CONSTRUCT FOR EXPRESSING MONOMERIC STREPTAVIDIN

Abstract

The present invention relates to a monomeric streptavidin-expressing gene construct and a host cell into which a recombinant vector comprising the gene construct has been introduced. The gene construct according to the present invention, after injected in vivo through a strain, may express streptavidin, thereby making it possible not only to monitor in real time the location of the strain or a cancer tissue pre-targeted by the strain by using a biotinylated diagnostic agent, but also to increase the cancer targeting efficiency of a biotinylated anticancer agent.

Claims

1-20. (canceled)

21. A gene construct comprising: a gene encoding biotin-binding protein; a gene encoding fusion partners for improving solubility and expression of recombinant proteins; and a regulatory gene that regulates expression of the gene encoding biotin-binding protein.

22. The gene construct of claim 21, wherein the regulatory gene is operably linked upstream of the gene encoding monomeric streptavidin.

23. The gene construct of claim 21, wherein the regulatory gene is at least one selected from the group consisting of a ribosome binding site (RBS), a 5-untranslated region (5-UTR) and a transcription factor binding site.

24. The gene construct of claim 21, wherein the regulatory gene causes the monomeric streptavidin to be expressed in a periplasm of a host cell when a recombinant vector comprising the gene construct is transformed into the host cell.

25. The gene construct of claim 21, wherein the regulatory gene has a total Gibbs free energy change of (G.sub.total) of 0 or less.

26. The gene construct of claim 21, wherein the regulatory gene has a translation initiation rate (TIR) controlled within a predetermined range.

27. The gene construct of claim 26, wherein the translation initiation rate of the regulatory gene is 50 to 45,000 AU.

28. The gene construct of claim 21, wherein the regulatory gene has a sequence length of 15 to 39 bp.

29. The gene construct of claim 21, wherein the regulatory gene comprises a gene sequence represented by any one of SEQ ID NOs: 5 to 7.

30. The gene construct of claim 29, wherein a spacing between the 3 end of the gene sequence represented by any one of SEQ ID NOs: 5 to 7 in the regulatory gene and the initiation codon of the gene encoding monomeric streptavidin is 6 to 13 bp.

31. A recombinant vector comprising the gene construct of claim 21.

32. A host cell transformed by introduction of the recombinant vector of claim 31 thereinto.

33. A method for screening a regulatory gene for regulating expression of monomeric streptavidin, the method comprising steps of: introducing a gene encoding monomeric streptavidin (mSA) and a candidate regulatory gene into a vector; and measuring an expression level of the gene encoding monomeric streptavidin.

34. The method of claim 33, wherein the candidate regulatory gene satisfies at least one of the following conditions: the candidate regulatory gene has a total Gibbs free energy change (G.sub.total) controlled to 0 or less; the candidate regulatory gene has a translation initiation rate of 50 to 45,000 AU; the candidate regulatory gene has a sequence length of 15 to 39 bp; the candidate regulatory gene comprises a gene sequence represented by any one of SEQ ID NOs 5 to 7; and a spacing between a 3 end of the gene sequence and an initiation codon of the gene encoding monomeric streptavidin is 6 to 13 bp.

35. The method of claim 33, wherein a gene encoding fusion partners for improving solubility and expression of recombinant proteins is further introduced into the vector in the step of introducing.

36. The method of claim 33, wherein the step of measuring the expression level is performed by measuring an expression level of monomeric streptavidin expressed from a host cell transformed with the vector.

37. The method of claim 36, wherein, when the expression level of monomeric streptavidin expressed from the host cell is higher than that before the candidate regulatory gene is introduced, it is determined that the candidate regulatory gene is a gene that increases expression of the monomeric streptavidin.

38. The method of claim 36, wherein the step of measuring the expression level is performed by measuring an expression level of monomeric streptavidin expressed in a periplasm of the transformed host cell.

39. The method of claim 38, wherein, when the monomeric streptavidin is expressed in the periplasm of the transformed host cell, it is determined that the candidate regulatory gene is a gene that increases expression of the monomeric streptavidin.

40. The method of claim 36, wherein the step of measuring the expression level further comprises a step of culturing the transformed host cell.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0087] FIG. 1 shows the results of analyzing the expression of plasmids transduced with mSA gene alone in Experimental Example 1.

[0088] FIG. 2 shows the results of analyzing the expression of MBP-mSA gene in Experimental Example 2.

[0089] FIG. 3 shows the results of Western blotting performed to determine the expression and activity of MBP-mSA gene in Experimental Example 2.

[0090] FIG. 4 is a graph showing the results of analyzing biotin binding to recombinant strains in Experimental Example 2.

[0091] FIG. 5 depicts confocal microscope images showing biotin binding to recombinant strains in Experimental Example 2.

[0092] FIG. 6 depicts confocal microscope images showing biotin binding to recombinant strains in Experimental Example 2.

[0093] FIG. 7 shows the results of analyzing the expression of MBP-mSA gene in Experimental Example 3.

[0094] FIG. 8 shows the results of Western blotting performed to determine the expression and activity of MBP-mSA gene in Experimental Example 3.

[0095] FIG. 9 shows the results of Western blotting performed to determine the expression of MBP-mSA gene in Experimental Example 4.

[0096] FIG. 10 shows the results of Western blotting performed to compare the expression of MBP-mSA gene in Experimental Example 4.

[0097] FIG. 11 is a graph showing the results of analyzing biotin binding to recombinant strains in Experimental Example 4.

