COMPOSITION FOR REGULATING OSTEOCLAST DIFFERENTIATION, AND USE THEREOF

20230405092 ยท 2023-12-21

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a composition for regulating the differentiation of osteoclasts, and is very effective in preventing or treating bone-related diseases by effectively maintaining bone homeostasis by regulating bone metabolism, particularly the differentiation of bone marrow cells into osteoclasts.

    Claims

    1-28. (canceled)

    29. A method for providing information for diagnosing bone-related disease, comprising a step of measuring the expression level of the Pellino-1 protein (protein pellino homolog 1) or the gene encoding the protein in the biological sample isolated from a subject of interest.

    30. The method of claim 29, wherein it is predicted that, when the measured expression level of the Pellino-1 protein or the gene encoding the protein in the biological sample is higher than a control, the subject of interest has bone-related disease due to inhibition of osteoclast differentiation.

    31. The method of claim 29, wherein it is predicted that, when the measured expression level of the Pellino-1 protein or the gene encoding the protein in the biological sample is lower than a control, the subject of interest has bone-related disease due to hyperdifferentiation of osteoclast.

    32. A method for treating bone-related disease, comprising a step of administering an effective amount of a composition to a subject in need thereof, wherein the composition comprises at least one selected from the group consisting of the Pellino-1 protein (protein pellino homolog 1); the gene encoding the Pellino-1 protein; and the expression vector containing the gene encoding the Pellino-1 protein.

    33. The method of claim 32, wherein the bone-related disease comprises at least one selected from the group consisting of osteoporosis, osteomalacia, osteopenia, osteopetrosis, bone atrophy, fibrous dysplasia, Paget's disease, hypercalcemia, giant cell tumor, neoplastic destruction, cancer-related bone resorption disease, fracture, osteolysis, osteoarthritis, and rheumatoid arthritis.

    34. The method of claim 32, wherein the bone-related disease is caused by hyperdifferentiation of bone marrow cells into osteoclasts.

    35. A method for treating bone-related disease, comprising a step of administering an effective amount of an agent to a subject in need thereof, wherein the agent is for reducing the expression level of the Pellino-1 protein (protein pellino homolog 1) or the gene encoding the protein.

    36. The method of claim 35, wherein the bone-related disease is osteopetrosis.

    37. The method of claim 35, wherein the bone-related disease is caused by inhibition of differentiation of bone marrow cells into osteoclasts.

    Description

    BRIEF DESCRIPTION OF DRAWINGS

    [0141] FIG. 1 shows the results confirming the mRNA expression levels of Pellino-1, Pellino-2, and Pellino-3 during the osteoclast differentiation period of mice bone marrow derived macrophage (mBMM) according to an embodiment of the present invention.

    [0142] FIGS. 2A and 2B shows changes in the NFATc1 promoter activity when overexpressing or knocking down Pellino-1 (protein pellino homolog 1) in HEK293T in vitro according to an embodiment of the present invention.

    [0143] FIG. 2C shows changes in the NFATc1 promoter activity when Pellino-1 is gradually inhibited in HEK293T in vitro according to an embodiment of the present invention.

    [0144] FIG. 3 shows a view of bone marrow derived microphage (BMM) separated from Pellino-1.sup.f1/f1 and Pellino-1.sup.f1/f1Ctsk mice dyed with a tartrate resistant acid phosphatase (TRAP) and viewed under an electron microscope according to an embodiment of the present invention.

    [0145] FIG. 4 shows the tartrate resistant acid phosphatase (TRAP) activity of bone marrow derived microphage (BMM) separated from Pellino-1.sup.f1/f1 and Pellino-1.sup.f1/f1Ctsk mice according to an embodiment of the present invention.

    [0146] FIGS. 5A to 5C confirm changes in body weight and skeletal changes of a control group and a Pellino-1 deficient mouse according to an embodiment of the present invention.

    [0147] FIG. 6A shows the analysis of femurs of a control group and a Pellino-1 deficient mouse using a computed tomography (micro-CT) scan according to an embodiment of the present invention.

    [0148] FIG. 6B shows the trabecular bone volume ratio (BV/TV), bone mineral density (BMD), volumetric BMD of trabecular bone, bone surface ratio (BS/BV), trabecular thickness (Tb.Th), trabecular number (Tb.N) and trabecular separation (Tb.Sp) of a control group and a Pellino-1 deficient mouse according to an embodiment of the present invention.

