METHOD FOR ISOLATING AND CULTURING CORD BLOOD STEM CELLS EXPRESSING GDF-3 AT HIGH LEVEL, AND USE OF GDF-3
20230406897 · 2023-12-21
Assignee
Inventors
- Jae-yong LEE (Gwangju-si, Gyeonggi-do, KR)
- Hee-jin Ahn (Seoul, KR)
- Yea-in LEE (Gwangmyeong-si Gyeonggi-do, KR)
- Dong-yeol Lee (Seoul, KR)
- Kyu-heum NA (Suwon-si, Gyeonggi-do, KR)
Cpc classification
A61K9/00
HUMAN NECESSITIES
A61K35/51
HUMAN NECESSITIES
A61P17/02
HUMAN NECESSITIES
C12N5/0665
CHEMISTRY; METALLURGY
C12N2501/115
CHEMISTRY; METALLURGY
A61K8/64
HUMAN NECESSITIES
International classification
A61K8/64
HUMAN NECESSITIES
Abstract
A method for isolating and culturing umbilical cord blood stem cells that express high levels of GDF-3 is disclosed. Umbilical cord blood stem cells isolated and cultured as described herein exhibit high expression of GDF-3. Stem cells with high expression of GDF-3 maintain high proliferation capacity contrary to conventional stem cells even as passages progress, allowing for the advantage of obtaining a large quantity of healthy stem cells. Furthermore, due to the higher proliferation rate of stem cells, it has been observed that the concentration of extracellular matrix components secreted by the cells is also higher. Therefore, when utilizing GDF-3 high-expressing umbilical cord blood stem cells for the production of cell and culture medium compositions, it is possible to produce raw materials with excellent efficacy and effects.
Claims
1. A method of producing GDF-3, which is characterized by culturing umbilical cord blood stem cells to induce GDF-3 expression.
2. The method of producing GDF-3 according to claim 1, wherein the umbilical cord blood stem cells with a cell doubling time of 24 hours or less, exhibiting a fast growth rate, are isolated and cultured.
3. The method of producing GDF-3 according to claim 1, wherein the umbilical cord blood stem cells are cultured in DMEM/F12 medium supplemented with FGF-2, EGF, TGF- superfamily growth factors, ascorbic acid, and heparin to isolate the umbilical cord blood stem cells with the desired cell doubling time.
4. The method of producing GDF-3 according to claim 1, wherein GDF-3 promotes the growth of fibroblasts.
5. The method of producing GDF-3 according to claim 4, wherein the fibroblasts that are stimulated to grow by GDF-3 are human dermal fibroblasts.
6. The method of producing GDF-3 according to claim 1, wherein GDF-3 increases the expression of at least one protein gene selected from a group consisting of GDF-3, collagen, and fibronectin, in fibroblasts.
7. The method of producing GDF-3 according to claim 1, wherein GDF-3 promotes the synthesis of bioactive substances involved in cell proliferation and/or regeneration.
8. A method of producing GDF-3-expressing umbilical cord blood stem cells, wherein umbilical cord blood stem cells with a fast cell doubling time are isolated and cultured to obtain umbilical cord blood stem cells that express GDF-3 at high levels.
9. The method of producing GDF-3-expressing umbilical cord blood stem cells according to claim 8, wherein the higher the proliferation rate of the isolated and cultured umbilical cord blood stem cells, the higher the expression level of GDF-3 in these cells.
10. The method of producing GDF-3-expressing umbilical cord blood stem cells according to claim 8, which is used to establish a cell bank for umbilical cord blood stem cells with high expression of GDF-3.
11. The method of producing GDF-3-expressing umbilical cord blood stem cells according to claim 8, comprising the following steps: (i) seeding the mononuclear cells isolated from umbilical cord blood onto a culture dish containing a medium supplemented with TGF- superfamily growth factors; and (ii) selectively isolating and culturing the mononuclear cells that attach to the culture dish and exhibit relatively rapid proliferation.
