TWO-PART MEDIATOR PROBE

Abstract

The present invention concerns a mediator probe for the detection of at least one target molecule comprising at least two oligonucleotides. A first oligonucleotide of the mediator probe according to the invention comprises a probe region and a mediator binding region, wherein the probe region has an affinity to a target molecule and/or template molecule, and the mediator binding region has an affinity to at least one mediator. At least one further oligonucleotide of the mediator probe is a mediator which is bound to the first oligonucleotide of the mediator probe via the mediator binding region and has an affinity for at least one detection molecule, wherein the mediator triggers a detectable signal by interaction with the detection molecule after release from the first oligonucleotide of the mediator probe. Furthermore, the present invention concerns a system comprising at least one mediator probe according to the invention and at least one detection molecule, as well as a method for the detection of at least one target molecule.

Claims

1-18. (canceled)

19. A system comprising at least one mediator probe for the detection of at least one target molecule, the system comprising: a first oligonucleotide comprising a probe region and a mediator binding region, wherein the probe region has an affinity to a target molecule and/or template molecule, and wherein the mediator binding region has an affinity for at least one mediator; a second oligonucleotide, wherein the second oligonucleotide is a mediator that is bound via the mediator binding region to the first oligonucleotide of the mediator probe and that comprises an affinity for at least one detection molecule, wherein the mediator triggers a detectable signal after release from the first oligonucleotide of the mediator probe by interaction with the detection molecule; and at least one detection molecule, wherein the at least one detection molecule comprises one or more oligonucleotides and comprises at least one first region that interacts with at least one mediator and one or more of (i) a second region comprising a fluorescence acceptor or a fluorescence donor and/or a chemical group for binding to a solid phase and/or a chemical protecting group and/or redox modifications and/or luminescence modifications, or (ii) a third region comprising a fluorescence donor or a fluorescence acceptor and/or a chemical group for binding to a solid phase and/or a chemical protecting group and/or redox modifications and/or luminescence modifications, or (iii) at least one fourth region which interacts with at least one first probe which has a fluorescence donor and/or a fluorescence acceptor, or (iv) at least one fifth region interacting with at least one second probe comprising a fluorescence donor and/or a fluorescence acceptor.

20. The system of claim 19, wherein the first oligonucleotide of the mediator probe and/or of the mediator does not comprise a marker for signal generation.

21. The system of claim 19, wherein the first oligonucleotide of the mediator probe and/or the mediator contains one or more markers for signal generation.

22. The system of claim 21, wherein the marker for signal generation comprises a fluorescent molecule.

23. The system of claim 21, wherein the marker for signal generation comprises a redox molecule.

24. The system of claim 21, wherein the marker for signal generation comprises a luminescent molecule.

25. The system of claim 19, wherein the detection molecule comprises a hairpin structure.

Description

SPECIAL DESCRIPTION OF THE INVENTION

[0181] In the following, the invention will be explained by means of figures and examples of execution, but without being limited to this. Show it:

[0182] FIG. 1: Schematic representation of the structure of a mediator probe in an embodiment of the invention.

[0183] FIG. 2: Schematic sequence of a mediator displacement during an amplification process in the presence of a beach displacement polymerase.

[0184] FIG. 3: Schematic representation of a possible detection molecule.

[0185] FIG. 4: Schematic representation of the enzymatic mediator extension.

[0186] FIG. 5: Arrangement possibilities when using several mediators and/or several mediator probes and/or several detection molecules per target molecule.

[0187] FIG. 6: Structure of a detection molecule with the structure of a molecular beacon.

[0188] FIG. 7: Linear or circular detection molecule with fluorescence donor and fluorescence acceptor labeled hybridized probes.

[0189] FIG. 8: Electrochemical detection on a solid phase.

[0190] FIG. 9: Schematic sequence of a mediator displacement during an amplification process in the presence of a beach displacement polymerase.

[0191] FIG. 10: Mechanism of a mediator release and subsequent signal generation during a LAMP.

[0192] FIG. 11: Normalized fluorescence plot of a LAMP for the detection of E. coli (W3110, complete genome) using mediator probes and detection molecules according to the invention.

[0193] FIG. 12: Normalized fluorescence plot of an RT-LAMP for the detection of HIV-1 RNA using invention mediator probes and detection molecules.

[0194] FIG. 13: Structure of a mediator probe which does not function as a primer.

[0195] FIG. 14: Detection method for the detection of target molecules by target molecule-specific aptamers.

[0196] FIG. 15: Invented detection method for the detection of target molecules by mediator probes which additionally contain aptamer region and primer binder region.

[0197] FIG. 16: Invented detection method for the detection of target molecules by mediator probes which act as primers and enable an exponential detection reaction.

[0198] FIG. 17: Immobilization of a detection molecule on a solid phase.

[0199] FIG. 18: Immobilization of a labeled detection molecule on an electrode.

[0200] FIG. 19: Detection molecule consists of two labeled, hybridized oligonucleotides.

[0201] FIGS. 20-24: Electrochemical detection on a solid phase.

[0202] FIG. 25: Detection molecule consists of several oligonucleotides.

[0203] FIG. 26: Normalized fluorescence plot of a LAMP for the detection of H. ducreyi.

[0204] FIG. 27: Normalized fluorescence plot of a LAMP for the detection of T. pallidum.

[0205] FIG. 28: Normalized fluorescence plot of an RT-LAMP for detection of HTLV-1.

[0206] FIG. 29: Normalized fluorescence plot of an RT-LAMP for the detection of TMV.

[0207] FIG. 30: Normalized fluorescence plot of a PCDR for the detection of 100 pg G3PDH fragment.

[0208] FIG. 31: Binding of the mediator to a magnetic or magnetizable nanoparticle.

[0209] FIG. 32: Proof of electrochemical detection of electroactively labeled mediators.

[0210] FIG. 1 shows a schematic representation of a possible structure of a mediator probe, which is a preferred version of the invention.

[0211] FIG. 2 shows the schematic sequence of mediator displacement during amplification in the presence of a strand displacement polymerase from a mediator probe acting as a primer in DNA amplification.

[0212] FIG. 3 (A) shows the linear representation of a possible detection molecule. (B) Representation of a 3-immobilized detection molecule under formation of the secondary structure. The reverse-complementary sequence segments, whose interaction produces the secondary structure of the detection molecule, are shown as black regions, the mediator binding sequence as diagonally striped region.

[0213] FIG. 4 shows the schematic representation of an enzymatic mediator extension. i) A detection molecule is free in solution or immobilized on a solid phase and assumes a defined secondary structure under reaction conditions. Two suitable fluorescence modifications F and Q interact with each other, whereby the fluorescence signal of F is suppressed. ii) The mediator can interact with the detection molecule at a defined position (mediator binding region, Region 5) iii)-iv) and is thereby enzymatically extended by a strand displacement polymerase. Region 1 together with the fluorescence acceptor molecule Q is displaced by the detection molecule, thereby restoring the fluorescence intensity of the fluorescence donor F. vi) After displacement of region 1, the mediator can be further extended.