[0098] FIG. 12 depicts confocal microscope images showing biotin binding to a recombinant strain in Experimental Example 4.

[0099] FIG. 13 depicts confocal microscope images showing biotin binding to recombinant strains in Experimental Example 4.

[0100] FIG. 14 is a graph showing the results of analyzing the specificity of biotin binding to recombinant strains in Experimental Example 5.

[0101] FIG. 15 is a graph showing the results of analyzing the specificity of biotin binding to recombinant strains in Experimental Example 5.

[0102] FIG. 16 depicts images showing biotin binding to recombinant strains in tumor animal models in Experimental Example 5.

[0103] FIG. 17 depicts images showing biotin binding to recombinant strains in tumor animal models in Experimental Example 5.

[0104] FIG. 18 depicts images showing biotin binding to recombinant strains in tumor animal models in Experimental Example 5.

[0105] FIG. 19 depicts images showing biotin binding to recombinant strains in harvested tumors in Experimental Example 5.

[0106] FIG. 20 depicts images showing biotin binding to a recombinant strain in tumor animal models in Experimental Example 5.

MODE FOR INVENTION

[0107] Hereinafter, the present invention will be described in more detail with reference to examples. These examples are only for explaining the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention according to the subject matter of the present invention is not limited by these examples.

[Example 1] Construction of Msa Expression Plasmids

[1-1] Construction of mSA Gene-Inserted Plasmids

[0108] In order to construct a plasmid for mSA expression in a recombinant strain, the monomeric streptavidin (mSA) gene represented by SEQ ID NO: 2 was synthesized (Macrogen, Korea), amplified, digested with restriction enzymes EcoRI and SalI, and purified to obtain a gene amplification product which was then cloned into a pBAD24 plasmid digested with the same restriction enzymes, thus constructing a pBAD-mSA (B-mSA) plasmid.

[0109] Additionally, in order to increase the expression of the mSA gene, BBa_B0032, BBa_B0030, and BBa_B0034, which are the ribosome binding sites (RBSs) shown in Table 1 below, were each inserted downstream of the promoter, thereby constructing pBAD_RBS 0.3-mSA (B_R0.3-mSA), pBAD_RBS 0.6-mSA (B_R0.6-mSA), and pBAD_RBS 1.0-mSA (B_R1.0-mSA) plasmids.

[0110] In addition, in order to increase the expression and solubility of the gene, the mSA gene was amplified using the pBAD-mSA plasmid as a template, and then digested with restriction enzymes EcoRI and HindIII and purified to obtain a gene amplification product which was then cloned into each of pMA1_p2x and pMA1_c2x plasmids digested with the same restriction enzymes, thereby constructing pMA1_p2x-mSA (M_p-mSA) and pMA1_c2x-mSA (M_c-mSA) plasmids.

[1-2] Construction of MBP-mSA-Expressing Plasmids

[0111] Next, for use in animal experiments, the maltose binding protein (MBP)-encoding gene represented by SEQ ID NO: 4, the mSA gene represented by SEQ ID NO: 2, and the BBa_B0034 sequence were each cloned into a pBAD24 plasmid, thereby constructing pBAD_p2x-mSA (B_p-mSA), pBAD c2x-mSA (B_c-mSA), pBAD_RBS 1-p2x-mSA (B_R1.0-p-mSA), and pBAD_RBS1-c2x-mSA (B_R1.0-c-mSA) plasmids.

[1-3] Construction of RBS-Substituted Plasmids

[0112] In order to increase the expression level and functionality of mSA, gene constructs in which the existing RBS was substituted with a new regulatory gene were additionally constructed (Table 1 below). First, a sequence library was prepared by analyzing the RBS sequence of the plasmid. Next, the translation initiation rate (TIR) of the B_p-mSA plasmid was analyzed using the RBS calculator (Penn State University) program, and then a regulatory gene library having a translation initiation rate value ranging from 3.97 to 42,889 as calculated by the RBS library calculator was constructed. The regulatory gene constructed according to the library was cloned to substitute for the RBS sequence of the B_p-mSA plasmid, and then the resulting colonies were selected, thereby constructing the final plasmids pBAD_R01-p2x-mSA (B_R01-p-mSA), pBAD_R02-p2x-mSA (B_R02-p-mSA), pBAD_R1-p2x-mSA (B_R1-p-mSA), pBAD_R11-p2x-mSA (B_R11-p-mSA), pBAD_R12-p2x-mSA (B_R12-p-mSA), pBAD_R13-p2x-mSA (B_R13-p-mSA), pBAD_R2-p2x-mSA (B_R2-p-mSA), and pBAD_R21-p2x-mSA (B_R21-p-mSA) (see Table 1 below).

[0113] The name, abbreviation, backbone plasmid and entire sequence of each gene construct obtained in Examples 1-1 to 1-3 are shown in Table 1 below.