12. The method of producing GDF-3-expressing umbilical cord blood stem cells according to claim 8, wherein GDF-3-expressing umbilical cord blood stem cells are used for culturing and producing a culture medium containing GDF-3.
13. The method of producing GDF-3-expressing umbilical cord blood stem cells according to claim 8, wherein the expression level of GDF-3 increases gradually as the passages progress in GDF-3-expressing umbilical cord blood stem cells.
14. The method of producing GDF-3-expressing umbilical cord blood stem cells according to claim 8, wherein GDF-3-expressing umbilical cord blood stem cells from passage 5 or higher are used, to obtain umbilical cord blood stem cells, which express high levels of GDF-3.
15. The method of producing GDF-3-expressing umbilical cord blood stem cells according to claim 8, wherein GDF-3-expressing umbilical cord blood stem cells are expanded through successive passages, to secure a large quantity of umbilical cord blood stem cells.
16. The method of producing GDF-3-expressing umbilical cord blood stem cells according to claim 8, wherein GDF-3-expressing umbilical cord blood stem cells are expanded through successive passages, to obtain a large quantity of umbilical cord blood stem cells with superior extracellular matrix secretion capability.
17. GDF-3-expressing umbilical cord blood stem cells, which have been obtained by seeding isolated mononuclear cells from umbilical cord blood onto a culture dish containing a medium supplemented with TGF- superfamily growth factors and then selectively culturing cells based on their attachment to the culture dish and their relative fast proliferation rate.
18. A method for increasing growth of fibroblasts or for skin regeneration, characterizing by using GDF-3 produced by the method of claim 1.
19. (canceled)
20. The method according to claim 18, wherein GDF-3 increases the expression of at least one protein gene selected from a group consisting of GDF-3, collagen, and fibronectin, in fibroblasts.
21. The method according to claim 18, wherein GDF-3 promotes the synthesis of effective substances involved in cell proliferation and/or regeneration.
22. (canceled)
23. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS/FIGURES
[0023] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
DETAILED DESCRIPTION OF THE INVENTION
[0032] The inventors have conducted various experiments considering the need to obtain a large quantity of stem cells for easy establishment of a master cell bank, and the possibility of obtaining a large amount of cells and culture medium containing high levels of active ingredients. Based on these experiments, they discovered the following:
[0033] (i) High expression of GDF-3 promotes the synthesis of effective substances involved in cell proliferation and regeneration. (ii) There is a correlation between the expression level of GDF-3 in isolated and cultured umbilical cord blood stem cells and their proliferation rate. (iii) Gene expression of GDF-3 is significantly higher in umbilical cord blood stem cells. (iv) Treatment of human dermal fibroblasts (HDF) with GDF-3 results in elongated and shorter cell morphology, which is favorable for cell proliferation and sustained growth (Example 5 and
[0034] Based on these findings, the present invention has been completed.
[0035] According to the present invention, isolated and cultured umbilical cord blood stem cells exhibit the characteristic of high expression of GDF-3. Typically, as the passages progress, the proliferation of stem cells decreases, making it difficult to obtain a sufficient quantity of cells. However, in the case of stem cells expressing high levels of GDF-3, their proliferation capacity remains higher compared to the control group even as passages progress, allowing for the mass amount secure of healthy stem cells.
[0036] Additionally, the high proliferation rate of stem cells leads to increased concentration of extracellular matrix components secreted by the cells. Therefore, when producing a culture medium composition utilizing umbilical cord blood stem cells with high expression of GDF-3, it is possible to produce raw materials with excellent efficacy and effects due to the higher concentration of bioactive substances.
[0037] The method of isolating and culturing stem cells with high expression of GDF-3 according to an aspect of the present invention is characterized by the use of a newly designed stem cell culture medium. In this case, the newly designed stem cell culture medium incorporates various growth factors, including those from the TGF- superfamily.
[0038] The present invention enables the isolation and cultivation of umbilical cord blood stem cells with a cell doubling time of less than 24 hours.