[0214] FIG. 5 (A-C) shows several possible arrangements when using several mediators and/or several mediator probes and/or several detection molecules per target molecule. (A) increasing the number of detectable target molecules using multiple mediators per mediator probe or multiple mediator probes per target molecule. The maximum number of detectable target molecules as a function of the number of detection molecules when using several mediators per target molecule can be calculated using the binomial coefficient and the number of detection molecules. (B) Increasing the number of detectable target molecules using detection molecules with multiple mediator binding regions. (C) Increasing the specificity of a detection reaction using multiple mediators per target molecule and exploiting the interaction between the mediators. The release of both mediators allows them to interact in a way with each other and simultaneously with the detection molecule, prolonging one of the mediators and triggering a detection reaction. The interaction of a single mediator does not lead to a detection reaction.

[0215] FIG. 6 shows the structure of a detection molecule corresponding to the structure of a molecular beacon. Fluorescence acceptor and fluorescence donor are attached at the 5 and 3 ends and the mediator binding region is located in the loop.

[0216] FIG. 7 shows a linear or circular detection molecule to which fluorescence donor and fluorescence acceptor labeled probes are hybridized. By hybridizing the mediator to the detection molecule and extension, the labeled probes are released and a signal change can be detected. In order to prevent released probes labeled with fluorescence donor or fluorescence acceptor from re binding to the detection molecule, binding molecules can be used to which the labeled probes can bind after release.

[0217] FIG. 8 shows a version of the invention in which electrochemical detection is used on a solid phase. The detection molecules are immobilized on an electrode. After hybridization and extension of the mediator at the detection molecule, redox molecules present in the solution can intercalate into the dimer of the detection molecule and the extended mediator, whereby a change in the electrochemical signal can be detected.

[0218] FIG. 9 shows the schematic sequence of mediator displacement during amplification in the presence of a strand displacement polymerase from a mediator probe acting as a primer in DNA amplification. The mediator and the detection molecule are each labeled with a fluorescent dye, which enables an increase in fluorescence intensity at one wavelength to be detected if the mediator is hybridized with the detection molecule by FRET energy transfer. When using detection molecules with different numbers of nucleotides, a melting curve analysis can be used to differentiate between different target molecules.

[0219] FIG. 10 shows the mechanism of a mediator release and subsequent signal generation during a LAMP. The mediator binding region at the detection molecule and in the mediator probe is abbreviated with Medc (corresponds to the sequence complementary to the mediator). In this version of the present invention, the mediator probe simultaneously serves as a loop primer; accordingly, the mediator probe consists of a loop primer extended by Medc (Loop_Medc) and a mediator hybridized to it (Med). After the initial LAMP steps, a dumbbell-like amplification product is formed to which the mediator probe can bind. By extending the mediator probe and reconnecting a primer to it, the mediator is displaced by the beach displacement polymerase. The released mediator can then generate a detectable signal by interacting with a detection molecule.

[0220] FIG. 11 shows a standardized fluorescence plot of a LAMP for the detection of E. coli DNA (W3110, complete genome) using mediator probes and detection molecules according to the invention. The plot shows a correlation between the amount of DNA and the fluorescence course. The fluorescence intensities were standardized to the initial value at 0 min. The number of DNA copies is expressed in copies per reaction (e.g. 10 cp corresponds to 10 copies per reaction with a total volume of 10 l). The negative control contains 0 copies per reaction (NTC, no template control).

[0221] FIG. 12 shows the standardized fluorescence plot of an RT-LAMP for the detection of HIV-1 RNA using mediator probes and detection molecules according to the invention. The fluorescence intensities were standardized to the initial value at 0 min. The number of RNA copies is given in copies per reaction (3,400 cp corresponds to 3,400 copies per reaction with a total volume of 10 l). The negative control contains 0 copies per reaction (NTC, no template control).

[0222] FIG. 13 shows a design of a mediator probe which does not serve as a starting point for amplification.

[0223] FIG. 14 shows a detection according to the invention method for the detection of target molecules by target molecule-specific aptamers.

[0224] FIG. 15 shows a detection according to the invention method for the detection of target molecules by mediator probes which additionally contain aptamer region and primer binder region. In the absence of the target molecule, the mediator probe is amplified, while in the presence of the target molecule, the extension of the primer is blocked by the bound target molecule. Consequently, no detectable signal is triggered in the presence of the target molecule and a detectable signal is generated in the absence of the target molecule.

[0225] FIG. 16 shows a detection method according to invention for the detection of target molecules by mediator probes, which act as primers and enable an exponential detection reaction. In the absence of the target molecule, the linear aptamer is amplified and the mediator is released during amplification, while in the presence of the target molecule, the extension of the primer is blocked by the bound target molecule. Consequently, no detectable signal is triggered in the presence of the target molecule and a detectable signal is generated in the absence of the target molecule.

[0226] FIG. 17 shows a design of the detection method according to the invention, in which the detection molecules are immobilized in a suitable reaction vessel on a solid phase.

[0227] FIG. 18 shows a version of the detection according to the invention method in which the detection molecules are immobilized on an electrode. Through hybridization and extension of the mediator at the detection molecule, the redox molecule bound to the detection molecule is spatially separated from the electrode surface, generating a change in the signal. Schemes a and b schematize possible binding sites of the mediator in two different regions of the detection molecule.

[0228] FIG. 19 shows a detection molecule consisting of two labeled, hybridized oligonucleotides. Fluorescence acceptor and fluorescence donor are attached at the 5 and 3 ends, respectively; in addition, one of the two oligonucleotides has a mediator binding region.

[0229] FIG. 20 shows a possibility of electrochemical detection on a solid phase. The detection molecules are immobilized on an electrode. After hybridization of the mediator at the detection molecule, redox molecules present in the solution can intercalate into the dimer of detection molecule and mediator, whereby a change in the electrochemical signal can be detected.

[0230] FIG. 21 shows electrochemical detection on a solid phase using a marked mediator. The detection molecules are immobilized on an electrode. By hybridizing the labeled mediator to the detection molecule, a change in the electrochemical signal can be detected.

[0231] FIG. 22 shows the electrochemical detection on a solid phase. The detection molecules are immobilized on an electrode. By hybridization and extension of the labeled mediator on the detection molecule, a change in the electrochemical signal can be detected.

[0232] FIG. 23 shows a possibility of electrochemical detection on a solid phase. The detection molecules are immobilized on an electrode. By hybridization and extension of the labeled mediator on the detection molecule, a change in the electrochemical signal can be detected. The electrical charge transport between the redox molecule and the electrode is caused by the formation of a double strand.

[0233] FIG. 24 shows electrochemical detection on a solid phase. The detection molecules are immobilized on an electrode. By hybridization and extension of the mediator on the labeled detection molecule, a change in the electrochemical signal can be detected. The electrical charge transport between the redox molecule and the electrode is caused by the formation of a double strand.

[0234] FIG. 25: The detection molecule consists of several oligonucleotides in which an unlabeled oligonucleotide is hybridized with shorter fluorescence-labeled oligonucleotides. Fluorescence acceptors and/or fluorescence donors are attached to the shorter oligonucleotides. These are arranged in such a way that the fluorophore and quencher are spatially close to each other. The released mediator has a higher binding energy to the unlabeled detection molecule and thus displaces, for example, the shorter oligonucleotide labeled with the quencher.

