A HIGH-THROUGHPUT AUTOMATED GENE SYNTHESIS DEVICE BASED ON CLUSTER ARRAY

20230407359 ยท 2023-12-21

    Inventors

    Cpc classification

    International classification

    Abstract

    A high-throughput automated gene synthesis device based on a cluster array includes a substrate and a microwell plate; the substrate is provided with a plurality of clusters of micropores; the inner wall surface of the micropores is chemically modified as a solid phase carrier for nucleic acid synthesis, or the micropore is filled with solid phase carriers; the clusters of micropores are arranged in a cluster array and each cluster of micropores has the same size and corresponding position as each well on the microwell plate. When using the device to synthesize oligonucleotides, by automatically recovering the synthesized oligonucleotides into a standard SBS plate of the corresponding size under the device, the oligonucleotide pool for each gene is formed. The yield of oligonucleotides is in picomole level, which is used for subsequent polymerase-mediated gene assembly (PCA) or ligase-mediated gene assembly (LCR) without amplification.

    Claims

    1-14. (canceled)

    15. A high-throughput gene synthesis device based on cluster arrays, including a substrate and a microwell plate; the substrate is provided with a plurality of clusters of micropores; the inner wall surface of the micropore is chemically modified as a solid phase carrier for nucleic acid synthesis, or the micropore is filled with solid phase carriers for nucleic acid synthesis; a plurality of clusters of the micropores are arranged in a cluster array, and each cluster of the micropores has the same size and corresponding position as each well on the microwell plate.

    16. The gene synthesis device according to claim 15, wherein the micropore is a funnel-shaped micropore or a cylindrical micropore; the opening of the funnel-shaped micropore is a large opening end.

    17. The gene synthesis device according to claim 16, wherein the substrate is a silicon wafer.

    18. The gene synthesis device according to claim 17, wherein the micropore is prepared by the MEMS micro-nano processing method.

    19. The gene synthesis device according to claim 16, wherein the substrate is a polymer plastic plate.

    20. The gene synthesis device according to claim 16, wherein the micropore is prepared by 3D printing or injection molding.

    21. The gene synthesis device according to claim 15, wherein the solid phase carriers are glass microspheres or polystyrene microspheres.

    22. The gene synthesis device according to claim 15, wherein the solid phase carriers are immobilized in the micropore as follows: mixing the solid phase carriers with high-density polyethylene spheres, and sintering.

    23. The gene synthesis device according to claim 15, wherein each cluster of the micropores includes from 4 to 68 of the micropores.

    24. The gene synthesis device according to claim 15, wherein the microwell plate is a standard SBS plate.

    25. Any of the following methods: (i) a method for oligonucleotide synthesis; (ii) a method for nucleic acid synthesis; (iii) a method for synthesizing oligonucleotides and genes.

    26. The method according to claim 25, wherein the method for oligonucleotide synthesis comprises the steps of: (1) Phosphoramidite monomers or auxiliary reagents are added to the micropores of the gene synthesis device utilizing a liquid dispensing device; (2) The reaction is conducted on the solid phase carriers within the micropores to synthesize the oligonucleotides; (3) The gene synthesis device is then matched with the microwell plate; (4) The oligonucleotides synthesized in each cluster of the micropores are recovered into a single well within the microwell plate.

    27. The method according to claim 26, wherein the liquid dispensing device is a micro-nano litre level liquid dispensing head.

    28. The method according to claim 25, wherein the method for nucleic acid synthesis comprises the steps of: (1) Synthesis of oligonucleotides within the micropores of a gene synthesis device, using any of the methods specified in claim 25; (2) Recovery of the oligonucleotides from all the micropores in a cluster into a single well of a microwell plate; (3) Direct splicing of the recovered oligonucleotides to obtain the synthesized nucleic acid.

    29. The method according to claim 25, wherein the method for synthesizing oligonucleotides and genes comprises the use of a gene synthesis device, wherein the gene synthesis device includes a substrate and a microwell plate; the substrate is provided with a plurality of clusters of micropores; the inner wall surface of the micropore is chemically modified as a solid phase carrier for nucleic acid synthesis, or the micropore is filled with solid phase carriers for nucleic acid synthesis; and a plurality of clusters of the micropores are arranged in a cluster array, and each cluster of the micropores has the same size and corresponding position as each well on the microwell plate.