[0039] As confirmed in the present invention, GDF-3 can promote the growth of fibroblasts (
[0040] Furthermore, as observed in the present invention, GDF-3 can increase the expression of GDF-3, collagen, and/or fibronectin genes in fibroblasts (
[0041] Based on the discovery that the expression level of GDF-3 in isolated and cultured umbilical cord blood stem cells is correlated with their proliferation rate, the method for producing GDF-3-expressing umbilical cord blood stem cells in accordance with an aspect of the present invention involves the isolation and cultivation of umbilical cord blood stem cells with a fast cell doubling time to secure umbilical cord blood stem cells highly expressing GDF-3.
[0042] The higher the proliferation rate of the isolated and cultured umbilical cord blood stem cells, the higher the expression level of GDF-3.
[0043] Therefore, the present invention enables the establishment of a cell bank for umbilical cord blood stem cells highly expressing GDF-3. For example, the method involves seeding the isolated mononuclear cells from umbilical cord blood onto a culture medium containing TGF- superfamily growth factors, selectively isolating and culturing mononuclear cells that attach to the culture dish and proliferate relatively rapidly, resulting in the establishment of a cell bank for GDF-3-high expressing umbilical cord blood stem cells.
[0044] Furthermore, the method for producing GDF-3-high expressing umbilical cord blood stem cells according to an aspect of the present invention is characterized by isolating and culturing umbilical cord blood stem cells with a fast cell doubling time in a culture medium (Example 1).
[0045] According to one embodiment, the method for producing GDF-3-expressing umbilical cord blood stem cells includes a first step of seeding the isolated mononuclear cells from umbilical cord blood into a culture medium containing TGF- superfamily growth factors and cultivating them; and a second step of selectively isolating and culturing mononuclear cells that attach to the culture dish and proliferate relatively rapidly.
[0046] In the second step, only the attached mononuclear cells can be cultured, while the cells that do not attach to the culture dish can be removed.
[0047] The GDF-3-expressing umbilical cord blood stem cells produced according to the present invention are capable of differentiating into adipocytes, chondrocytes, and/or osteocytes. Therefore, umbilical cord blood stem cells highly expressing GDF-3 can be used as cellular therapeutics.
[0048] The types, combinations, and concentrations of growth factors produced during stem cell culture vary depending on the origin and culture method of the stem cells. Thus, the GDF-3-expressing umbilical cord blood stem cells produced according to the present invention can be cultured to produce a GDF-3-containing culture medium. In particular, the present invention enables the isolation and culturing of umbilical cord blood-derived stem cells highly expressing GDF-3 for the production of GDF-3-containing culture medium.
[0049] Surprisingly, it was discovered that the expression level of GDF-3 in the umbilical cord blood stem cells produced according to the present invention gradually increases as passages progress (
[0050] The method for producing GDF-3-expressing umbilical cord blood stem cells according to one embodiment of the present invention is characterized by isolating and culturing umbilical cord blood stem cells in a medium containing TGF- superfamily growth factor. In this case, superior GDF-3-expressing umbilical cord blood stem cells can be obtained through serial culturing, ensuring their robust growth ability.
[0051] Therefore, the method for producing GDF-3-expressing umbilical cord blood stem cells according to an aspect of the present invention involves isolating and culturing umbilical cord blood stem cells in a medium containing various growth factors, including TGF- superfamily, and subsequently expanding the umbilical cord blood stem cells to obtain a large quantity through passages (
[0052] By serially culturing GDF-3-expressing umbilical cord blood stem cells according to an aspect of the present invention, it is possible to obtain a large quantity of umbilical cord blood stem cells with superior secretion ability of extracellular matrix components (
[0053] As mentioned, the stem cell marker GDF-3 belongs to the TGF- superfamily. TGF- is a pleiotropic factor and exhibits characteristics of a multifunctional growth factor.
[0054] TGF- (Transforming growth factor-) signaling plays a crucial role in various biological processes and performs diverse functions such as cell growth inhibition, apoptosis, differentiation, and epithelial-mesenchymal transition (EMT). The TGF- signaling pathway is tightly regulated and plays a critical role in maintaining cellular homeostasis, as well as in development and organ formation. Disruption of TGF- signaling can lead to life-threatening conditions such as cancer, fibrosis, and congenital malformations.