[0235] FIG. 26 shows a standardized fluorescence plot of a LAMP for the detection of Haemophilus ducreyi (H. ducreyi) using mediator probes and detection molecules according to the invention. The fluorescence intensities were standardized to the initial value at 0 min. The negative control (NTC, no template control) does not contain H. ducreyi DNA, the positive control was mixed with purified H. ducreyi DNA.

[0236] FIG. 27 shows a standardized fluorescence plot of a LAMP for the detection of Treponema pallidum (T. pallidum) using mediator probe according to the inventions and detection molecules. The fluorescence intensities were standardized to the initial value at 0 min. The negative control (NTC, no template control) does not contain T. pallidum DNA, the positive control was mixed with purified T. pallidum DNA.

[0237] FIG. 28 shows a standardized fluorescence plot of an RT-LAMP for the detection of HTLV-1 using mediator probe according to the inventions and detection molecules. The fluorescence intensities were standardized to the initial value at 0 min. The negative control (NTC, no template control) does not contain HTLV-1 RNA, the positive control was mixed with purified HTLV-1 RNA.

[0238] FIG. 29 shows a standardized fluorescence plot of an RT-LAMP for the detection of TMV using mediator probe according to the inventions and detection molecules. The fluorescence intensities were standardized to the initial value at 0 min. The negative control (NTC, no template control) does not contain TMV RNA, the positive control was mixed with purified TMV RNA.

[0239] FIG. 30 shows a standardized fluorescence plot of a PCDR for the detection of 100 pg mice G3PDH DNA using mediator probe according to the inventions and detection molecules. The fluorescence intensities were normalized to the initial value at 0 cycles.

[0240] FIG. 31 shows a mediator bonded to a magnetic or magnetizable nanoparticle. After release in the presence of the target molecule, the mediator can bind to the detection molecule, detecting a change in the magnetic property on the surface of the solid phase.

[0241] FIG. 32 shows a functional demonstration of the electrochemical detection of electroactively labeled mediators. In the positive control (60,000 copies of E. coli DNA), the mediators are displaced during the LAMP reaction and can then hybridize to the detection molecule. Accordingly, the marked (here methylene blue) mediator accumulates on the electrode surface, which leads to the formation of a characteristic peak at 0.39 V in electrochemical analysis (here square wave voltammetry). In contrast, the absence of a peak at the NTC indicates that no significant release of mediators has occurred.

DESIGN EXAMPLES

[0242] In the following explanations, several mediators can bind to a special primer or first oligonucleotide of the mediator probe according to the invention and/or several different primers and/or mediator probes can be provided with mediators in order to increase the mediator concentration in the sample.

Example 1: Mediator Probe

[0243] Invention design examples include a mediator probe for detecting at least one target molecule, wherein the mediator probe comprises at least two oligonucleotides. A first oligonucleotide has a mediator binding region and a probe region. The mediator binding region is located at the 5 terminus and the probe region at the 3 terminus of the oligonucleotide. A second or several further oligonucleotides, the mediator or mediators, are chemically, biologically and/or physically bound to the mediator binding region of the first oligonucleotide. A mediator can be composed of DNA, RNA, PNA or modified RNA, such as LNA. The probe region of the first oligonucleotide has an affinity to the target and/or template molecule and the mediator binding region has an affinity to the mediator or mediators (FIG. 1). The mediator or mediators have an affinity for at least one detection molecule.

Example 2: Procedure of Mediator Displacement

[0244] After binding of the probe region to a target molecule and/or template molecule, the mediator is displaced by the mediator binding region, for example using a beach displacement polymerase. This process can take place during an amplification process of the target molecule and/or template molecule. In the examples of the invention, the probe region of the mediator probe can act as a primer in DNA amplification. After binding the probe region to a target molecule and/or template molecule, the mediator probe is extended. A second primer can then be attached to the extended mediator probe and extended. During the amplification process, the mediator or mediators are released from the mediator binding region and trigger a detectable signal through interaction with one or more detection molecules (FIG. 2).

Example 3: Detection Molecule with 6 Regions

[0245] The detection of the released, unmarked mediator takes place with the help of a detection reaction. The reaction mechanism described below can be performed in parallel with the amplification of the target molecule and/or template molecule described above.

[0246] In a preferred version of the invention, a detection molecule may consist of an oligonucleotide divided into six regions (FIG. 3). Region 1 comprises the 5 terminus of the detection molecule consisting of a sequence portion and a fluorescence acceptor Q. Region 3 is a reverse-complementary sequence of Region 1 and is separated therefrom by Region 2. Region 4 separates Region 3 and Region 5, which can specifically interact with a mediator molecule. Region 6 comprises the 3-terminal sequence region, which may have a chemical modification and thus allows directional immobilization of the oligonucleotide. A fluorescence donor F is associated in a suitable way with a region of Region 2 to Region 6, for example Region 4. Region 1 and Region 3 of the detection molecule form a defined secondary structure (hairpin structure) under reaction conditions, in which the 5 terminus hybridizes to an internal sequence section (FIG. 3 B). After formation of this structure, fluorescence donor F and fluorescence acceptor Q interact with each other and the fluorescence signal of F is suppressed (FRET). As an alternative to a fluorescence donor and fluorescence acceptor modification of the detection molecule in Region 1 and Region 4, other signal-generating modifications may be used, such as redox molecules, chemiluminescence resonance energy transfer (CRET) pairs and intercalating molecules.

Example 4: Mediator Extension Leads to Signal Change of the Detection Molecule

[0247] After release, the mediator is diffusively present in the reaction solution and can interact with the mediator binding sequence (Region 5) of the detection molecule (FIG. 4 i)+ii)). The detection molecule may be immobilized on a solid phase or present in solution. The mediator is elongated by a suitable auxiliary molecule, e.g. the beach displacement polymerase, whereby Region 1 of the detection molecule is displaced by the polymerase. The distance between fluorescence acceptor Q and fluorescence donor F is increased by displacement of the 5 terminus and the previously suppressed fluorescence signal of the fluorescence donor F is restored (FIG. 4 iii)+iv)). Alternatively, the distance of a redox molecule at the 5 terminus of the detection molecule changes in relation to the 3 terminus of the detection molecule or the efficiency of CRET changes or the intercalation of molecules changes due to the formation of the duplex of mediator or its extension product and the detection molecule. If the described displacement prevents the interaction of Region 1 and Region 3, the formation of the secondary structure is cancelled. In this case, the mediator can be extended complementarily by the described auxiliary molecule under certain conditions up to the newly formed 5 terminus of the detection molecule (FIG. 4 v)+vi)). This full extension provides the extended mediator with a sequence segment complementary to Region 1, 2 and Region 3 of the detection molecule.

[0248] The detection reaction must be designed in such a way that, in contrast to the mediator, the initial mediator probe does not trigger a signal-generating reaction and thus no false-positive results are produced. Initially, the mediator is bound to the first oligonucleotide of the mediator probe, for example by hydrogen bonds. In order to prevent a signal generating reaction by binding the mediator to the detection molecule, the balance between binding the mediator to the first oligonucleotide of the mediator probe and binding the mediator to the detection molecule can be adjusted accordingly.

[0249] The interaction event of the mediator with the detection molecule produces a local, detectable signal. If a sufficient number of detection molecules are activated by the mediator extension with resulting displacement of the 5 terminus, the signal is amplified and can be detected using suitable detection devices. This allows detection in the presence of the reaction mixture and does not require any processing steps.

Example 5: Multiplex Analyses

[0250] Multiplex analyses require the detection of several different analytes in a reaction mixture. In order to increase the degree of multiplexing of the reaction according to the invention, the use of n different mediator probes for n different target molecules is planned. Each target molecule to be detected can be assigned a mediator probe whose probe region interacts specifically with the target molecule or template molecule. The mediator binding region and the mediator of the respective mediator probe are not affine or complementary to the target or template molecule. However, the mediator represents a specific interaction partner for a defined detection molecule. Thus, each target molecule is indirectly assigned a detection molecule, which is assigned by the mediator probe. The detection of different target molecules requires different detection molecules.

[0251] Since the probe region and mediator binding region of the mediator probe can be freely combined independently of each other, a detection molecule can also be correlated with another target molecule by linking and synthesizing the matching mediator binding region and mediator with any probe region. The method according to the invention therefore allows the target molecule to be designed independently of the detection molecule. Thus, with a standardized set of detection molecules, different target molecules can be detected in one sample, whereby the reaction can be adapted cost-effectively to the respective target molecule by adapting the mediator probe and using suitable auxiliary molecules (e.g. primers or aptamers).

[0252] Examples of invention execution may include multiple mediators and/or multiple mediator probes and/or multiple detection molecules per target molecule. The following constellations are possible. [0253] A. Several mediators, which bind to the same mediator probe can bind to several detection molecules. By astutely combining several mediators of a mediator probe with different detection molecules, the multiplexing degree of an assay can be greatly increased. The prerequisite is that the detection molecules generate fluorescence signals with different wavelengths. By using n detection molecules and two mediators per mediator probe and target molecule, n over 2+n different target molecules can be detected. The binomial coefficient can be used to calculate the number of detectable target molecules for a given number of different detection molecules. Since a target molecule can be identified not only by generating two fluorescence signals with two different wavelengths, but also by generating a single fluorescence signal, the value of the binomial coefficient must be increased by n in order to calculate the maximum number of detectable target molecules. With four different detection molecules, 10 different target molecules can be detected, while only five detection molecules allow the differentiation of 15 target molecules (FIG. 5A). Similarly, several mediator probes can be used per target molecule, whereby one mediator probe can only contain one mediator. [0254] B. One or more mediator probes binding to the same target or template molecule may be used and the mediator or mediators of such mediator probes may bind to one or more detection molecules simultaneously. By astutely combining the mediator binder regions in the detection molecules, it is possible, for example, to distinguish between three target molecules using only two detection molecules. By using n detection molecules and at least two mediators per detection molecule, 2n1 different target molecules can be detected. Several different mediator probes can bind to the same target molecule. In the above example, where three target molecules can be distinguished using only two detection molecules, the detection molecules may each contain two different mediator binding regions. Two mediators, which are linked to two different target sequences, each bind to only one specific detection molecule. A specific signal is generated per target molecule. The third mediator, which is linked to the third target sequence, binds to both detection molecules and thus triggers two different signals. To ensure that the probability that two released mediators bind to the same detection molecule simultaneously is high enough, the concentration of released mediators should be in the order of the concentration of detection molecules (FIG. 5 B). In addition, detection molecules that can bind more than two different mediators can also be used. [0255] C. Several mediator probes, each selectively binding to a common target molecule or template molecule, can be used, whereby the mediator or mediators of these mediator probes have different sequences. Several different mediators can bind to one and the same detection molecule, whereby a detection reaction can only be triggered by binding several mediators. This method can be used to increase the specificity of the detection reaction. A possible reaction sequence is shown in Figure C. To ensure that the probability that two released mediators bind to the same detection molecule simultaneously is high enough, the concentration of released mediators should be in the order of the concentration of detection molecules.

Example 6: Melt Curve Analysis

[0256] In certain versions of the invention, a melting curve analysis of the detection molecules hybridized with the extended mediators can be performed after the amplification reaction. This allows an additional increase in the multiplexing degree to be achieved by using different detection molecules, which, for example, are labeled with different signaling molecules.

Example 7: Detection Molecule in the Form of a Molecular Beacon

[0257] In a possible form of the invention, the detection molecule has the structure of a molecular beacon in which the mediator binding region is located in the loop (FIG. 6). By attachment of the mediator to the described detection molecule and subsequent extension, the molecular beacon is opened and the labeled 5 and 3 ends separated, resulting in a detectable signal increase. An advantage of this structure over the structure considered so far (FIG. 3) is lower synthesis costs for terminal fluorescent markings.

Example 8: Detection Molecule Consisting of Two Labeled Oligonucleotides

[0258] In another version of the invention, the detection molecule consists of several fluorescence-labeled oligonucleotides. Two oligonucleotides labeled with quencher and fluorophore can be hybridized with each other and separated when interacting with a mediator, thus a signal change can be detected. The described detection molecule can be structured as shown in FIG. 19.

Example 9: Detection Molecule from Single-Stranded DNA with Hybridized Probes

[0259] In this design, the detection molecule may consist of single-stranded DNA to which several probes labeled with fluorescence donor and fluorescence acceptor are hybridized. After release of the mediator, the mediator binds to the detection molecule and is prolonged, whereby the labeled probes are released and fluorescence donor and fluorescence acceptor are spatially separated from each other, leading to an increase in fluorescence. The multiple hybridization of the detection molecule with several labeled probes leads to a multiplication effect of the signal generation. The detection molecule can be linear or circular, it can be homogeneous in solution or immobilized on a solid phase and may have several mediator binding sites. If the detection molecule is circular and several mediator binding sites are inserted, a rapid detection reaction can take place in a good dynamic range by simultaneously binding several mediators at different sites. The circular structure of the detection molecule allows an additional increase in sensitivity to be achieved, since hybridization and extension of a mediator on a detection molecule releases all bound, labeled probes, regardless of the site to which the mediator binds. Probes with different fluorescence donors and fluorescence acceptors, which emit at different wavelengths, can be bound to a detection molecule. By combining different fluorescent dyes, which can also be used in different concentrations (which is determined by the number of labeled probes per detection molecule), the degree of multiplexing can be increased. Certain concentration ratios can be assigned to a defined detection molecule. Binding molecules to which the labeled probes can bind after release (FIG. 7) can be used to prevent released probes labeled with fluorescence donor or fluorescence acceptor from re binding to the detection molecule in the long term. The described design is preferably used with isothermal amplification methods, thus ensuring that the labeled probes bind to the detection molecule in the absence of the target molecule and do not dissociate from the detection molecule due to high thermal energy generated, for example, by PCR.

[0260] In a preferred design, the probes labeled with fluorescence donor and fluorescence acceptor are not separated from the detection molecule by extending the mediator, but are displaced by adjusting the equilibrium in the presence of released mediators. The released mediator has a higher binding energy to the unlabeled detection molecule than the labeled probe and thus displaces, for example, the shorter probe labeled with the fluorescence acceptor (FIG. 25).

Example 10: Detection Via Internal Total Reflection Fluorescence Microscopy (TIRF) or Surface Plasmon Resonance Spectroscopy

[0261] Similar to electrochemical detection, detection by internal total reflection fluorescence microscopy (TIRF) can be performed in certain designs. In this method, the detection molecule is immobilized on a glass or polymer test carrier above the TIRF illuminator. The evanescent field formed by total reflection penetrates into the sample volume and activates fluorescence molecules, which are located at the detection molecule and/or at the mediator and/or at probes or are intercalated in dimers, whereby a change of the fluorescence signal can be detected. In further versions, the binding of the mediator to the detection molecule is detected by surface plasmon resonance spectroscopy. By the release and subsequent binding of the mediator to the detection molecule immobilized on a surface, a change in the refractive index in the sample can be detected. The detection molecules can be immobilized directly on the metal surface in which the plasmons are activated or, for example, in/on a membrane located directly on the metal surface.

Example 11: Verification by Gravimetric Measurements

[0262] In preferred versions of the invention, the release and binding of the mediator to a detection molecule can be demonstrated by gravimetric measurements. For example, the detection molecule is immobilized on a carrier surface whose weight can be determined with oscillating quartz. Changes in weight due to binding of the mediator to the detection molecule can thus be detected.

Example 12: Proof of Rolling Circle Amplification

[0263] In preferred versions of the invention, the released mediator in the presence of appropriate amplification enzymes can trigger rolling circle amplification and thus the target molecule can be identified by the detection of the rolling circle amplification products. Amplification products of Rolling Circle Amplification can, for example, be detected sequence-specifically via probes or via pH value changes, gel electrophoresis or colorimetry.

Example 13: Detection Via Sequencing

[0264] In preferred versions of the invention, the released mediator can be analyzed by sequencing and thus identified. An example of next-generation sequencing is nanopore sequencing, in which potential changes on a membrane with pores are measured as molecules, such as nucleic acids, flow through it, and the sequence of the nucleic acid can thus be determined. Sequencing can be used to detect the simultaneous release of any number of mediators, each of which signals the presence of a specific target molecule. The degree of multiplexing increases considerably compared to conventional methods, such as fluorescence measurements. The sequencing method is not limited to nanopore sequencing because any sequencing method can be selected for the detection of released mediators.

Example 14: Using a Selected Mediator

[0265] In preferred versions of the invention, the mediator bound to the mediator probe can be marked with a fluorescence donor/fluorescence acceptor, which emits at a certain wavelength .sub.1. After displacement of the mediator probe, the mediator can bind to a detection molecule labeled with a fluorescence acceptor/fluorescence donor, which is emitted at a second wavelength .sub.2, which is different to .sub.1. The energy transfer from the fluorescence donor to the fluorescence acceptor via the FRET mechanism leads to a detectable increase in the radiation intensity of the fluorescence acceptor, which allows the emission of .sub.2 to be detected. In further versions, chemiluminescent or bioluminescent donor molecules can be used. Fluorescence acceptors, which are non-emissive, can also be used in designs. By using detection molecules with different numbers of nucleotides, different target molecules can be distinguished simultaneously in one sample by means of a melting curve analysis. By marking the mediator, the universal character of the described detection method is not lost, since the mediator is a universal molecule independent of the target sequence. In further designs, several probes or primers per target molecule can be used to which mediators labeled with fluorescent dyes are bound, whereby the sequences of the mediators and the emission wavelengths of the fluorescent dyes may differ (FIG. 9).

Example 15: Use of an Isothermal Amplification Method

[0266] In this example, the detection method according to invention is used for the detection of DNA in an isothermal amplification method, for example the LAMP. The mechanism of a mediator release during a LAMP is detailed in FIG. 10. The initial amplification steps of a LAMP lead to a dumbbell-like structure of an intermediate amplification product. The mediator probe, which acts as primer in this example, can bind to this intermediate amplification product and be extended in a next step. By displacing the intermediate amplification product, another primer can bind to the extended mediator probe and be extended. During this process, the mediator is displaced by the beach displacement polymerase. The released mediator can now bind to a detection molecule with a hairpin structure and can also be extended. During extension of the mediator, the 5 end of the closed hairpin structure of the detection molecule is displaced from the complementary region, generating a fluorescence signal.

[0267] Place the sample and reagents in a suitable reaction vessel and incubate the mixture (between 10 min and 60 min at about 62 C.). During this process the fluorescence is detected in the reaction vessel. In the following, the execution described using the example of a LAMP is described in detail:

[0268] For real-time LAMP detection of E. coli DNA (W3110, complete genome), the primers listed in Table 1 were used. The LAMP primers were taken from (Tanner et al. 2012) and partially modified. The mediator probe was combined with the LoopF primer by adding a mediator binding region to the 5 end of the primer, which can hybridize with a mediator. Mediator, LoopF with mediator binding region and the detection molecule were created manually using VisualOMP (DNA Software, USA). The synthetic oligonucleotides from Table 1 were synthesized by Biomers (biomers.net, Ulm, Germany).

TABLE-US-00001 TABLE1 Sequencesofprimer,mediatoranddetection moleculeforareal-timeLAMPforthe detectionofE.coliDNA. FIP CTGCCCCGACGATAGGCTTAATCGTGGTCTGGTGAAGT TCTACGG c CCAGTGCGACCTGCTGGGTGGGTATTGTTCGCCGCCAG TAC F3 GATCACCGATTTCACCAACC B3 CTTTTGAGATCAGCAACGTCAG LoopF TGCGCCATGTCCCGCT LoopB TGAGTTAACCCACCTGACG mediator TCCGCAGCAAGTGGGCTCTACGACC LoopFwith GGTCGTAGAGCCCACTTGCTGCGGATGCGCCATGTCCC mediator GCT binding sequence Detection BHQ-2-GACCGGCCAAGACGCGCCGGT(dC-Cy5)TGT molecule TGGTCGT-AGAGCCCAGAACGA

[0269] The LAMP reaction was performed with Bst 2.0 WarmStart DNA Polymerase in 1 Isothermal Amplification Buffer (New England Biolabs, Frankfurt, Germany). 1 Isothermal Amplification Buffer contains 20 mM Tris-HCl, 10 mM (NH4).sub.2SO4, 50 mM KCl, 2 mM MgSO4 and 0.1% Tween 20 (pH 8.8 at 25 C.). In addition, MgSO4 (New England Biolabs, Frankfurt, Germany), final concentration 8.0 mM, and dNTP Mix (Qiagen, Hilden, Germany), final concentration 1.4 mM, were added to the buffer. The LAMP reaction consisted of 1.6 M FIP and BIP, 0.2 M F3 and B3, 0.8 M LoopB, 0.6 M LoopF, 0.2 M LoopF with mediator binding region, 0.1 M Mediator, 0.05 M detection molecule, 320 U/ml Bst 2.0 WarmStart DNA Polymerase, lx Isothermal Amplification Buffer and 1 g/I BSA. The reaction was carried out in a rotor gene 6000 (Corbett, Mortlake, Australia, now Qiagen, Hilden, Germany) at 62 C. in triplicates. The fluorescence data were normalized to the initial value at min (FIG. 11).

[0270] The detection method was also used in a LAMP of Haemophilus ducreyi (H. ducreyi) and Treponema pallidum (T. pallidum). The performance and reaction conditions were identical to the LAMP of E. coli described above, but with sequence-specific primers for H. ducreyi and T. pallidum. The fluorescence data were normalized to the initial value at 0 min (FIGS. 26 and 27).

Example 16: Procedure According to Invention Using an RT-LAMP

[0271] In further examples, the detection according to the invention method can be used to detect RNA, whereby the RNA is transcribed into cDNA using reverse transcription (RT) or another suitable enzymatic system and the cDNA is then amplified. In the following, the execution example using an RT-LAMP is described in detail:

[0272] The primers listed in Table 2 were used for an RT-LAMP for the detection of HIV-1 RNA. The RT-LAMP primers were taken from (Curtis et al. 2008) and partially modified. The mediator probe was combined with the LoopF primer by adding a mediator binding region to the 5 end of the primer, which can hybridize with a mediator. Mediator, LoopF with mediator binder region and the detection molecule were created manually using VisualOMP. The synthetic oligonucleotides Mediator, LoopF with mediator binding sequence and detection molecule were synthesized by Biomers (biomers.net, Ulm, Germany) and the primers FIP, BIP, F3, B3, LoopF and LoopB were synthesized by Ella Biotech (Martinsried, Germany). The template RNA (HIV, VR-3245SD) was synthesized by ATCC, LGC Standards GmbH (Wesel, Germany).

TABLE-US-00002 TABLE2 Primer,mediatoranddetectionmolecule sequencesforareal-timeRT-LAMPfor thedetectionofHIV-1RNA. FIP CAGCTTCCTCATTGATGGTTTCTTTTTAACACCATGCT AAACACAGT BIP TGTTGCACCAGGCCAGATAATTTTGTACTGGTAGTTCC TGCTATG F3 ATTATCAGAAGGAGCCACC B3 CATCCTATTTGTTCCTGAAGG LoopF TTTAACATTTGCATGGCTGCTTGAT LoopB GAGATCCAAGGGGAAGTGA Mediator CCATGCCTCAGGAGCTCAGTTCGGTCAGTG LoopFwith CACTGACCGAACTGAGCTCCTGAGGCATGGTTTAACAT mediator TTGCATGGCTGCTTGAT binding sequence Detection BMN-Q-535-CACCGGCCAAGACGCGCCGG(dT- molecule Atto-647N)GTGTTCACT-GACCGAACTGGAGCA

[0273] The RT-LAMP reaction was performed with Bst 2.0 WarmStart DNA Polymerase (New England Biolabs, Frankfurt, Germany) and Transcriptor Reverse Transcriptase (Roche Diagnostics, Mannheim, Germany) in 1Isothermal Amplification Buffer (New England Biolabs, Frankfurt, Germany). 1Isothermal Amplification Buffer contains 20 mM Tris-HCl, mM (NH4).sub.2SO4, 50 mM KCl, 2 mM MgSO4 and 0.1% Tween 20 (pH 8.8 at 25 C.). In addition, MgSO4 (New England Biolabs, Frankfurt, Germany), final concentration 8.0 mM, and dNTP Mix (Qiagen, Hilden, Germany), final concentration 1.4 mM, were added to the buffer. The RT-LAMP reaction consisted of 1.6 M FIP and BIP, 0.2 M F3 and B3, 0.8 M LoopB, 0.6 M LoopF, 0.2 M LoopF with mediator binding region, 0.1 M Mediator, 0.05 M detection molecule, 320 U/ml Bst 2.0 WarmStart DNA Polymerase, 400 U/ml Transcriptor Reverse Transcriptase and 1Amplification Buffer. The reaction was carried out in a rotor gene 6000 (Corbett, Mortlake, Australia, now Qiagen, Hilden, Germany) at 63 C. in triplicates. The positive control contained 3,400 copies/reaction of synthetic HIV-1 RNA, the negative control contained no HIV-1 RNA. The fluorescence data were normalized to the initial value at 0 min (FIG. 12).

[0274] The detection method was also successfully applied in an RT-LAMP of human T-lymphotropic virus (HTLV-1) and tobacco mosaic virus (TMV) RNA. The performance and reaction conditions were identical to the already described RT-LAMP of HIV-1, but with sequence-specific primers for HTLV-1 and TMV. The fluorescence data were normalized to the initial value at 0 min (FIGS. 28 and 29).

Example 17: Procedure According to Invention Using Non-Isothermal Amplification Reactions

[0275] In further examples of the invention, the detection method according to the invention can be used to detect DNA in a non-isothermal amplification reaction, such as PCR or PCDR. This involves modifying one or more primers in such a way that they represent a mediator probe. In a suitable reaction vessel, the sample and the required reagents are placed and the mixture incubated. During this process the fluorescence is detected in the reaction vessel. In the following, the execution example is described in detail using a PCDR:

[0276] The primers listed in Table 3 were used for real-time PCDR detection of mouse DNA. The PCDR primers for the amplification of G3PDH DNA were taken from (Ignatov et al. 2014) and partially modified. The mediator probe was created using the F3 primer by attaching a mediator binder region to the 5 end of the primer, which can hybridize with a mediator. Mediator, F3 with mediator binding region and the detection molecule were created manually using VisualOMP. The primers as well as the synthetic oligonucleotides mediator, F3 with mediator binding sequence and detection molecule were synthesized by Biomers (biomers.net, Ulm, Germany). The mouse G3PDH DNA sequence to be amplified was taken from (Ignatov et al. 2014) and the G3PDH fragment was synthesized by Integrated DNA Technologies (IDT, Coralville, IA).

TABLE-US-00003 TABLE3 Primer,mediatoranddetectionmolecule sequencesforareal-timePCDRforthe detectionofmiceG3PDHDNA. F1 GTGAAGGTCGGTGTGAACGGA F2 TTCTGCCGATGCCCCCATGT F3 GCATCCTGCACCACCAACTG R1 GGTTTCTTACTCCTTGGAGGC R2 CAGATCCACGACGGACACATT R3 GAGCTTCCCGTTCAGCTCTG Mediator TAAAGCCATAGCCGTACTAGCTGCTCCAGTTCGGTCAGT G F3with CACTGACCGAACTGGAGCAGCTAGTACGGCTATGGCTTT mediator AGCATCCTGCACCACCAACTG binding sequence Detection BMN-Q-535-CACCGGCCAAGACGCGCCGG(dT-Atto- molecule 647N)GTGTTCACTGACCGAACTGGAGCA

[0277] PCDR was performed with SD Hotstart DNA Polymerase in 1SD buffer (Bioron, Ludwigshafen, Germany). In addition, MgCl2 (Bioron, Ludwigshafen, Germany), final concentration 2.75 mM, and dNTPs (New England Biolabs, Frankfurt, Germany), final concentration 0.25 mM, were added to the buffer. The PCDR reaction consisted of 0.1 M F3 and F3 each with mediator binding region, 0.2 M R3, 0.1 M F2 and R2, 0.05 M F1 and R1, 0.05 M mediator, 0.05 M detection molecule, 200 U/ml SD Hotstart DNA Polymerase and 1SD buffer. The reaction was carried out in a rotor gene 6000 (Corbett, Mortlake, Australia, now Qiagen, Hilden, Germany) according to the following protocol (Ignatov et al. 2014): Initial denaturation at 92 C. for 2 min, followed by 45 cycles at 92 C. (15 sec) and 66 C. (40 sec). The fluorescence data were normalized to the initial value at 0 cycles (FIG. 30). The positive control contained 100 pg G3PDH fragment per reaction, the negative control contained no template DNA.

Example 18: Invented Mediator Probe that does not Act as Primer

[0278] In further examples, the detection according to the invention method can be used for the detection of DNA or RNA with increased specificity. A primer does not serve as a mediator probe, but a special probe is used which does not serve as a starting point for amplification. In the absence of the target molecule, the probe is closed. As soon as the target molecule is in the reaction mixture, the mediator probe binds to the target molecule or template molecule, whereby a primer can bind to the 3 end of the now opened mediator probe. By processing with a suitable enzyme system, the attached primer can be extended, whereby the mediator is displaced by the mediator probe. The released mediator can be detected with the help of a specific detection molecule. The enzymatic amplification process may include, but is not limited to, isothermal processes (FIG. 13).

Example 19: Use of Target Molecule-Specific Aptamers

[0279] In further versions, the detection according to the invention method for the detection of target molecules by target molecule-specific aptamers can be applied. Target molecule-specific aptamers, the sample to be investigated and detection molecules are placed in a suitable reaction vessel. The target molecule to be detected can be a protein or peptide, for example, but is not limited to it. An aptamer binds to the target molecule and changes its structure so that an aptamer-specific mediator probe and primer can attach after interaction. By processing with a suitable enzyme system, primers attached to the aptamer (FIG. 14: white marker in the aptamer) can be prolonged, resulting in amplification of the aptamer sequence outside the protein binding region. By binding a mediator probe to a linear amplification product, the probe is opened and further primers are used to displace the mediator from the mediator probe. The released mediator can be detected using a specific detection molecule or a suitable detection method. The enzymatic amplification process may include, but is not limited to, isothermal processes (FIG. 14).

Example 20: Modified Mediator Probes, which have an Aptamer Region, a Mediator Binding Region and a Primer Binding Region

[0280] In preferred designs, the ingenious detection method can be used to detect target molecules using modified mediator probes, which have an aptamer region, a mediator binding region and a primer binding region. The target molecule to be detected can be a protein or peptide, for example, but is not limited to this. In the absence of the target molecule, the primer binds to the mediator probe and can be prolonged by processing with a suitable enzyme system, displacing the mediator from the mediator probe. The released mediator can trigger a detectable signal using a specific detection molecule or method. If the target molecule is present, the aptamer region of the mediator probe binds to the target molecule, whereby the primer attached to the primer binder region cannot be extended (FIG. 15). If the target molecule is present, a signal drop is detected in comparison to the absence of the target molecule. The enzymatic amplification process may include, but is not limited to, isothermal processes.

Example 21: Use of an Aptamer Comprising a Protein Binder Region Flanked by Primer Binder Regions

[0281] In order to generate an exponential detection reaction, a mediator probe is used which consists of a primer with a mediator hybridization sequence at the 5 end and a mediator hybridized to it. In addition, an aptamer is used, which is a protein binding region flanked by primer binding regions. In the presence of the target molecule, the aptamer binds to the target molecule. Primers that bind to the aptamer cannot be extended due to the binding to the target molecule. Consequently, the mediator is not released and, in the presence of the target molecule, a drop in signal compared to the absence of the target molecule is detected. In the absence of the target molecule, primers can bind to the aptamer and be prolonged, which leads to a signal increase through mediator release. The enzymatic amplification process may include, but is not limited to, isothermal methods (FIG. 16).

Example 22: Immobilization of Detection Molecules

[0282] In other preferred versions of the detection method according to the invention, the detection molecules can be immobilized in a suitable reaction vessel on a solid phase. The sample and the required reagents are then added to the reaction vessel and the mixture incubated under the appropriate conditions. The sample may consist of DNA, RNA and/or peptides or proteins. If the target molecule is present, the mediator is displaced by the mediator probe and can diffuse in the reaction mixture to the immobilized detection molecule. The procedure includes but is not limited to isothermal amplification procedures (FIG. 17).

Example 23: Use of Relaxometry

[0283] In further versions, the detection according to the invention method can be used in combination with magnetic relaxometry for the detection of target molecules. The detection molecules can be bound to magnetic particles and allow detection by magnetic relaxometry. In magnetic relaxometry, the magnetic particles are magnetized by a short magnetic pulse and the temporal degradation of the induced magnetic moment is detected. The hydrodynamic resistance of particles to which mediators bind and are extended via the detection molecules immobilized on the particles is greater, i.e. the hydrodynamic resistance of particles to which no mediators bind. Particles to which mediators bind and are extended therefore degrade their induced magnetic moment more slowly than particles to which no mediators bind. The relaxation times of the induced magnetic moments of the mentioned particles therefore differ from each other, whereby the release of mediators can be detected. By combining magnetic relaxometry with a melting curve analysis, different target molecules can be detected side by side in one sample. The procedure includes, but is not limited to, isothermal amplification procedures.

Example 24: Use of Magnetic or Magnetizable Particles

[0284] In other designs, the detection according to the invention method can be used in combination with magnetic or magnetizable particles to detect target molecules (FIG. 31). The mediators are bound to magnetic or magnetizable nanoparticles. Several mediators can be bound to one particle at the same time. According to the invention, the mediators hybridize initially with primers. During amplification of the target or template molecule, the mediator is displaced by the primer and can then hybridize with a detection molecule immobilized on the solid phase. The binding between the released mediator and the detection molecule brings the nanoparticles to the surface of the solid phase, which enables a change in the magnetic properties to be detected. For the detection of a signal change on the surface of the solid phase, magnetic field sensors can be used, among other things, which, for example, but not exclusively, are based on galvano-magnetic, magneto-resistive, magneto-optical effects or on the Josephson effect. In order to prevent false positive signals due to the deposition of the non-released mediator/particle units on the solid phase, the non-released mediator/particle units can be separated from the solid phase by applying a weak magnetic field.

Example 25: Electrochemical Detection with Detection Molecules Having a Hairpin Structure

[0285] In further versions, the detection according to the invention method can be used in combination with electrochemical detection to detect target molecules. In this version, the detection molecule is immobilized on an electrode, which simultaneously represents the solid phase. The released mediator can hybridize with the detection molecule in the mediator binding region and be extended by a polymerase. The mediator binding region may be located in different regions of the detection molecule. The detection molecule may have a hairpin structure and be marked with a redox molecule at the 5 end. The extension of the mediator displaces the 5 end of the detection molecule and opens the latter. Due to the displacement of the marked 5 end, the distance between the redox molecule and the electrode surface increases, resulting in a detectable signal change. The procedure includes, but is not limited to, isothermal amplification procedures (FIG. 18).

Example 26: Proof by Electrochemical Detection on a Solid Phase

[0286] In this preferred design, detection by electrochemical detection can take place on a solid phase. In this version, the detection molecule is immobilized on an electrode, which simultaneously represents the solid phase. The released mediator can hybridize with the detection molecule in the mediator binding region and be extended by a polymerase. After extension, redox molecules can intercalate into the dimer of detection molecule and extended mediator and generate an electrochemical signal that can be detected (FIG. 8). Signal generation can also take place without extension of the mediator according to FIG. 20. The mediator may be label-free and intercalating redox molecules may be used and/or the mediator may be labeled with one or more redox molecules. If the mediator is labeled with a redox molecule, the binding of the released mediator and, if necessary, subsequent extension of the mediator to the detection molecule leads to signal generation as described in FIGS. 21-23. In another version, the detection molecule is marked with one or more redox molecules. The binding of the released mediator and possibly subsequent extension of the mediator to the detection molecule leads to a signal change according to FIG. 24. It may be advantageous to release several mediators per target molecule and/or amplicon to obtain a stronger signal. The release of several mediators per target molecule can be achieved, for example, by attaching mediators to several different mediator probes.

[0287] In the following, electrochemical detection according to FIG. 21 will be discussed. The mediator is labeled with (a) redox molecule(s) and is released during amplification. In this version, the unlabeled detection molecule is immobilized on an electrode, which simultaneously represents the solid phase, and the released mediator can hybridize with the detection molecule in the mediator binder region. Due to the spatial proximity between the redox molecule on the mediator and the electrode surface, a signal change can be detected. Detection can take place in real time during the amplification reaction or as endpoint detection by transferring the amplification products to the electrode surface. The execution example is described in detail below using the electrochemical endpoint detection of the amplification products of a LAMP of E. coli:

[0288] The LAMP reaction was performed as described in example 15. However, for electrochemical detection mediator, LoopF with mediator binding sequence and detection molecule were adapted accordingly (Table 4). LoopF with mediator binding sequence and detection molecule were synthesized by Biomers (biomers.net, Ulm, Germany) and the mediator, which is modified with a methylene blue derivative (Atto MB2), by IBA Lifesciences (Gttingen, Germany).

TABLE-US-00004 TABLE4 LoopF_withmediatorbindingsequence, mediatoranddetectionmolecule Sequencesfortheelectrochemical detectionofaLAMPofE.coli. mediator AttoMB2-TCGTTCTGGGCTCTACGACC LoopFwith GGTCGTAGAGCCCAGAACGATGCGCCATG mediator TCCCGCT binding sequence detection TTTTTTTTTTGGTCGTAGAGCCCAGAACG molecule A

[0289] After performing the LAMP of E. coli DNA as described in example 15, the reaction mix was transferred into a chamber with an electrode on which the detection molecules are immobilized. The electrochemical detection of the released mediators in the positive control reaction (60,000 copies of E. coli DNA) was performed by square wave voltammetry (FIG. 32). In the positive control, the mediators are displaced during the LAMP reaction and can hybridize to the detection molecule after transferring the reaction mix into the electrode chamber. Accordingly, the marked (here methylene blue) mediator accumulates on the electrode surface, which leads to the formation of a characteristic peak at 0.39 V in electrochemical analysis (here square wave voltammetry). In contrast, the absence of a peak in negative control (NTC) indicates that there was no significant release of mediators. The application of the detection method according to the invention in combination with the electrochemical detection proves to be particularly advantageous here, since after the amplification reaction there is no need to carry out further modifications or reaction steps.

Example 27: Parallel Detection of DNA, RNA, Peptides and/or Proteins

[0290] In a preferred version of the method according to the invention, DNA, RNA and peptides or proteins or another combination of the mentioned substance classes are detected in parallel by the described methods in one approach. The procedure includes, but is not limited to, isothermal amplification procedures.

REFERENCES

[0291] Das, Jagotamoy; Cederquist, Kristin B.; Zaragoza, Alexandre A.; Lee, Paul E.; Sargent, Ed-ward H.; Kelley, Shana O. (2012): An ultrasensitive universal detector based on neutralizer displacement. In: Nature chemistry 4 (8), S. 642-648. DOI: 10.1038/nchem.1367. [0292] Curtis, Kelly A.; Rudolph, Donna L.; Owen, S. Michele (2008): Rapid detection of HIV-1 by reverse-transcription, loop-mediated isothermal amplification (RT-LAMP). In: Journal of virological methods 151 (2), S. 264-270. DOI: 10.1016/j.jviromet.2008.04.011. [0293] Faltin, Bernd; Wadle, Simon; Roth, Gunter; Zengerle, Roland; Stetten, Felix von (2012): Mediator probe PCR: a novel approach for detection of real-time PCR based on label-free primary probes and standardized secondary universal fluorogenic reporters. In: Clinical chemistry 58 (11), S. 1546-1556. DOI: 10.1373/clinchem.2012.186734. [0294] G. J. Nuovo; R. J. Hohman; G. A. Nardone; I. A. Nazarenko (1999): In Situ Amplification Using Universal Energy Transfer-labeled Primers. In: The Journal of Histochemistry & Cytochemistry (47), S. 273-279. [0295] Ignatov, Konstantin B.; Barsova, Ekaterina V.; Fradkov, Arkady F.; Blagodatskikh, Konstantin A.; Kramarova, Tatiana V.; Kramarov, Vladimir M. (2014): A strong strand displacement activity of thermostable DNA polymerase markedly improves the results of DNA amplification. In: BioTechniques 57 (2), S. 81-87. DOI: 10.2144/000114198. [0296] Li, Xiaomin; Huang, Yong; Guan, Yuan; Zhao, Meiping; Li, Yuanzong (2006): Universal molecular beacon-based tracer system for real-time polymerase chain reaction. In: Analytical chemistry 78 (22), S. 7886-7890. DOI: 10.1021/ac061518. [0297] Li, Xiaomin; Huang, Yong; Song, Chen; Zhao, Meiping; Li, Yuanzong (2007): Several concerns about the primer design in the universal molecular beacon real-time PCR assay and its application in HBV DNA detection. In: Analytical and bioanalytical chemistry 388 (4), S. 979-985. DOI: 10.1007/s00216-007-1281-4. [0298] Linardy, Evelyn M.; Erskine, Simon M.; Lima, Nicole E.; Lonergan, Tina; Mokany, Elisa; Todd, Alison V. (2016): EzyAmp signal amplification cascade enables isothermal detection of nucle-ic acid and protein targets. In: Biosensors & bioelectronics 75, S. 59-66. DOI: 10.1016/j.bios.2015.08.021. [0299] Tanner, Nathan A.; Zhang, Yinhua; Evans, Thomas C., J R (2012): Simultaneous multiple target detection in real-time loop-mediated isothermal amplification. In: BioTechniques 53 (2), S. 81-89. DOI: 10.2144/0000113902. [0300] Yang, Litao; Liang, Wanqi; Jiang, Lingxi; Li, Wenquan; Cao, Wei; Wilson, Zoe A.; Zhang, Dabing (2008): A novel universal real-time PCR system using the attached universal duplex probes for quantitative analysis of nucleic acids. In: BMC molecular biology 9, S. 54. DOI: