THREE-DIMENSIONAL SELF-ASSEMBLED NUCLEIC ACID NANOPARTICLES AND USE THEREOF

20210128748 ยท 2021-05-06

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to three-dimensional self-assembled nucleic acid nanoparticles, a drug delivery system comprising the same, and a pharmaceutical composition for the prevention or treatment of acute kidney injury, which comprises the same. The three-dimensional self-assembled nucleic acid nanoparticles of the present invention, which have a tetrahedral structure, exhibit an excellent renal-targeting ability, and thus the nanoparticles conjugated with the pharmaceutically active ingredient for p53 exhibit excellent p53 and caspase 3 expression reductions in vitro and in vivo, and can thereby be applied to the prevention or treatment of acute kidney injury.

    Claims

    1. A kidney-specific drug delivery system comprising three-dimensional self-assembled nucleic acid nanoparticles having a tetrahedral structure.

    2. The kidney-specific drug delivery system of claim 1, wherein the nucleic acid nanoparticles consist of one or more oligonucleotides selected from the group consisting of SEQ ID NOs: 1 to 8.

    3. The kidney-specific drug delivery system of claim 2, wherein the oligonucleotide consists of any one selected from the group consisting of D-DNA, L-DNA, 2-fluoro-RNA, and 2-O-methoxy-RNA.

    4. The kidney-specific drug delivery system of claim 3, wherein the oligonucleotide consisting of the nucleotide sequence of SEQ ID NOs: 1 to 4 consists of any one of 2-fluoro-RNA and 2-O-methoxy-RNA.

    5. The kidney-specific drug delivery system of claim 2, wherein a number of the oligonucleotides forming the nucleic acid nanoparticles is four.

    6. The kidney-specific drug delivery system of claim 2, wherein the nucleic acid nanoparticles comprise a double-stranded nucleic acid including a hybridization region in which the oligonucleotide and the oligonucleotide hybridizing thereto are hybridized, wherein the double-stranded nucleic acid forms a side of a surface of a nucleic acid nanoparticle structure.

    7. The kidney-specific drug delivery system of claim 1, wherein the drug delivery system further comprises a pharmaceutically active ingredient.

    8. A pharmaceutical composition, comprising: a kidney-specific drug delivery system comprising three-dimensional self-assembled nucleic acid nanoparticles having a tetrahedral structure; and a pharmaceutically active ingredient bound to the drug delivery system.

    9. The pharmaceutical composition of claim 8, wherein the pharmaceutical composition comprises: an oligonucleotide including D-DNA or L-DNA bound to the 3 end of any one of four oligonucleotides forming the three-dimensional self-assembled nucleic acid nanoparticles of the drug delivery system; an oligonucleotide hybridized to the oligonucleotide to form a double bond; and a pharmaceutically active ingredient bound to the oligonucleotide forming the double bond.

    10. The pharmaceutical composition of claim 8, wherein the pharmaceutically active ingredient inhibits a gene upregulating an apoptosis pathway.

    11. The pharmaceutical composition of claim 10, wherein the gene upregulating an apoptosis pathway is any one or more selected from the group consisting of p53, Fas, a tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), a tumor necrosis factor (TNF), receptors thereof, bcl-2 and caspase.

    12. The pharmaceutical composition of claim 11, wherein the gene is p53.

    13. The pharmaceutical composition of claim 8, wherein the pharmaceutically active ingredient is any one or more selected from the group consisting of siRNA, shRNA, an antisense oligonucleotide, and microRNA.

    14. A method for preventing or treating acute kidney injury, comprising a step of administering to a subject a pharmaceutical composition for preventing or treating acute kidney injury, comprising: a kidney-specific drug delivery system comprising three-dimensional self-assembled nucleic acid nanoparticles having a tetrahedral structure; and a pharmaceutically active ingredient bound to the drug delivery system.

    15. The method of claim 14, wherein the pharmaceutically active ingredient inhibits a gene upregulating an apoptosis pathway.

    16. The method of claim 15, wherein the gene upregulating an apoptosis pathway is any one or more selected from the group consisting of p53, Fas, a tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), a tumor necrosis factor (TNF), receptors thereof, bcl-2 and caspase.

    17. The method of claim 16, wherein the gene is p53.

    18. The method of claim 15, wherein the pharmaceutically active ingredient is any one or more selected from the group consisting of siRNA, shRNA, an antisense oligonucleotide, and microRNA.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0059] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

    [0060] FIG. 1. Melting temperature of D-sTd (300 nM) in TM buffer.