    Description

    DESCRIPTION OF THE DRAWINGS

    [0025] FIG. 1 shows a process flow of processing funnel-shaped micropores arranged in clusters on a silicon wafer.

    [0026] FIG. 2 shows a SEM image of a funnel-shaped micropore on a silicon wafer (FIG. 2A) and an image of loaded microspheres in a micropore (FIG. 2B).

    [0027] FIG. 3 shows a nucleic acid synthesis device based on funnel-shaped micropores arranged in clusters on a silicon wafer (when a standard 96-well plate is used for recovering).

    [0028] FIG. 4 shows a nucleic acid synthesis device based on funnel-shaped micropores arranged in clusters on a silicon wafer (when a standard 384-well plate is used for recovering).

    [0029] FIG. 5 shows a nucleic acid synthesis device based on funnel-shaped micropores arranged in clusters on a silicon wafer (when a standard 1536-well plate is used for recovering).

    [0030] FIG. 6 shows a nucleic acid synthesis device based on funnel-shaped micropores arranged in cluster arrays on a polymer plastic plate (when a standard 96-well plate is used for recovering).

    [0031] FIG. 7 shows a nucleic acid synthesis device based on funnel-shaped micropores arranged in cluster arrays on a polymer plastic plate (when a standard 384-well plate is used for recovering).

    [0032] FIG. 8 shows a dispensing device based on a micro-nano dispensing head.

    [0033] FIG. 9 shows a flow chart of the overall process of gene synthesis.

    [0034] FIG. 10 is a graph showing the detection by capillary electrophoresis (150 nt) after oligonucleotide synthesis.

    [0035] FIG. 11 is a graph showing the detection of PCA products by capillary electrophoresis.

    [0036] FIG. 12 is a graph showing the detection of PCR products by capillary electrophoresis.

    [0037] FIG. 13 is a graph showing the detection of error-corrected products by capillary electrophoresis.

    [0038] FIG. 14 shows the sequencing results of strain 1 (including FIG. 14-A, FIG. 14-B and FIG. 14-C).

    [0039] FIG. 15 shows the sequencing results of strain 2 (including FIG. 15-A, FIG. 15-B and FIG. 15-C).

    DETAILED DESCRIPTION OF THE INVENTION

    [0040] The experimental methods in the following examples are conventional methods unless otherwise specified.

    [0041] The materials, reagents, and etcetera used in the following examples can be obtained from commercial sources unless otherwise specified.

    Example 1: Preparation of Funnel-Shaped Micropores Arranged in Clusters on Silicon Wafers and Loading of Microspheres

    [0042] The process flow of processing funnel-shaped micropores arranged in clusters on a silicon wafer is shown in FIG. 1: [0043] (1) On both sides of an 8-inch silicon wafer with a thickness of 400 jam and double-sided polished, a 20 nm thick layer of silicon nitride is deposited by chemical vapor deposition, as shown in FIG. 1A. [0044] (2) Photoresist is coated on the front side of the silicon wafer, and the mask plate is used for photolithography, as shown in FIG. 1B. [0045] (3) The silicon nitride layer was removed by reactive ion etching, as shown in FIG. 1C. [0046] (4) The silicon is etched to the bottom silicon nitride layer using a wet etching solution of potassium hydroxide with an etching angle of 54.7, as shown in FIG. 1D. [0047] (5) The silicon nitride layer at the small opening of the inverted wedge-shaped hole on the back of the silicon wafer is removed by ultrasonic (or reactive ion etching), creating a through hole, as shown in FIG. 1E.

    [0048] FIG. 2A illustrates a scanning electron microscope (SEM) image with an opening side length of 605 jam above a funnel-shaped micropore. [0049] (6) The funnel-shaped microhole obtained by the above process is a reaction cavity for oligonucleotides. Polystyrene microspheres or glass microspheres (solid phase carriers) are loaded into the funnel-shaped micropores. The microspheres are mixed with high-density polyethylene spheres in a certain ratio (such as 1:1) and sintered at 140 C. for 45 minutes. The high-density polyethylene spheres are used to achieve physical bonding between the solid phase carriers and the inner wall of the funnel-shaped micropores, thus fixing the solid phase carriers inside the through hole, as shown in FIG. 1F. The image after loading the solid phase carriers into the funnel-shaped micropores is shown in FIG. 2B. Subsequent oligonucleotide chemical synthesis reactions are carried out on the solid phase carriers, and the carrier surface is connected with intermediates, which can serve as the starting point for nucleic acid synthesis.