TABLE-US-00001 TABLE 1 Gene construct Name Backbone Entire (abbreviation) plasmid mSA MBP RBS sequence pBAD-mSA pBAD24 SEQ ID NO: Not added Unsubstituted SEQ ID NO: (B-mSA) 2 8 pBAD_RBS 0.3- pBAD24 SEQ ID NO: Not added SEQ ID NO: SEQ ID NO: mSA 2 26 9 (B_R0.3-mSA) pBAD_RBS 0.6- pBAD24 SEQ ID NO: Not added SEQ ID NO: SEQ ID NO: mSA 2 27 10 (B_R0.6-mSA) pBAD_RBS 1.0- pBAD24 SEQ ID NO: Not added SEQ ID NO: SEQ ID NO: mSA 2 28 11 (B_R1.0-mSA) pMAl_p2x- pMAl_p2x SEQ ID NO: SEQ ID NO: Unsubstituted SEQ ID NO: mSA(M_p-mSA) 2 4 12 pMAl_c2x-mSA pMAl_c2x SEQ ID NO: SEQ ID NO: Unsubstituted SEQ ID NO: (M_c-mSA) 2 4 13 pBAD_p2x-mSA pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: (B_p-mSA) 2 4 29 14 pBAD_c2x- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA(B_c-mSA) 2 4 29 15 pBAD_RBS1-p2x- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA(B_R1.0-p- 2 4 28 16 mSA) pBAD_RBS1-c2x- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA(B_R1.0-c- 2 4 28 17 mSA) pBAD_R01-p2x- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA(B_R01-p- 2 4 30 18 mSA) pBAD_R02-p2x- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 31 19 (B_R02-p-mSA) pBAD_R1-p2x- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 32 20 (B_R1-p-mSA) pBAD_R11-p2x- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 33 21 (B_R11-p-mSA) pBAD_R12-p2x- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 34 22 (B_R12-p-mSA) pBAD_R13-p2x- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 35 23 (B_R13-p-mSA) pBAD_R2-p2x- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 36 24 (B_R2-p-mSA) pBAD_R21-p2x- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 37 25 (B_R21-p-mSA) pBAD R-lib-1-1- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 65 38 (R-lib-1-1-mSA) pBAD R-lib-1-5- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 66 39 (R-lib-1-5-mSA) pBAD R-lib-1-7- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 67 40 (R-lib-1-7-mSA) pBAD R-lib-1-10- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 68 41 (R-lib-1-10-mSA) pBAD R-lib-1-11- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 69 42 (R-lib-1-11-mSA) pBAD R-lib-1-12- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 70 43 (R-lib-1-12-mSA) pBAD R-lib-1-13- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 71 44 (R-lib-1-13-mSA) pBAD R-lib-1-14- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 72 45 (R-lib-1-14-mSA) pBAD R-lib-1-16- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 73 46 (R-lib-1-16-mSA) pBAD R-lib-1-17- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 74 47 (R-lib-1-17-mSA) pBAD R-lib-1-18- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 75 48 (R-lib-1-18-mSA) pBAD R-lib-2-2- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 76 49 (R-lib-2-2-mSA) pBAD R-lib-2-3- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 77 50 (R-lib-2-3-mSA) pBAD R-lib-2-4- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 78 51 (R-lib-2-4-mSA) pBAD R-lib-2-5- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 79 52 (R-lib-2-5-mSA) pBAD R-lib-2-6- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 80 53 (R-lib-2-6-mSA) pBAD R-lib-2-7- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 81 54 (R-lib-2-7-mSA) pBAD R-lib-2-8- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 82 55 (R-lib-2-8-mSA) pBAD R-lib-2-14- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 83 56 (R-lib-2-14-mSA pBAD R-lib-2-16- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 84 57 (R-lib-2-16-mSA pBAD R-lib-2-17- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 85 58 (R-lib-2-17-mSA pBAD R-lib-3-4- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 86 59 (R-lib-3-4-mSA pBAD R-lib-3-5- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 87 60 (R-lib-3-5-mSA pBAD R-lib-3-11- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 88 61 (R-lib-3-11-mSA pBAD R-lib-3-13- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 89 62 (R-lib-3-13-mSA pBAD R-lib-3-18- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 90 63 (R-lib-3-18-mSA pBAD R-lib-3-20- pBAD24 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: mSA 2 4 91 64 (R-lib-3-20-mSA

[1-4] Calculation of Total Gibbs Free Energy Changes of Regulatory Gene Transcripts

[0114] For the sequence from the promoter to the initiation codon of the ribosome binding site (RBS) S) constructed in Example 1-3, in order to confirm the mSA expression ability of the gene construct depending on the total Gibbs free energy change (G.sub.total), the total Gibbs free energy change (G.sub.total) was calculated by calculating the following parameters, and the results are shown in Table 2 below: G.sub.mRNA-rRNA which is the Gibbs free energy change when a reaction that forms a complex of the mRNA of the regulatory gene and the 30S ribosomal subunit occurs; G.sub.spacing which is a Gibbs free energy penalty that occurs when the spacing between the sequence forming the 30S ribosomal subunit complex and the initiation codon in the mRNA transcript of the regulatory gene is not optimized; G.sub.stacking which is the Gibbs free energy change of nucleotides stacked in the region of the spacing; G.sub.standby which is the Gibbs free energy penalty when a binding reaction between the standby site of the mRNA transcript of the regulatory gene and a ribosome occurs; G.sub.start which is the Gibbs free energy change when a reaction that forms an mRNA-tRNA complex occurs; and G.sub.mRNA which is the Gibbs free energy change when the mRNA transcript of the regulatory gene forms a folded complex structure. Here, the total Gibbs free energy change (G.sub.total) was calculated using Equations 1 and 2 below.

