TRANSFERABLE TYPE I-F CRISPR-CAS GENOME EDITING SYSTEM
20230407339 ยท 2023-12-21
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N15/74
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N2800/80
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
International classification
C12N15/90
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N9/12
CHEMISTRY; METALLURGY
Abstract
A generic type I CRISPR-Cas-based genome-editing system that can be used in microbial hosts having diverse genetic backgrounds has been established. The chromosomal integration system overcomes the limitations of narrow host range and the requirement for antibiotics to maintain propagation and expression which are associated with plasmid-encoded Cas proteins. Compositions and methods for a chromosomal integrated type I-F CRISPR-Cas system for programmable genome editing and robust gene regulation are provided. In some embodiments, the compositions and methods are effective to selectively and specifically edit and/or regulate the genome of multiple microbial species with diverse genotypes. Compositions and methods for gene editing and/or gene regulation in Pseudomonas spp, such as multiple strains of P. aeruginosa, are described.
Claims
1. A system for changing, adding, and/or deleting one or more genes in a microbial cell, comprising (a) a nucleic acid type I-F cas system vector, comprising (i) a type I-F cas operon, comprising the cas genes cas1, cas2-3, cas8f, cas5, cas7 and cas6, and a nucleic acid sequence configured to promote transcription of the cas genes in the microbial cell; (ii) one or more genes encoding an integrase enzyme; (iii) a nucleic acid sequence recognized as an integration site configured to recognize and attach the vector to a target attachment site within the microbial genome; (iv) two nucleic acid sequences configured to be Flp recombinase target sites; and (v) one or more reporter genes and a nucleic acid sequence configured to promote transcription of the reporter gene(s) upon integration into the microbial cell genome; wherein the vector is configured for integration into the genome of the microbial cell via attachment at the target attachment site; and (b) a nucleic acid editing vector comprising one or more CRISPR RNA (crRNA) nucleic acids and repair donors, configured to change, add, and/or delete one or more target genomic sites in the microbial cell through the type I-F CRISPR-Cas system.
2. The system of claim 1, further comprising (c) a nucleic acid targeting vector, comprising one or more CRISPR RNA (crRNA) nucleic acids configured to disrupt one or more target genomic sites in the microbial cell required for transcription and/or expression of the one or more reporter genes within the type I-F cas system vector.
3. The system of claim 1, wherein the one or more reporter genes within the nucleic acid type I-F cas system vector is a lacZ reporter gene.
4. The system of claim 2, wherein the targeting vector comprises crRNA nucleic acids configured to disrupt one or more genes associated with expression of the Acyl-homoserine-lactone synthase enzyme.
5. The system of claim 1, wherein the type I-F cas operon is the type I-F cas operon from P. aeruginosa strain PA154197.
6. The system of claim 1, wherein the target attachment site within the microbial genome is the attB site of Pseudomonas aeruginosa.
7. The system of claim 1, wherein the nucleic acid I-F cas system vector further comprises: (vi) a functional phage -red recombination system, comprising genes encoding -Red proteins Exo, Gam, and Beta, and an arabinose-inducible promoter.
8. The system of claim 1, further comprising (c) a nucleic acid CRISPR-Cas removal vector, comprising one or more CRISPR RNA (crRNA) nucleic acids configured to delete an integrated type I-F cas system from the microbial cell.
9. A system for repressing a gene of interest in a microbial cell, comprising a nucleic acid type I-F CRISPRi system vector comprising (i) a type I-F cas operon, comprising the cas genes cas1, cas8f, cas5, cas7, and cas6, and a nucleic acid sequence configured to promote transcription of the cas genes in the microbial cell, wherein the type I-F cas operon lacks a functional copy of cas2-3 gene; (ii) one or more genes encoding an integrase enzyme; (iii) a nucleic acid sequence encoding an integration site configured to recognize and attach the plasmid to a target attachment site within the microbial genome; (iv) two nucleic acid sequences configured to be Flp recombinase target sites; (v) one or more reporter genes and a nucleic acid sequence configured to promote transcription of the reporter gene(s) upon integration into the microbial cell genome; and (vi) one or more CRISPR RNA (crRNA) nucleic acids, configured to target one or more sites of the gene of interest in the genome of the microbial cell, wherein the vector is configured for integration into the genome of the microbial cell via attachment at the target attachment site.
10. The system of claim 9, wherein the functional copy of cas2-3 gene is absent from the type I-F cas operon.
11. The system of claim 9, wherein the one or more reporter genes within the nucleic acid type I-F CRISPRi system vector is a lac Z reporter gene.
12. The system of claim 9, wherein the type I-F cas operon is based on the I-F cas operon from P. aeruginosa strain PA154197.
13. The system of claim 9, wherein the target attachment site within the microbial genome is the attB site of Pseudomonas aeruginosa.
14. The system of claim 9, wherein the one or more CRISPR RNA nucleic acids are configured to target one or more transcriptional sites of the gene of interest.
15. The system of claim 14, wherein the one or more transcriptional sites are selected from the group consisting of the RNA polymerase binding region, the transcription initiation region, the 5-end of the coding region, the middle region of the gene, the 3-end of the coding region, or a combination thereof, of the gene of interest in the recipient cell.
16. A microbial cell comprising the recombinant nucleic acid type I-F CRISPR-Cas system of claim 1, the system comprising.
17. The microbial cell of claim 16, wherein the cell is a Pseudomonas spp. Bacterium, wherein the cell is a P. aeruginosa bacterium, or wherein the cell is a P. aeruginosa bacterium that is a strain selected from strain PAO1, strain PA14, strain PA27853, strain PA150577, strain PA154197, strain PA151671, strain PA130788, and strain PA132533.
18-19. (canceled)
20. The microbial cell of claim 16, wherein the cell does not contain an endogenous CRISPR-Cas system.
21. The microbial cell of claim 16, wherein the cell does not comprise functional anti-CRISPR genes, or other components that inactivate the type I-F CRISPR-Cas system.
22. The microbial cell of claim 16, wherein the cell is a P. aeruginosa strain bacterium or a P. aeruginosa strain PA130788, wherein endogenous anti-CRISPR elements have been disrupted.
23. (canceled)
24. A method for changing, adding, and/or deleting one or more genes in a microbial cell using the system of claim 1, comprising the steps of (a) contacting the bacterial cell with the nucleic acid type I-F cas system vector, wherein the contacting occurs under conditions suitable for integration of the type I-F CRISPR-Cas system into the microbial cell genome to form a recipient cell; and (b) contacting the recipient cell with the nucleic acid editing vector.
25. The method of claim 24, wherein the nucleic acid I-F cas system vector further comprises (vi) a functional phage -red recombination system, comprising genes encoding -Red proteins Exo, Gam, and Beta, and an arabinose-inducible promoter.
26. The method of claim 24, wherein the type I-F CRISPR-Cas system induces from about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, up to 100% reduction in the expression, translation, or activity of a target gene in the recipient cell.
27. The method of claim 24, further comprising the step of (c) assessing the activity of the integrated Cas system (a) by contacting the recipient cell with a nucleic acid targeting vector, comprising one or more CRISPR RNA (crRNA) nucleic acids configured to disrupt one or more target genomic sites in the microbial cell required for transcription and/or expression of the one or more reporter genes within the type I-F CRISPR-Cas system vector, wherein efficiency is assessed by efficacy of the CRISPR-mediated genome interference.
28. The method of claim 24, wherein the one or more reporter genes within the nucleic acid type I-F cas system vector is a lac Z reporter gene.
29. The method of claim 24, further comprising the step of (d) removing the CRISPR-Cas system from the recipient cell by contacting the recipient cell with a nucleic acid CRISPR-Cas removal vector, wherein the vector comprises a lacZ-targeting mini-CRISPR and a donor sequence downstream of homologous arms of the attB insertion site.
30. A method for repressing a gene of interest in a microbial cell using the system of claim 1, comprising the step of contacting the bacterial cell with the nucleic acid type I-F CRISPRi system vector, wherein the contacting occurs under conditions suitable for integration of the type I-F CRISPRi system into the microbial cell genome to form a recipient cell.
31. The method of claim 30, wherein the type I-F CRISPRi system induces from about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, up to 100% reduction in the transcription of the gene of interest in the recipient cell.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
DETAILED DESCRIPTION OF THE INVENTION
I. Definitions
[0038] The term transferable I-F cas system refers to the vector carrying the I-F cas operon. The term transferable I-F CRISPR-Cas system refers to the system employing the transferable I-F cas system and editing plasmids for gene editing.
[0039] The term recipient cell refers to a microbial cell, such as a bacterium, which has been modified by incorporation of the transferable I-F cas system.
[0040] The terms targeted gene, targeted genome, or targeted element refers to a gene or genomic component within a recipient microbial cell, which has been selected for modification by the CRISPR-Cas system.