    Example 2: Nucleic Acid Synthesis Device Based on Funnel-Shaped Micropores Arranged in Clusters on a Silicon Wafer

    [0050] FIGS. 3, 4 and 5 show three different throughputs of nucleic acid synthesis devices for the purpose of gene synthesis.

    [0051] As shown in FIG. 3, there are 13 funnel-shaped micropores 1 (oligonucleotide synthesis pores) on a silicon wafer form a cluster. The silicon wafer is combined with a 96-wellplate below. A dispensing system based on micro-nano dispensing heads is used to conduct the chemical synthesis of oligonucleotides on the solid-phase carriers in the funnel-shaped micropore 1, and the oligonucleotides synthesized in the 13 funnel-shaped micropores 1 are automatically recovered into a large well 2 (gene splicing well), followed by automated one-step splicing to synthesize a gene.

    [0052] FIGS. 4 and 5 are schematic diagrams of the devices for synthesizing 384 and 1536 genes, with 7 and 4 funnel-shaped micropores 1 as a cluster, respectively. The arrangement and density of each cluster of funnel-shaped micropores can be adjusted according to the length of the gene to be synthesized, the crystal orientation and thickness of the silicon wafer, the size of the upper and lower openings of the funnel-shaped micropores, and the like.

    Example 3: Nucleic Acid Synthesis Device Based on Funnel-Shaped Micropores Arranged in Cluster Arrays on a Polymer Plastic Plate

    [0053] FIGS. 6 and 7 illustrate two different throughputs of nucleic acid synthesis devices for the purpose of gene synthesis.

    [0054] As shown in FIG. 6, there are 1536 funnel-shaped micropores 1 (oligonucleotide synthesis pores) with large upper opening and small lower opening arranged on the polymer plastic plate. The funnel-shaped micropore 1 is loaded with fits obtained by sintering solid phase carriers and high-density polyethylene spheres. A dispensing system based on micro-nano dispensing heads is used to conduct the synthesis of oligonucleotides on the solid phase carriers in the micropore. 16 pores form a cluster, and 16 kinds of oligonucleotides are synthesized in the pore. The oligonucleotides are automatically recovered into one large well 2 (gene splicing well) of the 96-well plate, i.e., the assembly of one gene can be completed in one large well 2, and the assembly of 96 genes can be completed simultaneously.

    [0055] As shown in FIG. 7, 4 pores form a cluster and 384 genes can be assembled simultaneously.

    Example 4: Oligonucleotide Synthesis

    [0056] Nucleic acid synthesis reactions were carried out on the solid phase carriers in funnel-shaped micropores on silicon wafers or in micropores in polymer plastic plates: standard chemical synthesis methods (including the steps of deprotection, coupling, capping and oxidation) may be used.

    [0057] Specific chemical synthesis implementation method is as follows: using different micro-nano dispensing heads for four or more different (deoxygenated/modified) nucleotide monomer solutions and activators and/or auxiliary reagents, according to the sequence information to be synthesized in each synthesis pore. The liquid type, position and liquid amount of the dispensing head were automatically controlled to complete the chemical synthesis of nucleic acid.

    [0058] The liquid dispensing device used in the synthesis process is a micro-nanoliquid dispensing head, as shown in FIG. 8. The overall frame adopts a high-precision marble platform as the installation reference surface, a gantry-type 4-axis servo positioning transmission, and the X-axis, Y1-axis, and Y2-axis choose a high-precision linear motor drive, with Z-axis precision screw drive module. The core dispensing element is a micro-nano dispensing head with high-speed response accuracy. The liquid dispensing process is assisted by the visual positioning of the workstation; the waste liquid generated during the synthesis process is collected into a waste liquid bottle by negative pressure generated by a vacuum pump. Among them, two identical parallel stations, Y1 and Y2, are set in the Y direction, and the two axes alternately dispense the liquid to improve the synthesis throughput and efficiency; 4 of the above cluster array plates can be installed on the Y1/Y2 axis fixture, and the array plate is driven to the zero point in the Y axis direction. Five micro-nano dispensing heads and auxiliary positioning cameras are installed on the Z-axis. After the X-axis drives the Z-axis camera to locate the synthetic dispensing origin, the X-axis is continuously positioned in the position control mode to drive the micro-nano liquid dispensing head to selectively dispense into the micropores corresponding to the first row, and the X-axis returns to zero point. Next, the Y-axis drives the fixture to advance one row, and the X-axis flight mode is used to selectively dispense liquid to the second row, and so on, to complete the automated synthesis of 1 base of 4 cluster array plates.