[0055] TGF- initially exhibits tumor-suppressive activity in the early stages of carcinogenesis but is known to promote tumor growth in later stages. TGF-1 is abundantly expressed in most cancer tissues, and its high expression is associated with malignancy and poor prognosis in cancer patients.
[0056] Secreted TGF- binds to a heteromeric complex composed of two types of receptors, type I and type II receptors, initiating signaling. When TGF- binds to the type II receptor, the type I receptor recognizes it and forms a complex with the type II receptor, leading to phosphorylation of the GS domain of the type I receptor by the type II receptor. Phosphorylated TGF- type I receptor activates downstream mediators of TGF- signaling, such as Smad2 and Smad3, by phosphorylating their C-terminal serine residues. Activated Smad2 and Smad3 form a complex with Smad4 and translocate to the nucleus, where they participate in the expression of target genes.
[0057] The tumor-suppressive role of TGF- has been demonstrated in various studies. Conversely, TGF- promotes tumor growth, invasion, and metastasis at later stages of cancer progression. The detailed molecular mechanisms underlying the switch in the role of TGF- during these opposing processes of cancer progression have not yet been clearly elucidated.
[0058] TGF- is known to play a crucial role as an executor in determining immune homeostasis and tolerance by inhibiting the function and expansion of various components of the immune system. TGF- regulates immune tolerance and inflammatory responses. The TGF- signaling directly suppresses the cytotoxic program of CD8+ T cells.
[0059] In the tumor microenvironment, excessive production of TGF-1 by cancer cells leads to significant alterations in the signaling cascade of cancer cells. These changes negatively impact the interaction between cancer cells and the tumor stroma. When cross-talk between cells is disrupted, it creates a permissive stroma that facilitates the spread of tumor cells. TGF- secreted by cancer cells induces the transition to epithelial-mesenchymal transition (EMT) and promotes the generation of cancer stem cells (CSC)-like cells, which possess similar characteristics to CSCs.
[0060] Cells undergoing EMT acquire an increased migratory ability, making them prone to undergo metastasis. These cells undergo morphological changes, adopting a spindle-shaped morphology, and undergo alterations in the cytoskeleton, enabling them to easily migrate to other organs, facilitating metastasis.
[0061] In epithelial cells, EMT is characterized by the loss of E-cadherin, a protein necessary for epithelial cell adhesion, and an increase in the expression of mesenchymal markers such as N-cadherin, vimentin, and fibronectin. TGF- serves as a key mediator of EMT by activating various transcription factors, including SNAI1/2, Twist, and ZEB1/2. Tumor cells undergoing EMT acquire cancer stem cell (CSC) properties. Similarly, TGF-, a pleiotropic factor and multifunctional growth factor, plays contrasting roles in the progression of cancer, and the detailed molecular mechanisms underlying this role switch are still not fully understood. Therefore, considering the potential for similar side effects, GDF-3, which is a member of the TGF- superfamily, may also pose similar risks. Hence, it is desirable to use GDF-3 produced in large quantities through the in vitro cultivation of isolated umbilical cord blood stem cells according to the present invention. By controlling the timing, site, and dosage of GDF-3 administration, it can be applied effectively in vivo.
[0062] In this specification, the term culture medium refers to a composition that contains essential components necessary for the growth and proliferation of cells in vitro. It encompasses stem cell culture media commonly used in the field, including but not limited to DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI 1640, DMEM/F-10 (Dulbecco's Modified Eagle's Medium: Nutrient Mixture F-10), DMEM/F-12 (Dulbecco's Modified Eagle's Medium: Nutrient Mixture F-12), a-MEM (a-Minimal essential Medium), G-MEM (Glasgow's Minimal Essential Medium), IMDM (Isocove's Modified Dulbecco's Medium), KnockOut DMEM, commercially manufactured media, or artificially synthesized media. The culture medium typically contains carbon sources, nitrogen sources, and trace elements, and may also include amino acids, antibiotics, and other additives.
