 10.34 D156W TCTA 10.25 D156W TTCC 10.18 D156W TTCT 10.1 D156W GTTA 10.08 D156W TTCG 9.92 D156W TTTT 9.65 D156W CTCA 9.63 D156W CTTC 9.54 D156W TCCCC 9.49 D156W ATTA 9.47 D156W CTTG 9.45 D156Y TCTG 12.9 D156Y ATTC 12.41 D156Y TCTA 12.32 D156Y TCCC 11.75 D156Y TCTC 11.68 D156Y ATTG 10.93 D156Y CTTA 10.52 D156Y TTCC 10.34 D156Y GTTG 10.31 D156Y CTTC 10.17 D156Y TTCT 10.02 D156Y TTGC 9.75 D156Y TTTA 9.64 D156Y TTCG 9.59 D535A TTCC 17.75 D535A TTCA 16.69 D535A CTTG 16.57 D535A CTTA 15.51 D535A TCTC 15.39 D535A TCGC 15.38 D535A TCTA 15.02 D535A TTGC 14.6 D535A TCCC 14.6 D535A TTTA 14.59 D535A TTAC 14.56 D535A TTTT 13.92 D535A TTCG 13.69 D535A TTTC 12.57 D535A CTTC 12.57 D535A TCTG 12.5 D535A TCCG 12.08 D535A TTTG 11.96 D535A ATTA 11.71 D535A TTAG 11.43 D535A CCCC 11.28 D535A ATTG 11.06 D535A TTGA 10.6 D535A TTCT 10.56 D535A GCGC 10.49 D535A ATTC 10.41 D535A TCCA 10.31 D535A GTTG 10.15 D535A TCAC 9.7 D535A GTTC 8.85 D535A CCCG 8.33 D535A TCAG 8.01 D535H TCAC 12.82 D535H TTCA 11.72 D535H TCCG 11.42 D535H TTCG 11.3 D535H TCTA 11.27 D535H TCTC 10.82 D535H CCCC 10.68 D535H TTCT 10.51 D535H TTTT 10.43 D535H TCAG 10.24 D535H ATTA 10.22 D535H ATTG 10.1 D535H TTAC 10.04 D535H TCCC 10.02 D535H TTCC 9.97 D535H CTTC 9.97 D535H TCGC 9.95 D535H TTGC 9.74 D535H TTTG 9.52 D535H CCTA 9.5 D535H CTTA 9.28 D535H CCAG 9.27 D535H TCTG 9.24 D535H TTTA 9.15 D535H TTGG 8.73 D535H CCAC 8.4 D535H GCAC 8.08 D535K TTTA 14.65 D535K TTTC 13.64 D535K TTTG 13.58 D535K TTGC 11.64 D535K TTAC 10.49 D535N TTGC 10.94 D535N TTAG 10.83 D535N TTCC 10.61 D535N TTTC 10.54 D535N TTTT 10.52 D535N TCGC 10.51 D535N TTAC 10.39 D535N TTTA 10.34 D535N TCAC 10.22 D535N TTTG 10.01 D535N TTAA 9.04 D535N TCAG 8.94 D535N TCCC 8.46 D535N TTGG 7.82 D535S TTCG 12.34 D535S TCTG 12.09 D535S CTTG 12.07 D535S CTTA 11.85 D535S TCTC 11.41 D535S TTTA 10.73 D535S TCCC 10.7 D535S TTAC 10.6 D535S TTAG 10.49 D535S TTCC 10.47 D535S TCAG 10.46 D535S TCTA 10.4 D535S TTCA 10.36 D535S TCGC 10.31 D535S ATTA 10.14 D535S TTGA 10.13 D535S TTTT 10.1 D535S TCAC 10.07 D535S TTTC 9.76 D535S CCCC 9.75 D535S TTGC 9.72 D535S CCGC 9.66 D535S ATTG 9.64 D535S GTTG 9.6 D535S TTCT 9.51 D535S TTTG 9.4 D535S CCTG 9.34 D535S CCCG 9.18 D535S TCCA 9.11 D535S TTGG 9.02 D535S TTAA 8.98 D535T CTTA 14.25 D535T TTCG 13.61 D535T TTTT 13.51 D535T TCCC 12.73 D535T TCTA 12.41 D535T CTTG 12.36 D535T TCTG 11.75 D535T TTGC 11.65 D535T TCCG 11.65 D535T TCTC 11.38 D535T TCGC 11.38 D535T TTAC 11.38 D535T TTTA 11.34 D535T TTTG 11.25 D535T CTTC 11.2 D535T TTGG 10.8 D535T TTCT 10.42 D535T TCAC 10.06 D535T TCAG 9.75 D535T TTTC 9.07 D535T GTTA 8.61 D535T CTCC 8.06 D535V TTTG 15.43 D535V TTTA 13.9 D535V TTTC 12.89 D535V TTGC 9.81 D535V TTTT 9.77 D541A ATTG 9.99 D541E CTTC 15.41 D541E TTTG 14.24 D541E TTTT 14.15 D541E CTTA 13.23 D541E TTTC 12.78 D541E CTTG 11.68 D541E TTCA 11.56 D541E TTCC 11.02 D541E TTTA 10.69 D541E CCGC 10.13 D541E TCTA 9.86 D541E TCTC 9.77 D541E TCCG 9.75 D541E TCCC 9.37 D541E TTGC 9.33 D541E TTCG 9.03 D541E CCCC 8.91 D541E TTAC 8.69 D541E CCTG 8.3 D541E ATTG 8.18 D541E CCTA 7.96 D541E GTTA 7.84 D541H TTCG 8.67 D541H CTTC 8.58 D541I TTTC 11.44 D541I TTTG 10 D541I CTTA 9.11 D541I TTTT 8.7 D541N TCCC 8.36 D541R TTTG 8.99 D541Y CTTA 10.32 D541Y TTTC 9.36 D541Y CTTC 8 E125K TTGC 10.22 E125K TCTC 9.44 E125K ATTG 9.32 E125K TTAC 9.11 E125K CCCC 8.94 E125K TTCG 8.93 E125K CTTC 8.83 E125K TCCC 8.81 E125K TTCT 8.62 E125K TTTA 8.56 E125K TTTT 8.43 E125K TTGA 8.25 E125K TCGA 8.15 E125K ATTC 8.04 E125Q TTCA 12.74 E125Q CTTC 12.55 E125Q CTTA 12.14 E125Q TCCC 11.7 E125Q TTCG 11.66 E125Q TCTA 11.06 E125Q TTGC 10.88 E125Q ATTC 10.84 E125Q ATTA 10.53 E125Q TTTG 10.51 E125Q TTTT 10.08 E125Q CCCC 10.04 E125Q TCTC 10.03 E125Q CCCG 9.96 E125Q TCCA 9.94 E125Q TTGG 9.92 E125Q TTCC 9.88 E125Q TCCG 9.84 E125Q TTCT 9.61 E125Q CTTG 9.55 E125Q ATTG 9.45 E125Q GTTG 9.29 E125Q TCTG 9.17 E125Q TTTA 9.1 E125Q TTAC 8.56 E125Q TCGC 8.55 E125Q TCAC 8.5 E125Q CCTG 8.42 E125Q CTCG 8.25 E125R CCCG 11.21 E125R TCCC 8.35 E125R TCCA 8.03 E125Y TTCG 11.77 E125Y TTGC 10.69 E125Y CTTC 9.94 E125Y CCCC 9.82 E125Y TTTT 9.39 E159K TTCT 12.66 E159K CCCC 12.33 E159K ATTG 11.53 E159K CTTG 11.38 E159K CTTA 11.24 E159K TCTC 11.21 E159K ATTC 11.05 E159K TCCC 11.04 E159K TTCG 10.86 E159K TTCA 10.67 E159K TCTA 10.64 E159K TTGC 10.56 E159K CTTC 10.36 E159K TCTG 10.17 E159K TTAC 10.12 E159K TTCC 9.92 E159K TCGC 9.78 E159K GTTA 9.69 E159K TCCG 9.67 E159K CCTG 9.31 E159K GTTG 9.04 E159K GCCC 8.85 E159K CCTC 8.85 E159K GCGC 8.65 E159K ACTC 8.23 E159K TTTT 11.37 E159K TTCG 10.89 E159K CTTA 10.51 E159K TTGC 10.5 E159K TTTC 10.15 E159K TTCC 9.95 E159K CTTG 9.91 E159K TTCA 9.8 E159K TTTA 9.44 E159K TTTG 9.27 E159R GTTC 14.77 E159R GTTG 13.13 E159R TCCG 12.2 E159R TTGC 11.82 E159R TTGC 11.71 E159R CCTC 11.67 E159R ATTG 11.35 E159R CCCC 11.9 E159R TTAC 11.05 E159R CTTC 10.88 E159R TCTG 10.85 E159R ATTC 10.72 E159R TTCT 10.71 E159R TCTC 10.63 E159R GTTA 10.62 E159R TTCA 10.59 E159R CTTG 10.51 E159R TCGC 10.29 E159R TCTA 10.16 E159R ATTA 10.06 E159R ACCC 9.76 E159R TTTG 9.55 E159R CCTA 9.52 E159R CTTA 9.47 E159R GCGC 9.32 E159R ACTC 8.95 E159R CCGC 8.91 E159Y TTTT 11.72 E159Y CTTC 11.71 E159Y TTTA 11.42 E159Y CTTA 10.79 E159Y TTTG 10.39 E159Y TTGC 10.37 E159Y TTCC 9.94 E159Y CTTG 9.51 E159Y TCCC 9.43 G532A TTTT 13.95 G532A CTTG 12.83 G532A ATTC 12.56 G532A CTTC 11.75 G532A TCTC 11.56 G532A TTCC 11.55 G532A TTCG 11.5 G532A TCTA 11.01 G532A TTCA 10.91 G532A CCCC 10.36 G532A CTTA 10.35 G532A TTGC 10.19 G532A GTTG 10.18 G532A TCCC 10.1 G532A TCTG 9.94 G532A ATTG 9.6 G532A TTTA 9.47 G532A GTTA 9.4 G532C TTTT 15.09 G532C TTCC 12.43 G532C TTTC 12.3 G532C TTGC 11.56 G532C CTTA 11.27 G532C TTAC 11.02 G532C TTTG 10.94 G532C TTCA 10.93 G532C CTTG 10.62 G532C TTTA 10.31 G532C TCCC 10.29 G532C TCTA 10.26 G532C TCTG 10.19 G532C GTTA 9.93 G532C TCTC 9.91 G532C CTTC 9.78 G532C GTTG 8.88 G532D CTTG 21.38 G532D CTTA 15.81 G532D TTCC 15.28 G532D TTTT 14.57 G532D CTTC 13.93 G532D TTTC 13.65 G532D TTTG 13.59 G532D TTCG 13.54 G532D TTCT 13.13 G532D TTCA 12.84 G532D CCCC 12.66 G532D TTTA 12.54 G532D TTGC 12.49 G532D GTTG 11.87 G532D TCCG 11.41 G532D ATTG 11.27 G532D ATTA 11 G532D TCCC 10.91 G532D ATTC 10.56 G532D TCTA 10.36 G532D CTCC 9.98 G532D TTAC 9.81 G532D TCGC 9.2 G532F CTTA 13.56 G532F ATTG 11.28 G532F CTTC 11.1 G532F TTCA 10.82 G532F TTGC 10.74 G532F TTTT 10.6 G532F TCTA 10.52 G532F TTAC 10.48 G532F TTTA 10.31 G532F TTTG 10.25 G532F ATTA 10.2 G532F GTTA 9.82 G532F TTTC 9.64 G532F ATTC 9.47 G532F TCCC 9.44 G532F CTTG 9.28 G532F TCTC 9.23 G532F TCCG 8.95 G532F TCTG 8.91 G532F CCCC 8.33 G532F GTTG 8.17 G532F CCTA 8.08 G532H TTCA 16.2 G532H CTTC 15.09 G532H GTTG 14.43 G532H TTTT 13.93 G532H TTCG 13.87 G532H CTTG 13.72 G532H TCTG 13.22 G532H GTTC 12.71 G532H TTGG 12.66 G532H CTTA 12.54 G532H TTGC 12.31 G532H TCTA 12.2 G532H TTCT 12.15 G532H ATTC 11.94 G532H CCCC 11.91 G532H TTTC 11.89 G532H TCCG 11.71 G532H TTTA 11.67 G532H TCCC 11.6 G532H TTTC 11.23 G532H CTCA 11.23 G532H ATTA 11.16 G532H TCCA 11.11 G532H ATTG 11.02 G532H TTAC 10.74 G532H TCTC 10.55 G532H TCGC 10.42 G532H CCTA 10.3 G532H CTCC 9.99 G532H GTTA 9.77 G532H CCCA 9.61 G532H CCTG 9.15 G532H CCTC 9.03 G532H CCCG 8.84 G532H TCAC 7.76 G532K CTCA 13.19 G532K GCCC 12.17 G532K CTTA 11.31 G532K CTTC 11.17 G532K TTGC 10.91 G532K CTTG 10.78 G532K ATTA 10.64 G532K GCCG 10.53 G532K TTAC 10.41 G532K TTTT 9.96 G532K TCCA 9.94 G532K ACCG 9.8 G532K CCCC 9.69 G532L CTTC 15.2 G532L TTTT 14.33 G532L TTTA 12.17 G532L CTTG 12.04 G532L CTTA 11.73 G532L TTGC 11.67 G532L TTCA 11.66 G532L TTAC 11.57 G532L TTTG 11.5 G532L ATTA 11.36 G532L TTTC 11.15 G532L TTCC 10.89 G532L ATTG 10.02 G532L GTTG 9.71 G532L TCTA 9.46 G532L CCTA 9.29 G532L ATTC 8.98 G532L TCCC 8.77 G532L TTGA 8.33 G532L CTTG 15.59 G532N TCCC 15.09 G532N TTCG 14.11 G532N ATTG 13.73 G532N CTTC 12.97 G532N TTGC 12.7 G532N TTAC 12.61 G532N TTCT 12.13 G532N ATTA 12.03 G532N TCTA 12.02 G532N TTCC 12 G532N TTTT 11.95 G532N TCTC 11.91 G532N ATTC 11.98 G532N CTTA 11.8 G532N TTTC 11.52 G532N TTCA 11.33 G532N TCTG 11.3 G532N TTTA 11.23 G532N TTTG 11.18 G532N TCCG 11.17 G532N GTTG 11.14 G532N GTTA 10.53 G532N CCCG 10.51 G532N GTTC 9.62 G532N CTCC 9.48 G532N CCCC 9.46 G532N TCCA 9.45 G532N CCTA 9.35 G532N CCTG 9.28 G532Q TTTG 16.46 G532Q TTGC 14.95 G532Q TTCA 14.64 G532Q CTTC 13 G532Q TTTT 12.79 G532Q ATTA 12.41 G532Q TTCC 12.4 G532Q TTAC 11.52 G532Q TTCT 11.34 G532Q CTTG 11.2 G532Q TCTA 11.19 G532Q TTTA 10.72 G532Q CTTA 10.58 G532Q ATTG 10.43 G532Q TTTC 10.32 G532Q TTCG 10.23 G532Q TCCC 10.05 G532Q GTTG 9.8 G532Q CCCC 9.74 G532Q TCTC 9.47 G532S TTAC 13.85 G532S TTTT 13.71 G532S GTTA 13.01 G532S TCTC 12.51 G532S TTCA 12.5 G532S CTTA 12.33 G532S TCCC 12.3 G532S ATTG 12.3 G532S CTTC 12.28 G532S ATTC 12.08 G532S TTCC 11.95 G532S TCTA 11.79 G532S TCTG 11.78 G532S TCCG 11.58 G532S ATTA 11.51 G532S TTTC 11.49 G532S CTTG 11.43 G532S GTTC 11.1 G532S TTCG 11.03 G532S GTTG 10.72 G532S TTTG 10.63 G532S TTTA 10.56 G532S TTCT 10.36 G532S TTGC 10.15 G532S TCGC 9.46 G532S TTAG 9.38 G532S CCCC 9.11 K116N CTCC 8.12 K116N CTTA 12.52 K116N CTTC 11.57 K116N TCCC 10.05 K116N TTAC 10.99 K116N TCTA 10.97 K116N TCTC 10.9 K116N TCCA 10.84 K116N TCTG 10.77 K116N TCCG 10.73 K116N TTCG 10.7 K116N TTCA 10.66 K116N ATTA 10.47 K116N TTTT 10.21 K116N TTGC 10.17 K116N TTTC 9.92 K116N CTTG 9.87 K116N TTCC 9.85 K116N TTCT 9.64 K116N CCTA 9.42 K116N GTTA 9.31 K116N CCTG 9.21 K116N CCCC 9.13 K116N TCGC 9.04 K116N GTTC 8.91 K116N CTCA 8.61 K116N CCGC 8.39 K116N TTGA 7.69 K116R TCCG 13.47 K116R ATTC 13.02 K116R TTAC 12.37 K116R GTTC 11.83 K116R CCTA 11.44 K116R TTCT 11.35 K116R ATTG 11.11 K116R TCTA 11.03 K116R CCCC 11.03 K116R CTCC 10.97 K116R TCTC 10.84 K116R TCGC 10.29 K116R GTTG 10.27 K116R GCTC 10.2 K116R CTTA 10.15 K116R TTGC 10.12 K116R CCTG 10.04 K116R ATTA 10.02 K116R TTTT 9.98 K116R CCTC 9.78 K116R TCCC 9.72 K116R GTTA 9.65 K116R CCCG 9.62 K116R ACTA 9.61 K116R TTCG 9.54 K116R TCCA 9.36 K116R GCGC 9.27 K116R TTCC 9.22 K116R TTCA 9.14 K116R GCTA 9.14 K116R CCCA 8.96 K116R CTTC 9.95 K116R TCTG 8.93 K116R TTGG 8.82 K116R CCGC 8.81 K116R GCTG 8.67 K116R ACGC 8.32 K116R ACTC 8.29 K116R CTCA 8.06 K120H TCTC 10.27 K120H TTCG 10.07 K120H TTTT 9.97 K120H CTTG 9.77 K120H CTTA 9.69 K120H TTCC 9.3 K120H TTCA 9.02 K120H TTTG 8.5 K120H TCGC 8.43 K120H TTTC 8.26 K120H TTTA 8.02 K120H TTGC 7.89 K120H TCCC 7.56 K120H CCCC 7.55 K120N TTTA 12.31 K120N TTTT 11.86 K120N CCCC 11.41 K120N TCTC 11.4 K120N TTCC 11.21 K120N TCCC 11.18 K120N CTTA 10.93 K120N TTTC 10.91 K120N TTGC 10.55 K120N TCTG 10.41 K120N ATTA 10.4 K120N CTTC 10.32 K120N ATTC 10.31 K120N TTTG 9.99 K120N TTCA 9.95 K120N TCTA 9.86 K120N CCCG 9.64 K120N CTTG 9.6 K120N TCCG 9.49 K120N TTCG 9.48 K120N TTCT 9.32 K120N GCGC 9.07 K120N CCTA 8.43 K120N CTCC 8.18 K120Q TTTC 12.01 K120Q TTCC 11.56 K120Q TTCA 11.1 K120Q CTTG 10.57 K120Q TTGC 10.37 K120Q TTTG 10.25 K120Q TTCG 10.25 K120Q TTTT 9.91 K120Q CTTC 9.83 K120Q TTTA 9.72 K120Q ATTG 9.25 K120Q TTAC 9.25 K120Q TCTA 9.18 K120Q GTTC 9.03 K120Q CTTA 8.96 K120Q ATTC 8.71 K120R TTCA 10.74 K120R CTTA 9.7 K120T TTTT 7.73 K120T TTCG 7.73 K120T TTGA 7.34 K121D TTTA 12.69 K121D TTTG 11.07 K121D TTTC 10.18 K121G TTTT 16.86 K121G TTCA 15.35 K121G TTCC 15.22 K121G CTTG 14.67 K121G TTGC 14.52 K121G CTTA 14.02 K121G TTTC 13.96 K121G TTTA 13.42 K121G CTTC 13.37 K121G TTCG 13.33 K121G TTTG 12.87 K121G TTCT 12.72 K121G ATTG 12.35 K121G ATTC 11.96 K121G ATTA 11.89 K121G TTAC 11.65 K121G TCCC 11.12 K121G TCTA 10.53 K121G TCGC 9.78 K121G GTTA 9.62 K121G GTTG 9.32 K121G TCTC 9.08 K121G CCCC 8.06 K121G GTTC 7.89 K121H TTCA 10.11 K121H TTGC 9.93 K121H TCTA 9.6 K121H TTCC 9.53 K121H CTTG 9.11 K121H TTTT 8.99 K121H TTCG 8.82 K121H TTTC 8.53 K121H TTTA 8.28 K121H CTTC 7.95 K121H TCCG 7.77 K121H CCTG 7.66 K121H TCTC 7.51 K121Q TTTA 8.76 K121Q TTTG 8.76 K121Q TTTT 8.28 K121Q TTCT 7.93 K121Q TTCC 7.89 K121R TTCT 14.44 K121R CTTC 13.38 K121R TTCA 13.05 K121R TTTT 13.03 K121R CCTG 12.96 K121R ATTG 12.3 K121R TTAC 12.28 K121R CCCC 12.28 K121R TCGC 12.01 K121R ATTA 12 K121R TCCG 11.99 K121R TCTA 11.97 K121R TTCG 11.79 K121R TCTC 11.72 K121R TTGC 11.55 K121R CCGC 11.31 K121R GTTA 11.23 K121R GTTG 11.05 K121R TTTG 10.86 K121R ATTC 10.84 K121R CTTA 10.83 K121R CCTA 10.71 K121R CCTC 10.52 K121R TTCC 10.4 K121R CCCG 10.37 K121R CTCC 10.21 K121R TCCA 10.18 K121R TTTA 10.07 K121R TCCC 9.9 K121R CTTG 9.72 K121R GCGC 9.67 K121R TCAC 9.59 K121R CCCA 9.45 K121R GTTC 9.23 K121R CTCA 9.04 K121R TTTC 8.93 K121R TCTG 8.87 K121S TTGC 11.77 K121S CCTG 11.74 K121S TCCA 11.66 K121S TTTT 10.88 K121S TTCA 10.85 K121S CCTC 10.72 K121S TCTC 10.62 K121S CTTA 10.33 K121S TTCT 10.1 K121S TCTA 10.06 K121S CCCC 10.02 K121S TTCC 9.9 K121S CTTG 9.88 K121S TCCC 9.81 K121S TTCG 9.71 K121S CTCC 9.65 K121S TCCG 9.59 K121S CTTC 9.59 K121S ATTC 9.53 K121S TCTG 9.47 K121S TTAC 9.46 K121S TTTA 9.31 K121S GCGC 9.26 K121S GTTC 9.25 K121S ATTA 9.2 K121S CCGC 9.14 K121S ACTA 8.94 K121S GCCC 8.9 K121S TTTC 8.89 K121S CTTT 8.79 K121S TTGA 8.76 K121S TCGC 8.63 K121S CCCG 8.61 K121S GTTA 8.5 K121S GTTG 8.35 K121S ACTG 7.89 K121S CTCG 7.8 K121S GCTA 7.57 K121T TTTC 13.85 K121T TTTT 13.26 K121T TTTA 13.02 K121T TTTG 12.09 K121T CTTA 11.65 K121T CTTC 10.99 K121T CTTG 10.52 K121T TTCA 10.44 K121T TTCC 10.36 K121T TTGC 9.85 K538C CTTC 9.67 K538F TTTA 17.03 K538F TTTC 15.83 K538F CTTG 11.01 K538F CTTC 10.62 K538F CTTA 9.14 K538G TTTC 11.42 K538G TTTA 10.22 K538G TTTG 9.79 K538G CTTC 9.18 K538H TTTG 11.31 K538H CTTC 10.74 K538L TTTC 10.95 K538L TTTA 10 K538L CTTA 9.31 K538M TTTG 13.69 K538M TTTA 13.09 K538M TTTC 11.36 K538M CTTC 10 K538M CTTA 9.97 K538Q CTTC 13.23 K538Q TTTC 12.93 K538Q TTTA 12.91 K538Q CTTA 11.77 K538Q TTTG 11.17 K538Q CTTG 11.03 K538R TTTG 12.33 K538R TTTC 12.28 K538R TTTA 12.26 K538R CTTA 11.95 K538R TTTT 9.32 K538R CTTG 9.16 K538V CTTC 18.4 K538V CTTG 18.05 K538V TTTA 17.53 K538V TTTG 17.49 K538V TTTC 15.98 K538V CTTA 14.13 K538W TTTC 11.69 K538W TTTG 11.18 K538W TTTA 11.03 K538W TATA 10.38 K538W CTTC 10 K538W TATC 9.66 K538W CTTA 9.26 K538Y CTTG 9.14 K538Y CTTA 8.3 K538Y CTTC 8.08 K591A TTTG 8.62 K591F TTTA 13.44 K591F TTTG 12.35 K591F TTTC 11.17 K591F TTTT 10.9 K591G TTTA 11.71 K591G TTTC 11.25 K591G TTTT 10.92 K591G TTTG 10.78 K591H TTTC 16.42 K591H TTTA 14.07 K591H TTTG 14.02 K591H TTTT 12.41 K591R TTTG 10.31 K591R TTCC 9.81 K591R TTTC 9.07 K591R CTTG 8.61 K591S TTTT 11.24 K591S TTCC 9.81 K591S TTTA 9.37 K591S TTTC 9.23 K591S CTTG 8.98 K591S TTTG 8.89 K591S TTCG 8.04 K591W TTTA 13.93 K591W TTTC 11.17 K591W TTTG 11.14 K591Y TTTC 12.29 K591Y TTTA 11.4 K591Y TTTG 10.79 K595H TTGC 12.45 K595H TTTT 11.42 K595H TTTG 10.91 K595H TTCA 10.39 K595H TTTC 10.21 K595H TTCG 9.36 K595L TTTA 16.84 K595L TTCC 15.92 K595L TTTG 14.92 K595L CCTG 13.79 K595L TTCG 13.45 K595L TTTC 13.12 K595L TCTA 12.6 K595L TCTC 12.15 K595L TCCA 12.14 K595L TCTG 11.7 K595L ACTC 11.46 K595L TCCG 11.37 K595L CCTC 10.6 K595L TTCA 10.5 K595L TCCC 10.24 K595L ACTG 9.69 K595M TTGC 13.18 K595M TTTA 12.88 K595M CCTG 12.36 K595M TTTG 12.07 K595M TCCC 11.4 K595M TTTT 11.26 K595M CCTC 10.96 K595M TCTG 10.95 K595M TTTC 10.84 K595M TTCA 10.81 K595M ACTG 10.74 K595M TCTA 10.34 K595M TCTT 10.1 K595M TCCG 9.83 K595M ACGC 9.6 K595M TTCC 9.51 K595M CCCC 9.4 K595M TCGG 9.21 K595M GCTG 9.12 K595M CTTC 8.62 K595M CTTA 8.14 K595Q TCCG 15.13 K595Q TTCC 14.56 K595Q TTCA 13.57 K595Q TCTG 13.57 K595Q TCTC 12.93 K595Q TTTG 12.45 K595Q TTTA 12.22 K595Q TCTA 12.06 K595Q TTCG 11.85 K595Q TTTC 11.69 K595Q TCCC 10.62 K595Q ACCC 10.09 K595Q CCCC 9.21 K595R TCTT 8.5 K595R TCCC 8 K595S TCCC 14.55 K595S TTGC 14.34 K595S TCGC 14.23 K595S TTTA 13.22 K595S TCTC 12.48 K595S TCTA 12.47 K595S TCCG 12.3 K595S CCGC 12.29 K595S ACGC 11.62 K595S TTCC 11.53 K595S TTTC 10.96 K595S TCGG 10.45 K595S CCCC 10.13 K595S TTCA 9.48 K595S TTCG 8.92 K595W CCCC 11.92 K595W TCGA 11.62 K595W ACGG 11.48 K595W ACCC 11.35 K595W CCTG 11.35 K595W TCTC 11.28 K595W TTTT 10.53 K595W GCCG 10.42 K595W TTTA 10.21 K595W ACTA 10.18 K595W ACGA 9.87 K595W GCGC 9.81 K595W ATGC 9.77 K595W TCGT 9.71 K595W ATTG 9.63 K595W TCCT 9.25 K595W CCGG 9.19 K595W TTGT 9.08 K595W TCGG 9.03 K595W TTCT 8.95 K595W ACTG 8.88 K595Y ACCC 18.7 K595Y TCCC 18.62 K595Y ACCG 18.58 K595Y CCCG 18.42 K595Y TTCG 17.75 K595Y GCGC 17.47 K595Y TCCA 16.89 K595Y CCGC 16.66 K595Y CCGG 16.59 K595Y GCGG 16.46 K595Y TCCG 16.23 K595Y CCCC 16.05 K595Y TTTC 15.82 K595Y TCGA 14.88 K595Y TCGG 14.74 K595Y TTTA 14.31 K595Y CCGA 14.29 K595Y TTTG 14.12 K595Y CTGC 14.03 K595Y TCGT 14.01 K595Y ACGA 13.83 K595Y ACGG 13.62 K595Y ACGG 13.55 K595Y TCTG 13.36 K595Y TCTC 13.31 K595Y TCGC 13.26 K595Y GCCG 13.19 K595Y GCCC 13.15 K595Y TTGA 12.32 K595Y TTCT 12.28 K595Y TTCA 12.22 K595Y TTGT 12.12 K595Y TTGG 12.01 K595Y TCTA 11.81 K595Y GCGA 11.57 K595Y CCCA 11.52 K595Y CTCG 11.51 K595Y TTGC 11.46 K595Y TTCC 11.3 K595Y ACCA 11.3 K595Y ACTG 11.29 K595Y CCTG 10.54 K595Y CTCC 10.3 K595Y ACTC 9.54 K595Y ATGC 9.28 K600G ATTG 14.1 K600G TTTT 13.53 K600G TCTC 13.48 K600G CTTG 13.02 K600G TTTA 12.84 K600G CTTC 12.82 K600G TCTG 12.69 K600G ATTA 12.52 K600G TCTA 12.41 K600G TTCA 12.15 K600G TTTC 12.11 K600G CTTA 12.01 K600G TTCG 11.67 K600G TTCC 11.66 K600G TTTG 11.58 K600G TTAC 11.52 K600G TCCC 11.4 K600G CCTG 11.38 K600G CCCC 10 K600G GTTA 9.75 K600G GTTG 9.72 K600G TCCG 9.69 K600G TTCT 9.48 K600G CCTA 9.4 K600G TCCA 9.38 K600H CTTC 16.65 K600H TTTG 14.45 K600H TTCC 14.11 K600H TTTT 13.78 K600H TTCA 13.27 K600H CTTA 12.42 K600H TCTA 12.26 K600H TCTC 12.2 K600H TCCC 12.16 K600H ATTG 120.2 K600H ATTA 11.77 K600H CTTG 11.23 K600H TTCG 11.13 K600H TTTC 10.82 K600H TTAC 10.54 K600H GTTC 9.1 K600H GTTG 8.65 K600H CCGC 8.41 K600R ATTC 13.41 K600R TTGC 12.52 K600R TTCT 11.83 K600R TTCC 11.61 K600R TTCA 11.08 K600R TTTT 11.07 K600R CCCC 11.05 K600R TCGC 11.02 K600R TCTA 10.96 K600R GTTC 10.91 K600R TCCA 10.84 K600R TCCC 10.63 K600R CCTC 10.42 K600R TTCG 10.1 K600R CTCA 8.96 K601H CCTG 14.33 K601H CTTG 12.41 K601H TCTA 12.13 K601H TCTC 11.97 K601H ATTC 11.89 K601H TCCG 11.84 K601H TTTG 11.78 K601H CCCG 11.7 K601H TTTT 11.35 K601H CCTA 11.15 K601H TTGC 10.89 K601H CTTC 10.79 K601H TTTC 10.65 K601H CTTA 10.45 K601H CCCC 10.42 K601H TTCG 10.39 K601H ATTG 10.26 K601H TTTA 10.21 K601H ATTA 10.2 K601H TTCA 10.12 K601H TCTG 10.09 K601H CCTC 9.82 K601H TCGC 9.4 K601H GCTC 8.68 K601Q CTTA 13.97 K601Q TTTG 11.17 K601Q TTTC 10.17 K601Q CTTG 9.73 K601Q TTTT 9.44 K601R TCTA 12.21 K601R TTGC 12.09 K601R ATTC 11.08 K601R TTTT 10.98 K601R TTCC 10.95 K601R TCTG 10.8 K601R TTCA 10.77 K601R CCTA 10.4 K601R ATTG 10.33 K601R CTTG 10.31 K601R CTTC 10.11 K601R TCTC 9.85 K601R TCCG 9.65 K601R ATTA 9.5 K601R TCCA 8.91 K601R CCTG 8.54 K601R TTTC 8.41 K601T CTTA 12.42 K601T TTTG 11.55 K601T TTCC 11.36 K601T TTCG 11.26 K601T TTTT 11.13 K601T CTTC 11.06 K601T TTTA 10.99 K601T TTCA 10.85 K601T TTTG 10.2 K601T TCCC 10.17 K601T TCCG 9.65 K601T CCTG 9.53 K601T TCTC 9.29 K601T CCCC 8.18 L585F TTTG 13.66 L585F TTTT 11.79 L585F TTTA 11.72 L585F TTTC 10.51 L585G TTCC 13.33 L585G TTAC 11.98 L585G CTTG 11.26 L585G TTTT 11.21 L585G TCCC 11.09 L585G TTCA 10.97 L585G CTTC 10.32 L585G TTTA 9.92 L585G TCTC 9.8 L585G TTGC 9.57 L585G CTTA 9.48 L585G TCAC 9.48 L585G TTTG 9.02 L585G TTTC 8.8 L585H TTCC 9.49 L585H TTTT 8.29 L585H TCTC 8.06 M592A TTTG 15.81 M592A TTTA 11.41 M592A TTTC 10.98 M592A CTTA 10.8 M592A TTCA 10.53 M592A TCTA 10.38 M592A TTTT 9.48 M592E TTTA 12.63 M592E TTTG 11.85 M592E TTTC 11.64 M592Q TTCA 12.54 M592Q TTTA 10.68 M592Q TCCG 10.66 M592Q CTTG 10.19 M592Q TTCG 9.93 M592Q CTTA 9.45 M592Q CCCG 9.41 M592Q TCTG 9.39 M592Q TTTG 9.37 M592Q CCCA 9.22 M592Q TCCC 9.17 M592Q TTCC 9.16 M592Q CCCC 8.93 M592Q TTTC 8.89 M592Q CTCA 8.41 Q529A TCTG 13.89 Q529A CCCC 13.38 Q529A TTCC 12.5 Q529A ATTC 12.31 Q529A TCCA 12.26 Q529A TCTC 12.21 Q529A TTGC 11.88 Q529A CCCG 11.81 Q529A TTTT 11.69 Q529A TTCG 11.43 Q529A TCTA 11.31 Q529A CTTC 11.2 Q529A ATTG 10.94 Q529A CCTA 10.85 Q529A ATTA 10.79 Q529A TTTA 10.73 Q529A CTTA 10.63 Q529A CCTG 10.54 Q529A CTTG 10.47 Q529A TCCG 10.4 Q529A CCTC 10.38 Q529A TCCC 10.18 Q529A TTCA 10.16 Q529A TTCT 9.89 Q529A CCGC 9.68 Q529A TTTG 9.62 Q529A TTTC 9.51 Q529A GTTA 9.4 Q529D TTTC 13.64 Q529D TTTT 13.03 Q529D TTTG 12.45 Q529D TTCC 12.36 Q529D CTTC 12.27 Q529D TTTA 12.24 Q529D TTGC 10.98 Q529D CTTG 10.85 Q529D CTTA 10.81 Q529D TTCA 10.36 Q529D TCCC 8.52 Q529F CTTA 14.01 Q529F CTTG 13.75 Q529F TTTG 12.84 Q529F TTTA 11.62 Q529F TTTC 10.91 Q529G CTTC 13.9 Q529G TTCA 11.91 Q529G TCTA 11.71 Q529G CCCC 11.18 Q529G TTTA 10.86 Q529G TCTG 10.79 Q529G TTTC 10.63 Q529G CTTA 10.61 Q529G TTTG 10.19 Q529G CTTG 9.88 Q529G CCTA 9.67 Q529G TCCC 9.5 Q529G TTCG 9.15 Q529G TCTC 9.11 Q529G ATTC 8.98 Q529G CCTG 8.96 Q529G ATTA 8.33 Q529G TCGC 8.2 Q529G TCCG 8.11 Q529H TTTC 11.09 Q529H CTTG 10.43 Q529H TTTA 10.39 Q529H TTCC 10.29 Q529H TTCG 10.26 Q529H CTTC 9.59 Q529H ATTG 9.52 Q529H TTTG 9.12 Q529H TTCA 9.07 Q529H ATTA 8.47 Q529N TCGC 13.73 Q529N TCTC 13.48 Q529N TCCG 12.62 Q529N TTTT 12.48 Q529N TCTG 12.38 Q529N TTGC 12.3 Q529N TTCC 12.2 Q529N TCCA 11.98 Q529N TCCC 11.38 Q529N TCTA 11.04 Q529N TTCA 10.89 Q529N TTCG 10.81 Q529N ATTC 10.79 Q529N CCCC 10.6 Q529N TTTA 10.57 Q529N CTTG 10.24 Q529N CTTA 10.18 Q529N TTCT 9.91 Q529N CTTC 9.87 Q529N ATTA 9.85 Q529N TTTC 9.83 Q529N CCTA 9.49 Q529N GTTA 9.32 Q529N GTTC 9.18 Q529N TCTT 8.71 Q529N TCAC 8.3 Q529N CCCG 8.23 Q529P TTTA 14.13 Q529P TTTG 12.06 Q529P TTTC 10.87 Q529S TTCA 11.88 Q529S CTTA 11.14 Q529S TTTG 11.09 Q529S TTTA 11.06 Q529S TCTA 10.17 Q529S TTTC 10.1 Q529S CCCC 10.1 Q529S TTTT 10.03 Q529S TTCC 10.02 Q529S CTTG 9.9 Q529S TCCC 9.77 Q529S TCTG 9.68 Q529S ATTA 8.81 Q529T CTTG 15.39 Q529T TTCA 14.62 Q529T TCTG 13.74 Q529T TCTC 13.63 Q529T TCTA 13.2 Q529T TTCC 13.17 Q529T TTTT 12.6 Q529T TCCG 12.44 Q529T TCCA 12.34 Q529T ATTA 12.15 Q529T CTTC 12.13 Q529T TTCG 11.89 Q529T TCCC 11.35 Q529T TTGC 11.17 Q529T CCTA 11.07 Q529T GTTG 10.96 Q529T ATTG 10.9 Q529T TTTC 10.88 Q529T TTTA 10.73 Q529T TTTG 10.51 Q529T ATTC 10.41 Q529T CTTA 10.37 Q529T CCTC 10.12 Q529T TCGC 10.06 Q529T GTTA 9.83 Q529T CCCC 9.78 Q529T GTTC 9.72 Q529T CCTG 9.3 Q529T TTCT 8.86 Q529T TTAC 7.99 Q529W TTTG 15.75 Q529W CTTA 14.5 Q529W TTTA 12.69 Q529W TTTC 11.31 Q529W CTTC 9.28 S599G CTTG 12.09 S599G TTTT 11.66 S599G TTTA 10.2 S599G TTCC 9.87 S599G CCCC 9.47 S599G TTCA 9.36 S599H TTTA 10.82 S599H TTTG 9.61 S599N CTTA 13.93 S599N TTTG 13.04 S599N TTTA 11.64 S599N TTTC 11.3 S599N CTTC 11.15 S599N CTTG 10.54 S599N TTCA 8.73 T148A TTTC 13.06 T148A TTTA 11.98 T148A TTTT 11.53 T148A TTGC 11.48 T148A TTTG 11.33 T148A TTCC 10.97 T148A CTTG 9.83 T148A TTCA 9.26 T148C TTCA 15.44 T148C TTTG 15.17 T148C TTTC 15.09 T148C CTTG 14.75 T148C CTTA 13.98 T148C CTTC 13.67 T148C TTTT 13.43 T148C TTTA 13.16 T148C TTCC 12.16 T148C TTGC 11.1 T148C TCTA 10.77 T148C GTTG 10.01 T148C TCTC 9.93 T148H TTTC 14.35 T148H TTTG 13.68 T148H TTTA 13.64 T148S TTTT 13.35 T148S CTTA 12.93 T148S TTTA 12.48 T148S TTCG 12.31 T148S TTCA 11.85 T148S TTGC 11.56 T148S TTTG 11.55 T148S TTCC 11.39 T148S TTTC 11.01 T148S CTTC 11.01 T148S CTTG 10.8 T148S ATTA 9.58 T148S TCTA 8.54 T148S ATTG 8.31 T149C TTTC 11.35 T149C TTTA 11.08 T149C TTTG 10.49 T149C CTTA 10.35 T149C TTTT 9.98 T149F TTTC 13.56 T149F TTTG 13.11 T149F TTTA 11.72 T149G TTTG 12.06 T149G TTTA 10.59 T149G CTTG 10.14 T149G TCCC 10.11 T149G GTTG 10.08 T149G TTTC 9.96 T149G TTCA 9.78 T149G TTTT 9.77 T149G CCCC 9.29 T149G ATTG 9.26 T149G TTCC 9.2 T149G CTTC 8.83 T149G TCTA 8.83 T149G ATTC 8.6 T149G TCCG 8.58 T149G CCCG 8.57 T149G TCTC 8.45 T149H TTTA 15.77 T149H TTTC 11.31 T149N TTTA 13.97 T149N TTTC 13.27 T149N TTTG 10.86 T149P TTTC 10.27 T149P TTTA 10.14 T149P TTTG 9.22 T149S TTCC 14.11 T149S CTTC 14.01 T149S ATTG 13.88 T149S TCTG 13.24 T149S TTCA 12.74 T149S ATTC 12.36 T149S CTTA 12.32 T149S TTTT 12.24 T149S CTTG 11.87 T149S CCTG 11.55 T149S ATTA 11.51 T149S TCTC 11.38 T149S TTCG 11.34 T149S TCTA 11.17 T149S GTTA 10.66 T149S GTTC 10.45 T149S GTTG 10.44 T149S TCGC 10.43 T149S CCCC 10.4 T149S TCCG 10.35 T149S TTGC 10.2 T149S TCCA 9.82 T149S CCTA 9.7 T149S TTTC 9.68 T149S TCCC 9.33 T149S TTCT 9.18 T149S TTTA 9.08 T149S CCGC 8.88 T149S CCCG 8.63 T149S CCTC 8.45 T149V TTCA 13.47 T149V TTTA 13.34 T149V TTCC 12.51 T149V TTTG 12.3 T149V TTTT 11.86 T149V TTCG 11.21 T149V TTTC 10.58 T149V TCCC 9.41 T149V CTTG 8.81 T149V TCTC 8.75 T152E CCTC 18.07 T152E CTTC 16.54 T152E TTGC 15.59 T152E TTCA 14.71 T152E TCTG 14.5 T152E TCCC 14.43 T152E TCGC 14.25 T152E TCTC 14.21 T152E GTTC 14.11 T152E TTTC 14.1 T152E TTTT 14.1 T152E ATTC 13.83 T152E CTTG 13.72 T152E TTTA 13.71 T152E TCCG 13.52 T152E CCCC 12.98 T152E TTCC 12.87 T152E TTCG 12.63 T152E ACTC 12.45 T152E CCGC 12.05 T152E GCGC 12.01 T152E CTTA 11.75 T152E TTTG 11.67 T152E TTCT 11.58 T152E TCAC 10.76 T152E CCAC 10.72 T152E GTTG 10.4 T152F TTCC 16.18 T152F CTTC 15.86 T152F CTTA 15.51 T152F TTTC 14.6 T152F TTGC 14.54 T152F TTCA 14.36 T152F TTTT 13.43 T152F TTTG 13.17 T152F CTTG 12.61 T152F ATTA 12.5 T152F TCTC 11.97 T152F TTCG 11.93 T152F TCCC 11.76 T152F TTTA 11.14 T152F TCGC 10.44 T152F CCCC 9.98 T152H TCCC 12.04 T152H TTGC 11.41 T152H CCCC 11.3 T152H TTTT 11.27 T152H CTTA 11.1 T152H TTCC 11.06 T152H TCTC 10.51 T152H CTTG 10.27 T152H TTTC 10.23 T152H TTTA 10.06 T152H TCGC 10.02 T152H ATTC 10.01 T152H TTTG 9.94 T152H TCTG 9.88 T152H CCTC 9.85 T152H CTTC 9.81 T152H TCCG 9.76 T152H TTCA 9.71 T152H ATTA 9.64 T152H TCTA 9.63 T152H TTCT 9.34 T152H TCCA 9.05 T152H TTAC 8.95 T152H ATTG 8.74 T152H TTCG 8.46 T152K CTTG 14.08 T152K CCGC 13.88 T152K CCTA 13.58 T152K ATTA 13.28 T152K ACTC 13.28 T152K TCCC 13.26 T152K GTTG 13.22 T152K GCTC 13.21 T152K CCCC 12.99 T152K TTCT 12.84 T152K TCAC 12.63 T152K GCTA 12.51 T152K CCTG 12.5 T152K CTTA 12.46 T152K GTTC 12.46 T152K ATTG 12.29 T152K ATTC 12.24 T152K TCTC 12.23 T152K TCTG 12.2 T152K CTTC 12.12 T152K TTCA 11.99 T152K TTCG 11.88 T152K CCTC 11.81 T152K CCAC 11.76 T152K ACTG 11.5 T152K TCTA 11.44 T152K GCGC 11.41 T152K TCGC 11.15 T152K TCCA 11.08 T152K GTTA 10.94 T152K TTAC 10.94 T152K CTCC 10.78 T152K TTTA 10.44 T152K TCGA 10.16 T152K ACTA 10.14 T152K TTCC 10.09 T152K GCCC 9.97 T152K TTTT 9.85 T152K ACGC 9.71 T152K TTGC 9.68 T152K GCTG 9.59 T152K TCCG 9.4 T152K TTGA 9.39 T152K CCCG 9.34 T152K ACCC 9.3 T152K TTTG 9.21 T152K CTTT 8.75 T152L CTTA 15.37 T152L ATTC 14.54 T152L TCGC 13.95 T152L TCTA 13.76 T152L CTTG 13.75 T152L CTTC 13.54 T152L TCTC 13.15 T152L CCCC 12.44 T152L TTGC 12.23 T152L TTCC 12.04 T152L TTCG 11.39 T152L ATTG 10.85 T152L TTTT 10.5 T152L CCTA 10.43 T152L TTAC 10.32 T152L GTTG 9.55 T152L CCTC 9.38 T152L TCTG 9.22 T152L TTTA 8.96 T152L CCTG 8.96 T152Q TCGC 11.48 T152Q CCTG 11.36 T152Q CCTA 11.27 T152Q CCCA 10.85 T152Q TCAC 9.99 T152Q CCGC 9.9 T152Q ATTC 9.85 T152Q TCTG 9.82 T152Q CTTC 9.78 T152Q TTGC 9.7 T152Q TCTC 9.7 T152Q GTTG 9.64 T152Q TTGA 9.56 T152Q TCTA 9.37 T152Q ATTG 9.12 T152Q TTAG 9.09 T152Q TTCT 9.04 T152Q ATTA 8.96 T152Q TTGG 8.65 T152Q TCCA 8.57 T152Q TTTG 8.56 T152Q ACTC 8.52 T152Q GCCC 8.37 T152Q TTTT 8.32 T152Q CTTA 7.83 T152Q TTCC 7.74 T152Q TTCG 7.35 T152R CTTC 16.05 T152R CCTG 14.82 T152R CCTC 13.67 T152R GCCC 12.97 T152R CCCC 12.95 T152R GTTG 12.67 T152R GCCG 12.64 T152R ACTC 12.49 T152R CCGC 12.38 T152R CCGG 12.22 T152R TCGA 12.16 T152R CTGC 11.86 T152R CCCG 11.78 T152R TCGG 11.59 T152R ATTA 11.55 T152R CCCA 11.27 T152R TCAG 11.2 T152R TTCA 11.03 T152R CTTA 10.87 T152R CCTA 10.82 T152R ATTG 10.8 T152R TTCG 10.71 T152R TCCG 10.7 T152R ACGA 10.69 T152R TCCA 10.66 T152R ATTC 10.62 T152R TCGT 10.58 T152R GCAC 10.54 T152R TTAC 10.46 T152R TCTA 10.44 T152R ACCC 10.44 T152R GCTA 10.41 T152R TTTT 10.4 T152R GCCA 10.38 T152R GTTA 10.31 T152R ACTG 10.25 T152R GCTG 10.24 T152R GCGA 10.23 T152R ACTA 10.21 T152R TTGT 10.12 T152R TTCT 10.07 T152R GCTC 10.05 T152R ACCG 10.01 T152R CCGA 9.99 T152R TCGC 9.92 T152R GTTC 9.85 T152R CTCG 9.82 T152R GCGG 9.74 T152R TTAG 9.7 T152R TCCC 9.66 T152R TCTC 9.58 T152R ACCA 9.58 T152R CTTG 9.53 T152R TTGG 9.53 T152R CTCA 9.17 T152R TTGC 9.03 T152R ACGG 8.22 T152W TTGC 16.19 T152W TTCA 14.29 T152W TTCG 13.39 T152W TTCC 13.36 T152W TTTT 13.32 T152W TCTA 12.94 T152W TTTG 12.53 T152W CTTC 12.39 T152W CTTG 12.21 T152W ATTA 12.11 T152W TCCG 12.04 T152W CCTG 11.72 T152W CTTA 11.67 T152W TTTC 11.21 T152W TTTA 11.1 T152W ATTG 11.02 T152W CCTA 10.57 T152W TCTC 10.48 T152W TTAC 10.29 T152W ATTC 9.95 T152W GTTA 9.86 T152W GTTC 9.45 T152Y TCCA 16.58 T152Y TCTG 15.9 T152Y TCTC 18.89 T152Y CCTC 14.57 T152Y TCTA 15.43 T152Y TTAC 15.31 T152Y CCTG 15.3 T152Y CTTG 15.16 T152Y ACTG 14.71 T152Y GCTA 14.52 T152Y ATTA 14.36 T152Y ACTC 14.29 T152Y ATTG 14.24 T152Y TTCG 14.05 T152Y CCGC 13.93 T152Y GCCC 13.92 T152Y TCCG 13.65 T152Y CTTC 13.65 T152Y GCTC 13.61 T152Y GTTG 13.55 T152Y TCAC 13.42 T152Y ATTC 13.38 T152Y CTTA 13.2 T152Y TTGC 13.03 T152Y TCGC 12.87 T152Y GTTA 12.47 T152Y TCCC 12.23 T152Y ACTA 12.07 T152Y CCTA 12.04 T152Y GCTG 11.97 T152Y ACGC 11.96 T152Y TTCA 11.9 T152Y TTCC 11.9 T152Y GTTC 11.89 T152Y TCGG 11.8 T152Y TTCT 11.68 T152Y CCCC 11.49 T152Y CCAC 11.49 T152Y GCGC 11.42 T152Y CCCA 11.39 T152Y GCAC 11.15 T152Y TTGA 10.7 T152Y CTCC 10.58 T152Y CCCG 10.42 T152Y CTTT 10.32 T152Y TTTT 10.31 T152Y ACCC 10.09 T152Y TTGG 9.8 T152Y TTTC 9.37 T152Y ACAC 8.65 V596H TTTG 11.75 V596H TTTC 11.08 V596T CTTA 20.31 V596T TTTG 16.49 V596T TTCA 15.21 V596T CTTG 14.59 V596T TTTA 14.55 V596T CTTC 14.43 V596T TCTA 13.11 V596T TTCC 13 V596T TTGC 12.93 V596T TCCC 12.65 V596T TTTT 12.27 V596T TCTC 12.27 V596T TCTG 12.07 V596T CCCC 12.03 V596T TTTC 12.02 V596T TTCG 10.87 V596T CCCG 9.96 V596T TCCG 9.6 V596T GTTC 9.3 V596T GCGC 9.17 W649H TTTC 11.36 W649H TTTA 11.18 W649H TTTG 10.47 W649K TTTA 13.34 W649R TTTA 8.84 W649S TTTA 9.77 W649Y TTTC 11.78 W649Y TTTG 11.48 W649Y TTTA 11.05 Y542F TTTA 11.24 Y542F TTTC 10.25 Y542F TTTG 9.9 Y542H CTTA 11.46 Y542H TTTT 11.44 Y542H CTTA 10.96 Y542H TTTC 10.6 Y542H TCCC 10.37 Y542H GTTA 10.23 Y542H TTCG 10.16 Y542H TTCA 10.06 Y542H TTTG 10.04 Y542H CCAC 8.42 Y542H GCTC 8.27 Y542K TTTA 10.62 Y542K TTTG 9.4 Y542K TTCA 8.45 Y542L CTTA 12.93 Y542L TTTA 10.46 Y542L TTTC 10.2 Y542L TTTG 10.04 Y542M TTTG 11.54 Y542M TTTA 11.15 Y542M TTTC 10.32 Y542M CTTG 10.17 Y542M CTTA 10.05 Y542M CTTC 8.67 Y542N TTGC 11.39 Y542N TTTA 11.38 Y542N TTTG 11.27 Y542N TTCC 11.06 Y542N TTTT 10.31 Y542N GTTC 10.16 Y542N CCCC 9.87 Y542N ATTA 9.39 Y542N TCCC 9.37 Y542N TTTC 9.21 Y542R TTTT 10.21 Y542R CTTG 8.75 Y542R TTCA 8.73 Y542R TCCC 8.68 Y542R GTTA 7.7 Y542T TTTA 11.46 Y542T TTTC 9.68 Y542T TTTG 9.59 Y542V TTTG 12.03 Y542V TTTA 10.76 Y616E TTTG 12.92 Y616E TTTA 12.58 Y616E TTTC 12.02 Y616F TTTT 12.56 Y616F TTTA 12.36 Y616F CTTA 12.33 Y616F CTTG 11.97 Y616F TTTG 11.74 Y616F TTCA 11.5 Y616F ATTG 11.46 Y616F CTTC 11.34 Y616F TTCC 11.06 Y616F TCTA 10.99 Y616F ATTA 10.97 Y616F TTTC 10.79 Y616F TTCT 10.63 Y616F GTTG 10.46 Y616F TTGC 9.95 Y616F TTCG 9.74 Y616F TCTG 9.65 Y616F ATTC 9.45 Y616F TTAC 8.77 Y616H CTTA 12.23 Y616H CTTG 11.73 Y616H TTTC 11.26 Y616H CTTC 11.18 Y616H TTTT 11.11 Y616H TTTA 11 Y616H TTTG 11 Y616H TTCA 10.45 Y616H TTCC 10.28 Y616H TTGC 10.16 Y616K TTTG 9.23 Y616K TTCC 8.66 Y616R TTTG 10.22 Y616R TTCC 9.77 Y646E TTTA 13.43 Y646E CTTA 12.79 Y646E TTTT 11.99 Y646E TTTG 11.63 Y646E TTTC 11.28 Y646E CTTC 11.26 Y646E CTTG 10.71 Y646E TTCC 9.96 Y646H TTGC 13.8 Y646H GTTC 12.39 Y646H GTTA 12.24 Y646H TCTA 11.57 Y646H TCTC 11.45 Y646H ATTA 10.92 Y646H TTCT 10.69 Y646H TCTG 10.57 Y646H TCCC 10.3 Y646H CTTC 10.25 Y646H ATTG 10.23 Y646H CTTG 10.13 Y646H TTCC 9.81 Y646H CCTG 9.69 Y646H ATTC 9.61 Y646H GTTG 9.13 Y646K TTTT 10.71 Y646K CTTA 9.82 Y646K TTTC 9.2 Y646N TTCA 10.45 Y646N ATTA 10.38 Y646N TTTA 8.91 Y646N TCTA 8.61 Y646Q ATTA 11.69 Y646Q ATTG 11.67 Y646Q TCTA 11.39 Y646Q TTCC 11.24 Y646Q CTTC 10.99 Y646Q TTTT 10.98 Y646Q TTCA 10.58 Y646Q CTTA 9.82 Y646Q TCTC 9.52 Y646Q TTTG 9.27 Y646R TTTC 10.17 Y646R TCTA 9.17 Y646R TTTA 8.09 Y646W TTTT 10.69 Y646W TTTC 9.78 Y646W CTTG 9.6
[0220] We observed 36 unique PAM sequences cleaved in vitro using two LbCas12a controls. This is in line with the observation that in vitro wtLbCas12a can recognize and cleave more sequences than just TTTV. TTCN, CTTN, TCTN, and others have been shown to be recognized and cleaved by LbCas12a in vitro, where AsCas12a was shown only to cleave TTTN (Zetsche et al. Cell 163:759-771 (2015)).
[0221] Some of the mutants increased the total number of PAM sequences recognition and cleavage in vitro (Table 5) as compared to wtLbCas12a. This does not speak to the absolute PAM recognition sequences, but to the overall promiscuity imparted by individual mutations. Some individual point mutants were more promiscuous than wildtype. For example, T152R recognized 57 different PAMs and K959Y recognized 45.
TABLE-US-00007 TABLE 5 Some of the more promiscuous LbCas12a mutants as judged by the number of PAMs (nPAM) the recognized and cleaved in vitro. Mutant nPAM T152R 57 T152Y 50 T152K 47 D156Q 45 K595Y 45 D156L 43 D122H 39 K116R 39 D156K 38 K121S 38 K121R 37 wildtype 36
Comparing Depletions to Wildtype LbCas12a
[0222] In vitro wtLbCas12a can recognize and cleave more sequences than just TTTV (Zetsche et al. Cell 163:759-771 (2015)). TTCN, CTTN, TCTN, and others have been shown to be recognized and cleaved by LbCas12a in vitro, where AsCas12a was shown only to cleave TTTN (Zetsche et al. Cell 163:759-771 (2015)). The goal of this study was to expand LbCas12a's PAM recognition beyond its wildtype capabilities. To this end, we employed a different analysis than library depletion scores alone. Those scores are important for determining absolute PAM recognition and cleavage in vitro, but do not readily highlight the changes to the PAM recognition by the enzyme due to the introduced point mutations.
[0223] First, the 5 nucleotide depletion results were collapsed into 4 nucleotide PAMS, as before. Each time point was maintained individually. Each mutant-time point NGS total counts were normalized to 100 counts per PAM to account for loading differences on the NGS chip. Then the global medians for each 4 nt PAMs were compared to each mutant-time point. This provided a depletion as compared to wildtype, rather than a depletion as compared to the total library. The results highlight which mutations changed the PAM recognition profiles. We took a conservative approach and chose a depletion score of 4 or over as an indication of new PAM recognition by a mutant. A depletion score of 4 indicated four times as much of that particular PAM-containing library member was cleaved as compared to the median for wildtype. For example if 100 NGS counts were remaining for a PAM with GCGC for wildtype and 25 counts remained for a particular mutant-time point, then a score of 4 was calculated.
[0224] A summary of each of the 186 mutations is shown below in Table 6. Mutations provided in bold lettering indicates that the mutation recognized and cleaved more than 3 new PAM sequences as compared to wildtype with a score above 4. Mutations provided in italics indicates the mutant acquired between 1 and 3 or new PAM sequences as compared to wildtype with a score above 4. Mutations in regular font (not bolded or italicized) indicates the point mutation did not cleave new PAM sequences as compared to wildtype with a score above 4. Certain amino acids, such as T149 did not acquire new PAM recognitions despite being near the PAM-recognition domain of the protein and testing 10 new amino acids. Other amino acids, such as D156, appeared to be a hot-spot for engineering new PAM recognition motifs. Aspartate 156 when changed to 10 differing amino acids had with 7 mutations recognizing multiple new PAMs, 1 showing a few new PAMs, and two not acquiring new PAMs as compared to wtLbCAs12a. In general, any locations which showed a difference in PAM recognition and cleavage as compared to wildtype could be combined into double, triple, or multiple mutations to further alter PAM recognition. In total 130/186 point mutations did not acquire new PAMs over wtLbCas12a (regular font/not bold or italicized) above a score of 4, 40/186 acquired many new PAMs (bold font), and 16/186 acquired 1-3 new PAMs (italicized font). An overall 30% success rating (56/186) indicates an efficacious method was used to design novel PAM recognition motifs by making point mutations to LbCas12a.
TABLE-US-00008 TABLE 6 Summary table for the 186 LbCas12a point mutations (reference sequence SEQ ID NO: 1). K116R K120R K121S D122R E125R T148H T149A T152R D156R E159K Q529N G532D D535N K116N K120H K121T D122K E125K T148S T149C T152K D156K E159R Q529T G532N D535H K120N K121H D122H E125Q T148A T149S T152W D156Y E159H Q529H G532S D535V K120T K121R D122E E125Y T148C T149G T152Y D156W E159Y Q529A G532H D535T K120Y K121G D122N T149H T152H D156Q E159Q Q529F G532F D535S K120Q K121D T149P T152Q D156H Q529G G532K D535A K121Q T149F T152E D156I Q529S G532R D535W T149N T152L D156V Q529P G532Q D535K T149D T152F D156L Q529W G532A T149V D156E Q529D G532L G532C K538R D541N Y542R L585G K591W M592R K595R V596T S599G K600R K601R Y616K Y646R W649H K538V D541H Y542K L585H K591F M592K K595Q V596H S599H K600H K601H Y616R Y646E W649K K538Q D541R Y542H L585F K591Y M592Q K595Y V596G S599N K600G K601Q Y616E Y646K W649R K538W D541K Y542Q K591H M592E K595L V596A S599D K601T Y616F Y646H W649Y K538Y D541Y Y542F K591R M592A K595W Y616H Y646Q W649E K538F D541I Y542L K591S K595H Y646W W649S K538H D541A Y542M K591A K595E Y646N W649V K538L D541S Y542P K591G K595S W649T K538M D541E Y542V K591P K595D K538C Y542N K595M K538G Y542T K538A K538P
[0225] Many of the point mutations imparted novel PAM recognition to LbCas12a, allowing it to cleave DNA preceded by these sequences in vitro. Some mutations caused an increase in overall promiscuity, while others designed and tested were not shown to change wtLbCas12a recognition and cleavage. Overall 130/186 point mutations did not acquire new PAMs over wtLbCas12a (Table 6, regular font/not italicized or bold) above a score of 4, 40/186 acquired many new PAMs (Table 6, bold font), and 16/186 acquired 1-3 new PAMs (Table 6, italicized font). An overall 30% success rating (56/186) indicates an efficacious method was used to design novel PAM recognition motifs by making point mutations to LbCas12a.
2. Determining Binding of Point Mutations and Combinations in Prokaryotes
[0226] Combinations of individual mutations can alter the PAM recognition even more than single mutations. However, such experiments rapidly scale to large numbers of combinations to test. Taking just the 40 mutations which caused LbCas12a to recognize 3 or more new PAMs and making a library of double mutants a total of 40.sup.2 or 1,600 enzymes could be tested. Making a triple-mutant library would result in 40.sup.3 or 64,000 enzymes to purify and assay in replicates, which is not practical. We, therefore, adapted a bacterial method, known as PAM-SCANR (Leenay et al. Mol Cell 62, 137-147 (2016)) to assess combinatorial mutations. We used a library in Escherichia coli to test binding of Cas12a mutations to the 256 possible PAM NNNN variants. This assay does not test cleavage, rather it tests binding in vivo. Since the mutations made were nowhere near the catalytic region, binding is expected to reflect cleavage as well (this was verified later in the 293T assay). The advantage to PAM-SCANR is the ability to rapidly test not only point mutations, but combinations of amino acid point mutations in a quick and accurate way. It also tends to be more stringent than in vitro cleavage assays.
Reporter Plasmid
[0227] Plasmid pWISE1963 was used as the base vector for generating reporters with each of the 256 PAMS. The plasmid contains Spectinomycin resistance, ColE1 origin of replication, Lad, and eGFP under control of the lac promoter. 256 gene blocks containing the fragment between the NotI and SmaI restriction site (from just 5 of the lacI promoter into the lacI gene) were synthesized by Twist Bioscience. Each fragment contained a different 4-mer PAM directly 5 of the lacI promoter. Each gene block was cloned into the pWISE1963 via restriction and ligation. Clones were selected for each variant and the identity of the PAM was verified by Sanger sequencing.
CRISPR-Cas Plasmid
[0228] Plasmid pWISE2031 was used as the base vector for generating all CRISPR-Cas plasmids. The plasmid contains Chloramphenicol resistance, a CloDF13 origin of replication, dLbCas12a driven by promoter BbaJ23108, and the LbCas12a with a crRNA targeting the lacI promoter driven by the BbaJ23119 promoter. The negative control plasmid, pWISE1961 contains the same components as pWISE2031 with the exception that a non-targeting crRNA was used. Each point and combinatorial mutant (pWISE2984-pWISE3007) was constructed via site-directed mutagenesis of pWISE2031 at Genewiz.
Cell Line
[0229] An E. coli cell line containing a chromosomal deletion of the lacI gene, JW0336, was obtained from Dharmacon Horizon Discovery. Electrocompetent cells were prepared according to the protocol described (Sambrook, J., and Russell, D. W. (2006). Transformation of E. coli by Electroporation. Cold Spring Harb Protoc 2006, pdb.prot3933). E. coli JW0336 was used in all library transformation and cell sorting experiments.
Preparation of Reporter Library
[0230] 10 ng of each reporter plasmid described in the section above was pooled into a single tube to generate a library for transformation and amplification. 1/20.sup.th of the pooled plasmid library (approximately 0.5 ng of each reporter) was transformed into supercompetent XL1-Blue according to manufacturer's instructions. After 1-hour of recovery at 37 C. with shaking at 225 rpm the entire transformation was transferred to 1-L of LB Spectinomycin and grown overnight at 37 C. with shaking at 225 rpm. The following day plasmid DNA was extracted from the overnight culture using a ZymoPURE plasmid gigaprep kit according to manufacturer's instructions. The DNA was quantified by nanodrop and used in all subsequent library transformations.
Library Transformations and Cell Sorting
[0231] 100 ng of reporter plasmid library and 100 ng of Crispr/Cas plasmid were co-transformed into 40 uL of JW0336 by electroporation. Transformations were recovered at 37 C. with shaking at 225 rpm for 1-hour. At the end of recovery, 10 uL of transformation was removed, mixed with 90 uL LB and plated onto LB agar plates with chloramphenicol and spectinomycin to determine transformation efficiency. The remaining amount of recovery (990 uL) was transferred to an overnight culture containing 29 mL of LB with Spectinomycin and Chloramphenicol. The cultures were grown overnight at 37 C. with shaking at 225 rpm. The following morning colonies were counted on the transformation plates to determine transformation efficiency; all transformations except for 2 of them showed >2,000 transformants, equating to 10 or greater coverage of the reporter library. The two samples that did not show 10 or greater coverage were repeated. Glycerol stocks of the overnight cultures were then prepared and stored at 80 C, and 6-mL of each culture was miniprepped using a Qiagen miniprep kit, according to manufacturer's instructions. These minipreps were labeled pre-sort and stored at 4 C.