    [0059] A purified 150 nt oligonucleotide product was detected on the 2100 Bioanalyzer using the capillary electrophoresis kit, RNA Pico 6000 Kit (Agilent, Cat. No. 5067-1513).

    Example 5. Gene Synthesis

    [0060] The flow chart of the overall process of gene synthesis is shown in FIG. 9.

    [0061] The oligonucleotides synthesized in each cluster of funnel-shaped micropores are recovered into one well of the corresponding multi-well plate (96 wells, 384 wells, 1536 wells), and gene splicing and assembly are performed directly in the corresponding wells to achieve automated parallel synthesis of 96 or 384 or 1536 genes.

    [0062] For example, to synthesize the 1546-base CDS sequence (with a 27-base tag sequence at the N-terminus for protein purification) of the methylcytosine dioxygenase (Tet1, mouse) gene, the sequence is as follows (SEQ ID NO: 1 in the Sequence Listing):

    TABLE-US-00001 5-ATGGACTACAAAGACGATGACGACAAGGAAGCTGCACCCTGTGACTG TGATGGAGGTACACAAAAAGAAAAAGGCCCATATTATACACACCTTGGGG CAGGACCAAGTGTGGCTGCTGTCAGGGAGCTCATGGAGACTAGGTTTGGC CAGAAGGGGAAGGCAATCCGGATTGAGAAGATAGTGTTCACGGGGAAGGA AGGGAAGAGCTCTCAGGGCTGCCCGGTCGCCAAGTGGGTGATCAGAAGAA GTGGTCCTGAAGAGAAGCTTATTTGTTTGGTTCGTGAGCGTGTAGACCAT CACTGTTCGACGGCTGTGATAGTTGTCCTTATCCTGCTGTGGGAAGGTAT CCCTCGCCTGATGGCTGACCGCCTGTACAAAGAGCTCACTGAGAACTTGA GGTCCTACAGCGGACATCCCACAGACCGAAGATGTACCCTCAACAAAAAG CGTACCTGCACCTGTCAAGGCATCGACCCAAAAACCTGCGGAGCGTCCTT CTCCTTTGGCTGTTCGTGGAGCATGTATTTCAACGGCTGTAAGTTTGGGA GGAGTGAAAACCCCAGAAAATTCAGACTTGCTCCAAACTACCCCTTACAT AACTACTATAAGAGAATTACTGGAATGAGTTCTGAAGGAAGTGACGTGAA AACCGGGTGGATCATTCCAGACCGCAAGACCCTCATAAGCAGAGAGGAAA AACAGCTTGAAAAGAATTTACAAGAATTGGCTACAGTATTAGCTCCACTT TACAAGCAGATGGCTCCAGTTGCTTATCAAAATCAGGTGGAATATGAAGA AGTTGCTGGAGACTGTCGACTTGGAAATGAAGAGGGGCGTCCTTTCTCTG GTGTCACCTGTTGCATGGATTTTTGTGCCCATTCTCACAAGGACATTCAC AACATGCACAACGGAAGCACCGTGGTGTGTACGTTGATTCGAGCAGATGG CCGTGACACAAATTGTCCCGAGGATGAACAACTCCACGTCCTGCCACTAT ACCGGCTTGCAGACACTGATGAATTTGGCTCCGTGGAAGGGATGAAGGCC AAAATCAAATCTGGGGCCATCCAAGTCAATGGGCCAACCAGGAAGAGGCG ACTACGTTTTACTGAGCCTGTTCCTCGATGTGGGAAGAGGGCCAAAATGA AGCAGAACCACAATAAATCAGGTTCACACAACACTAAGAGCTTTTCATCA GCCTCATCTACTTCTCACCTAGTGAAAGACGAATCTACAGACTTCTGTCC CCTGCAGGCTTCCTCCGCAGAAACATCTACCTGTACGTACAGTAAAACAG CCTCAGGTGGGTTTGCAGAAACAAGTAGTATTCTCCACTGCACAATGCCT TCTGGAGCACACAGTGGTGCTAATGCAGCTGCTGGGGAATGTACTGGAAC GGTGCAGCCTGCCGAGGTGGCTGCTCATCCTCACCAGTCTCTTCCCACAG CCGATTCTCCCGTTCATGCTGAGCCTCTCACTAGTCCATCTGAGCAGCTA ACTTCTAACCAGTCAAACCAGCAGCTCCCTCTCCTCAGCAATTCTCAGA- 3