    [0061] FIG. 2. Systemic kidney delivery of sTds. (a) Intravenously injected small tetrahedrons (sTds) are filtered through GBM and Bowman's space to enter tubules where the nanoconstructs taken up into tubular cells. (b) AFM images of sTds with their schematic structures. The insets display representative images of sTds. Scale bars indicate 10 nm. (c) Hydrodynamic sizes of sTds (1 M) in TM buffer measured by dynamic light scattering. (d) sTds were incubated in 50% mouse serum solution and analyzed by agarose gel (1%) electrophoresis. The control (ctrl.) indicates sTds in the absence of serum.

    [0062] FIG. 3. Agarose gel (2%) electrophoresis of sTds (300 nM).

    [0063] FIG. 4. In vivo behavior of sTds. (a) In vivo biodistribution of intravenously injected Cy5.5-sTds (2 M, 200 L) in healthy nude mice. (b) Ex vivo distribution of sTds imaged at 7 h post-injection. Scale bars indicate 40 m. (c) Section images of kidney from mice injected with L-sTd (red) at 7 h post-injection. Nuclei were stained with DAPI (blue). Glomeruli and tubules are indicated with dotted circles and arrows, respectively. (d) Relative distribution levels of sTds in kidney or liver at 7 h and 24 h. (e) Cellular uptake efficiency of L-sTd in mouse kidney tubular epithelial cells (TCMK-1) in the presence of endocytosis inhibitors: chlorpromazine (CPZ, 10 M, clathrin-mediated endocytosis), methyl--cyclodextrin (MbCD, 1 mM, caveolae-mediated endocytosis) or 5-(N-ethyl-N-isopropyl) amiloride (EIPA, 50 M, macropinocytosis). The lowered uptake level at 4 C. indicated endocytosis of L-sTd. Data are represented as meanstandard deviation (SD) (n=3) with statistical significance (***P<0.001; ns, non-significant).

    [0064] FIG. 5. Potency of siP53 delivered by L-sTd. (a) Schematic structure of siP53 loaded in L-sTd (siP53@L-sTd). In vitro potency of siP53 estimated by (b) qRT-PCR analysis of p53 mRNA level and (c) western blotting of p53 in TCMK-1 cells (meanSD, n=3; **P<0.01; ns, non-significant). (d) Kidney distribution level of siP53 and siP53@L-sTd (meanSD, n=3; ns, non-significant). (e) Preparation of AKI mice and treatment schedule to analyze in vivo potency of siP53. In vivo potency of siP53 (0.25 mg/kg per injection) in AKI mice was estimated by (f) qRT-PCR analysis of p53 mRNA level and (g) western blotting of p53 in kidney tissue lysate (meanSD, n=5; ***P<0.001; *P<0.05; ns, non-significant). GAPDH was used as the internal control to determine relative p53 mRNA levels. -Actin was used as the internal control to determine relative p53 protein levels. (h) Immunofluorescence analysis of p53 expression (green) on kidney sections. Nuclei were stained with DAPI (blue). Scale bars indicate 100 m.

    [0065] FIG. 6. Sense (SS) and antisense (AS) sequences of siRNA used. RNA is indicated with blue, and 2-O-Me-RNA is indicated with red. The DNA sequences complementary to the linker are underlined.

    [0066] FIG. 7. L-sTd loaded with siP53 (siP53@L-sTd) was characterized by agarose gel electrophoresis. Mobility of siP53@L-sTd was slightly reduced compared with that of L-sTd and L-sTd with the linker overhang.

    [0067] FIG. 8. Representative image of western blotting of p53 in TCMK-1 cells. The -actin level was used as the internal control to determine the relative p53 level.

    [0068] FIG. 9. Ex vivo imaging of major organs from AKI mice treated with PBS, siP53, and siP53@L-sTd (K, kidney; Lv, liver; Lu, lung; H, heart; S, spleen; B, brain).

    [0069] FIG. 10. Representative image of western blotting of p53 in kidney lysate. The -actin level was used as the internal control to determine the relative p53 level.

    [0070] FIG. 11. (a) Representative image of western blotting of caspase-3 in kidney lysate. (b) Relative caspase-3 levels in kidney lysate estimated by western blotting (meanSD; n=5; ***P<0.001; ns, non-significant). The -actin level was used as the internal control to determine the relative caspase-3 level.

    [0071] FIG. 12. (a) Cellular uptake efficiency of siP53 and siP53@L-sTd in TCMK-1 cells. (b) Mean fluorescence intensity of TCMK-1 cells treated with siP53 and siP53@L-sTd in the presence or in the absence of chloroquine (CQ) (meanSD; n=3; *P<0.05; ***P<0.001; ns, non-significant).