[0063] Furthermore, as confirmed in the present invention, GDF-3 can stimulate the synthesis of effective substances that increase the expression of at least one selected gene(s) encoding proteins such as GDF-3, collagen, and fibronectin in fibroblasts, thereby promoting cell proliferation and/or regeneration. Therefore, it can be used as an active ingredient in compositions for fibroblast growth and proliferation (
[0064] Therefore, according to the present invention, GDF-3 can be used as an effective ingredient in compositions for skin regeneration.
[0065] Examples of compositions for skin regeneration include cosmetic compositions for skin regeneration or wrinkle improvement, dermatological compositions for topical administration, and pharmaceutical compositions for skin regeneration or wrinkle treatment. The pharmaceutical compositions of the present invention may include pharmaceutically acceptable salts of the aforementioned active ingredients.
[0066] Skin regeneration refers to the recovery of skin tissue from damage caused by external and internal factors. External factors may include ultraviolet radiation, external pollutants, wounds, injury, etc., while internal factors may include stress, etc. Skin wrinkles refer to fine lines or creases that appear on the skin and can be caused by genetic factors, a decrease in collagen and elastin present in the dermis, and external environmental factors.
[0067] Wrinkle improvement refers to the inhibition or reduction of the formation of wrinkles on the skin or the alleviation of already existing wrinkles. In the context of the present invention, skin regeneration and wrinkle improvement may include the enhancement of skin elasticity.
[0068] Wrinkle treatment refers to at least partially or temporarily halting the formation of wrinkles on the skin.
[0069] Skin elasticity is manifested by elastic fibers composed of elastin in the dermal layer. These elastic fibers have a very low elastic modulus, similar to rubber, allowing them to deform easily under minimal force and return to their original shape when the force is removed. Additionally, elastic fibers have a structure where microfibrils are embedded in an amorphous matrix called elastin. Elastin is a protein consisting of highly unique amino acids derived from lysine, including desmosine and isodesmosine, which are found exclusively in elastic fibers. Desmosine and isodesmosine form cross-links within long peptide chains, conferring rubber-like properties to elastin.
[0070] Promotion of skin elasticity refers to the maintenance or increase in skin elasticity when elastic fibers composed of elastin coexist with collagen, known as connective fibers, in sufficient amounts.
[0071] When the aforementioned active ingredients are used in cosmetic compositions, they can be formulated in various forms of emulsion and dispersion. For example, they can be formulated as lotions such as fluid lotions or nourishing lotions, liquids such as facial lotions or body lotions, creams such as nutrient creams, moisturizing creams, eye creams, essences, sprays, gels, masks, sunscreens, makeup bases, liquid or powder type of makeup removers such as cleansing creams, cleansing lotions, cleansing oils, cleansing foams, soaps, body washes, and other types of cleansers commonly used in the field.
[0072] Additionally, the cosmetic compositions may contain, in addition to the active ingredients, fatty substances, organic solvents, solubilizers, thickeners, emollients, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, surfactants, water, ionic or non-ionic emulsifiers, fillers, metal ion chelating agents, preservatives, vitamins, sunscreens, humectants, essential oils, dyes, pigments, hydrophilic or lipophilic active agents, lipid vesicles commonly used in the field of cosmetics, and other additives commonly used in the field of cosmetic science.
[0073] When the aforementioned active ingredients are used in dermatological formulations, in addition to the active ingredients, they may contain fatty substances, organic solvents, solubilizers, thickeners, emollients, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, surfactants, water, ionic or non-ionic emulsifiers, fillers, metal ion chelating agents, preservatives, vitamins, sunscreens, humectants, essential oils, dyes, pigments, hydrophilic or lipophilic active agents, lipid vesicles, or other additives commonly used in the field of dermatology. Moreover, these ingredients can be introduced in amounts commonly used in the field of dermatological formulations.