    [0063] The process of gene synthesis is as follows:

    [0064] (1) Design of Oligonucleotide Sequences According to the DNA Sequence of the Target Gene

    [0065] By using DNAWorks, the target DNA sequence was codon-optimized and split into 12 sequence fragments connected end to end. And each segment was about 150 nt in length, the average number of bases in the overlapping region was about 20 bp, and the Tm value was 62 C. The head and tail primers for amplifying the 1546 nt fragment, Pa and Pb, were designed. The sequences of the 12 fragments and the head and tail primers are shown in Table 1:

    TABLE-US-00002 TABLE1 Seqs1-12andthesequencesoftheheadandtailprimers Name Sequence(5-3) Length(nt) Seq1 ATGGACTACAAAGACGATGACGACAAGGAAGCTGCACCCTGTGACTGTGATGGAGGTACACAA 108(correspondingto AAAGAAAAAGGCCCATATTATACACACCTTGGGGCAGGACCAAGT positions1-108inabove CDSsequence) Seq2 TGATCACCCACTTGGCGACCGGGCAGCCCTGAGAGCTCTTCCCTTCCTTCCCCGTGAACACTGG 150(correspondingto ATTGCCTTCCCCTTCTGGCCAAACCTAGTCTCCATGAGCTCCCTGACAGCAGCCACACTTGGTC positions92-241inabove CTGCCCCAA CDSsequence) Seq3 TCGCCAAGTGGGTGATCAGAAGAAGTGGTCCTGAAGAGAAGCTTATTTGTTTGGTTCGTGAGC 150(correspondingto GTGTAGACCATCACTGTTCGACGGCTGTGATAGTTGTCCTTATCCTGCTGTGGGAAGGTATCCCT positions224-373inabove CGCCTGATGGCTGACCGCCTGT CDSsequence) Seq4 CCAAAGGAGAAGGACGCTCCGCAGGTTTTTGGGTCGATGCCTTGACAGGTGCAGGTACGCTTT 150(correspondingto TTGTTGAGGGTACATCTTCGGTCTGTGGGATGTCCGCTGTAGGACCTCAAGTTCTCAGTGAGCT positions357-506inabove CTTTGTACAGGCGGTCAGCCATC CDSsequence) Seq5 GAGCGTCCTTCTCCTTTGGCTGTTCGTGGAGCATGTATTTCAACGGCTGTAAGTTTGGGAGGAG 150(correspondingto TGAAAACCCCAGAAAATTCAGACTTGCTCCAAACTACCCCTTACATAACTACTATAAGAGAATT positions488-637inabove ACTGGAATGAGTTCTGAAGGAA CDSsequence) Seq6 GGAGCCATCTGCTTGTAAAGTGGAGCTAATACTGTAGCCAATTCTTGTAAATTCTTTTCAAGCTG 150(correspondingto TTTTTCCTCTCTGCTTATGAGGGTCTTGCGGTCTGGAATGATCCACCCGGTTTTCACGTCACTTC positions615-764inabove CTTCAGAACTCATTCCAGTA CDSsequence) Seq7 ACTTTACAAGCAGATGGCTCCAGTTGCTTATCAAAATCAGGTGGAATATGAAGAAGTTGCTGGA 150(correspondingto GACTGTCGACTTGGAAATGAAGAGGGGCGTCCTTTCTCTGGTGTCACCTGTTGCATGGATTTTT positions744-893inabove GTGCCCATTCTCACAAGGACAT CDSsequence) Seq8 CCCATTTCACAAGGACATTCACAACATGCACAACGGAAGCACCGTGGTGTGTACGTTGATTCG 150(correspondingto AGCAGATGGCCGTGACACAAATTGTCCCGAGGATGAACAACTCCACGTCCTGCCACTATACCG positions874-1023inabove GCTTGCAGACACTGATGAATTT CDSsequence) Seq9 GCTTGCAGACACTGATGAATTTGGCTCCGTGGAAGGGATGAAGGCCAAAATCAAATCTGGGGC 150(correspondingto CATCCAAGTCAATGGGCCAACCAGGAAGAGGCGACTACGTTTTACTGAGCCTGTTCCTCGATGT positions1002-1151inabove GGGAAGAGGGCCAAAATGAAGCA CDSsequence) Seq10 ACAGGTAGATGTTTCTGCGGAGGAAGCCTGCAGGGGACAGAAGTCTGTAGATTCGTCTTTCAC 150(correspondingto TAGGTGAGAAGTAGATGAGGCTGATGAAAAGCTCTTAGTGTTGTGTGAACCTGATTTATTGTGG positions1132-1281inabove TTCTGCTTCATTTTGGCCCTCTT CDSsequence) Seq11 CCGCAGAAACATCTACCTGTACGTACAGTAAAACAGCCTCAGGTGGGTTTGCAGAAACAAGTA 150(correspondingto GTATTCTCCACTGCACAATGCCTTCTGGAGCACACAGTGGTGCTAATGCAGCTGCTGGGGAATG positions1262-1411inabove TACTGGAACGGTGCAGCCTGCCG CDSsequence) Seq12 TCTGAGAATTGCTGAGGAGAGGGAGCTGCTGGTTTGACTGGTTAGAAGTTAGCTGCTCAGATG 150(correspondingto GACTAGTGAGAGGCTCAGCATGAACGGGAGAATCGGCTGTGGGAAGAGACTGGTGAGGATGA positions1397-1546inabove GCAGCCACCTCGGCAGGCTGCACCG CDSsequence) Pa ATGGACTACAAAGACGATGACG 22 Pb TCTGAGAATTGCTGAGGAGAGG 22

    [0066] (2) Synthesis of Oligonucleotides

    [0067] The designed oligonucleotides were synthesized on the solid phase carriers in the funnel-shaped micropores in cluster arrays, and each cluster of oligonucleotides after ammonolysis was recovered into one well of the corresponding 96-well plate/384-well plate. The recovered oligonucleotide pools (Seq1-Seq12) were directly used for gene assembly without further purification steps. The oligonucleotide pools (Seq1-Seq12) were detected by capillary electrophoresis on Agilent 2100 Bioanalyzer, and the results are shown in FIG. 10.

    [0068] (3) One-Step Gene Assembly Using the Polymerase Approach

    [0069] The polymerase-based assembly method comprises two steps. The first step was Polymerase Cycling Assembly (PCA). 12 oligonucleotide fragments were used as primers and templates for each other to perform one-step splicing. PCR amplification of the spliced target fragments was carried out using the head and tail primers, Pa and Pb, and the product was tested by capillary electrophoresis on Agilent 2100 Bioanalyzer.

    [0070] The PCA reaction system: 2HiFi HotStart ReadyMix (Roche, Cat. No. KK2602), oligomix (4 pmoL each), and nuclease-free water to bring the volume to 4 L (minimum reaction volume: 2 L, maximum volume: 50 L)

    TABLE-US-00003 TABLE 2 PCA reaction system Components Volume (L) 2 HiFi HotStart Ready Mix 2 OligoMix (4 pmol) 2 Total 4

    [0071] The following reaction program was executed:

    TABLE-US-00004 TABLE 3 PCA reaction program STEP Temperature ( C.) Time Intial Denaturation 95 5 min 18 Cycles 95 15 s 60 15 s 72 50 s Final Extension 72 10 min Hold 12 Hold

    [0072] The head and tail primers, Pa and Pb, were used to amplify the spliced target fragment by PCR. The reaction system:

    TABLE-US-00005 TABLE 4 PCR reaction system Components Volume (L) 2 HiFi HotStart Ready Mix 25 Pa (10 uM) 1 Pb (10 uM) 1 PCA product 1 Nuclease-free water 22 Total 50