[0041] The terms gene editing, genome modification, and gene manipulation are used interchangeably and refer to selective and specific changes to one or more targeted genes within a recipient cell through programming of the CRISPR-Cas system within the cell. The editing or changing of a targeted gene or genome can include one or more of a deletion, knock-in, point mutation, or any combination thereof in one or more genes of the recipient cell. Therefore, the result of the gene editing may be down-regulation or upregulation of one or more genes or expressed gene products as compared to a control cell without CRISPR-Cas-based gene editing. The extent of variation in the presence or activity of a gene or expressed gene product may be complete (i.e., 100%) or partial (i.e., 1-99.9%) of the level of that in a control cell. The terms inhibit or reduce in the context of inhibition, mean to reduce or decrease in activity and quantity. This can be a complete inhibition or reduction in activity or quantity, or a partial inhibition or reduction. Inhibition or reduction can be compared to a control or to a standard level. Inhibition can be measured as a % value, e.g., from 1% up to 100%, such as 5%, 10, 25, 50, 75, 80, 85, 90, 95, 99, or 100%. For example, gene repression or deletion may inhibit or reduce the activity and/or expression of one or more target genes, or the activity or quantity of one or more expressed gene products by about 10%, 20%, 30%, 40%, 50%, 75%, 85%, 90%, 95%, or 100% from the activity and/or quantity of the same gene or gene product in a control cell that is not subjected to CRISPR-Cas-base gene editing. In some embodiments, the inhibition and reduction are compared according to the level of mRNAs, or proteins corresponding to the targeted genetic element within the cell.
[0042] The terms individual, subject, and patient are used interchangeably, and refer to a mammal, including, but not limited to, murines, simians, humans, mammalian farm animals, mammalian sport animals, and mammalian pets.
[0043] The term pharmaceutically acceptable or biocompatible refers to compositions, polymers and other materials and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio. The phrase pharmaceutically acceptable carrier refers to pharmaceutically acceptable materials, compositions or vehicles, such as a liquid or solid filler, diluent, solvent or encapsulating material involved in carrying or transporting any subject composition, from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be acceptable in the sense of being compatible with the other ingredients of a subject composition and not injurious to the patient.
[0044] The terms treating or preventing mean to ameliorate, reduce or otherwise stop a disease, disorder or condition from occurring or progressing in a subject which may be predisposed to the disease, disorder and/or condition but has not yet been diagnosed as having it; inhibiting the disease, disorder or condition, e.g., impeding its progress; and relieving the disease, disorder, or condition, e.g., causing regression of the disease, disorder and/or condition. Treating the disease or condition includes ameliorating at least one symptom of the particular disease or condition. Desirable effects of treatment include decreasing the rate of disease progression, ameliorating or palliating the disease state, and remission or improved prognosis. For example, an individual is successfully treated if one or more symptoms associated with a bacterial infection or associated disease or disorder are mitigated or eliminated, including, but are not limited to, reducing and/or inhibiting rate of bacterial cell proliferation/growth, increasing the quality of life of those suffering from the disease, decreasing the dose of medications required to treat the disease, delaying the progression of the disease, and/or prolonging survival of individuals.
II. Compositions
[0045] A generic, transferable type I CRISPR-Cas-based genome-editing system that can be used in microbial hosts with diverse genetic backgrounds has been established. The system includes two or more nucleic acid vectors for expression of Cas genes and crRNA within a recipient host cell. The recipient microbial cell has a non-specific genetic background, and the type I CRISPR-Cas-based genome-editing system can integrate into the recipient cell genome in a single step, without the need for modification.
[0046] Class 1 CRISPR-Cas-based systems employ a multi-subunit effector complex which is known as the CRISPR-ASsociated Complex for Antiviral DEfense (CASCADE) to interfere with DNA or RNA within a cell. Class 1 systems are dependent on a small CRISPR RNAs (crRNA) to achieve site-specific DNA targeting and interference of genomic DNA.
[0047] Compositions for a chromosomal integrated type I-F cas system for programmable genome editing and robust gene regulation are provided. The chromosomal integration system overcomes the limitations of narrow host range and the requirement for antibiotics to maintain its propagation and cas expression, which are associated with plasmid-encoded Cas proteins.
[0048] In some embodiments, the compositions are effective to selectively and specifically edit and/or regulate the genome of multiple microbial species with diverse genotypes. The compositions are particularly effective for gene editing and/or gene regulation in multiple different Pseudomonas spp., such as strains of P. aeruginosa. In some embodiments, the compositions are effective to selectively and specifically edit and/or regulate the genome of multiple microbial species, particularly different Pseudomonas spp., with or without their own native CRISPR-Cas systems, with and without available genome sequences, with and without anti-CRISPR systems. In other embodiments, the compositions are effective for gene editing and/or gene regulation in Acinetobacter baumannii.
[0049] The Cas9-mediated genome editing system requires consecutive transformation of two plasmids with two different antibiotic markers. However, most P. aeruginosa strains, especially those wild isolates with clinical and environmental significance, have a poor DNA homeostasis capacity and are not tolerant to transformation and maintenance of two different plasmids. Hence, thus far, success of the Cas9-based genome editing is only limited to the model strains PAO1 and PAK. P. aeruginosa naturally harbors the type I-F CRISPR-Cas system in many of its genomes. In preferred embodiments, the compositions achieve high efficiency in PAO1 with much simpler procedures than those of Cas9-based method. In further preferred embodiments, the compositions are effective to selectively and specifically edit and/or regulate the genome of those clinical and environmental isolates of Pseudomonas spp., where the Cas9-based method is not applicable.
[0050] The Cas9 and Cas12a are generally derived from Streptococcus pyogenes or Lachnospiraceae bacterium, and need to be over-expressed when being exploited for genome editing in heterologous hosts. In preferred embodiments, the transferrable type I-F CRISPR-Cas system is expressed from its native promoter when the system is transferred to heterologous hosts. In further preferred embodiments, the transferrable type I-F CRISPR-Cas system is derived from a clinical P. aeruginosa strain PA154197.
[0051] Preferably, the compositions cause little to no intrinsic toxicity in the hosts. For example, the integration of the transferable I-F cas system into the cell does not impact bacterial physiology compared with a control cell. For example, preferably the integration of transferable I-F cas system does not impact any of cell growth, proteolytic activity, biofilm formation, C. elegans killing, antibiotic susceptibility, colony morphology or motility in the recipient cell.
[0052] A recent study reported repurposed the type I-F CRISPR-Cas system for transcriptional activation in human HEK293T cells (Chen et al., Nat Commun, 2020,11:3136). Thus, in some embodiments, the compositions are also effective to selectively and specifically edit and/or regulate the genome of eukaryotic cells.
[0053] A. Nucleic Acid Vectors
[0054] Nucleic acid vectors for changing, adding or deleting one or more genes in a microbial cell are described. Typically, two specific vectors are required. A first, type I-F cas system nucleic acid vector, integrates a functional type I-F cas operon into the genome of a recipient microbial cell. Once the transferable system is integrated into the genome of a recipient strain, it can be stably expressed in stoichiometry and enables precise and rapid genome editing using a single editing plasmid containing a pre-designed CRISPR RNA (crRNA)-expressing mini-CRISPR element and repair donor in one-step.
[0055] 1. Type I-F cas System Vector
[0056] A type I-F cas system nucleic acid vector includes nucleic acids configured to integrate a functional type I-F cas operon into the genome of a microbial cell. In some embodiments, the microbial cell is a Pseudomonas bacterium. Upon integration of the type I-F cas system into a recipient microbial cell, gene editing can be carried out in a single step, by application of a nucleic acid editing vector, including one or more CRISPR RNAs (crRNAs) targeting one or more selected genes for insertion, deletion, or modification within the microbial cell genome. Typically, the Type I-F cas system vector is a nucleic acid plasmid, including nucleic acids configured to include a type I-F cas operon, one or more elements for integration of the cas operon into the genome of the recipient microbial cell, and one or more reporter genes for assessing integration and CRISPR-Cas expression/activity. A schematic representation of the Type I-F Cas system vector is set forth in
[0057] In some embodiments, the transferable system enables integration of the entire cas gene cluster (8.693 kb) including the cas genes cas1, cas2-3, cas8f, cas5, cas7 and cas6 into the genome of the strain of interest, thus enabling the stable expression of six cas genes in heterologous bacterial hosts. In preferred embodiments, the genome-editing process involves a one-step transformation of a single editing plasmid. Thus, compared to the time-consuming methods currently used in Pseudomonas species such as the counter selection-based method and the two-plasmid-based Cas9 method, the transferable system thus generates desired mutants with efficiency and simplicity.
[0058] a. I-F Cas Operon
[0059] Nucleic acid vectors including nucleic acids configured to integrate a transferable type I-F cas system vector into the genome of a microbial cell include the I-F cas operon with a native promoter. The operon includes the cas genes cas1, cas2-3, cas8f, cas5, cas7 and cas6, and a nucleic acid sequence configured to promote transcription of the cas genes in the microbial cell. A schematic representation of the I-F cas operon is set forth in
[0060] Where the DNA cleavage ability is not desired, the Cas2-3 gene is modified in the I-F cas operon such that its DNA cleavage ability is disabled. For example, when repression of a particular target gene is desired, upon the presence of a programmable crRNA, the Cascade complex targets a genomic locus specifically and stably, which prevents the recruitment or movement of the RNA polymerase (RNAP) and consequently inactivates the expression of the target gene. Thus, in some embodiments, Cas2-3 gene is eliminated from the I-F cas operon.
[0061] b. Elements for Genomic Integration
[0062] The vector includes one or more nucleic acid sequences configured for integration of the vector into the genome of the recipient microbial cell, at a pre-determined region/site. The vector enables efficient integration of the type I-F cas operon from PA154197 into a conserved attB site which is present in diverse P. aeruginosa strains (Genomic location: 2,947,580-2,947,610 in strain PAO1). When the transferable systems are introduced into P. aeruginosa strains, they can integrate efficiently into the specific attB site, which is highly conserved among the P. aeruginosa species. The vector also includes nucleic acid sequences configured as one or more genes encoding an integrase enzyme; a nucleic acid sequence encoding an integration site configured to recognize and attach the plasmid to a target attachment site within the microbial genome.