[0074] Furthermore, although not limited to, when the aforementioned active ingredients are provided in the form of dermatological formulations, they can take the form of ointments, patches, gels, creams, or sprays, among others.
[0075] The pharmaceutically acceptable salts of the aforementioned active ingredient can include organic or inorganic acid addition salts. Examples of organic acids include formic acid, acetic acid, propionic acid, lactic acid, butyric acid, isobutyric acid, trifluoroacetic acid, malic acid, maleic acid, malonic acid, fumaric acid, succinic acid, succinic acid monoamide, gluconic acid, tartaric acid, oxalic acid, citric acid, glycolic acid, glucuronic acid, ascorbic acid, benzoic acid, phthalic acid, salicylic acid, anthranilic acid, dichloroacetic acid, aminoxyacetic acid, benzene sulfonic acid, p-toluenesulfonic acid, and methanesulfonic acid derivatives. Inorganic acids can include hydrochloric acid, bromic acid, sulfuric acid, phosphoric acid, nitric acid, carbonic acid, and sulfonic acid derivatives. Preferably, the salts can be in the form of hydrochloride or acetate, and more preferably in the form of hydrochloride.
[0076] The mentioned acid addition salts are prepared by a) directly mixing the active ingredient with the acid, b) dissolving and mixing either one in a solvent or aqueous solvent, or c) placing the active ingredient in a solvent or aqueous solvent with the acid and mixing them using conventional salt preparation methods.
[0077] In addition, other possible salt forms include gabapentin salts, gabapentin enacarbil salts, pregabalin salts, nicotinic acid salts, adipate salts, hemimalonate salts, cysteine salts, acetylcysteine salts, methionine salts, arginine salts, lysine salts, ornithine salts, aspartic acid salts, and so on.
[0078] In addition, when using the active ingredient of the present invention as a pharmaceutical, it can contain one or more additional active ingredients that exhibit similar or identical functions. For example, it may include already known skin regeneration or wrinkle-improving components. By incorporating additional ingredients for skin regeneration or wrinkle improvement, the effects of skin regeneration or wrinkle improvement of the present invention's culture conditioned media can be further enhanced. When adding these ingredients, considerations can be made for skin safety in combination use, ease of formulation, and stability of active ingredients. The additional ingredients can be included in the total composition in a range of 0.0001% to 10% by weight, and the inclusion range can be adjusted according to factors such as skin safety and ease of formulation with the active ingredient.
[0079] Furthermore, the pharmaceutical composition of the present invention can include other pharmaceutically acceptable excipients.
[0080] Pharmaceutically acceptable excipients can include various components such as buffer solutions, sterile injection water, normal saline or phosphate buffer saline, sucrose, histidine, salts, and polysorbate.
[0081] The pharmaceutical composition of the present invention can be administered orally or non-orally (e.g., transdermally). It can be formulated in various dosage forms for oral and non-oral administration during clinical use. When formulating, commonly used diluents or excipients such as fillers, disintegrants, binders, lubricants, solubilizers, surfactants, etc., can be used.
[0082] Solid formulations for oral administration can include tablets, powders, granules, capsule formulations, etc. These solid formulations can be formulated by mixing at least one excipient such as starch, calcium carbonate, sucrose, or lactose, and gelatin.
[0083] In addition to simple excipients, lubricants such as magnesium stearate and talc can also be used. Liquid formulations for oral administration can include suspensions, emulsions, syrups, etc. In addition to common diluents such as water and liquid paraffin, various excipients such as moistening agents, sweeteners, flavoring agents, preservatives, etc., can be included.
[0084] Formulations for non-oral administration can include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, suppositories, etc. Non-aqueous solvents and suspending agents such as propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, can be used. Bases for suppositories can include witepsol, macrogol, tween 61, cocoa butter, laurin, and glycerol gelatin.
[0085] In the present invention, adult stem cells that highly express GDF-3 are isolated from umbilical cord blood, and the role of GDF-3 in umbilical cord blood stem cells is analyzed. The results have shown that umbilical cord blood stem cells with high expression of GDF-3 exhibit increased cell proliferation ability and extracellular matrix secretion. Furthermore, it has been discovered that GDF-3 influences cell proliferation and extracellular matrix secretion in not only stem cells but also somatic cells.