    [0149] FIG. 7 shows the results confirming the expression level of CTX-1, a serum bone resorption index, of a control group and a Pellino-1 deficient mouse according to an embodiment of the present invention.

    [0150] FIG. 8 compares the degree of mRNA expression of NFATc1 after overexpressing Pellino-1 in raw cells in vitro according to an embodiment of the present invention.

    [0151] FIG. 9 shows an electron microscopy view after overexpression of Pellino-1 in raw cells in vitro for 1 hour, followed by staining with tartrate resistant acid phosphatase (TRAP) solution, according to an embodiment of the present invention.

    [0152] FIG. 10 shows the tartrate resistant acid phosphatase (TRAP) activity measured after overexpression of Pellino-1 in raw cells in vitro for 1 hour, followed by staining with tartrate resistant acid phosphatase (TRAP) solution, according to an embodiment of the present invention.

    BEST MODE

    [0153] One embodiment of the present invention is directed to a composition for diagnosing bone-related disease, comprising an agent for measuring an expression level of a Pellino-1 protein (protein pellino homolog 1) or a gene encoding the protein.

    [0154] Another embodiment of the present invention is directed to a kit for diagnosing bone-related disease, comprising the composition for diagnosing bone-related disease according to the present invention.

    [0155] Still another embodiment of the present invention is directed to a method for providing information for diagnosing bone-related disease, comprising a step of measuring the expression level of the Pellino-1 protein (protein pellino homolog 1) or the gene encoding the protein in the biological sample isolated from a subject of interest.

    [0156] Yet another embodiment of the present invention is directed to a device for diagnosing bone-related disease, the device comprising: (a) a measuring unit that measures the expression level of the Pellino-1 protein or the gene encoding the protein in the biological sample isolated from a subject of interest, and (b) a detection unit that outputs the onset or possibility of onset of bone-related diseases in the subject of interest from the measured expression levels by the measuring unit.

    [0157] Still yet another embodiment of the present invention is directed to a composition for inhibiting osteoclast differentiation, comprising at least one selected from the group consisting of the Pellino-1 protein (protein pellino homolog 1); the gene encoding the Pellino-1 protein; and expression vector containing the gene encoding the Pellino-1 protein.

    [0158] A further embodiment of the present invention is directed to a composition for inducing osteoclast differentiation, comprising an agent for reducing the expression level of the Pellino-1 protein (protein pellino homolog 1) or the gene encoding the protein.

    [0159] Another further embodiment of the present invention is directed to a pharmaceutical composition for preventing or treating bone-related disease, comprising at least one selected from the group consisting of the Pellino-1 protein (protein pellino homolog 1); the gene encoding the Pellino-1 protein; and the expression vector containing the gene encoding the Pellino-1 protein.

    [0160] Still another further embodiment of the present invention is directed to a pharmaceutical composition for preventing or treating bone-related disease, comprising an agent for reducing the expression level of the Pellino-1 protein (protein pellino homolog 1) or the gene encoding the protein.

    [0161] Yet another further embodiment of the present invention is directed to a method for preventing or treating bone-related disease, comprising a step of administering, to a subject in need thereof, an effective amount of composition containing at least one selected from the group consisting of the Pellino-1 protein (protein pellino homolog 1); the gene encoding the Pellino-1 protein; and the expression vector containing the gene encoding the Pellino-1 protein.

    [0162] Still yet another further embodiment of the present invention is directed to a method for preventing or treating bone-related disease, comprising a step of administering, to a subject in need thereof, an effective amount of an agent for reducing the expression level of the Pellino-1 protein (protein pellino homolog 1) or the gene encoding the protein.

    [0163] A still further embodiment of the present invention is directed to an agent for use in the treatment of bone-related disease, comprising at least one selected from the group consisting of the Pellino-1 protein (protein pellino homolog 1); the gene encoding the Pellino-1 protein; and the expression vector containing the gene encoding the Pellino-1 protein.

    [0164] Yet still further embodiment of the present invention is directed to an agent for use in the treatment of bone-related disease, reducing the expression level of the Pellino-1 protein (protein pellino homolog 1) or the gene encoding the protein.

    MODE FOR INVENTION

    [0165] Hereinafter, the present invention will be described in detail by following the embodiments. These embodiments are only for explaining the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these embodiments according to the gist of the present invention.