[0063] c. Reporter Systems
[0064] The vector includes one or more nucleic acid sequences configured to be one or more reporter genes for expression within the recipient cell, and optionally one or more nucleic acid sequences configured to promote transcription of the reporter gene(s) upon integration into the microbial cell genome. In a preferred embodiment, A lacZ reporter gene, driven by a strong promoter is designed in the transferable system. In some embodiments, the strong promoter is the Ptat promoter. When a lacZ reporter gene is included, chromosomal integration of the system can be easily detected on the 5-bromo-4-chloro-3-indolyl--D-galactopyranoside (X-gal)-containing plates. For example, successful chromosomal integration and expression of the lacZ gene following introduction of the transferable systems into the recipient microbial cell is indicated by recovery of blue cells. Reporter systems, including antibiotic resistance genes, are known in the art.
[0065] d. -Red Recombination System
[0066] For strains with insufficient homologous recombination capacities, the integrative -red recombination system can be included within the Type I-F cas system vector to enable the simultaneous introduction of both the I-F Cascade and -red recombination system into the microbial cell. A functional phage -red recombination system includes genes encoding -red proteins Exo, Gam, and Beta, and an arabinose-inducible promoter. Therefore, in some embodiments, the vector also includes nucleic acids configured to express the genes Exo, Gam, and Beta of the -red recombination system and an arabinose-inducible promoter. A schematic representation of the Type I-F cas system vector, including the -red recombination system is set forth in
[0067] 2. crRNA Expression Vectors
[0068] Nucleic acid vectors to enable specific, designed genome editing of the microbial recipient cell, including gene deletion, gene knock-in, point mutation, and/or gene modification via a one-step procedure through incorporation of one or more CRISPR RNAs (crRNAs) within the recipient microbial cell are also described. In some embodiments, a crRNA expression vector is configured to include crRNA, which, upon expression within the recipient microbial cell, enables assessment of the efficiency and/or activity of the Type I-F cas system within the recipient cell. In other embodiments, a crRNA expressing vector removes the Type I-F cas system from the recipient cell, for example, following gene editing, to prevent subsequent CRISPR-Cas activity within the cell.
[0069] In other embodiments, the one or more crRNAs are on the same plasmid as the I-F cas system. For example, a programmable mini-CRISPR insertion site downstream of the Ptat promoter was designed in the transferable system so that crRNA can be constitutively expressed from the chromosome to execute robust Cascade targeting as shown in
[0070] a. CRISPR-Cas Targeting Vectors
[0071] In some embodiments, the crRNA expression vector is configured to express one or more CRISPR RNAs (crRNAs) designed for assessing the efficiency and/or activity of a Cas operon (CRISPR-Cas Targeting Vectors) within a recipient microbial cell. Typically, vectors for assessing the efficiency and/or activity of a Cas operon within a recipient cell target the one or more reporter genes (selection markers) within the transferable type I-F cas system. Assessing the efficacy of the type I-F CRISPR-Cas system within the recipient cell is then facilitated by assessing the recovered survival cells by introducing the targeting vector. For example, Interference activities of the transferred cas systems in all recipient strains are examined by comparing the relative conjugation efficiency between a microbial cell receiving a control plasmid, and an active Targeting vector. Recipient cell strains showing active interference in the presence of the transferred cas system have active genome editing capabilities. A schematic representation of a Targeting vector is provided in
[0072] In some embodiments, the targeting vector comprises crRNA nucleic acids configured to disrupt one or more genes associated with expression of the Acyl-homoserine-lactone synthase enzyme. For example, in some embodiments, the Targeting vector includes nucleic acids configured to express a crRNA targeting the rhlI gene in the PAO1 strain (pRhlI-Targeting). An exemplary plasmid pRhlI-Targeting is constructed based on the platform plasmid pPlatform (pAY5211) (Xu & Yan, STAR Protocols 1, 100039, (2020)). The mini-CRISPR in pRhlI-Targeting encompasses a 32-bp spacer that is complementary to a 5-CC-3-preceded protospacers within the rhlI gene in PAO1 (
[0073] b. Designed Genetic Editing Vectors
[0074] In some embodiments, the crRNA vector is configured to express one or more crRNAs and carry repair donor(s) designed for genetic modification at one or more selected genomic regions (Genetic editing vector) within the microbial cell through the Type I-F CRISPR-Cas system. Gene editing nucleic acid vectors include nucleic acids configured to express one or more crRNA nucleic acids and repair donor(s) configured to change, add or delete one or more target genomic sites in the microbial cell. A schematic representation of an Editing vector is provided in
[0075] c. CRISPR-Cas Removal Vectors
[0076] In some embodiments, the crRNA expression vector is configured to express one or more crRNAs and carry a donor specific for removal of the integrated type I-F cas system from the recipient cell (Removal vector). After the desired genome editing is achieved, the transferred system can be conveniently removed from the genome using a Removal vector, in combination with one or more selection systems. Therefore, in some embodiments, the crRNA expression vector is a Removal vector, comprising one or more crRNA nucleic acids configured to disrupt one or more target genomic sites within the type I-F cas system that has been integrated into the genome of the recipient microbial cell.
[0077] 3. Control Vectors
[0078] The nucleic acid vectors can also be control vectors, which lack one or more of the nucleic acid sequences required for the activity of the Type I-F Cas System Vector, or one or more of the crRNA expression vectors. Therefore, the activity of any of the components of the Type I-F Cas System within a recipient bacterial cell can be compared to a control cell, which lacks the component. In some embodiments, the presence or lack of one or more specific CRISPR-Cas components within a recipient cell is visualized by inspection of one or more expressed gene products of a reporter gene.
[0079] B. Recipient Microbial Cells
[0080] The transferable system is designed for integration into microbial/bacterial cells having distinct genomes, therefore the microbial host cells can have diverse genetic backgrounds. Microbial host cells including the transferable type I-F cas system integrated within the cell's genome are described. In some embodiments, the recombinant recipient cell includes a recombinant nucleic acid type I-F cas system including (i) a type I-F cas operon, including the cas genes cas1, cas2-3, cas8f, cas5, cas7 and cas6 and a nucleic acid sequence configured to promote transcription of the cas genes in the microbial cell; (ii) one or more genes encoding an integrase enzyme; (iii) a nucleic acid sequence encoding an integration site configured to recognize and attach the plasmid to a target attachment site within the microbial genome; (iv) two nucleic acid sequences configured to be an Flp recombinase target sites; and (v) one or more reporter genes and a nucleic acid sequence configured to promote transcription of the reporter gene(s) upon integration into the microbial cell genome. The vector is integrated into the genome of the microbial cell via attachment at the target attachment site, such as the conserved attB site.
[0081] In some embodiments, the strain and/or genotype of the host cell is unknown. In some embodiments, the recipient cells are part of a population of genetically distinct strains of bacteria, for example, a group of two or more genetically different strains of P. aeruginosa.
[0082] 1. Pseudomonas Spp.
[0083] In a preferred embodiment, the microbial host cell is a Pseudomonas spp. bacterium. In a more preferred embodiment, wherein the cell is a P. aeruginosa bacterium. In some embodiments, the microbial cell is a P. aeruginosa bacterium strain selected from strain PAO1, strain PA14, strain PA27853, strain PA150577, strain PA154197, strain PA151671, strain PA130788, and strain PA132533. In some embodiments, the recipient microbial cell is a P. aeruginosa strain bacterium, wherein endogenous anti-CRISPR elements have been disrupted. In a particular embodiment, the recipient cell is a P. aeruginosa strain PA130788 cell.
[0084] Many Pseudomonas spp. cells include functional endogenous CRISPR-Cas systems, and exhibit endogenous CRISPR-Cas activity. However, many Pseudomonas spp. cells contain non-functional or semi-functional CRISPR-Cas systems, or do not possess any endogenous CRISPR-Cas activity. Pseudomonas spp. cells including endogenous CRISPR-Cas activity, as well as those lacking functional endogenous activity may be recipient cells of the described transferable I-F cas system. Therefore, in some embodiments, the recipient microbial cell does not contain an endogenous CRISPR-Cas system. In other embodiments, the recipient Pseudomonas spp. cell contains an endogenous CRISPR-Cas system which is functional, or which is fully or partially non-functional. In some embodiments, the recipient Pseudomonas spp. cell contains genes encoding an endogenous CRISPR-Cas system which is functional, but the functionality is precluded, reduced or minimized by the presence of one or more endogenous anti-CRISPR genes, or anti-CRISPR elements within the cell.
III. Methods of Genetic Modification
[0085] Methods for genome editing of recipient host cells using a transferable I-F CRISPR-Cas system have been developed. Methods for changing, adding or deleting one or more genes in a microbial cell are provided. In certain embodiments, the methods include administering to a bacterial cell a vector including a transferable I-F cas system in combination with one or more nucleic acid editing plasmids including one or more crRNAs and repair donors designed to change, add or delete one or more genes in a microbial cell. Methods for construction, reproduction, amplification, and conjugation of the recipient cells are also described. In particular, the transferable I-F cas system is passed from one donor Escherichia coli SM10 strain to the recipient strain through bacterial conjugation.