[0086] Based on these characteristics, as the potential for expansion of adult stem cells through passages increases, it becomes possible to obtain a larger quantity of stem cells and secure a significant amount of effective substances secreted by stem cells. This can be beneficial for the development of various compositions utilizing GDF-3-high expressing umbilical cord blood stem cells and the secreted substances by stem cells.
[0087] Therefore, the GDF-3-high expressing umbilical cord blood stem cells produced according to the present invention can be utilized as a key ingredient in the field of next-generation biopharmaceuticals.
[0088] Moreover, when the secretion of extracellular matrix is increased by GDF-3, the efficacy of cell culture conditioned media containing such factors is enhanced. This can be advantageous in the development of compositions applicable to cosmetics and pharmaceuticals, where the culture media can be utilized.
[0089] Hereinafter, the present invention will be described in more detail through examples. These examples are for illustrative purposes only, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not construed as being limited by these examples.
EXAMPLE 1. UMBILICAL CORD BLOOD STEM CELL ISOLATION
1.1. Isolation of Umbilical Cord Blood Mononuclear Cells
[0090] Umbilical cord blood obtained from the mother was mixed with Hetasep to remove red blood cells. The remaining mononuclear cells were isolated by processing the sample with Ficoll-plaque and subjected to centrifugation. The isolated umbilical cord blood mononuclear cells were washed with PBS. The cells were seeded onto culture dishes coated with fibronectin (50 g/ml), which had been pre-coated for 24 hours at 4 C. A novel self-developed culture medium, consisting of DMEM/F12 supplemented with FGF-2, EGF, TGF- superfamily growth factors, ascorbic acid, and heparin, was used for the culture.
1.2. Isolation of Umbilical Cord Blood Stem Cells
[0091] After 48 hours of culture, non-adherent cells were removed, and only the adherent mononuclear cells were cultured. The rapidly proliferating mononuclear cells were selectively isolated and cultured. The culture medium was replaced every 2-3 days, and umbilical cord blood stem cells with a cell doubling time of less than 24 hours were isolated. The stem cell marker was analyzed.
1.3. Analysis of Surface Marker Expression in Umbilical Cord Blood Stem Cells
[0092] Following the isolation of umbilical cord blood stem cells in step 1.2., flow cytometry experiments were performed to confirm whether the isolated cells were umbilical cord blood stem cells. For surface antigen phenotyping, 3-4 passages of cells were obtained, stained with fluorescein isothiocyanate (FITC) or phycoerythrin (PE)-conjugated antibodies, and analyzed using FACS (CytoFLEX, BECKMAN COULTER, CA).
[0093] To analyze the characteristics of the isolated umbilical cord blood stem cells from step 1.2., positive surface markers such as CD44 (mesenchymal stem cell marker), CD73 (mesenchymal stem cell marker), and CD105 (mesenchymal stem cell marker) were used. Negative surface markers including CD11b (hematopoietic progenitor cell marker), CD19 (immune cell marker), CD34 (hematopoietic progenitor cell marker), CD45 (non-hematopoietic stem cell marker), and HLA-DR (immune response-related marker) were also used. The results showed the percentage of positive cells for CD antigens of umbilical cord blood stem cells, as shown in Table 1 and represented graphically in
TABLE-US-00001 TABLE 1 the percentage (%) of cells positive for Types of CD antigens the CD antigens Positive antigens CD44 93.50% of umbilical cord CD73 94.05% blood stem cells CD105 99.33% Negative antigens CD11b 0.59% of umbilical cord CD19 2.73% blood stem CD34 0.35% CD45 0.31% HLA-DR 0.33%
Comparative Example 1
[0094] For the isolation of mononuclear cells from umbilical cord blood (1.1) and the subsequent isolation of umbilical cord blood stem cells (1.2), the same method as Example 1 was followed, except for the use of DMEM as the control medium instead of the novel self-developed stem cell culture medium.