[0232] One optical density (OD) of each overnight library culture was spun down in a tabletop microcentrifuge at 8,000 rpm, 4 C. for 5 minutes. The supernatant was pipetted off, and 1 mL of filter sterilized 1PBS buffer was added to each tube. The pellets were carefully re-suspended by pipetting. The wash with 1PBS was repeated 2 more times, and after the final re-suspension the cells (about 10.sup.8 cells per mL in 1PBS) were placed on ice. Each sample was sorted on a Beckman-Coulter MoFlo XDP cell sorter. A negative control (WT-dLbCas12a+non-targeting crRNA+reporter library) and positive control (WT-dLbCas12a+targeting crRNA+reporter library) were used to set gating parameters for cell sorting. Samples were sorted on single-cell purity mode, with voltage 425, ssc voltage 535, fsc voltage (gain) of 4.0. The typical rate of sorting was about 4000 events/second. Each sample had a minimum of 1.010.sup.6 events; cell sorting was performed until 50,000 GFP-positive events were collected or the sample was depleted. In cases where the sample was depleted, a minimum of 200 GFP positive events were collected. GFP-positive events were collected into tubes containing 2-mL of LB with Spectinomycin and Chloramphenicol. Post-sort, the samples were diluted to 6-mL with additional LB with Spectinomycin and Chloramphenicol, and then grown overnight at 37 C. with shaking at 225 rpm.
[0233] Example sorts are provided in
Next Generation Sequencing
[0234] The following morning after sorting glycerol stocks of each overnight culture were prepared and stored at 80 C. The remaining amount of each 6-mL culture was miniprepped with a Qiagen miniprep kit according to manufacturer's instructions. These minipreps were labeled post-sort and were stored at 4 C. Pre-sort and post-sort minipreps were quantified by nanodrop, diluted 10-fold and handed off for sequencing on an Illumina Mi-Seq.
[0235] The spacer vectors were subjected to deep sequencing analysis to calculate the frequency of A/T/G/C at each position of PAM using an Illumina MiSeq according to manufacturer's protocols. Briefly, 10 ng of DNA was used as template for PCR. Phasing gene specific forward and reverse PCR primers were designed to amplify across the target site. Amplicon libraries were generated using a two-step PCR method, where primary PCR with 5 tails allow a secondary PCR to add Illumina i5 and i7 adapter sequences and barcodes for sorting multiplexed samples. PCR amplifications were performed using the following parameters: 98 C. for 30 s; 25 cycles for PCR1 and 8 cycles for PCR2 (98 C. 10 s, 55 C. 20 s, 72 C. 30 s); 72 C. for 5 min; hold at 12 C. The PCR reactions were performed with Q5 High-Fidelity DNA Polymerase (New England BioLabs, Beverly, Mass., United States). The secondary PCR amplicon samples were individually purified using AMPure XP beads according to manufacturer's instruction (Beckman Coulter, Brea, Calif., United States); all purified samples were quantified using a plate reader, pooled with an equal molar ratio, and run on AATI fragment analyzer (Agilent Technologies, Palo Alto, Calif., United States). The pooled amplicon libraries were sequenced on an Illumina MiSeq (2250 paired end) using a MiSeq Reagent kit v2 (Illumina, San Diego, Calif., United States).
Sequencing Results of the Highly Fluorescent Sorted Cells
[0236] Two negative control samples were run containing wtdLbCas12a and a non-targeting crRNA in the presence of the 256-member reporter library. After normalization to 1.0, the value for each member of the library was plotted as a histogram (
[0237] The pre-sorted pools were all sequenced prior to sorting. The average reads per PAM was from about 250 to 500 NGS reads, depending on the sample. The highly fluorescent post-sorted pools were sequenced and had similar read counts per PAM at about 250-500 reads per PAM. Both samples were then normalized to control for small loading differences in each NGS experiment. The two values were then subtracted and normalized to 1.0. Many PAM sequences were bound by the point mutation library above the 1.67 cutoff (
TABLE-US-00009 TABLE 7 The ability of point mutations to bind PAMs above the 1.67 threshold, sorted by normalized score. TTTV sequences for wildtype are in bold. Wildtype wildtype T152R T152R K538W K538W K595Y K595Y D122H D122H PAM score PAM Score PAM Score PAM Score PAM Score TTTC 2.96 TTTG 2.94 TTTA 4.71 TCGC 3.23 TTTC 3.03 CTTG 2.56 TTTA 2.9 CTTA 2.80 TCCC 3.03 TTTG 2.87 TTTA 2.54 CTTA 2.72 AGCT 2.70 TTGC 2.98 TTTA 2.56 TTTG 2.47 TTTC 2.66 AATG 2.19 GCGC 2.93 TTTT 2.46 CCGC 2.23 GTTA 2.48 CTTC 2.03 ACGC 2.40 CTTA 2.20 CTTA 2.19 CTTG 2.19 TTTC 1.82 TCCA 2.35 TTCC 2.19 CTTC 1.97 GTTG 2.1 TTCC 2.32 CTTG 2.10 GTTC 1.82 CTTC 2.02 TCCG 2.17 GTTA 1.97 TTCC 1.82 AGAG 1.91 TTCG 2.01 ATTG 1.96 GTTG 1.80 ATTG 1.85 TCGG 1.93 CTTC 1.89 GTTA 1.75 TCCA 1.79 CCGC 1.84 TCTG 1.82 GCCA 1.72 CCCA 1.79 CCCA 1.79 TCTA 1.72 ACCC 1.74 GTTG 1.72 TTTT 1.72 GTTC 1.71 D156V D156V D156Q D156Q D535N D535N E159K E159K G532H G532H PAM Score PAM Score PAM Score PAM Score PAM Score AATG 3.13 TGTG 3.96 TTTG 4.66 TTTG 2.37 AATG 2.30 GTTG 2.16 CCTC 2.42 TTTC 4.23 TTTC 2.36 CCTA 1.89 TTTT 2.15 CCCA 2.14 TTTA 3.91 TTTA 2.25 GTTG 1.83 TTTA 2.02 GTTG 2.09 TTTT 2.04 CTTA 2.07 GTTA 1.79 CTTA 1.99 GTTC 2.07 CACG 2.03 CTTG 1.94 TTTA 1.77 GTTA 1.98 CTTC 1.97 CTTC 1.86 TCTA 1.73 ATTA 1.97 ATTC 1.96 CCCA 1.68 CTTA 1.68 CTTG 1.93 TTCC 1.90 GTTA 1.67 GTTC 1.85 TTGC 1.90 CTTC 1.77 TTCA 1.88 TCTC 1.71 ACTC 1.86 TTCA 1.70 ACAC 1.85 CTTG 1.82 AGCT 1.80 AATG 1.80 AAGC 1.72 GTAC 1.70 TCGC 1.69 CCTG 1.69 GTTA 1.69 TCCC 1.67 G532K G532K K121R K121R K595W K595W K538W K538W D535N D535N PAM Score PAM Score PAM Score PAM Score PAM Score TTTA 2.76 TTTG 3.28 TTTG 2.35 TTTA 11.18 GCGG 18.70 TTTC 2.66 TTTA 3.15 TTCC 2.27 CTTA 9.57 TTTG 16.34 TTTG 2.56 TTTC 2.95 TTTA 2.23 TTTC 8.45 TTTA 13.15 CCGC 2.51 CTTG 2.18 GCGC 2.03 TTTG 7.27 TTTC 3.87 TTCC 2.37 CTTA 2.17 TTCG 2.02 CTTC 6.70 TTGG 3.83 TTCA 2.16 TTTT 2.14 TTTC 2.01 CTTG 6.33 TTAC 2.94 TCCC 2.13 CTTC 1.85 TTCA 1.99 TATC 5.35 TCAC 2.78 TCCA 1.76 GTTG 1.80 ACCG 1.97 TATA 4.90 TTGC 2.38 GTTA 1.75 GTTA 1.78 TCCG 1.87 TATG 4.39 TTCC 1.87 ATTG 1.72 TTGG 1.74 TCGC 1.85 AATG 2.75 CCAC 1.87 CCCC 1.69 TTCC 1.71 TCCC 1.84 CCGC 2.19 TCGC 1.84 CTTA 1.68 AACG 1.84 AATC 2.13 CTTG 1.67 TTGC 1.83 GTTA 1.89 TTTT 1.67 TCCA 1.76 AATA 1.68
[0238] We combined the three point mutations T152R, K538W, and K595Y in various combinations to make double and triple dLbCas12a mutants (T152R+K538W, K538W+K595Y, and T152R+K538W+K595Y). This was compared to a previously described control, which was developed in AsCas12a known as RR whose LbCas12a mutations correspond to G532R+K595R control (Gao et al. Nat Biotechnol 35(8):789-792 (2017)). RR have been described as being able to cause INDELs in TYCV+CCCC sequences in AsCas12a and subsequently LbCas12a.