[0086] A. I-F CRISPR-Cas-Mediated Genetic Modification
[0087] Methods for changing, adding or deleting one or more genes in a bacterial cell are described. In some embodiments, the methods reduce, minimize or abrogate the expression or activity of a target gene in the recipient cell. For example, in some embodiments, the methods induce from about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, up to 100% reduction in the transcription or activity of a target gene in the recipient cell.
[0088] Methods for I-F CRISPR-Cas-mediated genetic modification of a microbial cell include the steps of: [0089] (a) transforming a bacterial cell with a nucleic acid type I-F cas system vector, including (i) a type I-F cas operon, comprising the cas genes cas1, cas2-3, cas8f, cas5, cas7 and cas6 and a nucleic acid sequence configured to promote transcription of the cas genes in the microbial cell; (ii) one or more genes encoding an integrase enzyme; (iii) a nucleic acid sequence encoding an integration site configured to recognize and attach the plasmid to a target attachment site within the microbial genome; (iv) two nucleic acid sequences configured to be an Flp recombinase target site; and (v) one or more reporter genes and a nucleic acid sequence configured to promote transcription of the reporter gene(s) upon integration into the bacterial cell genome. The contacting occurs under conditions suitable for integration of the type I-F cas system into the bacterial cell genome to form a recipient cell.
[0090] In some embodiments, the nucleic acid type I-F cas system vector further includes a functional phage -red recombination system, including genes encoding -Red proteins Exo, Gam, and Beta, and an arabinose-inducible promoter.
[0091] The transformation of cells can include any specific techniques for transformation of microbial cells with nucleic acids known in the art, including bacterial conjugation, whereby a plasmid is transferred from one bacterium to another. In a preferred embodiment, an E. coli SM10 strain including the type I-F cas system vector is used as a donor cell to transfer the type I-F cas system vector to a P. aeruginosa recipient cell by bacterial conjugation.
[0092] Chromosomal integration of the type I-F cas system having a lacZ reporter gene can be easily detected on the 5-bromo-4-chloro-3-indolyl--D-galactopyranoside (X-gal)-containing plates: the presence of blue colonies in the recipient cells transformed with the type I-F cas system vector indicates successful integration in the recipient cells. [0093] (b) transforming the recipient cell with a nucleic acid editing vector, including one or more CRISPR RNA (crRNA) nucleic acids and repair donor(s), configured to change, add or deleting one or more target genomic sites in the recipient cell through the type I-F CRISPR-Cas system.
[0094] The methods can include the optional step to assess the activity of the transferred type I-F cas system in the recipient cell. Therefore, in some embodiments, the methods include the step of: [0095] (c) assessing the self-targeting activity by introducing the recipient cell with a nucleic acid Targeting vector, comprising one or more CRISPR RNA (crRNA) nucleic acids configured to disrupt one or more target genomic sites in the microbial cell genome or the type I-F cas system. In particular embodiments, the methods include expressing within the recipient cell one or more CRISPR RNA (crRNA) nucleic acids configured to disrupt the rhlI gene, or the Ptat promoter, or both, for assessment of the activity of the type I-F CRISPR-Cas system. Therefore, in some embodiments, the methods include transforming the recipient cell with a crRNA nucleic acid targeting vector including one or more CRISPR RNA (crRNA) nucleic acids configured to disrupt the rhlI gene, or the Ptat promoter, or both.
[0096] In some embodiments, the methods further include the step of: [0097] (d) removing the type I-F cas system from the recipient cell by transforming the recipient cell with a nucleic acid CRISPR-Cas removal vector. The methods optionally include a step of removing the type I-F cas system from a recipient cell, for example, following successful completion of gene editing. Removal of the type I-F cas system prevents any further CRISPR-Cas mediated gene editing within the recipient cell, and therefore preserves the fidelity of the desired genetic modification with the cell. Therefore, in some embodiments, the methods include transforming the recipient cell with a CRISPR-Cas Removal vector, including one or more nucleic acids configured to be a lacZ-targeting CRISPR RNA (crRNA), for example, a lacZ-targeting mini-CRISPR and a donor sequence upstream and downstream of homologous arms of the attB insertion site.
[0098] B. Methods for Gene Repression
[0099] Methods for repressing a gene of interest in a bacterial cell are described. In some embodiments, the methods reduce, minimize or abrogate the transcription of a target gene in the recipient cell. For example, in some embodiments, the methods induce from about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, up to 100% reduction in the transcription of a target gene in the recipient cell.
[0100] In some embodiments, repression of a particular target gene is desired, the cas2-3 gene is eliminated from the I-F cas operon. Thus, upon the presence of a programmable crRNA, the Cascade complex targets a genomic locus specifically and stably, which prevents the recruitment or movement of the RNA polymerase (RNAP) and consequently inactivates the expression of the gene of interest. Thus, in some embodiments, the cas2-3 gene is modified in the I-F cas operon such that its DNA cleavage ability is disabled.
[0101] Methods for introducing a transferable CRISPR-based transcriptional interference (transferable CRISPRi) system in a microbial cell include the steps of: [0102] (a) transforming a bacterial cell with a nucleic acid type I-F CRISPRi system vector, including (i) a type I-F cas operon, comprising the cas genes cas1, cas8f, cas5, cas7 and cas6 and a nucleic acid sequence configured to promote transcription of the cas genes in the microbial cell; (ii) one or more genes encoding an integrase enzyme; (iii) a nucleic acid sequence encoding an integration site configured to recognize and attach the plasmid to a target attachment site within the microbial genome; (iv) two nucleic acid sequences configured to be an Flp recombinase target site; (v) one or more reporter genes and a nucleic acid sequence configured to promote transcription of the reporter gene(s) upon integration into the bacterial cell genome, and (vi) one or more CRISPR RNA (crRNA)-encoding nucleic acids, configured to target one or more sites of the gene of interest in the microbial cell through the type I-F CRISPRi system. The contacting occurs under conditions suitable for integration of the type I-F CRISPRi system into the bacterial cell genome to form a recipient cell.
[0103] In some embodiments, the one or more CRISPR RNA nucleic acids are configured to target one or more transcriptional sites of the gene of interest, including the RNA polymerase binding region, the transcription initiation region, the 5-end of the coding region, the middle region of the gene, the 3-end of the coding region, or a combination thereof.
[0104] The transformation of cells can include any specific techniques for transformation of microbial cells with nucleic acids known in the art, including bacterial conjugation, whereby a plasmid is transferred from one bacterium to another. In a preferred embodiment, an E. coli SM10 strain including the type I-F CRISPRi system vector is used as a donor cell to transfer the type I-F CRISPRi system vector to a P. aeruginosa recipient cell by bacterial conjugation.
[0105] Chromosomal integration of the type I-F CRISPRi system having a lacZ reporter gene can be easily detected on the 5-bromo-4-chloro-3-indolyl--D-galactopyranoside (-gal)-containing plates: the presence of blue colonies in the recipient cells transformed with the type I-F CRISPRi system vector indicates successful integration in the recipient cells.
IV. Kits
[0106] Kits are also disclosed. The kits can include, for example, an aliquot of the type I-F cas system Vector, and at least one Editing Vector, or a combination thereof in separately or together in the same admixture. The active agents can be supplied alone (e.g., lyophilized), or in a mixture composition. The active agents can be in a unit amount for transformation into a microbial host cell, or in a stock that should be diluted prior to use. In some embodiments, the kit includes a supply of buffers and reagents required for transformation of a bacterial cell. In some embodiments, the kit includes the type I-F cas system Vector, and one or more of a Targeting Vector, an Editing Vector, and a Removal Vector. The kit can also include devices for use of the active agents or compositions, for example, donor E. coli cells including the type I-F cas system Vector, syringes and pipettes. The kits can include printed instructions for use of the reagents according to the methods described above.
[0107] The present invention is further understood by reference to the following non-limiting examples.
EXAMPLES
Example 1: Transferable I-F CRISPR-Cas System is Active in a Broad Host-Range of P. aeruginosa Strains
Materials and Methods
[0108] Primers, Bacterial Strains, and Growth Conditions
[0109] Primers and bacterial strains used in this study are listed in Table 1. E. coli DH5 is used for plasmid propagation and is usually cultured at 37 C. in Luria-Bertani (LB) broth or on the LB agar plate supplemented with required antibiotics. E. coli SM10 is used for conjugative plasmid delivery. P. aeruginosa clinical strains were isolated from the Queen Mary Hospital in Hong Kong, China. Antibiotics supplemented in the agar plates for DH5 were 20 g/ml kanamycin, 10 g/ml tetracycline and 200 g/ml ampicillin. Antibiotics supplemented in the agar plates for SM10 were 500 g/ml kanamycin, 10 g/ml tetracycline and 200 g/ml ampicillin. Antibiotics supplemented in the agar plates for P. aeruginosa strains were 500 g/ml kanamycin, 50 g/ml tetracycline and 200 g/ml carbenicillin.