    [0073] The following PCR reaction program was executed:

    TABLE-US-00006 TABLE 5 PCR reaction program STEP Temperature ( C.) Time Intial 95 5 min Denaturation 18 Cycles 95 15 s 57 15 s 72 50 s Final Extension 72 10 min Hold 12 Hold

    [0074] After the above PCA reaction, the Smear product after the fragment fusion was obtained, and then the PCA product was subjected to a PCR reaction to carry out the full-length fragment synthesis of the gene to obtain the 1546 bp target fragment using bilateral primers. CorrectASE enzyme (Thermo Fisher, Cat. No. A14972) was used for the error correction of the PCR product to obtain the final product for downstream cloning. The PCA, PCR, and error-corrected products were tested on 2100 bioanalyzer using a capillary electrophoresis kit, High Sensitivity DNA Kit (Agilent, Cat. No. 5067-4626). The fragment analysis results are shown in FIG. 11, FIG. 12 and FIG. 13.

    [0075] On the basis of one-step assembly, the PCA system can be reduced to 2-5 L, and the components of PCR reaction system can be directly added into the PCA reaction tube for one-tube assembly.

    [0076] (4) Clone Sequencing

    [0077] After ligating the PCR product obtained in step (3) and the error-corrected product with the T vector, the plasmids were transferred into Escherichia coli DH5 competent cells, and every 10 to 16 positive clones were picked for first-generation sequencing. The sequencer used was ABI 3730 XL, and it was found that all the sequence results showed that the fragments of the target length had been successfully synthesized, and it was ensured that at least one strain contained completely correct sequences, while other sequences contained from 1 to 2 mutation sites. The sequencing results are shown in FIGS. 14-19. Among them, FIG. 14 is the sequencing result of strain 1 (including FIG. 14-A, FIG. 14-B and FIG. 14-C, three Sanger sequencing fragments were fully sequenced), FIG. 15 is the sequencing result of strain 2 (including FIG. 15-A, FIG. 15-B and FIG. 15-C, three Sanger sequencing fragments were fully sequenced), the sequencing result of strain 1 was correct, and the sequencing result of strain 2 had 1 base error. The above results were detected by Agilent 2100 Bioanalyzer, showing broad tailed peaks of uncorrected genes, and sequencing shows an error rate of about 1/500 to 1/1000.

    [0078] Then two rounds of error correction were performed using CorrectASE. After the first and second rounds of correction, on the 2100 bioanalyzer, a sharper peak was detected, indicating a lower error rate. From the error-corrected products obtained in step (3), 2 to 4 colonies were picked for sequencing to obtain completely correct gene clones. Sequencing results showed that after error correction, the sequencing showed an error rate of about 1/3000-1/10000.

    INDUSTRIAL APPLICATION

    [0079] The high-throughput automated gene synthesis system based on cluster arrays completes the high-throughput oligonucleotide synthesis through the funnel-shaped pores in cluster structure. Then these cluster arrays are one-to-one automatically recovered into the wells of standard SBS plates to form oligonucleotide pools for subsequent gene assembly. The yield of oligonucleotides reaches picomole level, which can just meet the needs of gene splicing without amplification.

    [0080] Compared with the traditional gene synthesis method, it avoids both a large number of the manual operations of mixing oligonucleotides, and waste caused by the nanomole level products of traditional oligonucleotide synthesis approach. Compared with oligonucleotides synthesized based on microarray chips, the yield of a single oligonucleotide is higher which can be directly used for subsequent gene assembly without amplification. There is no need for a PCR splitting step in high-throughput oligonucleotide sub-pools. At the same time, errors caused by amplification can be effectively reduced, thereby reducing the error rate.

    [0081] At the same time, ultra-long oligonucleotides can realize one-step splicing and simplify the operation steps. The synthesis amount of each oligonucleotide just meets the picomole level of gene splicing, which reduces the synthesis cost. At the same time, the cluster synthesis of unique oligonucleotides is innovatively connected with the standard microwell plate for downstream gene splicing, which achieves a higher automation level than traditional multi-step splicing.

    [0082] The present invention solves the current bottlenecks in the field of gene synthesis, such as low-throughput, and cumbersome manual operation, provides a commercialized and low-cost high-throughput automated gene synthesis method.