    Preparation Example 1: Preparation of Mice

    [0166] The inventors of the present invention were approved by the Yonsei University Health System Institutional Animal Care and Use Committee, and all experiments were performed with the approval of the Yonsei University College of Medicine Animal Experimentation Ethics Committee (Permit Number: 2013-0401, 2014-0033). The Pellino-1.sup.f1/f1Ctsk mice were prepared by crossing the Pellino-1.sup.f1/f1 mice with the Pellino-1 flox/+, Cathepin K-Cre mice. Pellino-1 flox/+ mice were obtained from Korea and Cathepin K-Cre mice were obtained from the United States, but all mice were of the C57BL/6 strain.

    Preparation Example 2: Isolation of Mice Bone Marrow Derived Macrophage (mBMMS) from Mice

    [0167] The bone marrow cells from 6-week old male Pellino-1.sup.f1/f1 and Pellino-1 Ctsk mice were isolated from the femur and tibia by flushing the bone marrow with 27 gauge needles and filtered through a 70 m cell strainer (Falcon, USA). Then the cells were centrifuged at 1,500 rpm for 10 minutes and resuspended in a -MEM medium containing 10% FBS and 50 unit/ml of 1% penicillin. The cells were seeded in a 75T flask culture dish, and after 72 hours, the supernatant was obtained and re-inoculated into a new 10 cm.sup.2 culture dish. The supernatant was collected again and centrifuged at 1,500 rpm for 10 minutes, and the mouse bone marrow-derived macrophages (BMM) were finally obtained by culturing at 37 C., 5% CO.sub.2 in -minimum essential medium (-MEM) containing 10% fetal bovine serum (FBS) with 1% antibiotic antifungal solution.

    Embodiment 1: Measurement of Pellino-1 Expression Level During Osteoclastogenesis

    [0168] To evaluate the role of Pellino-1 in the process of osteoclastogenesis, the inventors of the present invention isolated primary osteoclast precursor cells from ICR mice and induced osteoclast differentiation in vitro by M-CSF and RANKL. At this time, BMM was isolated using Detachin (Genlantis, San Diego, CA, USA) and 110.sup.5 cells were seeded on 12 well plates for osteoclastogenesis. BMM was carried out in a growth medium containing 10 ng/ml M-CSF and 10 ng/ml RANKL to induce osteoclastogenesis and replaced every other day.

    [0169] The mBMM obtained in Preparation Example 2 cultured with 10 ng/m of M-CSF and RANKL, and harvested on a designated day (right after induction and day 1 to 3 after induction). The expression levels of osteoclast marker genes were analyzed by qRT-PCR on each designated day. Total RNA used as per the manufacturer's instructions in the AccuPrep Universal RNA Extraction Kit (Bioneer), and qRT-PCR was performed to measure mRNA expression changes between groups. The primer sets used at this time are shown in Table 1 below.

    TABLE-US-00001 TABLE1 GENE PrimerSequence(5.fwdarw.3) Pellino-1 F:TGTGGGAACGTCTTCAGTCTGC R:CAGCAAGGTTGCACCACAAAGG Pellino-2 F:GTGTGACAGGAACGAGCCATAC R:AGGACACCGTTGGTAGTGAGTC Pellino-3 F:CTGCTGGCTTTGATGCCTCTAG R:GCAGAGTCCTCGGAGAAGCCA -ACTIN F:CTTCTACAATGAGCTGCGTG R:TCATGAGGTAGTCTGTCAGG

    [0170] Changes in the expression of the Pellino family were confirmed during osteoclast differentiation, and Pellino-1, Pellino-2, and Pellino-3 of the Pellino family were reduced but it was confirmed that there was a significant decrease in the mRNA expression level of Pellino-1 (see FIG. 1). Given such results, it can be seen that Pellino-1 of the Pellino family plays a negative role during osteoclast differentiation in mBMM.

    Embodiment 2: Verification of Osteoclast Differentiation Efficacy According to Pellino-1 Regulation

    [0171] In order to verify that Pellino-1 regulation is required to activate osteoclast differentiation efficacy, we tried to confirm the correlation between regulation of Pellino-1 expression and differentiation of osteoclasts. For this, the transcriptional activity of NFATc1 (nuclear factor of activated T cell) based on regulation of Pellino-1 expression, commonly known as the most important transcription factor for osteoclast differentiation, was confirmed.

    [0172] After overexpressing, knocking down, and gradually inhibiting Pellino-1 in the HEK293T cell line in vitro, the results confirming the transcriptional activity of osteoclast differentiation marker NFATc1 was shown in FIGS. 2A to 2C. It was confirmed that the transcriptional activity of NFATc1 decreased when Pellino-1 was overexpressed, whereas the transcriptional activity of NFATc1 increased when Pellino-1 was knocked down (see FIGS. 2A and 2B). In addition, it was confirmed that when Pellino-1 was knocked down gradually, the transcriptional activity of NFATc1 gradually increased (see FIG. 2C). NFATc1 is known to play an important role in activating calcium signals in osteoclast differentiation, and when the NFATc1 transcriptional factor is activated, osteoclast differentiation is induced. As such, it can be seen that when Pellino-1 is inhibited, NFATc1 is activated and osteoclast differentiation is accelerated.

    [0173] That is, the ability to activate NFATc1, a master regulator of osteoclasts, suggests that it can be used as a new target drug that can be applied to the treatment of bone and joint diseases including osteoporosis.

    Embodiment 3: Effects of Pellino-1 Deletion on Osteoclastogenesis

    [0174] 3.1 TRAP Staining and Activity Measurement

    [0175] In order to see what role the deletion of Pellino-1 plays in osteoclastogenesis, an additional experiment was performed using the mice prepared in the preparation sample to confirm the effect of Pellino-1 deletion on osteoclastogenesis. Supernatant obtained from 100 l of osteoclast culture was incubated for 1 hour at 37 C. with a substrate mixture containing acetate solution (Sigma-Aldrich), 1 M sodium tartrate and phosphatase substrate (Sigma-Aldrich). The reaction was stopped by adding 3 N HCl, and TRAP activity was measured at an absorbance wavelength of 405 nm. At this time, TRAP staining was performed using Acid Phosphatase and Leukocyte kit (Sigma-Aldrich) according to the manufacturer's instructions, and the cells were fixed with a fixative and stained for 1 hour at 37 C.

    [0176] More specifically, BMMs isolated from Pellino-1.sup.f1/f1 mice and Pellino-1 Ctsk mice were treated with 10 ng/ml M-CSF and 10 ng/ml RANKL to induce osteoclast differentiation, and as shown in the TRAP staining results in FIG. 3, it was confirmed that osteoclast differentiation increased in Pellino-1 Ctsk BMM in comparison to Pellino-1.sup.f1/f1 BMM. In addition, it was confirmed that TRAP activity was significantly increased in Pellino-1 Ctsk BMM compared to in Pellino-1.sup.f1/f1 BMM (see FIG. 4).

    [0177] 3.2 Confirmation of In Vivo Function of Pellino-1 (Confirmation of Body Weight and Skeletal Changes)

    [0178] In order to confirm the in vivo function of Pellino-1 in osteoclasts, experiments were performed with the mice from Preparation Example 2 from birth to 12 weeks. Femur specimen were fixed in 70% ethanol for 24 hours at room temperature for micro-CT (CT) analysis, and the fixed sample were analyzed using high-resolution CT (Skyscan-1173, Skyscan, Kontich, Belgium). CT image reconstruction and analysis were performed using the reconstruction software Nrecon (v1.7.0.4, Bruker-CT), cross-sectional images were performed with DataViewer (v1.5.1.2, Bruker-CT), and measurements were performed with SkyScan1173 control software (v1.6, Bruker-CT).

    [0179] Pellino-1 Ctsk in the femur of 6-week-old mice had no effect on viability and fertility. From the 5th week, the body weight of Pellino-1Ctsk was lower than that of Pellino-1.sup.f1/f1, and at week 6, it was confirmed that the size of Pellino-1 Ctsk was smaller than that of Pellino-1.sup.f1/f1. In addition, it was confirmed that the size of the femur was smaller in Pellino-1 Ctsk compared to Pellino-1.sup.f1/f1 mice (see FIGS. 5A to 5C). However, there was no difference in neonatal mice, suggesting that regulation of osteoclast activity by Pellino-1 was performed during postnatal development.

    [0180] The trabecular bone volume ratio (BV/TV), bone mineral density (BMD), volumetric BMD of trabecular bone, bone surface ratio (BS/BV), trabecular thickness (Tb.Th), trabecular number (Tb.N) and trabecular separation (Tb.Sp) of 6-week-old Pellino-1 Ctsk mice were measured. The femur showed a significant decrease in bone volume compared to the control group, and in bone, Pellino-1 Ctsk mice were characterized by significantly reduced trabecular bone volume ration, bone density, trabecular thickness, trabecular number, and trabecular separation compared to the Pellino-1.sup.f1/f1 mice (see FIG. 6B). These results suggest that Pellino-1 deletion in osteoclasts induces excessive bone resorption.

    [0181] 3.3 Measurement of the Level of Bone Resorption

    [0182] To confirm the effect of Pellino-1 deletion on osteoclast development, serum levels of CTX (collage type 1) c-terminal telopeptides, a bone resorption marker, were measured in the Pellino-1 Ctsk group. Immediately after sacrifice of the mice, blood was obtained from 6-week-old male Pellino-1.sup.f1/f1 and Pellino-1 Ctsk mice, and the serum was separated using a serum separator tube, and serum levels of CTX (IDS) were measured according to the serum bone resorption index using each ELISA kit according to the manufacturer's instructions.

    [0183] The Pellino-1 knockout was found to increase bone resorption (see FIG. 7). Increased serum levels of CTX-1, a diagnostic marker for bone resorption, were increased in the Pellino-1 deletion mouse group, confirming increased bone resorption, suggesting that the downregulation of Pellino-1 is an important process for osteoclast differentiation.

    [0184] 3.4 Statistical Analysis

    [0185] All statistical analyses in the present invention were performed by analysis of variance (ANOVA) or Student's t-test using GraphPad Prism6 software, and each data was calculated as meanstandard deviation. A p-value of less than 0.05 was considered statistically significant.

    Embodiment 4: Effect of Pellino-1 Overexpression on Osteoclastogenesis

    [0186] 4.1 Measurement of NFATc1 mRNA Expression Level

    [0187] In order to see what role Pellino-1 overexpression plays in the process of osteoclastogenesis, an additional in vitro experiment was performed to confirm the effect of Pellino-1 overexpression on osteoclastogenesis. Specifically, after overexpressing Pellino-1 in RAW 264.7 cells using a lentiviral vector, differentiation of osteoclasts was induced for 4 days. On day 4 of differentiation, RT-PCR was performed to compare and analyze the mRNA expression level of NFATc1, known as the most important transcription factor for osteoclast differentiation.

    [0188] The results of the experiment confirmed that the mRNA expression level of NFATc1 was inhibited in the Pellino-1 overexpressed group compared to the control group (see FIG. 8). From this, it can be seen that the differentiation of osteoclasts will be suppressed through the decreased expression of the NFATc1 transcriptional factor in the Pellino-1 overexpressed group.

    [0189] 4.2 TRAP Staining and Activity Measurement

    [0190] In order to confirm the osteoclastogenesis inhibitory effect upon Pellino-1 overexpression, an additional experiment was performed according to the method in Embodiment 3 using the RAW 264.7 cells prepared in 4.1 above. Specifically, the supernatant obtained from 100 l of cell culture was incubated for 1 hour at 37 C. with a substrate mixture containing acetate solution (Sigma-Aldrich), 1 M sodium tartrate and phosphatase substrate (Sigma-Aldrich). The reaction was stopped by adding 3 N HCl, and TRAP activity was measured at an absorbance wavelength of 405 nm. At this time, TRAP staining was performed using Acid Phosphatase and Leukocyte kit (Sigma-Aldrich) according to the manufacturer's instructions, and the cells were fixed with a fixative and stained for 1 hour at 37 C.

    [0191] The results of the experiment confirmed that as for osteoclast differentiation, the proportion of TRAP (+) cells decreased in the Pellino-1 overexpressed group as shown in the TRAP staining results of FIG. 9. As shown in FIG. 10, it was confirmed that the differentiation potential was inhibited through the decrease in TRAP activity. By confirming the effect of Pellino-1 overexpression, it was confirmed again that it was a negative regulator of osteoclast differentiation,

    [0192] Taken together, it can be confirmed that the deletion of Pellino-1 promotes differentiation of osteoclasts, and overexpression of Pellino-1 inhibits differentiation of osteoclasts. This suggests that using Pellino-1 as a positive/negative regulator that regulates the differentiation of osteoclasts can treat bone-related diseases caused by dysregulation of osteoclast differentiation. Therefore, Pellino-1 is expected to be a new therapeutic target for bone-related diseases beyond bone-related diagnosis.

    [0193] Having described specific parts of the present invention in detail above, it is clear to those skilled in the art that these specific techniques are only preferred embodiments, and that the scope of the present invention is not limited thereto. Accordingly, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

    INDUSTRIAL APPLICABILITY

    [0194] A composition according to the prevent invention can maintain bone homeostasis by regulating bone metabolism, particularly the differentiation of bone marrow cells into osteoclasts, and can also be used very effectively for preventing or treating bone-related diseases.