TABLE-US-00001 TABLE1 Bacterialstrains,primersusedinthisstudy Strainsandprimers Description Source Strains: DH5 F-endA1glnV44thi- Labcollection 1recA1relA1gyrA96deoRnupGpurB2080dlacZM15 SM10 (lacZYA-argF)U169,hsdR17(r.sub.K-m.sub.K+),- thithrleutonAlacYsupErecA:RP4-2-Tc:MuKmpir Labcollection PAO1 Pseudomonasaeruginosalaboratorystrain Labcollection PA14 Pseudomonasaeruginosalaboratorystrain Labcollection PA154197 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA27853 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA150577 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA130788 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA267067 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA129904 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA149623 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA150317 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA150571 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA152241 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA152821 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA153195 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA153301 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA153541 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA153983 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA151970 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA150873 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA151514 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA151671 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA151971 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA132526 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA132533 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA139140 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA150210 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA154054 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA150209 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA268859 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA152165 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA139357 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA152361 PAclinicalisolatefromQueenMaryHospital(HK) Labcollection PA238 PAisolatefromthesurfacelayeroftheNorth Labcollection PacificOcean PA1157 PAisolatefromthesurfacelayeroftheNorth Labcollection PacificOcean Primers: pUC57-F AGGGTTTTCCCAGTCACGAC Thisstudy pUC57-R AGCGGATAACAATTTCACAC Thisstudy pMS402-F CCAGCTGGCAATTCCGA Thisstudy pMS402-R AATCATCACTTTCGGGAAAG Thisstudy CTX-Kpn-IF-cas-F CTATAGGGCGAATTGGGTACCCTCGAACCCACCTCGGCCAC Thisstudy CTX-Kpn-IF-cas-R CTCGAGGGGGGGCCCGGTACCCGTCGTGCATCTGGGACTCG Thisstudy CTX-Kpn-Cas9-F CTATAGGGCGAATTGGGTACCATGGGCATAAAGTTGCCTCG Thisstudy CTX-Kpn-Cas9-R CTCGAGGGGGGGCCCGGTACCCCATACCCATGGGTATTTACCAC Thisstudy CTX-SalI-pKD46-F GGGCCCCCCCTCGAGGTGTATTTAGAAAAATAAACAAATAGGGGT Thisstudy TCC CTX-SalI-pKD46-R AAGCTTATCGATACCGTCGACCATGGATTCTTCGTCTGTTTCTACT Thisstudy G cas1-F ATTCGCACTACTGGAACATCC Thisstudy cas1-R CCGCAGAAGCCTACCAATAC Thisstudy cas2-3-F TTTCAGCCGCTACGAAGAAG Thisstudy cas2-3-R GACTAGCTCCTCCCGATAGTT Thisstudy cas8-F CCGCAGAAGCCTACCAATAC Thisstudy cas8-R GGAGAACTGGTTGCTACCTTC Thisstudy cas5-F GCTTCTCCCGAAGTCATGTT Thisstudy cas5-R AATGCCCGTGATAGGGAAAC Thisstudy cas7-F GATACCAAAGCAGGTCCGATAA Thisstudy cas7-R AAGCAGAAGCTGGACTTCTATAC Thisstudy cas6-F GATCAGGTTGGCGATCACATA Thisstudy cas6-R CAGCACTTCCGTCTCTTCAT Thisstudy gam-F GTTCAGCCATGAACGCTTATTAC Thisstudy gam-R AGTTCTGCCTCTTTCTCTTCAC Thisstudy beta-F GTTCAGCCATGAACGCTTATTAC Thisstudy beta-R AGTTCTGCCTCTTTCTCTTCAC Thisstudy exo-F GGTGGTTTCGAGGCCATAA Thisstudy exo-R CTTCATACGCGGGTCATAGTT Thisstudy acf-F GTCAGCAGTTCGACGATTCA Thisstudy acf-R TAAGCCACTCGCCATCTTTC Thisstudy aca-F TCGACAAAGCAGGTGTCAG Thisstudy aca-R TGCGAACTGAACCGTGTAA Thisstudy rhII-F CGTCGGTCTGGGAGCTTTCG Thisstudy rhII-R CCCAGGTACCAGGCGCATTG Thisstudy
[0110] Construction of Transferable Cas System
[0111] The transferable cas system was derived from the mini-CTX-lacZ plasmid. The mini-CTX-lacZ plasmid was linearized under HindIII (NEB, USA) treatment for 4 hours. The Ptat promoter was amplified from the PA154197 genome by PCR using the iProof High-Fidelity DNA Polymerase (Bio-Rad, USA) and ligated with the HindIII-digested mini-CTX-lacZ plasmid using the ClonExpress II One Step Cloning Kit (Vazyme, China), generating CTX-Ptat-lacZ plasmid. The I-F cas operon including its native promoter was amplified from the PA154197 genome. Fragments encoding -red genes with the L-arabinose inducible promoter was amplified from the pKD46 plasmid. The cas operon and -red encoding fragment were inserted into the KpnI and SalI sites in the CTX-Ptat-lacZ plasmid, respectively, to generate the transferable I-F cas system and transferable -I-F cas system. For the construction of the transferable -Cas9 system, the cas9 gene and its promoter was amplified from the pCasPA.
[0112] Integration of the Transferable Cas System
[0113] E. coli SM10 strain containing the transferable cas system was cultured in LB broth supplemented with 10 g/ml tetracycline at 37 C. with 220-rpm agitation for about 16 h. Simultaneously, P. aeruginosa recipient strain was cultured in LB broth at 42 C. with 220-rpm agitation for about 16 h. Cell densities of the E. coli SM10 and P. aeruginosa cultures were determined by measuring OD600 nm, then E. coli SM10 and P. aeruginosa were mixed with the cell number of 1.510.sup.9 and 0.510.sup.9. Mixture was pelleted by centrifugation at 16,000g for 1 min and resuspended in 50 l LB broth followed by spotted on the surface of a LB agar plate. Mating (plasmid delivery from SM10 to P. aeruginosa) occurred during the incubation of the mixture at 37 C. for 8 h. Mixture was scrapped from the agar plate and resuspended in 300 l PBS buffer. Cell suspension was serial diluted and spread on the VBMM plates with supplementation of 50 g/ml tetracycline and 40 g/ml X-gal and plates were incubated at 37 C. for 24 h. Blue colonies indicating the chromosomal integration of the transferable cas system are selected for further use.
[0114] Quantitative PCR (qPCR)
[0115] Expression of the integrated genes such as cas and -red genes was detected by qPCR which was performed as described previously (Xu, et al. Journal of Biological Chemistry 294, 16978-16991, doi:10.1074/jbc.RA119.010023 (2019)). 1 ml bacterial cells grown in LB were harvest when the OD600 nm reached 1.0. Total RNA was extracted using the Takara MiniBEST Universal RNA Extraction Kit (Takara, Japan) and reverse transcription were conducted using the PrimeScript RT Master Mix (Takara, Japan) following the manufacturer's instructions. qPCR was performed using specific primers mixed with the TB Green Premix Ex Taq (Takara, Japan) in a 20 l reaction system. The amplification was performed in the ABI StepOnePlus real-time PCR system. Amplification curves were plotted to display the transcription of tested genes and Ct value was used to compare the relative transcription levels in different strains. The recA gene was selected as the internal reference gene.
[0116] Construction of pTargeting and pEditing
[0117] A plasmid (pAY-mini-CRISPR) encompasses a 32-bp spacer insertion site flanked by two repeats (GTTCACTGCCGTATAGGCAGCTAAGAAA) is designed to assist the construction of specific mini-CRISPR elements. 32-bp nucleotides (spacer) preceded by a 5-CC-3 PAM is selected in the coding sequence of the gene to be edited. Two oligos of the spacer DNA are designed in the following form: 5-GAAANx32-3 and 5-GAACNx32-3. Oligos are first phosphorylated using T4 polynucleotide kinase (NEB, USA) at 37 C. for 1 h. The phosphorylated oligos are heated at 95 C. for 3 min and then cooled down to room temperature to generate annealed oligos. Annealed oligos are ligated into the plasmid pAY-mini-CRISPR which is pre-digested with BsaI (NEB, USA) using the Quick Ligation Kit (NEB, USA) to generate the desired mini-CRISPR. Assembly of mini-CRISPR and donor template into the platform plasmid (pAY5211) was followed our previously published protocol (Xu, & Yan, STAR Protocols 1, 100039, (2020)), the entirety of which is incorporated herein by reference. Specifically, amplified mini-CRISPR elements and plasmid pAY5211 were digested using KpnI and BamHI (NEB, USA) and ligated using the Quick Ligation Kit (NEB, USA) to generate the targeting plasmid (pTargeting). Donor sequences which contain upstream and downstream homologous arms of the gene being edited with 21-bp overlap of the XhoI-digested targeting plasmid at each end were amplified by PCR and ligated into the linearized targeting plasmid (digested by XhoI (NEB, USA)) using the ClonExpress II One Step Cloning Kit (Vazyme, China) to generate the editing plasmid (pEditing). All constructed plasmids were verified by Sanger sequencing (BGI, China).
[0118] Quantification of Conjugation Efficiency
[0119] E. coli SM10 strains containing the plasmids of pAY5211 and pAY7138 were cultured in LB broth supplemented with 100 g/ml kanamycin at 37 C. with 220-rpm agitation for about 16 h while the P. aeruginosa strains (tetracycline resistance due to the integrated transferable cas system) were cultured in LB broth at 42 C. with 220-rpm agitation for about 16 h. E. coli SM10 and P. aeruginosa were mixed with the cell number of 1.510.sup.9 and 0.510.sup.9. Mixture was pelleted by centrifugation at 16,000g for 1 min and resuspended in 50 l LB broth followed by spotted on the surface of a LB agar plate. The plate was incubated at 37 C. for 8 h. Mixture was scrapped from the agar plate and resuspended in 300 l PBS buffer. Cell density was determined by measuring OD600 nm and adjusted to 2.0. Cell resuspensions were serially diluted and plated on the LB agar plates containing 50 g/ml tetracycline and 500 g/ml kanamycin. Plates were incubated at 37 C. for 24-36 h. Original amounts of survival cells in the resuspension was determined by recovered colony numbers and dilution factors. Colony number recovered from pAY5211 was normalized as 100%.
