Poxvirus-derived promoter, and vector comprising same

11001860 ยท 2021-05-11

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention provides a poxvirus-derived promoter, a vector comprising the same, a method for expressing a transgene using the promoter, and use of the vector in the prevention or treatment of a disease. A promoter according to the present invention can be used for induction of strong expression of a transgene.

Claims

1. A recombinant nucleic acid molecule consisting of two or three different polynucleotides selected from the group consisting of the polynucleotides of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, wherein the two or three polynucleotides are consecutively linked in 5 to 3 direction in a way that 3-end of an immediate preceding polynucleotide is linked to 5-end of a next polynucleotide.

2. The recombinant nucleic acid molecule according to claim 1, consisting of: the polynucleotide of SEQ ID NO: 1; and one or two polynucleotides selected from the group consisting of the polynucleotides of SEQ ID NO: 2 and SEQ ID NO: 3.

3. The recombinant nucleic acid molecule according to claim 2, wherein the one or two polynucleotides selected from the group consisting of the polynucleotides of SEQ ID NO: 2 and SEQ ID NO: 3 is/are linked to the 3-end of the polynucleotide of SEQ ID NO: 1 in a 5 to 3 direction.

4. A recombinant nucleic acid construct consisting of (a) the recombinant nucleic acid molecule according to claim 2 and (b) a restriction enzyme recognition site at the 5-end and/or 3-end of the recombinant nucleic acid molecule.

5. The recombinant nucleic acid molecule according to claim 1, comprising the nucleotide sequence of SEQ ID NO: 9 or SEQ ID NO: 10.

6. A recombinant nucleic acid construct consisting of (a) the recombinant nucleic acid molecule according to claim 1 and (b) a nucleotide encoding a target protein, so as to induce expression of the target protein-encoding nucleotide sequence in a host cell.

7. The recombinant nucleic acid construct according to claim 6, wherein the host cell is a mammalian cell and the target protein is expressed in cytoplasm of the mammalian cell.

8. A vector comprising the recombinant nucleic acid molecule according to claim 1.

9. The vector according to claim 8, which is a virus.

10. The vector according to claim 9, which is derived from a virus of a poxviridae.

11. The vector according to claim 10, wherein the virus of the poxviridae is selected from the group consisting of the viruses of orthopoxvirus, avipoxvirus, parapoxvirus, capripoxvirus, and suipoxvirus genuses.

12. The vector according to claim 10, wherein the poxvirus is vaccinia virus.

13. A vector comprising the recombinant nucleic acid construct according to claim 6.

14. The vector according to claim 13, wherein the target protein is a tumor antigen, an immune response-inducing factor, a tumor growth-inhibitory factor, an apoptosis-inducing factor, or a factor which can aid in enhancing an activity of a virus in a tumor tissue.

15. A host transformed with a vector comprising the recombinant nucleic acid molecule according to claim 1.

16. The host according to claim 15, which is a microorganism, a mammal, a mammalian cell, or a cell line derived from a mammal.

17. A vector comprising the recombinant nucleic acid molecule according to claim 5.

18. A vector comprising the recombinant nucleic acid construct according to claim 4.

19. A vector comprising the recombinant nucleic acid molecule according to claim 3.

20. A vector comprising the recombinant nucleic acid molecule according to claim 2.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 is a graph showing the comparison of the protein expression levels of luciferase after transfection of a human cervical cancer cell (HeLa cell) with plasmids containing single promoters according to Example 1.

(2) FIG. 2 is a graph showing the comparison of the expression levels of luciferase after transfection of a human cervical cancer cell (HeLa cell) with plasmids containing recombinant promoters, i.e., pGL4.10-pI1 L-E3L, pGL4.10-pI1L-B19R, and pGL4.10-pI1L-I1L according to Example 2.

(3) FIG. 3 shows the size of DNA fragments of pSP72-p7.5-Luc obtained by introducing p7.5 promoter (a control group) into a vaccinia virus TK () shuttle vector, which was treated with the DNA restriction enzymes NheI or BamHI/EcoRI.

(4) FIG. 4 shows the size of DNA fragments of pSP72-pI1L-E3L-Luc obtained by introducing I1L-E3L promoter of Example 3 into a vaccinia viruses TK () shuttle vector, which was treated with restriction enzymes NheI/HindIII at the same time.

(5) FIG. 5 shows the size of DNA fragments of pSP72-pI1 L-B19R-Luc obtained by introducing I1L-B19R promoter of Example 3 into a vaccinia viruses TK () shuttle vector, which was treated with restriction enzymes NheI/HindIII at the same time.