G.sub.total=(G.sub.final)(G.sub.initial)[Equation 1]

(G.sub.final)(G.sub.initial)=[(G.sub.mRNA-rRNA)+(G.sub.spacing)+(G.sub.stacking)+(G.sub.standby)+(G.sub.start)](G.sub.mRNA)[Equation 2]

TABLE-US-00002 TABLE 2 RBS SEQ Unit: kcal/mol ID NO G.sub.mRNA-rRNA G.sub.spacing G.sub.stacking G.sub.standby G.sub.start G.sub.mRNA G.sub.total 29 14.4914 4.992 0 2.41 2.76 15.01 4.944348676 30 6.84135 1.525 0 1.5336 2.76 7.76 1.328848924 31 1.158649 0.005326 0 0.4314 0.42 3.4 4.641874373 32 7.05135 0 0 1.0898 2.76 5.79 3.555751381 33 1.37135 0 0 0.0786 2.76 4.17 0.1498488 34 0.24135 0 0 0.29 2.76 6.12 3.239348447 35 5.39135 0.672 0 4.0728 2.76 7.41 3.862748471 36 9.37135 0.288 0 4.0728 2.76 4.61 3.458051381 37 7.44135 0 0 4.8986 2.76 8.12 2.647948438 65 7.44135 0 0 4.8986 2.76 10.25 4.777948552 66 13.8614 0.288 0 4.0728 2.76 4.62 7.9380514 67 7.77135 0.288 0 4.0728 2.76 5.98 0.488051352 68 5.39135 0.288 0 4.0728 2.76 5.98 1.891948643 69 2.68135 0.288 0 3.3234 2.76 4.61 2.482548676 70 5.39135 0.288 0 4.0728 2.76 4.61 0.521948757 71 2.68135 0.288 0 4.0728 2.76 5.37 3.991948428 72 2.56135 0 0 3.3234 2.76 4.61 2.4427488 73 3.96135 0.288 0 4.8986 2.76 6.51 4.67774886 74 6.95135 0.288 0 4.8986 2.76 6.45 1.627748371 75 7.49135 0.288 0 4.0728 2.76 6.78 0.59194881 76 9.37135 0 0 2.6504 2.76 5.68 4.216651686 77 7.27135 0 0 2.6504 2.76 4.59 3.283051219 78 7.27135 0 0 2.6504 2.76 4.59 2.966951219 79 10.9714 0 0 2.6504 2.76 3.99 7.41975141 80 8.87135 0 0 2.6504 2.76 2.9 6.510651419 81 10.9714 0 0 2.6504 2.76 3.58 7.860951495 82 9.37135 0 0 2.6504 2.76 4.59 5.403751362 83 8.87135 0 0 2.6504 2.76 3.82 5.729451581 84 9.37135 0 0 2.6504 2.76 2.44 7.456651457 85 8.87135 0 0 2.6504 2.76 2.31 7.100651572 86 7.58135 1.525 0 0.0168 2.76 4.78 4.109751104 87 5.27135 0 0 0.4314 2.76 4.46 3.219451333 88 5.27135 0 0 0.4314 2.76 4.27 3.76635139 89 5.27135 0 0 0.4314 2.76 5.47 2.476551581 90 5.06135 0.005326 0 0.2168 2.76 4.1 3.800725876 91 7.75135 1.525 0 0.4314 2.76 4.95 3.695151507

[1-5] Calculation of Translational Initiation Rates of Regulatory Genes

[0115] In order to confirm the mSA expression ability of the plasmid depending on the translation initiation rate (TIR) of the regulatory gene, the translation initiation rate of each regulatory gene sequence constructed as described above was calculated, and the results are shown in Table 3.

TABLE-US-00003 TABLE 3 Regulatory gene Translation initiation rate (AU) Unsubstituted 1 SEQ ID NO: 29 133.266441 SEQ ID NO: 30 678.2310709 SEQ ID NO: 31 152.7003477 SEQ ID NO: 32 6110.586323 SEQ ID NO: 33 1152.963841 SEQ ID NO: 34 287.0559877 SEQ ID NO: 35 216.8312084 SEQ ID NO: 36 5847.72872 SEQ ID NO: 37 374.5906748 SEQ ID NO: 65 143.6296318 SEQ ID NO: 66 43914.95671 SEQ ID NO: 67 1536.365645 SEQ ID NO: 68 526.4033937 SEQ ID NO: 69 403.5382313 SEQ ID NO: 70 975.1871797 SEQ ID NO: 71 204.582929 SEQ ID NO: 72 410.8314232 SEQ ID NO: 73 150.2547754 SEQ ID NO: 74 592.8668512 SEQ ID NO: 75 944.9445588 SEQ ID NO: 76 8227.297678 SEQ ID NO: 77 5404.842895 SEQ ID NO: 78 4688.141139 SEQ ID NO: 79 34778.40472 SEQ ID NO: 80 23100.64943 SEQ ID NO: 81 42417.31004 SEQ ID NO: 82 14037.12899 SEQ ID NO: 83 16253.13229 SEQ ID NO: 84 35360.78091 SEQ ID NO: 85 30125.96282 SEQ ID NO: 86 7840.852282 SEQ ID NO: 87 5252.334127 SEQ ID NO: 88 6718.078741 SEQ ID NO: 89 3759.681518 SEQ ID NO: 90 6822.815917 SEQ ID NO: 91 6506.222717

[0116] As shown in Table 3, it was confirmed that, among the regulatory genes of the constructed plasmids, the regulatory genes of SEQ ID NOs: 29 to 37 and 65 to 91 had translation initiation rates in the range of 50 to 45,000 AU, and thereamong, the regulatory genes of SEQ ID NOs: 32 and 36 had translation initiation rates in the range of 900 to 9,000 AU.

[1-6] Sequence Analysis of Regulatory Genes

[0117] In order to examine the mSA expression ability of the plasmid depending on whether not the regulatory gene sequence comprises the AGG, TAGG or ATAGG sequence and on the spacing between the 3 end of the AGG sequence and the initiation codon, the regulatory gene sequence of each plasmid and the spacing (unit: bp) between the 3 end of the AGG sequence and the initiation codon were analyzed, and the results are shown in Table 4 below.

TABLE-US-00004 TABLE4 Spacing Regulatorygenesequence (bp) SEQIDNO:26 TCACACAGGAAAG 4 SEQIDNO:27 ATTAAAGAGGAGAAA 5 SEQIDNO:28 AAAGAGGAGAAA 5 SEQIDNO:29 ACCCGTTTTTTGGGCTAACAGGAGG 14 AAGCTAGCGCTAGC SEQIDNO:30 TAGCACTCGTTGACATACGGACGT CAC SEQIDNO:31 ACTACTGAGGCTACT 5 SEQIDNO:32 TGGAACAGCTCACGCAAAAATAGGT 6 TTCTT SEQIDNO:33 CGCTTTTTATCGCAACTCTCTA CTGTTTCTCCAT SEQIDNO:34 TCTGAGAAAGACACGATCTTACTAG SEQIDNO:35 TCTAGAGAAAGAGCGGATCCTACC TAG SEQIDNO:36 TCTAGAGAAAGATAGGAGAATACTAG 10 SEQIDNO:37 TCTAGAGAAAGAGGCGACGGTACTAG 11 SEQIDNO:65 TCTAGAGAAAGAGGCGAGTGTACTAG 12 SEQIDNO:66 TCTAGAGAAAGATAGGAGGTTACTAG 10 SEQIDNO:67 TCTAGAGAAAGAGGGGACACTACTAG 12 SEQIDNO:68 TCTAGAGAAAGAGCGGAAACTACTAG SEQIDNO:69 TTCTAGAGAAAGATTTGAATATAC TAG SEQIDNO:70 TCTAGAGAAAGAACGGACATTACTAG SEQIDNO:71 TCTAGAGAAAGACATGACTATACTAG SEQIDNO:72 TCTAGAGAAAGAACTGAAGATACTAG SEQIDNO:73 TCTAGAGAAAGAGGCGATCCTACTAG 12 SEQIDNO:74 TCTAGAGAAAGAAGAGAGCCTACTAG SEQIDNO:75 TCTAGAGAAAGACTTGAGGCTACTAG 7 SEQIDNO:76 GAACCCTAATACATTAGGAGATCT 9 TCT SEQIDNO:77 GAACCCTAATACATTAGGACATAT 9 TCT SEQIDNO:78 GAACCCTAATACATTAGGACATCA 9 TCT SEQIDNO:79 GAACCCTAATACATAAGGAGATCA 9 TAT SEQIDNO:80 GAACCCTAATACATAAGGACATAA 9 TAT SEQIDNO:81 GAACCCTAATACATAAGGAGATTA 9 TCT SEQIDNO:82 GAACCCTAATACATTAGGAGATTA 9 TAT SEQIDNO:83 GAACCCTAATACATAAGGACATCT 9 TAT SEQIDNO:84 GAACACTAATACATTAGGAGATCT 9 TCT SEQIDNO:85 GAACACTAATACATAAGGACATAA 9 TAT SEQIDNO:86 TTAAGTAGTTAAACAGGGTATAT 6 AGGGGAAGA SEQIDNO:87 TTAAGTAGTTAAACAGGGTATAT 6 AGGACGAGA SEQIDNO:88 TTAAGTAGTTAAACAGGGTATAT 6 AGGGCTATA SEQIDNO:89 TTAAGTAGTTAAACAGGGTATAT 6 AGGAGGATA SEQIDNO:90 TTAAGTAGTTAAACAGGGTATAT 6 AGGGCGATA SEQIDNO:91 TTAAGTAATTAAACAGGGTATAT 6 AGGGGAAGA

[0118] As shown in Table 4, it was confirmed that, among the regulatory genes of the constructed plasmids, the regulatory genes of SEQ ID NOs: 26, 27, 28, 29, 31, 32, 36, 37, 66, 67, 73, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90 and 91 contained the AGG sequence, and in particular, the spacing between the 3 end of the AGG sequence in the regulatory genes of SEQ ID NOs: 32 and 36 and the initiation codon was 6 to 13 bp. In addition, it was confirmed that, among the regulatory genes of the constructed plasmids, the regulatory genes of SEQ ID NOs: 32, 36, 66, 76, 77, 78, 82, 84, 86, 87, 88, 89, 90 and 91 contained the TAGG or ATAGG sequence.

[Example 2] Transformation and Culture of Host Cells

[0119] After each of the plasmids constructed in Example 1 was transformed into Escherichia coli (DH5a, or MG1655), or Salmonella sp. strains (SHJ2037), each of the transformed strains was cultured overnight using an LB solid medium containing ampicillin. Then, the resulting colonies were diluted at a ratio of 1:100 using an LB liquid medium containing antibiotics, and when the OD.sub.600 value reached 0.5 to 0.7 during additional culture, arabinose was added to the culture at a final concentration of 0.1%, followed by culturing in a shaking incubator under conditions of 200 rpm and 37 C.

[Experimental Example 1] Analysis of mSA Expression Level of Recombinant mSA Plasmid

[0120] In order to analyze the expression level of the plasmid into which the mSA gene was inserted alone, recombinant E. coli colonies containing each of the plasmids B-mSA, B_R0.3-mSA, B_R0.6-mSA and B_R1.0-mSA constructed in Example 1 were transformed and cultured as described in Example 2. Next, the cultured recombinant E. coli was added to SDS-PAGE sample buffer based on OD4, boiled at 95 C. for 10 minutes, and then loaded on SDS-PAGE to determine the expression level of the protein, and the results are shown in FIG. 1.

[0121] As shown in FIG. 1, it could be confirmed that the strains containing the plasmid in which the RBS sequence known as BBa_B0032, BBa_B0030 or BBa_B0034 was inserted upstream of the mSA gene sequence to improve protein expression did not express the mSA protein on SDS-PAGE. Thereby, it could be seen that the addition of the RBS sequence to the pBAD expression system did not significantly affect the overexpression of the mSA gene alone.

[Experimental Example 2] Analysis of mSA Expression Level and Activity of MBP-mSA Plasmid

[2-1] SDS-PAGE

[0122] The present inventors examined the mSA expression level of a strain transformed with an MBP-mSA plasmid in which the MBP gene was fused with mSA in order to increase the expression and solubility of mSA. Specifically, M_p-mSA and M_c-mSA plasmids obtained by fusion with the MBP gene were constructed as described in Example 1, and transformation and culture were performed as described in Example 2. When the OD.sub.600 value reached 0.5 to 0.7 during culture, isopropyl beta-D-1-thiogalactopyranoside (IPTG) was added to the culture at a final concentration of 0.1 mM, followed by culturing in a shaking incubator under conditions of 200 rpm and 37 C. The cultured recombinant E. coli was added to SDS-PAGE sample buffer based on OD4, boiled at 95 C. for 10 minutes, and then loaded on SDS-PAGE to confirm the expression level of the protein, and the results are shown in FIG. 2.

[0123] As a result, as shown in FIG. 2, it was confirmed that the mSA protein fused with MBP was overexpressed on the gel, and that the mSA gene fused with the MBP gene without the secretion sequence was more overexpressed than the mSA gene fused with the MBP gene with the secretion sequence.

[2-2] Western Blot Analysis

[0124] Western blot analysis was performed to analyze the mSA expression level and biotin binding activity of the recombinant strain transformed with the MBP-mSA plasmid. Specifically, the culture of the strain of Example 2 was diluted with PBS to 410.sup.7 CFU/ml, and the pellet was collected by centrifugation at 13,000 rpm for 5 minutes. The pellet fraction was washed with PBS and mixed with SDS sample buffer containing 0.2% beta-mercaptoethanol (catalog number: EBA-1052, ELPIS BIOTECH) to obtain a strain lysate. Then, the strain lysate was electrophoresed on 12% SDS-PAGE gel, and the protein was transferred from the gel to a nitrocellulose membrane, followed by blocking with 5% skim milk at room temperature. Then, the expression level of mSA was confirmed using his tag antibody, and the biotin-binding activity of mSA was confirmed using biotinylated peroxidase. The results are shown in FIG. 3.

[0125] As shown in FIG. 3, it was confirmed that the expression level of the MBP-fused mSA protein of each of the M_c-mSA and M_p-mSA plasmids into which both the MBP gene and the mSA gene were inserted was higher than the expression level of the non-MBP-fused mSA protein of the B-mSA plasmid into which only the mSA gene was inserted.

[0126] In addition, it could be confirmed that, although the expression level of the protein expressed from the M_c-mSA plasmid was higher than that from M_p-mSA, the biotin binding activity of MBP-fused mSA with the secretion sequence was higher.

[2-3] Biotin Uptake Assay

[0127] In order to analyze the biotin binding activity of the recombinant strain transformed with the MBP-mSA plasmid, biotin uptake assay was performed, and the results are shown in FIG. 4. Specifically, biotinylated fluorescent dye (biotin-flamma 675 dye, BioActs) was added to and reacted with the cultured strain, followed by washing with PBS to remove biotinylated fluorescent dye not bound to the strain. Then, the fluorescence value of the fluorescent dye absorbed by the recombinant strain was measured using a fluorescence measurement reader (Infinite m200, Tecan).

[0128] As a result, as shown in FIG. 4, the biotin binding signal (biotin activity) is more increased in the strain containing the B-mSA plasmid.

[2-4] Confocal Microscopic Observation

[0129] In order to actually image the binding of the biotinylated fluorescent dye to the recombinant strain, the recombinant strains were fixed to slides and observed with a confocal microscope, and the results are shown in FIGS. 5 and 6.

[0130] As shown in the biotin uptake assay results in FIGS. 5 and 6, the number of biotinylated fluorescent dye particles bound to the strain was very small regardless of MBP fusion. Thereby, it could be confirmed that mSA expression was improved through MBP gene fusion, but changes in gene expression and solubility through MBP could not improve biotin binding activity.

[Experimental Example 3] Analysis of mSA Expression Level and Activity of RBS-Added Plasmid

[3-1] SDS-PAGE

[0131] SDS-PAGE was performed to examine the mSA expression and activity of the recombinant strain transformed with the RBS-added plasmid. Specifically, SD S-PAGE was performed on recombinant strains transformed with each of B_p-mSA and B_c-mSA plasmids obtained by cloning the MBP-mSA gene into the pBAD plasmid, and B_R1.0-p-mSA and B_R1.0-c-mSA plasmids obtained by adding the BBa_B0034 sequence to improve the expression of the plasmids, and the results are shown in FIG. 7.

[0132] As shown in FIG. 7, as a result of loading the recombinant strains on SDS-PAGE and examining the expression level of the protein, it was confirmed that the MBP-fused mSA protein was overexpressed even from the pBAD plasmid.