[0120] Genome Editing and Verification
[0121] E. coli SM10 strain containing the editing plasmid was cultured in LB broth supplemented with 100 g/ml kanamycin at 37 C. with 220-rpm agitation for about 16 h while the P. aeruginosa strains (tetracycline resistance due to the integrated transferable cas system) were cultured in LB broth supplemented with 20 mM L-arabinose at 42 C. with 220-rpm agitation for about 16 h. E. coli SM10 and P. aeruginosa were mixed with the cell number of 1.510.sup.9 and 0.510.sup.9. Mixture was pelleted by centrifugation at 16,000g for 1 min and resuspended in 50 l LB broth followed by spotted on the surface of a LB agar plate containing 20 mM L-arabinose. The plate was incubated at 37 C. for 8 h. Mixture was scrapped from the agar plate and resuspended in 300 l PBS buffer. For most strains expect kanamycin resistant strains, cell resuspension was spread on the LB agar plates containing 50 g/ml tetracycline and 500 g/ml kanamycin. Plates were incubated at 37 C. for 24-36 h. Recovered single colonies were inoculated into LB broth containing 100 g/ml kanamycin in a 96-well plate. After incubation at 37 C. with 220-rpm agitation for 3 h, luminescence intensity was measured and ten colonies with the highest luminescence intensity were subjected to verification using PCR and Sanger sequencing with specific primers. PCR results of ten selected clones in each experiment were presented to show the efficiency of genome editing. The editing plasmid in the P. aeruginosa cells which underwent one round of editing is cured by streaking the cells onto a LB ager plate and incubation at 37 C. overnight. In some cases, multiple (2 to 3) rounds of streaking are required for the thorough plasmid curing.
[0122] Bacterial Whole Genome Sequencing and Analysis
[0123] Genomic DNA was extracted from 1 ml overnight bacterial culture using the Illustra bacteria genomic Prep Mini Spin Kit (GE Healthcare, USA) according to the manufacturer's instructions. Whole genome sequencing was conducted by Novogene (Beijing, China) with the sequencing platform Novaseq. The quality control of raw reads was done using Trimmomatic. The genome of the PAO1.sup.IF strain was assembled using SPAdes with PAO1 (NC_002516.2) as the reference, and completed using an assembly improvement pipeline. Circlators fixstart task was used to fix the start position of the manually finished complete genome of PAO1.sup.IF to be at the dnaA gene. Annotations of PAO1.sup.IF were done using Prokka with Pseudomonas genera specific database. With the complete genome of PAO1.sup.IF as the reference, the genome-wide integration site distribution for a given strain was done referring to one previous study. Mapping in the present study was performed using BWA. Integration events within 500 bp bins were computed using SAMtools and BEDTools47 and visualized with ggplot2 in R platform (https://ggplot2.tidyverse.org/index.html). To explore mutations on all other strains compared with PAO1.sup.IF, core SNPs were collected and annotated with the reference of the PAO1.sup.IF genome using snippy (https://github.com/tseemann/snippy).
[0124] PYO Quantification
[0125] 1 ml bacterial culture was subjected to centrifugation at 16,000g for 5 min. 750 l supernatant was collected and mixed with 450 l chloroform by vortex for 0.5 min. After centrifugation at 16,000g for 5 min, 400 l liquid from lower phase was then mixed with 200 l HCl (0.2 M) by vortex thoroughly for 0.5 min. After centrifugation at 16,000g for 5 min, 100 l upper aqueous phase containing PYO was transferred to a 96-well plate and its absorbance was measured at 510 nm. Concentration of PYO was determined according to the standard curve.
Results
[0126] Previous studies identified a highly active I-F CRISPR-Cas system from P. aeruginosa PA154197 which encompasses six cas genes sandwiched by two convergent CRISPR arrays (
[0127] When the transferable I-F and -I-F cas systems were constructed, the CRISPR-free model strain PAO1 was first selected to examine their integration efficiency as well as the expression and interference activities. All the recovered clones appeared in blue by introducing the transferable systems into PAO1 (
TABLE-US-00002 TABLE 2 WGS revealed mutations between the indicated strains and PAO1.sup.IF Strain Position Strand Gene Effect PAO1 WT 2015344 ccoN1_3 synonymous_variant: CCAC::ACAT at 738 to 741 False 2954847 + cas2-3 frameshift_variant: positive deletion from No. 1 1349 to1380 False 2958217 + cas5 stop_gained: C139T positive No. 2 False 2958217 + cas5 stop_gained: C139T positive No. 3
[0128] The interference activity of the transferred CRISPR-Cas system using self-targeting assay was tested. A targeting plasmid pRhlI-Targeting was constructed based on the platform plasmid pPlatform (pAY5211) that was developed. The mini-CRISPR in pRhlI-Targeting encompasses a 32-bp spacer that is complementary to a 5-CC-3-preceded protospacer within the rhlI gene in PAO1 (
Example 2: Comparison of the Transferable Type I and Type II CRISPR-Cas Systems
Results
[0129] It was reported that transcription activator fused to the type I-F Cascade has a higher activation level compared with its fusion to the type II dCas9 protein in human cells. The targeting efficiency of the transferable type I-F and type II CRISPR-Cas systems in bacterial cells was compared. A transferable -Cas9 system was constructed by replacing the I-F cas operon in the transferable -I-F cas system with the Spcas9 gene and confirmed the expression of cas9 and -red genes using RT-qPCR after the system was integrated into the PAO1 genome (PAO1.sup.Cas9) (
Example 3: Transferable I-F Cas Systems Enable Diverse Genetic Manipulations in PAO1
Results
[0130] As the targeting activity of the transferable I-F CRISPR-Cas system was confirmed, this system was then exploited for gene deletion. The rhlI gene as selected for deletion because mutants with dysfunctional Rhl system in P. aeruginosa showing an obvious phenotype change due to its inability to produce the blue pigmented pyocyanin (PYO). A rhlI-deleting plasmid (pRhlI-Deletion-1) was constructed by assembling 800-bp upstream and 800-bp downstream homologous arms of rhlI into the targeting plasmid (pRhlI-Targeting) for homologous recombination (
[0131] Consistent with the PCR result, abolished PYO biogenesis was observed in the corresponding 37 identified rhlI mutants (
[0132] We next asked the specificity of the transferable I-F cas-mediated genome editing and the potential causes of false positive clones. 3 PCR-confirmed rhlI-deleted clones (rhlI) and 3 false positive clones generated from PAO1.sup.IF were selected for WGS analysis. Precise rhlI deletion without additional off-target mutation was identified in rhlI (
[0133] To obtain the PAO1 mutant that only contains the desired rhlI deletion (PAO1 rhlI) without the redundant 21.212-kb transferred elements, the capacity of the transferred -I-F cas system was further explored to delete large-scale genomic fragments such as the transferred elements. However, deletion of the entire integrated sequence would be extremely difficult owing to its considerably large size. To achieve this, the lacZ reporter was employed therein to indicate the excision same as the integration process. Once the integrated sequence which contains the constitutively expressed lacZ gene is removed, the recovered cell is unable to digest the X-gal substrate and consequently the colony grows in white color. A CRISPR-Cas removal plasmid pAY7401 which encompasses a lacZ-targeting mini-CRISPR and a donor sequence consisting of 5,067-bp upstream and 5,082-bp downstream homologous arms of the attB site was constructed. The excision capacity was first tested in the PAO1.sup.IF strain by introducing pAY7401 into this strain and recovered them on X-gal containing plates. As shown in the
[0134] Furthermore, the effect of spacer numbers in editing efficiency was compared. Two more rhlI-deleting plasmids pRhlI-Deletion-2 and pRhlI-Deletion-3 were generated (
Example 4: Transferable -I-F Cas System Enables Genome Editing in Strains with Various Genetic Background
Results
[0135] This transferable -I-F cas system for genome editing was expanded in other strains with different genetic background. In addition to the CRISPR-free strain PAO1, we selected some representative I-F CRISPR-Cas-containing strains but with different activities as well as some un-sequenced strains (
[0136] PA150577 is a clinically isolated strain which was found harboring a I-F CRISPR-Cas system in its genome. Sequence alignment showed that this system has a 98.69% identity with the I-F CRISPR-Cas system in PA154197 (
Example 5: Presence of Anti-CRISPR Elements Restricts Genome-Editing
Results