[0239] The same methodology was applied to score the combinatorial mutations. Pre and post-sorted pools were sequenced each having an average of about 250-500 MiSeq NGS reads per PAM library member. The pre and post-sort pools were normalized and subtracted, the difference being normalized to 1.0. Many PAM sequences were bound by the combinations above the 1.67 cutoff (
TABLE-US-00010 TABLE 8 Ability of combinatorial mutations to bind PAMs above the 1.67 threshold, sorted by normalized score. TTTV sequences for wildtype are in bold. TYCV + CCCC sequences for the G532R + K595R control are underlined. T152R + T152R + G532R + G532R + T152R + T152R + K538W + K538W + K538W + K538W + wildtype wildtype K595R K595R K538W K538W K595Y K595Y K595Y K595Y PAM score PAM Score PAM Score PAM Score PAM Score TTTC 2.96 TTTT 5.07 TTTC 11.96 TTTC 11.96 AGCC 13.65 CTTG 2.56 TTCG 4.81 TTTA 11.62 TTTA 11.62 TGGC 10.28 TTTA 2.54 ACCC 4.52 TTTG 11.19 TTTG 11.19 TACC 9.35 TTTG 2.47 TCCG 4.51 GTTG 7.75 GTTG 7.75 TGCC 7.68 CCGC 2.23 TTCA 4.46 GTTA 6.68 GTTA 6.68 CTGC 6.69 CTTA 2.19 TTTA 4.30 CTTG 5.53 CTTG 5.53 GGGC 6.09 CTTC 1.97 TTTG 4.28 CTTA 4.93 CTTA 4.93 GGCC 5.71 GTTC 1.82 GCCG 4.15 GTTC 4.34 GTTC 4.34 AGGC 5.26 TTCC 1.82 TTCT 4.07 TTCC 4.11 TTCC 4.11 TAGC 4.96 GTTG 1.80 CTCC 4.03 TCCC 3.82 TCCC 3.82 CGGC 4.89 GTTA 1.75 GCCA 4.01 TTCA 3.78 TTCA 3.78 ACCC 4.15 CCCG 4.00 ATTG 3.78 ATTG 3.78 GACC 4.08 TCCA 3.92 TCCG 3.48 TCCG 3.48 AAGC 3.81 ACTA 3.90 TTGG 3.43 TTGG 3.43 AGCA 3.69 GTCC 3.87 GCCC 3.32 GCCC 3.32 GCGC 3.49 CCCC 3.87 CTTC 3.30 CTTC 3.30 TACA 3.26 TTTC 3.84 CCCC 2.95 CCCC 2.95 TCCC 3.17 CCCA 3.78 TCTA 2.88 TCTA 2.88 CCCA 3.15 TCTA 3.75 GCCA 2.86 GCCA 2.86 TGCA 2.87 TCCT 3.68 TCCA 2.86 TCCA 2.86 GCCC 2.66 GCTA 3.63 ATTA 2.44 ATTA 2.44 CCCC 2.49 GCCC 3.59 CTCC 2.29 CTCC 2.29 TTGC 2.42 GTTA 3.58 CCCG 2.19 CCCG 2.19 ACGC 2.21 ACCA 3.43 ACCC 2.16 ACCC 2.16 GGCA 2.21 TCCC 3.38 TTCG 2.13 TTCG 2.13 ACCA 2.18 TTCC 3.36 GTCC 2.13 GTCC 2.13 AACC 2.09 ACCG 3.36 CCCA 2.06 CCCA 2.06 GACA 1.83 TCTG 3.31 GCCG 1.99 GCCG 1.99 CAGC 1.81 TCTT 3.05 GCTA 1.97 GCTA 1.97 ACCG 1.80 CTTA 2.92 TCTG 1.96 TCTG 1.96 GGGG 1.80 TCTC 2.89 TCTC 1.84 TCTC 1.84 TACG 1.72 CCCT 2.89 TTTT 1.81 TTTT 1.81 TTCC 1.69 CTCA 2.86 ATTC 1.79 ATTC 1.79 GTCA 2.63 GTCA 1.67 GTCG 2.54 CCTA 2.54 ATCC 2.34 GTTC 2.11 TTAC 2.10 CTCG 2.03 ATTA 2.01 GCTC 1.94 GCCT 1.89 CCTC 1.82 GCTT 1.71
Overall Analysis of PAM-SCALAR Data
[0240] Wildtype LbCas12a showed strong TTTV binding the LbCas12a-G532R-K595R control showed strong TYCV and CCCC binding. This mutation, called RR was developed in AsCas12a and shown to bind TYCV and CCCC (Gao et al. Nat Biotechnol 35(8):789-792 (2017)). However, in vitro wtLbCas12a can recognize and cleave TTCN, CTTN, TCTN, and others, where AsCas12a was shown only to cleave TTTN (Zetsche et al., Cell 163:759-771 (2015)). We deduced that the RR mutation placed in the LbCas12a context would be more promiscuous than when it is placed in the AsCas12a context and this was what was observed for this control, with LbCas12a-RR recognizing 45 sequences. Both the wildtype and LbCas12a-RR results demonstrate the validity of the selection and sorting parameters
[0241] The mutations tested clearly indicated that novel PAMs are recognized in vivo by individual point mutations identified in vitro. For example, K595Y bound 13 PAMs above the 1.67 threshold, 11 of which were not recognized by wtLbCas12a, and none of which contained the TTTV sequence known to be bound by Cas12a. Similarly, T152R recognized 15 distinct PAMs, however in this case it retained the TTTV of wildtype. Overall out of the 12 point mutations tested, each had novel PAM binding sequences outside of the canonical TTTV motif and distinct from dLbCas12a controls.
Effects of Combinations
[0242] We found that combining multiple point mutations did not lead to a linear addition of the PAM sequences of the point mutations (
[0243] Overall, the combination of mutations results in a more than linear expansion of PAM recognition. For example K538W recognizes 6 PAM sequences, K595Y recognizes 13, but together they recognize 32 sequences (
Comparing Point Mutations PAM Recognition in PAM-SCALAR Versus In Vitro PAMDA
[0244] Taken as a whole for the 12 point mutations tested, PAM-SCALAR hits above 1.67 were well represented in the in vitro PAMDA depletion assay. K595Y and T152R examples are shown (
[0245] There is correlation between the datasets indicating our engineering of residues far from the catalytic site is affecting PAM recognition and binding and not catalysis. If mutations at these residues had affected nuclease activity along with PAM binding then there would be many hits in the PAM-SCANR assay (which measures binding but not cleavage) which did not show cleavage in the PAMDA assay. We do not see that pattern. We observe mutations which affected a change in binding (PAM-SCALAR) also resulted were cleaved in vitro (PAMDA).
3. Determining Binding, Cleavage, and INDEL Formation in Eukaryotes
[0246] We chose three mutations T152R, K538W, and K595Y to test their ability to cause insertions or deletions (INDELs) in eukaryotic HEK293T cells. This assay gives valuable eukaryotic INDEL data. In order to get insertions and deletions in eukaryotes a number of criteria all have to be met: the CRISPR enzyme needs to be expressed and stable in the cell, the crRNA needs to be expressed and correctly processed, the protein:RNA complex needs to form, the complex needs to be stable, the complex needs to translocate in sufficient quantities into the nucleus, the target DNA needs to be accessible, the DNA has to be well-targeted by the particular guide-RNA design, and double-stranded breaks need to occur at a rate high enough to yield the occasional DNA repair mistake via an insertion or deletion (INDEL). This makes eukaryotic assays the most stringent assays in this study. A few dozen PAMs were tested for each of the 3 point mutants described below, rather than all 256 due to the experiment being low-throughput. Three different targets were chosen for each PAM-mutant combination to try to avoid false-negatives since often a particular guide is ineffective due to target accessibility.
HEK293T Cell Testing
[0247] Eukaryotic HEK293T (ATCC CRL-3216) cells were cultured in Dulbecco's Modified Eagle's Medium plus GlutaMax (ThermoFisher) supplemented with 10% (v/v) FBS (FBS), at 37 C. with 5% CO2. Wildtype and mutant LbCas12 were synthesized using solid-state synthesis and subsequently cloned into plasmids behind a CMV promoter. CRISPR RNAs (crRNAs) were cloned behind a human U6 promoter (Table 9). HEK293T cells were seeded on 48-well collagen-coated BioCoat plates (Corning). Cells were transfected at about 70% confluency. 750 ng of protein plasmid and 250 ng of crRNA expression plasmids were transfected using 1.5 l of Lipofectamine 3000 (ThermoFisher Scientific) per well according to the manufacturer's protocol. Genomic DNA from transfected cells were obtained after 3 days and indels were detected and quantified using high-throughput Illumina amplicon sequencing.
[0248] The spacer vectors were subjected to deep sequencing analysis to calculate the frequency of A/T/G/C at each position of PAM using an Illumina MiSeq according to manufacturer's protocols. Briefly, 10 ng of DNA was used as template for PCR. Phasing gene specific forward and reverse PCR primers were designed to amplify across the target site. Amplicon libraries were generated using a two-step PCR method, where primary PCR with 5 tails allow a secondary PCR to add Illumina i5 and i7 adapter sequences and barcodes for sorting multiplexed samples. PCR amplifications were performed using the following parameters: 98 C. for 30 s; 25 cycles for PCR1 and 8 cycles for PCR2 (98 C. 10 s, 55 C. 20 s, 72 C. 30 s); 72 C. for 5 min; hold at 12 C. The PCR reactions were performed with Q5 High-Fidelity DNA Polymerase (New England BioLabs, Beverly, Mass., United States). The secondary PCR amplicon samples were individually purified using AMPure XP beads according to manufacturer's instruction (Beckman Coulter, Brea, Calif., United States); all purified samples were quantified using a plate reader, pooled with an equal molar ratio, and run on AATI fragment analyzer (Agilent Technologies, Palo Alto, Calif., United States). The pooled amplicon libraries were sequenced on an Illumina MiSeq (2250 paired end) using a MiSeq Reagent kit v2 (Illumina, San Diego, Calif., United States).
Wildtype Control
[0249] Wildtype LbCas12a (wtLbCas12a) recognizes TTTV (TTTA, TTTC, and TTTG). We used crRNA spacers (Table 9) to test the wildtype protein against TTTV containing 23 nucleotide spacer targets (
TABLE-US-00011 TABLE9 Spacersandtargets Spacer HEK SEQ name target PAM spacersequence IDNO PWsp125 EMX1 TTTC TCATCTGTGCCCCTCCCTCCCTG 54 PWsp449 FANCF1 TTTC GCGGATGTTCCAATCAGTACGCA 55 PWsp450 HEK2 TTTC CAGCCCGCTGGCCCTGTAAAGGA 56 PWsp453 RNF2 TTTA TATGAGTTACAACGAACACCTCA 57 PWsp454 RNF2 TTTA CACGTCTCATATGCCCCTTGGCA 58 PWsp455 RNF2 TTTA GAACATGAAAACTTAAATAGAAC 59 PWsp759 DNMT1 TTTG GTCAGGTTGGCTGCTGGGCTGGC 60 PWsp452 HEK2 TTTG ACAGATGGGGCTGGACAATTTTT 61
Choice of Proteins and Targets
[0250] There were many point mutations which showed increased PAM accessibility in the PAMDA in vitro assay. Testing all of the efficacious PAM mutants against endogenous 293T cell targets is effectively impossible given our many point mutations and 256 possible 4 nucleotide (nt) PAMS due to the complexity, cost, and time of the experiment. We, therefore, chose three point mutations to test against a subset of PAMs. The three point mutations tested were T152R, K538W, and K595Y.
[0251] Genomic targets in 293T cells were chosen based on their PAM sequences. Genomic targets for the three point mutations were chosen at random using no particular rules other than having the appropriate 4 nt PAM and selecting 23 nucleotides downstream from that PAM. Three different spacers were chosen to assay each PAM. This is to account for the observation that activities of CRISPR enzymes is target-specific and often cannot be predicted.
[0252] On average, we have observed that about half of 23 nucleotide wtLbCas12a spacers tested are ineffective despite having correct PAM TTTV sequences. With only three data points for each PAM and the observation that about 50% of targets will not produce INDELs, it is more informative to assess PAM recognition by visualizing maximum INDEL percentage per PAM rather than an average for randomly designed spacers (
[0253] Our overall transfection and assay conditions result in wildtype LbCAs12a causing INDELs in HEK293T cells at approximately 11-26% for TTTC, and 10% for TTTA, and 4-10% for TTTG (
[0254] K595Y was able to cause INDELs at ACCG at 25.5%, CCGC at 10.9%, TCGC at 10.1%, CCCG at 9.5%, GCGC at 8.3%, CTGG at 7.8%, ACGG at 6.3%, CCCG at 6.0%, TGGC at 5.3%, and others (
[0255] T152R was able to cause INDELs at CCTC at 11.5%, CCTG at 10.0%, CCCA at 9.6%, GCCA at 8.4%, GCCC at 7.2%, CTGC at 5.1%, and others (
[0256] As shown in
Correlation Between HEK293T INDELs and PAM-SCANR Binding
[0257] A correlation was observed between the maximal INDEL percentages observed and PAM-SCALAR scores for T152R and K595Y (
[0258] Notably, any point mutation with a PAM-SCALAR score over 1.5 tested generated INDELs in 293T cells at rates greater than 5%. This suggests that any of the mutations tested in the PAM-SCANR experiment with a normalized score greater than 1.5 (rather than our stringent 1.67 cutoff) is likely to be able to generate INDELs at rates useful for most eukaryotic applications.
[0259] The foregoing is illustrative of the present invention, and is not to be construed as limiting thereof. The invention is defined by the following claims, with equivalents of the claims to be included therein.