[3-2] Western Blot Analysis

[0133] Western blot analysis was performed to examine the mSA expression and activity of the recombinant strain transformed with the RBS-added plasmid. Western blot analysis was performed on B_p-mSA and B_c-mSA plasmids obtained by cloning the MBP-mSA gene into the pBAD plasmid, and B_R1.0-p-mSA and B_R1.0-c-mSA plasmids obtained by adding the BBa_B0034 sequence to improve the expression of the plasmids, in the same manner as in Experimental Example 2-2, and the results are shown in FIG. 8.

[0134] As shown in FIG. 8, as a result of performing Western blot analysis, it was confirmed that the B_p-mSA, B_c-mSA, B_R1.0-p-mSA and B_R1.0-c-mSA plasmids obtained by inserting both the MBP gene and the mSA gene overexpressed the MBP-fused mSA protein, and the expression level of the MBP-fused mSA protein was higher than that of the non-MBP-fused mSA protein.

[Experimental Example 4] Analysis of mSA Expression Level and Activity of RBS-Substituted Plasmid

[4-1] Western Blot Analysis (1)

[0135] The present inventors analyzed the RBS sequence of the B_p-mSA plasmid to induce increased functional expression of the gene in the recombinant strain, and constructed B_R01-p-mSA, B_R02-p-mSA, B_R1-p-mSA, B_R11-p-mSA, B_R12-p-mSA, B_R13-p-mSA B_R2-p-mSA and B_R21-p-mSA plasmids as described in Example 1. A strain was transformed with each of the constructed plasmids and cultured. In order to examine the protein expression level of each of the recombinant strains, Western blot analysis was performed in the same manner as in Experimental Example 2-2, and the results are shown in FIG. 9.

[0136] As shown in FIG. 9, it was confirmed that, among the mSA-expressing strains, the recombinant strains transformed with each of the B_R1-p-mSA and B_R2-p-mSA plasmids showed higher mSA expression levels than the other strains.

[4-2] Western Blot Analysis (2)

[0137] Additional experiments were performed on the two selected strains transformed with each of the B_R1-p-mSA and B_R2-p-mSA plasmids having high mSA expression levels, and the results are shown in FIG. 10.

[0138] As shown in FIG. 10, it was confirmed that, in the control group, the expression and secretion levels of mSA were higher in the recombinant strain containing the M_p-mSA plasmid than in the recombinant strain containing the B_p-mSA plasmid. In addition, it was confirmed that, even in the experimental group, the expression and secretion levels of mSA were higher in the recombinant strain containing the M_p-mSA plasmid than in the recombinant strains containing each of the B_R1-p-mSA and B_R2-p-mSA plasmids.

[0139] In addition, it was shown that the secretion level versus expression level of the protein was lower in the recombinant strains containing each of the B_R1-p-mSA and B_R2-p-mSA plasmids than in the recombinant strain containing the M_p-mSA plasmid, indicating that mSA expressed from each of the B_R1-p-mSA and B_R2-p-mSA plasmids remained in the periplasm of the strain. The biotin binding activity was higher in the order of the recombinant strains containing the BAD-mSA, B_R1-p-mSA, M_p-mSA and B_R2-p-mSA plasmids, respectively, and the secreted protein binding activity was higher in the order of the recombinant strains containing the M_p-mSA, BAD-mSA, B_R1-p-mSA, B_R2-p-mSA plasmids, respectively.

[4-3] Biotin Uptake Assay

[0140] In addition, in order to analyze the biotin binding activity of the recombinant strain with improved expression, biotin uptake assay was performed in the same manner as in Experimental Example 2, and the results are shown in FIG. 11.

[0141] As shown in FIG. 11, it was confirmed that the recombinant strain containing each of the B_R1-p-mSA and B_R2-p-mSA plasmids had significantly higher biotin binding activity than the recombinant strain containing each of the pBAD and B-mSA plasmid as a control, indicating that mSA expressed from each of the B_R1-p-mSA and B_R2-p-mSA plasmids had a significant biotin binding activity effect compared to mSA expressed from the other plasmids. In addition, it was confirmed that the biotin-binding activity was not proportional to the protein expression level, indicating that the biotin-binding activity effect could not be predicted simply by the protein expression level alone.

[4-4] Confocal Microscopic Observation

[0142] In order to actually image the binding of the biotinylated fluorescent dye to the recombinant strain, the cultured strains were fixed to slides and observed with a confocal microscope, and the results are shown in FIGS. 12 and 13.

[0143] As shown in FIG. 12, it could be confirmed that the biotinylated fluorescent dye more strongly bound to the recombinant strain containing each of the B_R1-p-mSA and B_R2-p-mSA plasmids than to the control B-mSA and B_p-mSA shown in FIG. 13, and in particular, mSA expression by the B_R2-p-mSA plasmid was optimal for binding to the biotinylated fluorescent dye. Thereby, it could be seen that even the strain in which the expression of the mSA gene was improved through MBP gene fusion did not sufficiently bind to external biotin, but in the case in which the MBP gene and the RBS gene were fused with the mSA gene, the expression of the mSA gene was functionally improved, and thus the ability to bind to external biotin was significantly improved.

[Experimental Example 5] Confirmation of Tracking Function for mSA-Expressing Recombinant Strain

[5-1] Biotin Uptake Assay

[0144] In order to confirm whether the mSA gene expressed in the constructed recombinant strain of the present invention is specific to biotin, as described in Experimental Example 1, each of the pBAD, B-mSA, BAD-mSA, B_R1-p-mSA and B_R2-p-mSA plasmids was transformed into Salmonella strains which were then cultured. Next, biotin uptake assay was performed in the same manner as in Experimental Example 2, and the results are shown in FIGS. 14 and 15.