    [0072] FIG. 13. Alleviation of AKI damage by siP53 delivered by L-sTd. (a) Images of kidney sections stained with Cy5-labeled annexin V (red). Nuclei were stained with DAPI (blue). Scale bars indicate 80 m. (b) Images of cortex and medullar regions in kidney sections stained with H&E. Representative glomeruli and tubules are displayed in insets. Red arrows indicate widened Bowman's space in glomeruli. White arrows indicate enlarged tubules. Scale bars indicate 50 m. (c) Relative sizes of glomeruli and tubules estimated in the section images (meanSD; n=16 for glomeruli; n=49 for tubules; *P<0.05; ns, non-significant). (d) Creatine (CRE) and blood urea nitrogen (BUN) levels estimated in blood samples of mice (meanSD; n=4; **P<0.01; ns, non-significant).

    DETAILED DESCRIPTION

    [0073] Hereinafter, the present invention will be described in more detail by way of examples. However, it will be apparent to those of ordinary skill in the art to which the present invention pertains that these examples are for illustrative purposes of the present invention, and the scope of the present invention is not limited by these examples.

    Example 1. Oligonucleotide Synthesis

    [0074] For effective accumulation in the kidney, a DNA tetrahedron with smaller size and higher cellular uptake efficiency is desired. However, the duplex side of the DNA tetrahedron should also have sufficient number of base pairs (bp) for stable assembly of the nanostructure at the physiological temperature (37 C.) while keeping the size of the DNA tetrahedron small enough to be filtered through GBM. Therefore, the tetrahedron was designed with 10 bp per side as the core structure to develop kidney-targeted siRNA carriers, with a sufficiently small size and melting temperature much higher than 37 C. (FIG. 1).

    [0075] Specifically, four small tetrahedrons (sTds) with 10 bp per side were prepared with different sugar backbones such as D-DNA (D-sTd), L-DNA (L-sTd), 2-O-Me-RNA (M-sTd), and 2-FRNA (F-sTd) (Table 1 and FIG. 2b).

    [0076] Sequences of the oligonucleotides used to construct sTds in Table 1. *U was used instead of T for M-sTd and F-sTd. The 2-O-Me-RNA linker used for siP53@L-sTd is indicated with underline.

    TABLE-US-00001 TABLE1 Strand Sequence S1 GGGATCCCGATTCGAGACAGCATTTCTCCCACAC (SEQIDNO:1) S2 CGTGGTAGGTTTTGCTGTCTCGTTAGCGCCGGCC (SEQIDNO:2) S3 TCGGGATCCCTTCACGGGCAACTTGGCCGGCGCT (SEQIDNO:3) S4 ACCTACCACGTTGTTGCCCGTGTTGTGTGGGAGA (SEQIDNO:4) S4- GGUGUAUGAAACCTACCACGTTGTTGCCCGTGTTGTGTGGGA linker GA(SEQIDNO:5)

    [0077] Oligonucleotides used for assembly of sTds were synthesized on a Mermaid 4 DNA synthesizer (Bioautomation, USA) using controlled-pore glass (CPG) resin (Glen Research, USA) at a 1 mol scale. The oligonucleotides were cleaved from CPG and de-protected in concentrated NH.sub.3 (30%) at 55 C. for 16 h. Crude oligonucleotides were purified by denaturing polyacrylamide gel electrophoresis (dPAGE). The oligonucleotides in the excised gel were crushed and incubated in 0.2TBE (30 mL) with gentle shaking overnight. The supernatant containing extracted oligonucleotides was mixed with n-butanol thoroughly and centrifuged (3000 rpm, 3 min). The upper phase (n-butanol phase) was decanted. This extraction step was performed repeatedly until the aqueous phase volume was decreased to approximately 500 L. To the aqueous phase (500 L) were added 3 M sodium acetate (pH 5.2, 50 L) and 2.5 volumes of pure ethanol, and this was then stored at 80 C. for 2 h. The precipitated pellet was collected after 20 min centrifugation at 13,000 rpm. Finally, the pellet was washed with 70% ethanol (200 L), dried, and re-suspended in distilled water. All purified oligonucleotides were quantified by a Genesys 10S UV/Vis Spectrophotometer (ThermoFisher Scientific, USA).

    [0078] The oligonucleotides were characterized by electrospray ionization mass spectrometry (ESI-MS) (Tables 1 and 2).

    TABLE-US-00002 TABLE 2 Sequence Calculated [M H].sup. Observed [M H].sup. D-sTd S1 10946.3 10949.3 S2 10642.8 10643.5 S3 10590.7 10590.0 S4 10659.8 10660.0 L-sTd S1 10946.3 10945.9 S2 10642.8 10643.4 S3 10590.7 10590.7 S4 10659.8 10660.0 M-sTd S1 11869.0 11872.0 S2 11509.3 11510.0 S3 11513.4 11513.8 S4 11540.4 11541.0 F-sTd S1 11461.0 11460.5 S2 11101.3 11099.5 S3 11105.4 11104.7 S4 11132.4 11130.4

    [0079] The self-assembly of the small tetrahedrons constructed using four oligonucleotides (S1-S4, Table 1) of each backbone was verified by agarose gel (2%) electrophoresis, which illustrated gradually retarded mobility of the constructs as the number of oligonucleotide strands increased (FIG. 3).

    Example 2. Preparation of Self-Assembled sTds and Melting Temperature

    [0080] The solution containing four oligonucleotides (S1-S4, 300 nM, Table 1) in TM buffer (5 mM MgCl.sub.2, 10 mM Tris-HCl, pH 8.3) was heated to 95 C. for 10 min and slowly cooled to 4 C. for 24 h. The self-assembled structure was verified on agarose gel (2%) run for 40 min at 100 V in 0.5TAE buffer. The nucleic acid bands in gel were stained by SYBR gold and imaged using the iBright FL1000 imaging system (Invitrogen, USA).

    [0081] Fluorescence intensity of the mixture containing D-sTd (300 nM) and SYBR green (1) in TM buffer was measured at varying temperature from 4 C. to 95 C. by using a real-time PCR machine (StepOne, Applied Biosystems, USA). Melting temperature was determined as the temperature at which (dF/dT) was the highest. F and T denote fluorescence intensity and temperature, respectively.

    [0082] As a result, the melting temperature of the tetrahedron with 10 bp per side as the core structure was much higher than 37 C. (FIG. 1).

    Example 3. Assay of Properties of Nanostructures

    [0083] 3-1. Measurement of Hydrodynamic Size of TDN

    [0084] The hydrodynamic sizes and zeta-potential of tetrahedrons (1 TM buffer) were measured at room temperature using a Zetasizer (Malvern, UK).

    [0085] As a result, the hydrodynamic size of sTds was approximately 6 nm, as measured by dynamic light scattering (DLS) (FIG. 2c).

    [0086] 3-2. Atomic Force Microscopy

    [0087] The structural features of sTds including triangular vertices were also evidenced by the nanoscale images analyzed using atomic force microscopy (AFM). Specifically, the sTds assembled at 50 nM to 100 nM were diluted to 20 nM in TAE-Mg buffer (50 m Tris-acetate, 2 mM EDTA, 12.5 mM MgCl.sub.2) and mixed with an equivalent volume of TAE-Mg including 10 mM NiCl.sub.2. These solutions were placed onto mica pre-treated with TAE-Mg including 5 mM NiCl.sub.2, and incubated at room temperature for 1 min. The samples were imaged in the non-contact mode on an AFM instrument (SCANASYST Multimode, Bruker, USA) using SCANASYST-FLUID+tips (Bruker, USA) in fluid.

    [0088] As a result, the structural features of sTds including triangular vertices were also evidenced by the nanoscale images analyzed using AFM (FIG. 2b).

    Example 4. Assay of Serum Stability of TDN

    [0089] The sTds (2000 nM) were incubated in 50% mouse serum (25 L) at 37 C. for 0 h, 1 h, 2 h, 3 h, 4 h, 5 h, 6 h, and 24 h. The reaction was quenched by 0.5 mM EDTA (2.5 L). Then, the samples were treated with proteinase K (0.8 mg/mL, Bioneer, Korea) for 1 h in 5% SDS (50 L). The mixture (100 L) was with gel loading buffer (100 L, 98% formamide, 0.5 M EDTA) and heated at 95 C. for 10 min. The mixture was analyzed on SYBR gold-containing agarose gel (1%). Gel images were obtained using the iBright FL1000 imaging system (Invitrogen, USA).

    [0090] For pull-down assay of serum proteins bound to sTds, streptavidin-coated magnetic beads (30 L, Dynabeads MyOne Streptavidin T1, Invitrogen, USA) were washed three times in buffer A (60 L, 0.5 mM EDTA, 1 M NaCl, 5 mM Tris-HCl, pH 7.5). After the final wash, the washed beads were resuspended with 50% mouse serum (30 Sigma-Aldrich, USA) and binding buffer (30 L, 1 mM EDTA, 2 M NaCl, 10 mM Tris-HCl, pH 7.5) at 37 C. for 1 h. The proteins non-specifically bound to the magnetic beads were removed. The protein supernatant (60 L) was added to biotinylated sTds (2 M) immobilized on streptavidin-coated magnetic beads, and the mixture was incubated at 37 C. for 1 h. Magnetic beads were separated from unbound serum proteins and washed with buffer A three times. Magnetic beads were resuspended in loading buffer (50 mM Tris-HCl, pH 6.8, 2% SDS, 6% (v/v) glycerol, 2 mM DTT, 0.01% (w/v) Bromophenol Blue) and incubated at 95 C. for 10 min. Proteins bound on sTds-immobilized magnetic beads were analyzed on 5% to 12% SDS-PAGE and silver-stained by EzStain Silver reagent (Atta, Japan) according to the manufacturer's instructions. Gel images were obtained using the iBright FL1000 imaging system (Invitrogen, USA).

    [0091] As a result, when serum stability of sTds was estimated in 50% mouse serum, all of the unnatural backbone-based sTds (L-sTd, M-sTd, F-sTd) showed greatly improved serum stability compared with natural D-sTd, which was significantly degraded after incubation for 2 h in the serum solution (FIG. 2d).

    Example 5. Confirmation of TDN Distribution In Vivo

    [0092] The in vivo biodistribution of the nanostructures was examined. Healthy BALB/c nude mice were intravenously administered Cy5.5-labeled sTds and imaged using the IVIS system. Specifically, the animal study was approved by the animal care and use committee of the Korea Institute of Science and Technology, and all mice were handled in accordance with institutional regulations (2018-082). Male BALB/c nude mice (22 g to 24 g, 6 weeks old) were purchased from Orient Bio (Seoungnam, Korea). The mice were randomly divided into four groups (n=3 per group), and Cy5.5-sTds (2 M, 200 L) was intravenously administered to each. In vivo fluorescence was monitored for 24 h by an animal imaging system (IVIS, Caliper Science, USA). After 24 h, mice were scarified for ex vivo imaging of main organs. The excitation and the emission wavelengths were 660 nm and 710 nm, respectively. The obtained images were analyzed by the IVIS Living Imaging 3.0 software.

    [0093] As a result, only L-sTd was substantially localized to the kidneys, whereas all of the other sTds did not show a considerable level of kidney distribution. The accumulation level of L-sTd in the kidneys was maximized at 7 h post-injection and decreased slowly over the next 17 h (FIG. 4a). Ex vivo images of the major organs harvested 7 h after the injection also displayed significantly high kidney distribution level of L-sTd (FIG. 4b). The accumulation level of L-sTd in the kidneys estimated by fluorescence intensity was 5 times higher than that in the liver, indicating that L-sTd is a kidney-specific nucleic acid nanostructure (FIGS. 4b and 4d).

    Example 6. Histological Analysis of Kidney Tissue Section

    [0094] Kidney tissues harvested from mice were fixed in 4% formaldehyde, paraffin-embedded, cut in 4 m sections, stained with hematoxylin and eosin (H&E), and analyzed by optical microscopy (Eclipse Ti-S, Nikon, Japan). For fluorescent histological inspection, sections were deparaffinized in xylene, re-hydrated with serial treatment of ethanolic solutions (100%, 95%, 75%, and 50%), and washed with washing buffer (1TBST, 0.05% Tween 20, 0.03% Triton X). Antigen retrieval was conducted by treating the sections with citrate buffer (10 mM sodium citrate, 0.05% Tween, pH 6.0) for 20 min. Then, the sections were treated with M.O.M. blocking buffer (Vector Laboratories, USA) for 1 h and 5% BSA/PBST for 5 min. Monoclonal anti-p53 was added to the sections and incubated at 4 C. overnight in a humid chamber. After washing with a washing buffer, the sections were treated with rabbit anti-mouse IgG secondary antibody conjugated with AlexaFluor 488 (1:2000, ThermoFisher Scientific, USA) for 2 h. The sections were rinsed, dried, and then mounted with DAPI solution (Abcam, UK). Finally, the sections were imaged by fluorescence microscopy (Axio Observer 3, Carl Zeiss, Germany).

    [0095] In the histological analysis of the kidney, the fluorescence of L-sTd was observed in tubules (FIG. 4c), suggesting that the nanostructure could successfully penetrate into kidney tissue after glomerular filtration. D-sTd showed a low kidney accumulation level, possibly due to degradation to small fragments subject to renal clearance. Other serum-stable unnatural backbone-based tetrahedrons such as M-sTd and F-sTd also showed a low kidney accumulation level.

    Example 7. Cellular Uptake Mechanisms

    [0096] The uptake mechanism of L-sTd was examined when it was internalized into tubular cells (TCMK-1). TCMK-1 (mouse tubular epithelial cell line) cells were obtained from the Korean cell line bank (Korea). Cells were cultured in RPMI medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin. Cells with 80% to 90% confluency were used for experiments. Cells (110.sup.5 cells) pre-incubated with inhibitors chlorpromazine (CPZ, 10 M), methyl--cyclodextrin (MCD, 1 mM), or ethylisopropylamiloride (EIPA, 50 M) for 30 min were treated with FAM-labeled sTds (200 nM) in serum-free RPMI at 37 C. in a 5% CO.sub.2 incubator. After 6 h, cells were harvested and washed twice with cold PBS (1 mL). Cellular uptake of sTds was estimated by quantifying fluorescent cells by flow cytometry (Guava, Millopore, USA).

    [0097] As a result, uptake of L-sTd was decreased in the presence of 5-(N-ethyl-N-isopropyl)amiloride (EIPA), an inhibitor of macropinocytosis, indicating that L-sTd was endocytosed into tubular cells by macropinocytosis (FIG. 4e).

    [0098] Having investigated the possible mechanisms that drive L-sTd into the kidneys, an attempt was made to use L-sTd as a carrier for the kidney-targeted delivery of siRNA to treat AKI.

    Example 8. siP53@L-sTd Preparation and p53 Knockdown

    [0099] L-sTd loaded with siRNA targeting p53 mRNA (siP53@L-sTd) was prepared by hybridization of 10-mer 2-O-Me-RNA linker with 10-mer D-DNA 3-overhang of the sense strand of siP53 (FIG. 5a, Table 1, and FIG. 6). Specifically, in order to prepare siP53@L-sTd, a single-stranded L-Td having an overhang arm (10-mer) was designed. The 5 end of the sense sequence of siP53 was also extended to 10-mer, and si-p53 was assembled into L-sTd through complementary base pairs (FIG. 6).

    [0100] To ensure in vivo stability of siRNA, 2-O-Me-modified siP53 was employed. Since L-DNA is unable to hybridize with D-DNA, 2-O-Me-RNA, which can form a duplex with D-DNA and has similar serum stability to L-DNA, was used as the linker. The mobility of siP53@L-sTd was slightly lower than L-sTd in agarose gel (FIG. 7).

    [0101] The gene silencing effect of siP53@L-sTd was initially examined in TCMK-1 cells. After treatment of the cells with siP53@L-sTd, the target mRNA level was analyzed using quantitative reverse-transcriptase PCR (qRT-PCR) and the lowered mRNA level downregulated p53 protein expression, as observed by western blotting analysis.

    [0102] For PCR (qRT-PCR), TCMK-1 cells seeded onto a 12-well plate (210.sup.5 cells/well) were treated with siP53@L-sTd (200 nM) in serum-free RPMI at 37 C. in a 5% CO.sub.2 incubator. After 48 h, total RNA was extracted from the cells using a RNeasy Minikit (Quiagen, UK). The reverse transcription was conducted with isolated RNA (2 g) to prepare cDNA using a Reverse Transcription Kit (Enzynomics, Inc.). PCR of p53 cDNA (target gene) and GAPDH cDNA (control gene) was performed using Power SYBR-Green PCR master mix (Invitrogen, USA). The quantitative amplification curve of PCR was monitored by StepOne Real-Time PCR system (Applied Biosystems). The relative p53 mRNA level was obtained by normalization of p53 to GAPDH mRNA level. For estimation of p53 mRNA level in vivo, total RNA was extracted from homogenized kidney tissues and amplified in the same manner. Primer sequences used for qRT-PCR are shown in Table 3.

    TABLE-US-00003 TABLE3 Primer Sequence Mousep53-F ACAGCGTGGTGGTACCTTAT(SEQIDNO:10) Mousep53-R TATACTCAGAGCCGGCCT(SEQIDNO:11) MouseGADPH- TGCACCACCAACTGCTTAG(SEQIDNO:12) F MouseGADPH- GGATGCAGGGATGATGTTC(SEQIDNO:13) R

    [0103] As a result, as shown in FIG. 5b, the mRNA level of the cells treated with siP53@L-sTd was 40% lower than the gene level of the untreated control cells. The gene-silencing effect of siP53@L-sTd was similar to that of siP53 delivered using the conventional transfection agent, lipofectamine, indicating that the target gene can be efficiently downregulated by treatment with siP53@L-sTd. When siRNA with a scrambled sequence was delivered by L-sTd (siSC@L-sTd), no significant change in the gene level was observed, showing that the gene-silencing by siP53@L-sTd is a target-specific event.

    [0104] For western blotting analysis, TCMK-1 cells or homogenized kidney tissues were lysed in RIPA containing protease inhibitors at 4 C. overnight. The mixture was centrifuged at 12,000 rpm for 20 min at 4 C. Proteins (20 g) in the supernatant were separated by 5% to 12% SDS-PAGE and transferred to PVDF membrane (100 min, 350 mA). After blocking with 5% BSA (w/v) in TBST buffer for 1 h at room temperature, the membrane was incubated with solutions containing monoclonal anti-p53 (1:1000), anti-caspase-3 (1:1000), anti-GADPH (1:1,000), and -actin (1:1000) (Cell Signaling Technology, USA) at 4 C. overnight. Then, they were incubated with a horseradish peroxidase (HRP)-conjugated secondary antibody (1:3,000) at room temperature for 1 h. After washing, the protein bands were visualized using Super Signal West Pico Chemiluminescent (Thermo Fisher Scientific, USA) and imaged using the iBright FL1000 imaging system (Invitrogen, USA).

    [0105] As a result, the lowered mRNA level downregulated p53 protein expression, as observed by western blotting analysis (FIGS. 5c and 8).

    Example 9. Preparation of AKI Mouse Model and Treatment with Td-p53

    [0106] It was examined whether the p53 gene silencing can be achieved to suppress the development of AKI in the AKI animal model established with BALB/c mice. Specifically, the AKI animal model was established by single intraperitoneal injection (intraperitoneal administration) of the folic acid solution (350 L, 250 mg/mL in 100 mM NaHCO.sub.3, pH 8.8) into BALB/c mice by following a previously reported procedure (Gupta A, Puri V, Sharma R, Puri S, Exp Toxicol Pathol., 2012, 64 (3), 225-32.). AKI mice were divided randomly in 5 groups (n=5 per group). At 2 h and 24 h after treatment of folic acid, each group of AKI mice was intravenously administered with PBS (200 L), siP53 (2 M, 200 L), L-sTd (2 M, 200 L), siSC@L-sTd (2 M, 200 L), or siP53@L-sTd (2 M, 200 L). The siRNA dose in each group was approximately 0.25 mg/kg per injection (FIG. 3e). After another 24 h, all mice were scarified, and the kidneys were harvested for further ex vivo analysis of the therapeutic effect of siRNA.

    [0107] As a result, the kidney-specific delivery of siRNA was successfully performed by L-sTd (FIGS. 5d and 9). Similarly, naked siRNA (siP53) was also accumulated in the kidneys due to its concise structure and serum stability.

    [0108] The qRT-PCR analysis revealed that the p53 mRNA level in kidney tissue of AKI mice was 9 times higher than that in healthy mice (FIG. 5f). The upregulated gene level in kidney tissue of AKI mice was decreased by 70% after treatment with siP53@L-sTd. The gene-silencing effect by siP53, vehicle alone (L-sTd), or siSC@L-sTd was not significant, demonstrating that only the siRNA with a target-specific sequence delivered by L-sTd could downregulate the target gene in a sequence-specific manner. Consistently, decrease in p53 protein expression was substantially observed by western blotting analysis only in the group treated with siP53@L-sTd (FIGS. 5g and 10). Downregulated p53 expression level by treatment with siP53@L-sTd was also revealed by immunofluorescence analysis of the kidney tissue section (FIG. 5h). In addition, the expression of caspase-3, a downstream factor in p53-driven apoptosis signal cascade, was also lowered by 70% after treatment with siP53@L-sTd, as analyzed by western blotting, whereas no significant decrease in caspase-3 level was observed in the other groups treated with siP53, L-sTd, and siSC@LsTd (FIG. 11).

    [0109] Although naked siP53 was able to reach the kidney, it failed to downregulate the target gene. This was due to low cellular uptake efficiency and unsuccessful endosomal escape of naked siP53. Flow cytometric analysis of TCMK-1 cells treated with fluorescein-labeled siP53 reveals substantially lower uptake level of siP53 than that of siP53@L-sTd (FIG. 12a).

    [0110] As fluorescein is a pH-sensitive dye showing greatly reduced intensity at endosomal pH, endosomal entrapment can also be indicated by the increase of fluorescence intensity of cells after treatment with chloroquine (CQ), which can facilitate endosomal escape. Specifically, for endosomal escape analysis, TCMK-1 cells (110.sup.5 cells) pre-treated with CQ (100 M) were incubated with fluorescein-labeled siP53 or siP53@L-sTd (200 nM) in serum-free RPMI for 6 h. The uptake level was analyzed by flow cytometry and compared with that without CQ pre-incubation.

    [0111] As shown by the results, CQ treatment significantly increased the relative mean fluorescence intensity of siP53-treated cells (FIG. 12b). This shows that the major portion of siP53 internalized in the cells was entrapped in endosomes, and thereby failed to show an activity on the target gene in cytoplasm. By contrast, CQ treatment did not affect the fluorescence intensity of siP53@L-sTd-treated cells (FIG. 12b), suggesting that siP53@L-sTd could escape endosomes, thereby successfully downregulating the target gene in cytoplasm. Sufficient cytosolic delivery of siP53 by L-sTd led to the considerable silencing effect of the siRNA even at a dose 20 times lower than that used in a previous study (Molitoris, B. A. et al. siRNA targeted to p53 attenuates ischemic and cisplatin-induced acute kidney injury. Journal of the American Society of Nephrology 2009, 20 (8), 1754-1764.).

    Example 10. Effect of Inducing Apoptotic Damages

    [0112] To examine whether the lowered p53 level by siP53@L-sTd could alleviate apoptotic damage induced in AKI, the kidney section was visualized after labeling the damaged region with fluorescent annexin V. Specifically, kidney was excised from mice intravenously injected with Cy5.5-labeled L-sTd at 7 h post-injection. A freshly dissected kidney tissue was embedded in optimum cutting temperature (OCT) compound (Leica Biosystems, Germany) and frozen completely at 80 C. The frozen tissue block was sectioned with 4 m thickness by a cryotome (Labcore Inc, Korea).

    [0113] To analyze apoptotic damage in the sections, the deparaffinized sections were treated with Cy5-labeled annexin V (Abcam, UK) and imaged using fluorescence microscopy (Axio Observer 3, Carl Zeiss, Germany).

    [0114] Compared with the healthy mice, AKI mice illustrated a wide region of damaged cells in the kidney section. The damage was significantly alleviated in the siP53@L-sTd-treated group, showing that siRNA treatment could considerably prevent apoptotic damage in AKI. This is consistent with the data observed in western blotting and qRT-PCR of p53. However, siP53, L-sTd, and siSC@L-sTd did not show any potency against the apoptotic damage in kidney tissue.

    [0115] The extent of damage recovery in the cortex and medulla of kidney tissue sections mounted with DAPI solution (Abcam, UK) (FIG. 13a) or stained with hematoxylin and eosin (H&E) (FIG. 13b) was also examined. The integrity of the renal structure in AKI mice was severely damaged resulting in significantly widened Bowman's space of glomeruli (red arrows) in the cortex and dilation (yellow arrows) of tubules in the cortex and medulla. Only treatment with siP53@L-sTd could restore the morphology of renal tubules and glomeruli significantly. The enlarged sizes of glomeruli (10% to 20%) and tubules (30% to 40%) in the AKI model were shrunken to sizes close to the healthy size only after treatment with siP53@L-sTd, while other treatments were not effective in restoring the sizes (FIG. 13c).

    Example 11. Serum Analysis

    [0116] BUN and serum CRE levels were measured in mice which are typical diagnostic indicators for AKI. Specifically, blood samples were collected from mice (n=4 per group) at 48 h after AKI induction, clotted at room temperature for 30 min, and centrifuged at 2,000 g at 4 C. for 15 min. The amounts of creatine and BUN in the supernatant were analyzed by SCL Healthy Inc. (Korea).

    [0117] As a result, the creatinine and BUN levels in AKI mice were significantly decreased only after treatment with siP53@L-sTd (FIG. 13d), which clearly confirms that the p53 siRNA delivered into the kidneys using L-sTd is effective for the recovery of kidney function.

    [0118] From the above description, those skilled in the art to which the present invention pertains will be able to understand that the present invention can be embodied into different and more detailed modes, without departing from the technical spirit or essential features thereof. In this regard, it will be understood that the embodiments described above are only illustrative, and should not be construed as limiting. The scope of the present invention should be construed such that all changes or modifications derived from the meaning and scope of the claims to be described below and equivalent concepts thereof, rather than the above detailed description, are included in the scope of the present invention.