(6) FIG. 6 shows the PCR confirmation of the genomic DNA of vaccinia viruses TK()-p7.5-Luc, TK()-pI1L-E3L-Luc, and TK()-pI1L-B19R-Luc into which a control group promoter or the recombinant promoter obtained in Example 3 is introduced.

(7) FIG. 7 shows the mRNA expression levels of luciferase, GFP and beta actin, confirmed by RT-PCR, of vaccinia viruses TK()-p7.5-Luc, TK()-pI1L-E3L-Luc, and TK()-pI1L-B19R-Luc into which a control group promoter or the recombinant promoter obtained in Example 3 is introduced.

(8) FIG. 8 shows the result of southern blot for confirmation of genomic DNA, of vaccinia viruses TK()-p7.5-Luc, TK()-pI1L-E3L-Luc, and TK()-pI1L-B19R-Luc into which a control group promoter or the recombinant promoter obtained in Example 3 is introduced.

(9) FIG. 9 shows comparative analysis of the luciferase expression levels in a human cervical cancer cell line HeLa or a human colorectal cancer cell line SW620 treated with vaccinia viruses TK()-p7.5-Luc, TK()-pI1L-E3L-Luc, and TK()-pI1L-B19R-Luc into which a control group promoter or the recombinant promoter obtained in Example 3 is introduced.

(10) FIGS. 10a to 10c depict vector map of vaccinia viruses TK()-p7.5-Luc, TK()-pI1L-E3L-Luc, and TK()-pI1L-B19R-Luc constructed by introducing thereinto a control group promoter or the recombinant promoter obtained in Example 3.

BEST MODE FOR CARRYING OUT THE INVENTION

(11) Hereinafter, the present invention is explained in detail by Examples. The following Examples are intended to further illustrate the present invention without limiting its scope.

EXAMPLE 1

Preparation of Promoters

(12) 1-1: Acquisition of Promoter Genes and Construction of Plasmids

(13) Each promoter was obtained through gene synthesis. The nucleotide sequence was as follows, gene synthesis was commissioned to Macrogen, and MM192E from Bioautomation, Inc. was used as a synthesizer. The promoter gene was based on the WR genomic DNA sequence (GenBank: AY243312.1), and the sequences of each promoter are shown in Table 2 below.

(14) TABLE-US-00002 TABLE2 Promoter SEQID Name Sequence(5.fwdarw.3) NO: pI1L TTTGTATTTAAAAGTTGTTTGGTGAACTTAA 1 ATGGCGG pE3L TGAATAAAAAAAATGATAAAATAAATTAGT 2 TTTATTA pB19R TGTGTGTAAAAAAACTGATATTATATAAATA 3 TTTTAGTGCCGTATAA pF11L GGTAAAATTATATAAAAAGTGAAAAACAAT 4 ATTATTTTTATCGTTGGTTGTTT pC11R AATTAACAATATATTATAGTTTATATTACTG 5 AATTAATAATATAAAATTCCCA p7.5 TCCAAACCCACCCGCTTTTTATAGTAAGTTT 6 TTCACCCATAAATAATAAATACAATAATTAA TTTCTCGTAAAAGTAGAAAATATATTCTAAT TTATTGCACGG pE/L AAAATTGAAATTTTATTTTTTTTTTTTGGAAT 7 ATAAATAGCTAGCTCGAG p11 ATATAGTAGAATTTCATTTTGTTTTTTTCTAT 8 GCTATAAAT

(15) For the plasmid construction, KpnI and XhoI sequences were added to the ends of the pE/L and pI1L promoter sequences, and NheI and HindIII sequences were added to the ends of the other promoter sequences. Each of the pE/L and pI1L promoter genes was inserted into pGL4.10 [luc2] vector (Promega, USA) digested with KpnI and XhoI, and plasmids pGL4.10-pE/L and pGL4.10-pI1L were obtained.

(16) The p7.5, p11, pE3L, pC11R, pF11L and pB19R promoter genes were inserted into pGL4.10 [luc2] vectors digested with NheI and HindIII, respectively, and the plasmids pGL4.10-p7.5, pGL4.10-p11, pGL4.10-pE3L, pGL4.10-pC11R, pGL4.10-pF11L and pGL4.10-pB19R were generated.

(17) 1-2: Evaluation of Activity of Single Promoter

(18) The amount of luciferase protein expressed in each of the eight kinds of plasmids generated in Example 1-1 was measured to evaluate the promoter activity. Plasmids comprising pI1L, pE3L, pC11R, pF11L, and pB19R promoters, and plasmids containing known p7.5, pE/L and p11 promoters as a control group were used.

(19) In order to examine the promoter activity of the plasmids, HeLa cells were transfected with plasmids, each of which contains one of the eight kinds of promoters prepared in Example 1-1, and then the amounts of expression of luciferase were determined. HeLa cells were cultured in a MEM medium supplemented with 10% fetal bovine serum and inoculated on a 24 well culture plate at 610.sup.4 cells/well. The next day, the cells were infected with vaccinia virus, and after 6 hours, the virus-infected cells were transfected with plasmids into which the virus promoter had been introduced using a transfection solution. After 24 hours, the media were removed, and a portion of the cell lysate obtained by treating the cells with cell lysis solution was transferred to a 96-well culture plate for luciferase measurement, and luciferin, which is a substrate of luciferase enzyme, was treated. The amount of light generated by substrate degradation was measured using a luciferase analyzer, and the measured results for each promoter are shown in FIG. 1. FIG. 1 shows the comparison of the expression levels of luciferase after transfection of HeLa cells, which are human cervical cancer cell lines, with plasmids containing respective promoters. p7.5, pE/L, and p11 are the promoters previously used as control groups, and pE3L, pC11R, pF11L, pB19R and pI1L are candidate promoters used in experimental groups.

(20) As shown in FIG. 1, the expression level of the gene by the plasmid into which pI1L was introduced was about three times higher as compared with the control plasmid in which p7.5, pE/L or p11 promoter was introduced, and the amount of gene expression by the plasmid into which pE3L or pB19R was introduced was similar to that of the control group.

(21) 1-3: Acquisition of Recombinant Promoter Genes

(22) In order to increase the activity of the promoter, recombinant promoters were generated by combining the I1L promoter, which exhibited the highest activity as a single promoter in Example 1-2, with the E3L or B19R promoter, which showed a relatively high activity. Each promoter was synthesized in the same manner as in Example 1-1, and the nucleotide sequence thereof was as follows.

(23) TABLE-US-00003 TABLE3 Promoter SEQID Name Sequence(5.fwdarw.3) NO: pI1L- TTTGTATTTAAAAGTTGTTTGGTGAACTTAAATGGCGGTG 9 E3L AATAAAAAAAATGATAAAATAAATTAGTTTTATTA pI1L- TTTGTATTTAAAAGTTGTTTGGTGAACTTAAATGGCGGTG 10 B19R TGTGTAAAAAAACTGATATTATATAAATATTTTAGTGCCG TATAA pI1L-I1L TTTGTATTTAAAAGTTGTTTGGTGAACTTAAATGGCGGTT 11 TGTATTTAAAAGTTGTTTGGTGAACTTAAATGGCGG

(24) For the plasmid construction, NheI and HindIII sequences were added to the ends of each recombinant promoter sequence.

(25) The recombinant promoter genes pI1L-E3L, pI1L-B19R and pI1L-I1L were inserted into the pGL4.10 [luc2] vector digested with NheI and HindIII to generate plasmids pGL4.10-pI1L-E3L, pGL4.10-pI1L-B19R, and pGL4.10-pI1L-I1L.

EXAMPLE 2

Evaluation of Promoter Activity

(26) The amount of luciferase protein expressed in the three kinds of plasmids generated in Example 1-3 was measured to evaluate the promoter activity.

(27) Specifically, in order to examine the promoter activity of the plasmids, the expression levels of luciferase were measured after transfection of HeLa cells with the plasmids. HeLa cells cultured in MEM medium supplemented with 10% fetal bovine serum were inoculated in a 24-well culture plate at 610.sup.4 cells per well. The next day, the cells were infected with vaccinia virus, and after 6 hours, plasmids into which the Vaccinia virus promoter was introduced were treated with virus-infected cells using a transfection solution. After 2 hours, the medium around the cells was removed, and a portion of the cell lysate obtained by treating the cell lysate was transferred to a 96-well culture plate for luciferase measurement, and luciferin, which is a substrate of luciferase enzyme, was treated. The amount of light generated by substrate degradation was measured using a luciferase analyzer, and the measured results for each promoter are shown in FIG. 2 and Table 4. FIG. 2 shows the comparison of the activities of recombinant promoters produced by combining pE3L or pB19R, which has a relatively high activity, with pI1L, which exhibited the highest activity in Example 1.

(28) As shown in FIG. 2, the plasmid in which the recombinant promoter pI1L-E3L or pI1L-B19R was introduced showed a gene expression amount about 6 times higher than that of the plasmid in which the p7.5 promoter was introduced as a control group, and showed a gene expression amount about 2.4 times higher than that of the plasmid in which the pI1L single promoter was introduced. In addition, the pI1L-I1L plasmid prepared by combining two copies of the pI1L promoter having a high promoter activity showed the expression level increased by about 1.5 times as compared with the plasmid in which the pI1L single promoter was introduced.

(29) TABLE-US-00004 TABLE 4 Promoter Luciferase activity (unit: RLU/mg) Vector 10,946 p7.5 1,747,383 pI1L 5,337,647 pI1L-E3L 11,834,807 pI1L-B19R 12,274,591 pI1L-pI1L 8,661,349

(30) In case of pI1L-I1L obtained by combining two copies of pI1L having the highest activity in Example 1-2, the activity of luciferase was U.S. Pat. No. 8,661,349, which is increased by less than twice as compared with pI1L. However, when pI1L was combined with E3L or B19R, the activity was increased by more than twice. As shown in the results of FIG. 1, the activity of p7.5 was the highest among the existing promoters, but it was confirmed from FIG. 2 that the activities of all promoters used in the experiment were higher than that of p7.5.

EXAMPLE 3

Promoter-Introduced Viral Vector

(31) 3-1: Shuttle Vector Construction for Viral Vector

(32) In order to examine whether the result of the activity evaluation of the promoter measured using the plasmid into which the recombinant promoter was introduced can be applied to viruses in the same way, the viral promoter according to the present invention and reporter gene luciferase were introduced together into the virus shuttle vector pSP72-TK() in which TK gene was removed.

(33) pGL4.10-p7.5 used as a control group in Example 1-1 and pGL4.10-pI1L-E3L and pGL4.10-pI1L-B19R obtained in Example 1-3 were cut by NheI and XbaI, and promoters and luciferase genes were obtained. The genes thus obtained were inserted into pSP72-TK() shuttle vectors cut by NheI and XbaI, and pSP72-TK()-p7.5-Luc, pSP72-TK()-pI1L-E3L-Luc, and pSP72-TK()-pI1L-B19R-Luc were finally obtained.

(34) 3-2: Generation of Recombinant Vaccinia Virus

(35) The recombinant shuttle vector prepared in Example 3-1 along with wild-type vaccinia virus was introduced into the cells to prepare a recombinant virus. Recombinant vaccinia virus was prepared by inserting into the TK gene position of vaccinia virus by homologous recombination.

(36) Specifically, HeLa cells cultured in MEM medium supplemented with 10% fetal bovine serum were inoculated in a 6-well culture plate at 310.sup.5 cells/well. The next day, the vaccinia virus shuttle vectors pSP72-TK()-p7.5-Luc, pSP72-TK()-pI1L-E3L-Luc, and pSP72-TK()-pI1L-B19R-Luc were treated with a transfection solution and vaccinia viruses were infected at 0.05 MOI, and 4 hours later, the culture medium was replaced with MEM medium supplemented with 5% fetal bovine serum, and then cultured for 48 hours. The cultured cells were removed from the medium, and frozen and thawed three times to obtain crude viruses, which were then subjected to a plaque isolation method three times to obtain a clone of pure recombinant viruses.

(37) The virus thus obtained was measured for the potency in Vero cells using the TCID50 method, and the structure was confirmed by RT-PCR, genomic DNA PCR, sequencing and southern blot, and then used for an experiment. As a result, TK()-p7.5-Luc (FIG. 10a), TK()-pI1L-E3L-Luc (FIG. 10b), TK()-pI1L-B19R-Luc (FIG. 10c), which are the recombinant vaccinia viruses into which each promoter and luciferase were introduced, were finally obtained.

(38) 3-3: Measurement of Virus Potency

(39) The concentration of infectious viruses is referred to by the diluted concentration of the viruses infecting 50% of the cultured host cells, i.e., 50% tissue culture infectious dose (TCID50). The potency of the viruses was measured using TCID50 methods, and the characteristics of the recombinant viruses were analyzed.

(40) Specifically, Vero cells were cultured in a 96-well plate at 510.sup.3 cells/well, and the viruses were respectively diluted at 1/10, 1/10.sup.2, 1/10.sup.3, 1/10.sup.4, 1/10.sup.5, 1/10.sup.6, 1/10.sup.7, and 1/10.sup.8 and then infected into each well. After 4 days, the number of wells in which the CPE (cytopathic effect) appeared was counted and the titer was calculated. The results of virus titration are shown in Table 5.

(41) TABLE-US-00005 TABLE 5 Virus Titer (TCID.sub.50/ml) TK()-p7.5-Luc 6.9 10.sup.7 TK()-pI1L-E3L-Luc 9.4 10.sup.7 TK()-pI1L-B19R-Luc 8.7 10.sup.7

(42) As shown in Table 5, all of the three recombinant viruses exhibited similar titers, indicating that they had similar productivity.

(43) 3-4: Analysis of the Structure of Recombinant Virus

(44) To perform genomic DNA PCR, the genomic DNA of the virus was extracted and the size of the transgene inserted instead of the TK gene was confirmed by PCR. Recombination was confirmed by comparison with wild-type virus IHD-W.

(45) The results are shown in FIG. 6. As shown in FIG. 6, it was confirmed that, in case of the wild type virus, the 966 bp fragment was amplified by the PCR, and in case of the recombinant virus, the length of the fragment amplified by gene introduction increased to 3.13.2 Kb, indicating that there was no abnormality in the DNA structure.

(46) HeLa cells were cultured in 6-well culture dishes at 310.sup.5 cells/well in order to perform RT-PCR of viral RNA, and the recombinant viruses that had been subjected to the above titer measurement were cultured for 48 hours after 0.05 MOI treatment. Then the cells were lysed by trizol treatment and RNA was extracted and cDNA was synthesized in vitro. The structure of the transgene was analyzed by PCR using the DNA as a template, and the recombination was confirmed. FIG. 7 indicates that mRNA of luciferase and EGFP were well expressed in all of the three kinds of recombinant viruses unlike the wild type virus into which no exogenous gene was introduced.

(47) To perform the southern blot, HeLa cells were cultured in a 75T culture dish at 210.sup.6 cells/well and the recombinant viruses that had been subjected to the above titer measurement were cultured for 72 hours after 0.05 MOI treatment. After the cell culture medium was removed, the cells were frozen and thawed three times to obtain the virus. The genomic DNA of the virus was extracted and cut with a Hind III restriction enzyme, and the bands were separated from 0.8% agarose, transferred to a nylon membrane, fixed at 120 C., and hybridized with a DIG-labeling probe. After contacting with the final substrate following washing and blocking processes, selective DNA bands were identified. The results of southern blot analysis are shown in FIG. 8.

(48) As shown in FIG. 8, in case of the wild type virus, the probe was bound to the DNA fragment of 5005 bp, but in case of the recombinant virus, the probe was bound to the DNA fragment reduced to 1337 bp by gene introduction. Thus, it was found that there was no abnormality in the DNA structure of the site where the transgene was introduced. The site where the probe binds is indicated by a blue arrow.

EXAMPLE 4

Evaluation of Protein Expression Level by Recombinant Virus

(49) The recombinant vaccinia viruses TK()-p7.5-Luc, TK()-pI1L-E3L-Luc, TK()-pI1L-B19R-Luc constructed in Example 3-2 were infected to human cervical cancer cell line HeLa or human colon cancer cell line SW620, and the expression levels of luciferase regulated by respective promoters were analyzed.

(50) Specifically, HeLa cells or SW620 cells cultured in MEM medium supplemented with 10% fetal bovine serum were inoculated in a 12-well culture plate at 210.sup.5 cells/well. The following day, they were infected with each of the recombinant viruses (wild-type WT, p7.5, I1L-E3L, and I1L-B19R) at 1 MOI. After 6 hours, the culture medium surrounding the cells was removed and cell lysis solution was added. A portion of the cell lysates was transferred to a 96-well culture plate for luciferase measurement, and treated with luciferin, which is a substrate of luciferase enzyme. The amount of light generated by substrate degradation was measured using a luciferase analyzer, and the results are shown in FIG. 9. FIG. 9 shows the results of analysis of the expression levels of luciferase after the human cervical cancer cell line HeLa or human colon cancer cell line SW620 were infected with the recombinant vaccinia viruses TK()-p7.5-Luc, TK()-pI1L-E3L-Luc, and TK()-pI1L-B19R-Luc.

(51) As shown in FIG. 9, the luciferase expression levels by the recombinant virus containing pI1L-B19R promoter in both HeLa and SW620 were about twice as high as that of the control virus containing p7.5 promoter.