[0137] Although the transferable -I-F cas system provides a novel genome-editing strategy in P. aeruginosa, its activity is still inhibited in 2/3 screened clinical strains. The factors that inactivate the transferred CRISPR-Cas system were analyzed. Anti-CRISPR (Acr) is a group of natural inhibitors of CRISPR-Cas immune systems (Peng, et al., Trends in Microbiology, doi:10.1016/j.tim.2020.05.007; Marino, et al., Nature Methods 17, 471-479, doi:10.1038/s41592-020-0771-6 (2020)). So, the presence of anti-CRISPR elements could greatly prevent the editing process. Unfortunately, more than 30% of sequenced P. aeruginosa genomes were found to carry one or more Acr encoding genes (van Belkum, A. et al. Mbio 6, doi:10.1128/mBio.01796-15 (2015)). To confirm this obstacle, we sequenced the genome of PA130788, one of the strains with ineffective self-targeting, and searched for the presence of anti-CRISPR genes using AcrFinder (Yi, et al. Nucleic Acids Research 48, W358-W365, doi:10.1093/nar/gkaa351 (2020)). As speculated, an anti-CRISPR gene acr was identified (
[0138] Anti-CRISPR associated (aca) gene is commonly found located downstream of the acr gene and its function was recently proved to repress the expression of the acr genes. Based on that, a repression-based anti-anti-CRISPR strategy was proposed to reactivate a CRISPR-Cas system that is inhibited by the presence of anti-CRISPR proteins and restore its potential for genome editing. Inspired by these studies, we sought to overexpress the aca gene in the PA130788.sup.IF strain to see if overproduced Aca proteins can repress the anti-CRISPR expression and restore the editing potentials. To stably and constitutively express aca without introducing additional plasmids, we first assembled the aca gene downstream of the Ptat promoter in the transferable -I-F cas system and integrated this system to PA130788, generating PA130788_aca.sup.IF. As a result, PA130788_ac.sup.IF displayed 2.6-fold upregulation of the aca gene and 2.7-fold downregulation of the acr gene compared to PA130788.sup.IF (
Example 6: Repurposing the Transferable I-F CRISPR-Cas System for Gene Repression
Results
[0139] In addition to the anti-CRISPR elements that inactivate the transferable CRISPR-Cas system, two other major factors that impede genome editing are the capacity of homologous recombination and the availability of the editing plasmid. Sometimes, it is difficult to obtain a replicating plasmid that is compatible to the strain of interest and the antibiotic-resistant capacity of a strain limits the use of antibiotic selection markers. For example, P. aeruginosa ATCC27853 (PA27853) exhibits intrinsic resistance to kanamycin which resulted in the incapability of our system for genome editing. To overcome such impediment, a transferable CRISPR-based transcriptional interference (transferable CRISPRi) system which allows alternative functional delineation of a gene without introduction of additional plasmid except the first integrative plasmid was developed. The CRISPRi system was devised by eliminating the cas2-3 gene in the transferable I-F cas system to disable its DNA cleavage ability (
[0140] Similarly, the rhlI gene in the PAO1 strain was selected to develop this transferable CRISPRi system. We designed five mini-CRISPRs that encode crRNAs targeting different transcriptional regions of the rhlI gene (
[0141] To prove the applicability of the transferable CRISPRi system in other strains, we next examined its capacity in PA27853. An anti-CRISPR gene was detected and first removed from the genome using the counter-selection-based method in this strain, generating a new strain PA27853 acrIF. Same as PAO1, transferable CRISPRi systems that carry the mini-CRISPRs encoding crRNA-2 and 3, respectively, exhibit the most significant reduction of the PYO production and transcription level of rhlI (
[0142] Combining the phage -red recombination system, the precise and highly specific genetic manipulations in diverse P. aeruginosa strains with distinct genetic background including strains without native CRISPR-Cas system and strains with native I-F CRISPR-Cas systems but showing different levels of activity was demonstrated. This integration-mediated transferable strategy for Cas expression has several advantages compared with plasmid-encoded Cas proteins.
[0143] First, cas machinery can be transferred from E. coli SM10 using RP4 plasmid conjugative machinery efficiently and stably into the exclusive attB site in the genomes of P. aeruginosa strains, which has broader host-range than expression plasmids (Becher & Schweizer, BioTechniques 29, 948-950, 952, doi:10.2144/00295bm04 (2000); Peters, et al., Nature Microbiology 4, 244-250, doi:10.1038/s41564-018-0327-z (2019)) and the whole integrated system can be excised with convenient selection after editing. Second, plasmid-carried cas genes require specific antibiotics to maintain its propagation and Cas expression, which has limited choice for clinical multidrug-resistant isolates and sometimes antibiotic treatment inhibits cell growth or even causes cell lysis during cell proliferation. For the same reasons, the transferable CRISPRi system was established to be free of additional plasmid for crRNA expression, ensuring the robustness and stability of gene repression in diverse hosts without antibiotic treatment. As use of chromosome-encoded Cas subunits in combination with plasmid-encoded crRNA was attempted to repress rhlI expression in PA154197 Acas2-3, cell lysis occurred during cell proliferation in the presence of antibiotic. Although CRISPRi-based reduction of PYO production we observed (
[0144] Although self-targeting assay showed significantly decreased conjugation efficiency by introducing the targeting plasmid into the transferable I-F cas system integrated strains compared with the introduction of the control plasmid pAY5211, colonies still occurred by escaping self-targeting. For example, in the PAO1 strain, around 107 colonies were recovered from the transformation of pAY5211 and 27 colonies were recovered in average from pRhlI-Targeting. These colonies escaped from targeting constitute the major false positive clones during editing and consequently reduce the editing efficiency. Occurrence of false positive clones is mainly attributed to the mutations in the self-targeting mini-CRISPR or cas genes. As the genomes of three representative false positive clones in rhlI deletion were sequenced, mutations in the cas genes in all the three clones were identified. Although mutations in the rhlI-targeting mini-CRISPRs were not found, mutations in the pqsA-targeting mini-CRISPR were observed when they were recovered and sequenced from 8 false positive clones in the case of pqsA deletion. Two of them showed the loss of the spacer and one repeat sequence (
[0145] Successful gene deletions were achieved using the transferable I-F cas system, but the efficiency varies in diverse P. aeruginosa hosts. For example, in the PAO1 strain and the PA130788 strain with the deletion of anti-CRISPR element, gene deletion can be achieved at the rate higher than 80%. However, low efficiency ranging from 20% to 40% were observed in other strains such as PA150577, PA151671 and PA132533. The transferred cas genes in these strains showed comparable expression levels (
[0146] The transferred CRISPR-Cas systems are not active in all the strains. The systems were only active in 10 out of 30 clinical strains. Given that a high percentage of sequenced P. aeruginosa genomes (30%) contains anti-CRISPR genes, anti-CRISPR elements are speculated as the major obstacle in CRISPR-Cas exploitations in prokaryotes. After searching anti-CRISPR genes in two stains, PA130788 and PA27853, whose whole genome sequences are available and their transferred CRISPR-Cas systems are inactive, both genomes were found to contain an anti-CRISPR gene. Activities of the CRISPR-Cas systems in these two strains were reactivated by deleting their endogenous anti-CRISPR genes for efficient gene deletion and gene repression, respectively. Based on the obtained results, removal of the anti-CRISPR element by other methods such as counterselection-based method exhibited the most effective way to overcome the inactivation of CRISPR-Cas in specific strains. Even though removal of the anti-CRISPR element is relatively laborious and time-consuming using these methods, one-step transferable CRISPR-Cas-based genome editing or gene repression can be achieved once the anti-CRISPR element is removed. However, this strategy is not applicable in the strains without applicable genetic tools. Over-expression of anti-CRISPR repressors seems the most promising strategy to reactive CRISPR-Cas system by introducing a plasmid to express the associated repressor gene aca. However, when repression of the anti-CRISPR gene by over-expressing its associated repressor Aca in PA130788 was attempted, it was still not possible to reactivate the CRISPR-Cas system efficiently for genetic manipulation even with 28-fold upregulated expression of aca. This means that Aca-based repression is not robust, and the repression efficiency may vary in different strains possibly owing to the distinct genetic background.
[0147] Cas9-based two-step approaches were developed to achieve efficient genome editing in P. aeruginosa strains PAO1 and PAK. However, they failed to deliver desired gene deletion in other well-characterized strains such as PA14 and PA154197 by implementing the editing plasmid that was used to efficiently delete the mexR gene in PAO1. Difficulty to transform the editing plasmid into PA14 and dysfunctionality of the Cas9 system in PA154197 resulted in the failure of gene deletion in two strains, respectively (
REFERENCES
[0148] 1 Marraffini, L. A. CRISPR-Cas immunity in prokaryotes. Nature 526, 55-61, doi:10.1038/nature15386 (2015). [0149] 2 Makarova, K. S. et al. Evolutionary classification of CRISPR-Cas systems: a burst of class 2 and derived variants. Nature Reviews Microbiology 18, 67-83, doi:10.1038/s41579-019-0299-x (2020). [0150] 3 Koonin, E. V. & Makarova, K. S. Origins and evolution of CRISPR-Cas systems. Philosophical Transactions of the Royal Society BBiological Sciences 374, doi:10.1098/rstb.2018.0087 (2019). [0151] 4 Adli, M. The CRISPR tool kit for genome editing and beyond. Nature Communications 9, doi:10.1038/s41467-018-04252-2 (2018). [0152] 5 Knott, G. J. & Doudna, J. A. CRISPR-Cas guides the future of genetic engineering. Science 361, 866-869, doi:10.1126/science.aat5011 (2018). [0153] 6 Zhang, F. Development of CRISPR-Cas systems for genome editing and beyond. Quarterly Reviews of Biophysics 52, doi:10.1017/s0033583519000052 (2019). [0154] 7 Burstein, D. et al. New CRISPR-Cas systems from uncultivated microbes. Nature 542, 237-241, doi:10.1038/nature21059 (2017). [0155] 8 Koonin, E. V., Makarova, K. S. & Zhang, F. Diversity, classification and evolution of CRISPR-Cas systems. Current Opinion in Microbiology 37, 67-78, doi:10.1016/j.mib.2017.05.008 (2017). [0156] 9 Pickar-Oliver, A. et al. Targeted transcriptional modulation with type I CRISPR-Cas systems in human cells. Nature Biotechnology 37, 1493-1501, doi:10.1038/s41587-019-0235-7 (2019). [0157] 10 Chen, Y. et al. Repurposing type I-F CRISPR-Cas system as a transcriptional activation tool in human cells. Nature Communications 11, 3136, doi:10.1038/s41467-020-16880-8 (2020). [0158] 11 Dolan, A. E. et al. Introducing a Spectrum of Long-Range Genomic Deletions in Human Embryonic Stem Cells Using Type I CRISPR-Cas. Molecular Cell 74, 936-+, doi:10.1016/j.molcel.2019.03.014 (2019). [0159] 12 Cameron, P. et al. Harnessing type I CRISPR-Cas systems for genome engineering in human cells. Nature Biotechnology 37, 1471-+, doi:10.1038/s41587-019-0310-0 (2019). [0160] 13 Xu, Z., Li, Y., Li, M., Xiang, H. & Yan, A. Harnessing the type I CRISPR-Cas systems for genome editing in prokaryotes. Environmental Microbiology n/a, doi:10.1111/1462-2920.15116 (2020). [0161] 14 Li, Y. J. et al. Harnessing Type I and Type III CRISPR-Cas systems for genome editing. Nucleic Acids Research 44, doi:10.1093/nar/gkv1044 (2016). [0162] 15 Pyne, M. E., Bruder, M. R., Moo-Young, M., Chung, D. A. & Chou, C. P. Harnessing heterologous and endogenous CRISPR-Cas machineries for efficient markerless genome editing in Clostridium. Scientific Reports 6, doi:10.1038/srep25666 (2016). [0163] 16 Hidalgo-Cantabrana, C., Goh, Y. J., Pan, M. C., Sanozky-Dawes, R. & Barrangou, R. Genome editing using the endogenous type I CRISPR-Cas system in Lactobacillus crispatus. Proceedings of the National Academy of Sciences of the United States of America 116, 15774-15783, doi:10.1073/pnas.1905421116 (2019). [0164] 17 Xu, Z. L. et al. Native CRISPR-Cas-Mediated Genome Editing Enables Dissecting and Sensitizing Clinical Multidrug-Resistant P. aeruginosa. Cell Reports 29, 1707-+, doi:10.1016/j.celrep.2019.10.006 (2019). [0165] 18 Selle, K. & Barrangou, R. Harnessing CRISPR-Cas systems for bacterial genome editing. Trends in Microbiology 23, 225-232, doi:10.1016/j.tim.2015.01.008 (2015). [0166] 19 Oliver, A., Mulet, X., Lpez-Causap, C. & Juan, C. The increasing threat of Pseudomonas aeruginosa high-risk clones. Drug resistance updates: reviews and commentaries in antimicrobial and anticancer chemotherapy 21-22, 41-59, doi:10.1016/j.drup.2015.08.002 (2015). [0167] 20 Silby, M. W., Winstanley, C., Godfrey, S. A., Levy, S. B. & Jackson, R. W. Pseudomonas genomes: diverse and adaptable. FEMS microbiology reviews 35, 652-680, doi:10.1111/j.1574-6976.2011.00269.x (2011). [0168] 21 Hidalgo-Cantabrana, C. & Barrangou, R. Characterization and applications of Type I CRISPR-Cas systems. Biochemical Society Transactions 48, 15-23, doi:10.1042/bst20190119 (2020). [0169] 22 Richter, C. et al. Priming in the Type I-F CRISPR-Cas system triggers strand-independent spacer acquisition, bi-directionally from the primed protospacer. Nucleic Acids Res 42, 8516-8526, doi:10.1093/nar/gku527 (2014). [0170] 23 Richter, C., Gristwood, T., Clulow, J. S. & Fineran, P. C. In vivo protein interactions and complex formation in the Pectobacterium atrosepticum subtype I-F CRISPR/Cas System. PloS one 7, e49549, doi:10.1371/journal.pone.0049549 (2012). [0171] 24 Xu, Z., Li, Y. & Yan, A. Repurposing the Native Type I-F CRISPR-Cas System in Pseudomonas aeruginosa for Genome Editing. STAR Protocols 1, 100039, doi:https://doi.org/10.1016/j.xpro.2020.100039 (2020). [0172] 25 Duan, K. & Surette, M. G. Environmental regulation of Pseudomonas aeruginosa PAO1 las and rhl quorum-sensing systems. Journal of Bacteriology 189, 4827-4836, doi:10.1128/jb.00043-07 (2007). [0173] 26 Grohmann, E., Muth, G. & Espinosa, M. Conjugative plasmid transfer in gram-positive bacteria. Microbiology and Molecular Biology Reviews 67, 277-+, doi:10.1128/mmbr.67.2.277-301.2003 (2003). [0174] 27 Chen, W. et al. CRISPR/Cas9-based Genome Editing in Pseudomonas aeruginosa and Cytidine Deaminase-Mediated Base Editing in Pseudomonas Species. iScience 6, 222-231, doi:10.1016/j.isci.2018.07.024 (2018). [0175] 28 Peng, X., Mayo-Munoz, D., Bhoobalan-Chitty, Y. & Martinez-Alvarez, L. Anti-CRISPR Proteins in Archaea. Trends in Microbiology, doi:10.1016/j.tim.2020.05.007. [0176] 29 Marino, N. D., Pinilla-Redondo, R., Csorgo, B. & Bondy-Denomy, J. Anti-CRISPR protein applications: natural brakes for CRISPR-Cas technologies. Nature Methods 17, 471-479, doi:10.1038/s41592-020-0771-6 (2020). [0177] 30 van Belkum, A. et al. Phylogenetic Distribution of CRISPR-Cas Systems in Antibiotic-Resistant Pseudomonas aeruginosa. Mbio 6, doi:10.1128/mBio.01796-15 (2015). [0178] 31 Yi, H. et al. AcrFinder: genome mining anti-CRISPR operons in prokaryotes and their viruses. Nucleic Acids Research 48, W358-W365, doi:10.1093/nar/gkaa351% J Nucleic Acids Research (2020). [0179] 32 Choi, K.-H. & Schweizer, H. P. An improved method for rapid generation of unmarked Pseudomonas aeruginosa deletion mutants. BMC Microbiol 5, 30-30, doi:10.1186/1471-2180-5-30 (2005). [0180] 33 Stanley, S. Y. et al. Anti-CRISPR-Associated Proteins Are Crucial Repressors of Anti-CRISPR Transcription. Cell 178, 1452-1464.e1413, doi:https://doi.org/10.1016/j.cell.2019.07.046 (2019). [0181] 34 Csrg, B. et al. A minimal CRISPR-Cas3 system for genome engineering. bioRxiv, 860999, doi:10.1101/860999 (2019). [0182] 35 Bikard, D. et al. Programmable repression and activation of bacterial gene expression using an engineered CRISPR-Cas system. Nucleic acids research 41, 7429-7437, doi:10.1093/nar/gkt520 (2013). [0183] 36 Becher, A. & Schweizer, H. P. Integration-proficient Pseudomonas aeruginosa vectors for isolation of single-copy chromosomal lacZ and lux gene fusions. BioTechniques 29, 948-950, 952, doi:10.2144/00295bm04 (2000). [0184] 37 Peters, J. M. et al. Enabling genetic analysis of diverse bacteria with Mobile-CRISPRi. Nature Microbiology 4, 244-250, doi:10.1038/s41564-018-0327-z (2019). [0185] 38 Xu, Z. L. et al. Zinc excess increases cellular demand for iron and decreases tolerance to copper in Escherichia coli. Journal of Biological Chemistry 294, 16978-16991, doi:10.1074/jbc.RA119.010023 (2019). [0186] 39 Bolger, A. M., Lohse, M. & Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114-2120, doi:10.1093/bioinformatics/btu170 (2014). [0187] 40 Bankevich, A. et al. SPAdes: A New Genome Assembly Algorithm and Its Applications to Single-Cell Sequencing. J Comput Biol 19, 455-477, doi:10.1089/cmb.2012.0021 (2012). [0188] 41 Page, A. J. et al. Robust high-throughput prokaryote de novo assembly and improvement pipeline for Illumina data. doi:10.17863/CAM.43554 (2016). [0189] 42 Hunt, M. et al. Circlator: automated circularization of genome assemblies using long sequencing reads. Genome Biol 16, 294, doi:10.1186/s13059-015-0849-0 (2015). [0190] 43 Seemann, T. Prokka: rapid prokaryotic genome annotation. Bioinformatics 30, 2068-2069, doi:10.1093/bioinformatics/btu153 (2014). [0191] 44 Klompe, S. E., Vo, P. L. H., Halpin-Healy, T. S. & Sternberg, S. H. Transposon-encoded CRISPR-Cas systems direct RNA-guided DNA integration. Nature 571, 219-225, doi:10.1038/s41586-019-1323-z (2019). [0192] 45 Li, H. Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. (2013). [0193] 46 Li, H. et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078-2079, doi:10.1093/bioinformatics/btp352 (2009). [0194] 47 Quinlan, A. R. & Hall, I. M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841-842, doi:10.1093/bioinformatics/btq033 (2010). [0195] 48 Cao, H. L. et al. Uncoupled Quorum Sensing Modulates the Interplay of Virulence and Resistance in a Multidrug-Resistant Clinical Pseudomonas aeruginosa Isolate Belonging to the MLST550 Clonal Complex. Antimicrobial Agents and Chemotherapy 63, doi:10.1128/aac.01944-18 (2019).