EXAMPLE 2. UMBILICAL CORD BLOOD STEM CELL CULTURE AND PROLIFERATION ANALYSIS
[0095] The umbilical cord blood stem cells isolated from Example 1 and Comparative Example 1 were cultured in a novel stem cell culture medium based on DMEM/F12 supplemented with 10% fetal bovine serum (FBS) and fibroblast growth factor 2 (FGF2). The cells were cultured at 37 C. in a 5% CO.sub.2 incubator. The cell proliferation rates were compared (
[0096] As shown in
[0097] Furthermore, as observed in
[0098] EXAMPLE 3. COMPARISON OF EXTRACELLULAR MATRIX (ECM) SECRETION ABILITY OF UMBILICAL CORD BLOOD STEM CELLS
[0099] Umbilical cord blood stem cells isolated from Example 1 and Comparative Example 1 were cultured through passages. Umbilical cord blood stem cells at each passage were seeded at a density of 41010.sup.3 cells/cm.sup.2. After 24 hours, the cells were washed with PBS and the culture medium was exchanged with serum-free media. The cells were then cultured for 2-7 days to obtain the umbilical cord blood stem cell culture supernatant.
[0100] The expression levels of fibronectin in the umbilical cord blood stem cell culture supernatant for each passage were analyzed using an ELISA kit (
[0101] As shown in
[0102] Therefore, the umbilical cord blood stem cells isolated from Example 1 not only demonstrated enhanced cell proliferation compared to the umbilical cord blood stem cells derived from Comparative Example 1 but also exhibited increased secretion of ECM components.
EXAMPLE 4. ANALYSIS OF GDF-3 MRNA EXPRESSION AT EACH PASSAGE
[0103] Umbilical cord blood stem cells isolated from Example 1 and Comparative Example 1 were cultured through passages. Umbilical cord blood stem cells at each passage were washed with PBS and dissociated with Trypsin EDTA. The dissociated cells were resuspended in an equal volume of culture medium containing twice the amount of Trypsin EDTA to deactivate it. The suspended cells were centrifuged to remove the supernatant. The cell pellet was resuspended in PBS, followed by another centrifugation to remove the supernatant. Total RNA was extracted using the PureLink RNA Mini Kit (Invitrogen), and the concentration was determined. cDNA synthesis was performed using the extracted total RNA.
[0104] Real-Time PCR was conducted using the synthesized umbilical cord blood stem cell cDNA and the primers listed in Table 2 to quantify the expression levels of GDF-3 at each passage. GAPDH, a housekeeping gene, was used as the loading control (
TABLE-US-00002 TABLE2 GAPDH Forward GACCTGCCGTCTAGAAAAAC Reverse TTGAAGTCAGAGGAGACCAC GDF-3 Forward AGACTTATGCTACGTAAAGGA Reverse CTTTGATGGCAGACAGGTTAA
[0105] As observed in the graph in
[0106] Furthermore, as shown in
EXAMPLE 5. ANALYSIS OF HUMAN DERMAL FIBROBLAST (HDF) CHARACTERISTICS TREATED WITH GDF-3
[0107] During the cultivation of Human Dermal Fibroblasts (HDF), the cell characteristics were analyzed through mRNA analysis comparing the group treated with GDF-3 to the untreated control group. As shown in
EXAMPLE 6. THE EFFECTS OF GDF-3 ON HDF Growth
[0108] During the cultivation of Human Dermal Fibroblasts (HDF) in DMEM medium, GDF-3 was administered at concentrations ranging from 1 to 100 ng/ml at 48-hour intervals. As shown in
Example 7. Gene Expression Analysis Of Extracellular Matrix (ECM) COMPONENTS IN GDF-3-HIGH EXPRESSING HDF
[0109] The gene expression of skin structural components such as Collagen and Fibronectin, which are involved in skin regeneration, was examined using the Real-Time PCR technique following GDF-3 treatment (
[0110] As shown in