[0145] As shown in FIG. 14, it was confirmed that, when the recombinant strains were treated only with the biotinylated fluorescent dye, the recombinant Salmonella strains containing the B_R2-p-mSA plasmid had the highest biotin uptake. On the other hand, as shown in FIG. 15, it was confirmed that, when biotin without the fluorescent dye was added to the recombinant strains which were then treated with the biotinylated fluorescent dye, the uptake of the biotinylated fluorescent dye by the recombinant strains decreased. Through the difference between FIGS. 14 and 15, it was confirmed that the binding of the biotinylated fluorescent dye to the recombinant strain could be inhibited when 200 nM of biotin without the fluorescent dye was added prior to addition of the biotinylated fluorescent dye, suggesting that the recombinant strain of the present invention binds specifically to biotin.

[5-2] Tumor Imaging Assay (1)

[0146] In order to confirm the biotin binding activity of the recombinant strain of the present invention, in vivo imaging system (IVIS) imaging was performed. Specifically, first, the CT26 cell line was subcutaneously injected into the flanks of Balb/c mice to construct tumor animal models. After 3 days form each recombinant strain was injected into the tumor animal model, biotinylated fluorescent dye was injected into each mouse. The results of IVIS imaging performed 6 hours after biotinylated fluorescent dye injection are shown in FIG. 16, the results of IVIS imaging performed 9 hours after biotinylated fluorescent dye injection are shown in FIG. 17, and the results of IVIS imaging performed 24 hours after biotinylated fluorescent dye injection are shown in FIG. 18.

[0147] As shown in FIGS. 16 to 18, it could be seen that the biotinylated fluorescent dye injected into each of the tumor animal model injected with the recombinant strains transformed with B-mSA, and B_p-mSA plasmids, was gradually eliminated in vivo over time after injection, suggesting that there was no tumor specificity. On the other hand, it was confirmed that the tumor animal model injected with the recombinant strain containing the B_R2-p-mSA plasmid showed a stronger signal in the tumor tissue than the control group after injection of the biotinylated fluorescent dye, and the signal was still strongly maintained even after 24 hours after injection of the biotinylated fluorescent dye. Thereby, it was confirmed that the biotinylated fluorescent dye strongly bound only to the recombinant strain of the present invention in small animals. In particular, it could be seen that, the signal generated from the biotinylated fluorescent dye can be detected by an imaging means, enabling real-time tumor imaging.

[5-11] Tumor Imaging Assay (2)

[0148] In addition, in order to confirm the biotin binding activity of the recombinant strain of the present invention, cancer tissue was harvested from the tumor animal model and imaged with an in vivo imaging system (IVIS). Specifically, 24 hours after the biotinylated fluorescent dye was injected into the tumor animal model, the tumor was harvested from each group and imaged with an IVIS to detect the signal of the biotinylated fluorescent dye, and the results are shown in FIG. 19.

[0149] As shown in FIG. 19, it was confirmed that the group treated with the recombinant strain containing the B_R2-p-mSA plasmid maintained strong fluorescence activity compared to the other groups. Thereby, it was confirmed that the biotinylated fluorescent dye strongly bound only to the recombinant strain of the present invention in small animals, and in particular, it could be seen that real-time tumor imaging using the recombinant strain having tumor specificity is possible.

[5-12] Tumor Imaging Assay (3)

[0150] In order to confirm the multiple-biotin-binding activity of the recombinant strain of the present invention, in vivo imaging system (IVIS) imaging was performed. Specifically, first, the CT26 cell line was subcutaneously injected into the flanks of Balb/c mice to construct tumor animal models. The recombinant strain was injected into the tumor animal models. Three days after injecting the recombinant strain into the tumor animal models, the biotinylated fluorescent dye was injected (first injection). Two days later, the biotinylated fluorescent dye was injected into the same tumor animal models (second injection). IVIS imaging was performed before, 6 hours after, and 9 hours after the first injection of the fluorescent dye, and then IVIS imaging was performed before, 6 hours after, and 9 hours after the second injection of the fluorescent dye, and the results are shown in FIG. 20.

[0151] As shown in FIG. 20, it was confirmed that the signal of the biotinylated fluorescent dye after first injection was strongly maintained in the cancer tissue over time by the recombinant strain of the present invention, and after the biotinylated fluorescent dye was eliminated in vivo, the signal of the biotinylated fluorescent dye after second injection was strongly maintained in the cancer tissue over time by the recombinant strain of the present invention. This means that, by regulating mSA expression of the recombinant strain of the present invention, it is possible to continuously acquire tumor images even when multiple treatments with the biotinylated fluorescent dye are performed, and that treatment with the biotinylated conjugate may be performed at adjusted time intervals.

[0152] Specifically, through the above experiments, it was confirmed that, when the recombinant vector or construct according to the present invention, especially the regulatory gene according to the present invention, is included, the monomeric streptavidin (mSA) expressed has excellent stability and can strongly bind to external biotin, and this is effective even in vivo, and treatment with the biotinylated fluorescent dye may be performed multiple times or at adjusted time intervals.

[0153] Although the present invention has been described in detail with reference to the specific features, it will be apparent to those skilled in the art that this description is only description of a preferred embodiment thereof, and does not limit the scope of the present invention. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereto.