PROTECTING OLIGONUCLEOTIDES FOR CRISPR GUIDE RNA

Abstract

Protecting oligonucleotides are provided. Protecting oligonucleotides with 5 and/or 3 conjugated moieties are provided. Protecting oligonucleotides with chemical modifications are provided. Methods of using the protecting oligonucleotides for genome editing with a CRISPR nuclease and kits for performing the same are also provided.

Claims

1. A protecting oligonucleotide comprising: (a) a sequence that is complementary to a crRNA; and (b) at least one chemically modified nucleotide, wherein the protecting oligonucleotide is capable of binding the crRNA, and wherein the protecting oligonucleotide confers nuclease resistance to the crRNA when bound.

2. The protecting oligonucleotide of claim 1, wherein the at least one chemically modified nucleotide comprises a modification of a ribose group, a phosphate group, a nucleobase, or a combination thereof, optionally wherein the modification of the ribose group is independently selected from the group consisting of 2-O-methyl, 2-fluoro, 2-deoxy, 2-O-(2-methoxyethyl) (MOE), 2-NH.sub.2(2-amino), 4-thio, a bicyclic nucleotide, a locked nucleic acid (LNA), a 2-(S)-constrained ethyl (5-cEt), a constrained MOE, and a 2-O,4-C-aminomethylene bridged nucleic acid (2,4-BNA.sup.NC).

3. (canceled)

4. The protecting oligonucleotide of claim 2, wherein at least 80% of the ribose groups are chemically modified.

5. The protecting oligonucleotide of claim 2, wherein at least 90% of the ribose groups are chemically modified.

6. The protecting oligonucleotide of claim 2, wherein 100% of the ribose groups are chemically modified.

7. (canceled)

8. The protecting oligonucleotide of claim 1, wherein the protecting oligonucleotide binds to the crRNA to form a duplex, optionally wherein the protecting oligonucleotide binds to a region of the crRNA that is not fully chemically modified.

9. The protecting oligonucleotide of claim 8, wherein the duplex has a melting temperature (Tm) of greater than 37 C. over the full length of the duplex.

10. The protecting oligonucleotide of claim 8, wherein the duplex has a melting temperature (Tm) of less than 37 C. over the region of complementarity comprising the guide sequence portion.

11. The protecting oligonucleotide of claim 1, wherein the binding of a tracrRNA to the guide sequence portion of the crRNA dissociates the protecting oligonucleotide from the crRNA.

12. The protecting oligonucleotide of claim 1, further comprising at least one moiety conjugated to the protecting oligonucleotide, optionally wherein the at least one moiety is selected from the group consisting of fatty acids, steroids, secosteroids, lipids, gangliosides analogs, nucleoside analogs, endocannabinoids, vitamins, receptor ligands, peptides, aptamers, and alkyl chains, or wherein the at least one moiety is selected from the group consisting of cholesterol, cholesterol-triethylene glycol (TEGChol), docosahexaenoic acid (DHA), docosanoic acid (DCA), lithocholic acid (LA), GalNAc, amphiphilic block copolymer (ABC), hydrophilic block copolymer (HBC), poloxamer, Cy5, and Cy3.

13-24. (canceled)

25. A double stranded oligonucleotide comprising: (a) a crRNA comprising (i) a guide sequence portion capable of hybridizing to a target polynucleotide sequence, and (ii) a repeat sequence portion; and (b) a protecting oligonucleotide that is complementary to the crRNA, wherein the crRNA comprises at least 50% modified nucleotides, and wherein the protecting oligonucleotide comprises at least one modified nucleotide.

26. The double stranded oligonucleotide of claim 25, wherein the at least one modified nucleotide in the protecting oligonucleotide or the modified nucleotides in the crRNA comprises a modification of a ribose group, a phosphate group, a nucleobase, or a combination thereof, optionally wherein the modification of the ribose group is independently selected from the group consisting of 2-O-methyl, 2-fluoro, 2-deoxy, 2-O-(2-methoxyethyl) (MOE), 2-NH.sub.2(2-amino), 4-thio, a bicyclic nucleotide, a locked nucleic acid (LNA), a 2-(S)-constrained ethyl (5-cEt), a constrained MOE, and a 2-O,4-C-aminomethylene bridged nucleic acid (2,4-BNA.sup.NC).

27-48. (canceled)

49. The double stranded oligonucleotide of claim 1, further comprising a tracrRNA comprising an anti-repeat nucleotide sequence that is complementary to the repeat sequence portion of the crRNA.

50. The double stranded oligonucleotide of claim 49, further comprising a nucleotide or non-nucleotide loop or linker linking the 3 end of the crRNA portion to the 5 end of the tracrRNA portion, optionally wherein: the non-nucleotide linker comprises an ethylene glycol oligomer linker; the nucleotide loop is chemically modified; and/or the nucleotide loop comprises the nucleotide sequence of GAAA.

51. The protecting oligonucleotide or double stranded oligonucleotide of claim 1, comprising a crRNA portion modification pattern consisting of: mN # mN # mN # mNmNmNmNmNmNmNfNfNfNfNrN # rN # fNfNrN # mNmGrU # rU # rU # fUfAmG mAmGmCmUmAmU # mG # mC # mU fSEQ ID NO:3) (crRNA 20); or comprising a crRNA modification pattern selected from any of crRNA 1-134 of Table 2; wherein rN=RNA, mN=2-O-methyl RNA, fN=2-fluoro RNA, N # N=phosphorothioate linkage, and N=any nucleotide.

52. The protecting oligonucleotide or double stranded oligonucleotide claim 1, wherein the protecting oligonucleotide comprises a modification pattern selected from the group consisting of: TABLE-US-00010 mAmAmAmCmNmNmNmNmN(RC01); mAmAmAmAmCmNmNmNmNmN(RC02); mAmAmAmCmNmNmNmNmNmN(RC03); mAmAmAmAmCmNmNmNmNmNmN(RC04); mUmAmAmAmAmCmNmNmNmNmNmN(RC05); mAmAmAmAmCmNmNmNmNmNmNmN(RC06); mUmAmAmAmAmCmNmNmNmNmNmNmN(RC07); mCmUmAmAmAmAmCmNmNmNmNmNmNmN(RC08); mUmAmAmAmAmCmNmNmNmNmNmNmNmN(RC09); mCmUmAmAmAmAmCmNmNmNmNmNmNmNmN(RC10); mU#mA#mAmAmAmCmNmNmNmNmN#mN#mN(RC07-2PS); and mU#mA#mA#mAmAmCmNmNmNmN#mN#mN#mN(RC07-3PS), whereinmN=2-O-methylRNA, N#N=phosphorothioatelinkage, andN=anynucleotide.

53-54. (canceled)

55. The protecting oligonucleotide or double stranded oligonucleotide of claim 52, wherein the guide RNA binds to a Cas9 nuclease selected from the group consisting of S. pyogenes Cas9 (SpCas9), S. aureus Cas9 (SaCas9), N. meningitidis Cas9 (NmCas9), C. jejuni Cas9 (CjCas9), and Geobacillus Cas9 (GeoCas9), optionally wherein the Cas9 is a variant Cas9 with altered activity.

56-57. (canceled)

58. A method of editing a target region of a genome in a cell, comprising administering to said cell a genome editing system comprising: the protecting oligonucleotide of claim 1; one or more crRNAs of; one or more tracrRNAs; and an RNA-guided nuclease or a polynucleotide encoding an RNA-guided nuclease.

59. The method of claim 58, wherein: the target gene is in a cell in an organism; expression of the target gene is knocked out or knocked down; and/or the RNA-guided nuclease or a polynucleotide encoding an RNA-guided nuclease and the one or more tracrRNAs are administered to the cell before the one or more crRNAs or the protecting oligonucleotide.

60-61. (canceled)

62. The oligonucleotide of claim 1, further comprising a linker linking the 3 end of the crRNA portion to the 5 end of the tracrRNA portion, optionally wherein: the linker is cleavable, optionally wherein: the linker is a cleavable d(TT)-PO-C7 linker.

63. (canceled)

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0061] The foregoing and other features and advantages of the present disclosure will be more fully understood from the following detailed description of illustrative embodiments taken in conjunction with the accompanying drawings. The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0062] FIG. 1A-FIG. 1E Schematic representation of stable cell lines, and activity and stability of chemically modified crRNAs. FIG. 1A is a schematic representation of the stable HEK293T cell line that expresses SpyCas9 nuclease, tracrRNA, and a fluorescent reporter gene that consists of a broken GFP and an out-of-frame mCherry. Electroporation of crRNAs targeting the GFP sequence will generate frameshift mutations and place the mCherry coding sequence in-frame. FIG. 1B is a schematic representation of the stable HEK293T cell line that expresses SpyCas9 Adenine base editor (SpyCas9-ABE8e), tracrRNA, and a fluorescent reporter gene that consists of a G-to-A nonsense mutation within the GFP coding sequence. Electroporation of crRNA will restore GFP fluorescence by an A-to-G edit that reverses the mutation. FIG. 1C depicts the activities of different chemically modified crRNAs were measured by electroporating 50 pmole crRNA per 510.sup.4 cells to the stable cell line shown in FIG. 1A. Cells were harvested 48 hours post-electroporation and the percentage of mCherry positive cells was quantified by FACS. The crRNA sequence employed is GAGACAAAUCACCUGCCUCGGUUUUAGAGCUAUGCU (SEQ ID NO:4) and the chemical modification patterns of the crRNAs are recited in Table 2. FIG. 1D (SEQ ID NOS:158-161) depict activities of different chemically modified crRNAs measured by electroporating 50 pmole crRNA per 510.sup.4 cells in a stable mouse Hepal -6 cell line that expresses SpyCas9-ABE8e and tracrRNA. Data measured by Sanger sequencing and EditR analysis. FIG. 1E depicts the stability of partially and fully-modified crRNAs shown in FIG. 1C. crRNAs were diluted to 1 M concentration in 10% FBS and incubated at 37 C. for the indicated numbers of hours before denaturing by formamide loading dye and fractionation by 10% urea-denaturing polyacrylamide gel electrophoresis (PAGE) followed by staining.

[0063] FIG. 2A-FIG. 2C depict protecting oligos enhancing the stability of crRNA without compromising activity. FIG. 2A (SEQ ID NOS:162-171,174) depicts representative designs and chemical modifications of C20 (top) and protecting oligos (bottom, RC01 to RC10). Chemical modification patterns of C20 and protecting oligos are color-coded: green, 2-O-Me; red 2-F; black, 2-OH; underlined, PS. FIG. 2B depicts the stability of C20-protecting oligo complex. C20 and the indicated protecting oligo were mixed at equal molar ratio and annealed by heating to 95 C. for 5 minutes and slowly cooled down to 4 C. (-0.1 C. per second). Annealed C20-protecting oligo complex was diluted to 1 M in 10% FBS and incubated for the indicated number of hours at 37 C. The RNAs were then denatured by formamide and resolved by 10% denaturing urea PAGE. FIG. 2C depicts the activity of the C20-protecting oligo complex. C20 and the indicated protecting oligo were annealed as described in FIG. 2B. 50 pmole crRNA per 510.sup.4 cells was then electroporated using the stable cell line shown in FIG. 1A. Cells were harvested at 48 hours post-electroporation and the percentage of mCherry was quantified by FACS.

[0064] FIG. 3A-FIG. 3B depicts protecting oligos enhancing the potency of crRNA. FIG. 3A depicts the activity of the C20-protecting oligo complex in the stable cell line shown in FIG. 1A at non-saturating dosages. FIG. 3B depicts the activity of C20-protecting oligo complex in the stable cell line shown in FIG. 1B at non-saturating dosages. The molar amounts of C20-protecting oligo complex per 510.sup.4 cells are given on the x axis. Cells were harvested at 48 hours post-electroporation and the percentage of mCherry or GFP positive cells was quantified by FACS.

[0065] FIG. 4A-FIG. 4D depicts the conjugation of protecting oligos enhanced cellular uptake without interfering with crRNA activity. FIG. 4A depicts the activities of C20-protecting oligo complex with conjugates were measured in the stable cell line shown in FIG. 1B by electroporating 50 pmole complex per 510.sup.4 cells. The chemical modification pattern of C20 (crRNA 20) is recited in Table 2 and the chemical modification pattern of the protecting oligo RC10 is recited in Table 1. Cells were harvested at 48 hours post-electroporation and the percentage of mCherry or GFP positive cells was quantified by FACS. FIG. 4B depicts a schematic representation of the design and modifications the editing efficiency of protecting oligonucleotides with and without lipid conjugations (Cholesterol is Chol, docosahexaenoic acid is DHA, N-acetylgalactosamine is GalNac) by GFP quantification. FIG. 4C depicts C20-protecting oligo complex uptake in mouse CNS after intrastriatal injection (n =3 mice per group).

[0066] FIG. 4D depicts cellular uptake of Cy3-labeled crRNA (right), Cy3-labeled crRNA with protecting oligo (middle), and with Cholesterol-conjugated protecting oligo (left). Oligonucleotides were diluted to 1.5 M in DMEM+3% FBS then mixed with HEK293T cells. Cells were plated on an 8-well glass bottom cell culture chamber slide (SKU230118) and incubated overnight. Cell culture media was then replaced with PBS and one drop of NucBlue (Hoechst 33342) were added to cell culture before imaging. Images were taken under Leica fluorescent microscope at 40 magnification.

[0067] FIG. 5 depicts editing efficiency by passive uptake of C20 with and without protecting oligo. GFP positive cells were quantified by FACS.

[0068] FIG. 6 depicts optimal duplex stability between protecting oligo and crRNA may be required for efficient editing. The activities of C20-protecting, oligo complexes in the stable cell line shown in FIG. 1B. C20 and the indicated protecting oligo were annealed as described in FIG. 1A. 50 pmole crRNA per 510.sup.4 cells was then electroporated using the stable cell line shown in FIG. 1A. Cells were harvested at 48 hours post-electroporation and the percentage of mCherry was quantified by FACS. The chemical modification patterns of C20 and the protecting oligos were color-coded: green, 2-O-Me; red, 2-F; black: 2-OH; underlined: PS, double underlined: locked nucleic acid (LNA).

[0069] FIG. 7A-FIG. 7B depict the in vivo genome editing in adult mouse CNS by co-delivery of AAV and self-delivering crRNA. FIG. 7A depicts the process of genome editing in adult mouse using scAAV9 by injection up to immunohistochemistry (IHC) detection. The editing efficiencies of these conjugates were tested by IHC staining using an anti-EGFP antibody and were quantified by percentage of EGFP positive cells within 1 mm2 around the site-of-injection. These results are shown in FIG. 7B. The chemical modification patterns are recited in Table 1.

[0070] FIG. 8A-FIG. 8G depict the in vivo genome editing in adult mouse liver by co-delivery of AAV-expressed effector and tracrRNA and GalNac conjugated self-delivering crRNA. The results of the expression of the injected AAV are shown in FIG. 8A for SpyCas9-ABE8e and tracrRNA expression and FIG. 8B for SpyCas9 nuclease and tracrRNA expression. FIG. 8C depicts the Fah.sup.PM/PM generating a point mutation resulting in exon 8 skipping and FAH deficiency. FIG. 8D shows the schematic representation of the AAV delivery to the Fah.sup.PM/PM mouse. First, AAV were RO injected to express SpyCas9-ABE8e and tracrRNA. After five weeks, RO injections of C20 were performed with a previously validated spacer sequence FIG. 8E depicts base editing efficiency of the genomic DNA of the mouse liver treated by AAV-SpyCas9-ABE-tracrRNA co-delivery with indicated C20/protecting oligo compound. The editing efficiency was measured by targeted amplicon deep sequencing (n=3 mice per group). Data present meanSD, *, P<0.05; **, P<0.01; ***, P<0.001 (two-way ANOVA). The body weight over time of the mice treated with AAV-expressed SpyCas9-ABE8e and tracrRNA, and C20 with protecting oligonucleotides was measured and the results are shown in FIG. 8F. The mice were then sacrificed after three months of NTBC cycles, and IHC staining was performed on liver sections using anti-FAH antibodies, the staining results are shown in FIG. 8G.

[0071] FIG. 9A-FIG. 9B depict the effect of optimization of the dosing regimen on the in vivo editing efficiency. FIG. 9A shows the schematic representation of the experimental process to test repeat crRNA dosing regimen. RO, retro-orbital injection. FIG. 9B depicts the editing efficiency of AAV-SpyCas9-ABE-tracrRNA co-delivered with either a single 80 mg/kg dose, as compared to the editing efficiency of three consecutive daily injections 26 mg/kg dose of C20+RC07-GalNac targeting the mouse Pcsk9 gene. The editing efficiency was measured by targeted amplicon deep sequencing of the mouse liver genomic DNA (n=3 mice per group). The single dose data was the same as what shown in FIG. 8A. Data present meanSD, ****, P<(two-way ANOVA).

[0072] FIG. 10A-FIG. 10B depict the effect of C20 targeting different sequences with and without protecting oligonucleotides. FIG. 10A shows the dose-response curves of C20 targeting different sequences with and without protecting oligonucleotides in the HEK293T-SpyCas9-ABE-tracrRNA-dGFP reporter. The editing efficiency was quantified by FACS. Data represent meanSD; ns, P>0.05, ****, P<0.0001 (two-way ANOVA, C20 was used as control in multiple comparisons). FIG. 10B Editing efficiency of the fully modified crRNA C40, with and without a 14-mer protecting oligo at different dosages in the SpyCas9-ABE-tracrRNA-dGFP reporter. The left panel shows the chemical modification pattern of the crRNA and the protecting oligo. Data represent meanSD; ns, P>0.05 (two-way ANOVA).

DETAILED DESCRIPTION

[0073] Provided herewith are protecting oligonucleotides, including heavily or fully chemically protecting oligonucleotides. In certain embodiments, protecting oligonucleotides and crRNAs with 5 and/or 3 conjugated moieties are provided. Methods of using the protecting oligonucleotides and crRNAs of the disclosure for genome editing with a CRISPR nuclease and kits for performing the same are also provided.

[0074] Unless otherwise defined herein, nomenclature used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. The methods and techniques provided herein are usually performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. Enzymatic reactions and purification techniques are performed according to manufacturer's specifications unless otherwise specified, as commonly accomplished in the art or as described herein. The nomenclature used in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art, unless otherwise specified. Standard techniques are used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients.

[0075] Unless otherwise defined herein, scientific and technical terms used herein have the meanings that are commonly understood by those of ordinary skill in the art. In the event of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. The use of or means and/or unless stated otherwise. The use of the term including, as well as other forms, such as includes and included, is not limiting.

[0076] So that the disclosure may be more readily understood, certain terms are first defined.

[0077] As used herein, the term protecting oligonucleotide refers to an oligonucleotide that comprises complementarity to a crRNA and confers increased nuclease resistance to the crRNA when bound relative to a crRNA that is not bound by a protecting oligonucleotide.

[0078] As used herein, the term guide RNA or gRNA refer to any nucleic acid that promotes the specific association (or targeting) of an RNA-guided nuclease such as a Cas9 to a target sequence (e.g., a genomic or episomal sequence) in a cell.

[0079] As used herein, a modular or dual RNA guide comprises more than one, and typically two, separate RNA molecules, such as a CRISPR RNA (crRNA) and a trans-activating crRNA (tracrRNA), which are usually associated with one another, for example by duplexing. gRNAs and their component parts are described throughout the literature (see, e.g., Briner et al. Mol. Cell, 56(2), 333-339 (2014), which is incorporated by reference).

[0080] As used herein, a unimolecular gRNA, chimeric gRNA, or single guide RNA (sgRNA) comprises a single RNA molecule. The sgRNA may be a crRNA and tracrRNA linked together. For example, the 3 end of the crRNA may be linked to the 5 end of the tracrRNA. A crRNA and a tracrRNA may be joined into a single unimolecular or chimeric gRNA, for example, by means of a four nucleotide (e.g., GAAA) tetraloop or linker sequence bridging complementary regions of the crRNA (at its 3 end) and the tracrRNA (at its 5 end).

[0081] As used herein, a repeat sequence or region is a nucleotide sequence at or near the 3 end of the crRNA which is complementary to an anti-repeat sequence of a tracrRNA.

[0082] As used herein, an anti-repeat sequence or region is a nucleotide sequence at or near the 5 end of the tracrRNA which is complementary to the repeat sequence of a crRNA.

[0083] Additional details regarding guide RNA structure and function, including the gRNA/Cas9 complex for genome editing may be found in, at least, Mali et al. Science, 339(6121), 823-826 (2013); Jiang et al. Nat. Biotechnol. 31(3). 233-239 (2013); and Jinek et al. Science, 337(6096), 816-821 (2012); which are incorporated by reference herein.

[0084] As used herein, a guide sequence or targeting sequence refers to the nucleotide sequence of a gRNA, whether unimolecular or modular, that is fully or partially complementary to a target domain or target polynucleotide within a DNA sequence in the genome of a cell where editing is desired. Guide sequences are typically 10-30 nucleotides in length, preferably 16-24 nucleotides in length (for example, 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides in length), and are at or near the 5 terminus of a Cas9 gRNA.

[0085] As used herein, a target domain or target polynucleotide sequence is the DNA sequence in a genome of a cell that is complementary to the guide sequence of the gRNA.

[0086] In addition to the targeting domains, gRNAs typically include a plurality of domains that influence the formation or activity of gRNA/Cas9 complexes. For example, as mentioned above, the duplexed structure formed by first and secondary complementarity domains of a gRNA (also referred to as a repeat: anti-repeat duplex) interacts with the recognition (REC) lobe of Cas9 and may mediate the formation of Cas9/gRNA complexes (Nishimasu et al. Cell 156: 935-949 (2014); Nishimasu et al. Cell 162(2), 1113-1126 (2015), both incorporated by reference herein). It should be noted that the first and/or second complementarity domains can contain one or more poly-A tracts, which can be recognized by RNA polymerases as a termination signal. The sequence of the first and second complementarity domains are, therefore, optionally modified to eliminate these tracts and promote the complete in vitro transcription of gRNAs, for example through the use of A-G swaps as described in Briner 2014, or A-U swaps. These and other similar modifications to the first and second complementarity domains are within the scope of the present disclosure.

[0087] Along with the first and second complementarity domains, Cas9 gRNAs typically include two or more additional duplexed regions that are necessary for nuclease activity in vivo but not necessarily in vitro (Nishimasu 2015, supra). A first stem-loop near the 3 portion of the second complementarity domain is referred to variously as the proximal domain, stem loop 1 (Nishimasu 2014, supra; Nishimasu 2015, supra) and the nexus (Briner 2014, supra). One or more additional stem loop structures are generally present near the 3 end of the gRNA, with the number varying by species: S. pyogenes gRNAs typically include two 3 stem loops (for a total of four stem loop structures including the repeat: anti-repeat duplex), while S. aureus and other species have only one (for a total of three). A description of conserved stem loop structures (and gRNA structures more generally) organized by species is provided in Briner 2014, which is incorporated herein by reference. Additional details regarding guide RNAs generally may be found in WO2018026976A1, which is incorporated herein by reference.

Protecting Oligonucleotides

[0088] The inventors have surprisingly discovered that the use of protecting oligonucleotides confers increased nuclease resistance to crRNAs. The protecting oligonucleotides described herein comprise complementarity to a crRNA. The protecting oligonucleotides confer nuclease resistance to the crRNAs when bound. In preferred embodiments, the protecting oligonucleotides described herein bind to a region of the crRNA the contains at least one unmodified ribose group. In certain embodiments, the protecting oligonucleotide binds to a region of the crRNA the contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 unmodified ribose groups.

[0089] In certain embodiments, the protecting oligonucleotide is about 5 to about 20 nucleotides in length (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length). In certain embodiments, the protecting oligonucleotide is 11, 12, 13, 14, 15, or 16 nucleotides in length. The length of the protecting oligonucleotide is shorter than the crRNA to which the protecting oligonucleotide comprises complementarity to (i.e., the protecting oligonucleotide comprises complementarity to a region of the crRNA, wherein said region is not the full length of the crRNA).

[0090] In certain embodiments, the protecting oligonucleotide binds to the crRNA to form a duplex, optionally wherein the protecting oligonucleotide binds to a region of the crRNA that is not fully chemically modified.

[0091] In certain embodiments, the duplex has a melting temperature (Tm) of greater than 37 C. over the full length of the duplex.

[0092] In certain embodiments, the duplex has a melting temperature (Tm) of less than 37 C. over the region of complementarity comprising the guide sequence portion.

[0093] In certain embodiments, the binding of a tracrRNA to the guide sequence portion of the crRNA dissociates the protecting oligonucleotide from the crRNA.

[0094] Exemplary protecting oligonucleotide sequences are recited below, wherein N corresponds to any nucleotide:

TABLE-US-00003 AAACNNNNN AAAACNNNNN AAACNNNNNN AAAACNNNNNN UAAAACNNNNNN AAAACNNNNNNN UAAAACNNNNNNN CUAAAACNNNNNNN UAAAACNNNNNNNN CUAAAACNNNNNNNN

Chemically Modified Guide RNA and Protecting Oligonucleotides

[0095] The protecting oligonucleotides and guide RNAs (i.e., crRNAs and tracrRNAs) of the disclosure possess improved in vivo stability, improved genome editing efficacy, and/or reduced immunotoxicity relative to unmodified or minimally modified protecting oligonucleotides and guide RNAs.

[0096] The protecting oligonucleotides and guide RNAs of the disclosure contain one or more modified nucleotides comprising a modification in a ribose group, a phosphate group, a nucleobase, or a combination thereof.

[0097] Chemical modifications to the ribose group may include, but are not limited to, 2-O-methyl, 2-fluoro, 2-deoxy, 2-O-(2-methoxy ethyl) (MOE), 2-NH.sub.2(2-amino), 4-thio, 2-O-Allyl, 2-O-Ethylamine, 2-O-Cyanoethyl, 2-O-Acetalester, or a bicyclic nucleotide, such as locked nucleic acid (LNA), 2-(S)-constrained ethyl (S-cEt), constrained MOE, or 2-O,4-C-aminomethylene bridged nucleic acid (2,4-BNA.sup.NC).

[0098] The term 4-thio as used herein corresponds to a ribose group modification where the sugar ring oxygen of the ribose is replaced with a sulfur.

[0099] Chemical modifications to the phosphate group may include, but are not limited to, a phosphorothioate, phosphonoacetate (PACE), thiophosphonoacetate (thioPACE), amide, triazole, phosphonate, or phosphotriester modification.

[0100] In an embodiment, the crRNA portion of the chemically modified guide RNA comprises between 1 and 20 phosphorothioate modifications (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 phosphorothioate modifications). In an embodiment, the crRNA portion of the chemically modified guide RNA comprises between 1 and 20 phosphorothioate modifications (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 phosphorothioate modifications) and comprises at least about 50% activity relative to a guide RNA that does not comprise phosphorothioate modifications (e.g., 50% activity, 60% activity, 70% activity, 80% activity, 90% activity, 95% activity, or 100% activity, relative to a guide RNA that does not comprise phosphorothioate modifications).

[0101] Chemical modifications to the nucleobase may include, but are not limited to, 2-thiouridine, 4-thiouridine, N.sup.6-methyladenosine, pseudouridine, 2,6-diaminopurine, inosine, thymidine, 5-methylcytosine, 5-substituted pyrimidine, isoguanine, isocytosine, or halogenated aromatic groups.

[0102] The chemically modified guide RNAs may have one or more chemical modifications in the crRNA portion and/or the tracrRNA portion for a modular or dual RNA guide. The chemically modified guide RNAs may also have one or more chemical modifications in the single guide RNA for the unimolecular guide RNA.

[0103] The protecting oligonucleotides and guide RNAs may comprise at least about 50% to at least about 100% chemically modified nucleotides, at least about 60% to at least about 100% chemically modified nucleotides, at least about 70% to at least about 100% chemically modified nucleotides, at least about 80% to at least about 100% chemically modified nucleotides, at least about 90% to at least about 100% chemically modified nucleotides, and at least about 95% to at least about 100% chemically modified nucleotides.

[0104] The protecting oligonucleotides and guide RNAs may comprise at least about 50% chemically modified nucleotides, at least about 60% chemically modified nucleotides, at least about 70% chemically modified nucleotides, at least about 80% chemically modified nucleotides, at least about 90% chemically modified nucleotides, at least about 95% chemically modified nucleotides, at least about 99% chemically modified, or 100% (fully) chemically modified nucleotides.

[0105] The protecting oligonucleotides and guide RNAs may comprise at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% chemically modified nucleotides.

[0106] Protecting oligonucleotides and guide RNAs that comprise at least about 80% chemically modified nucleotides to at least about 99% chemically modified nucleotides are considered heavily modified, as used herein.

[0107] Protecting oligonucleotides and guide RNAs that comprise 100% chemically modified nucleotides are considered fully modified, as used herein.

[0108] In certain exemplary embodiments, the protecting oligonucleotides and guide RNAs may comprise a chemically modified ribose group at about 50% of the nucleotides to about 100% of the nucleotides, at about 60% of the nucleotides to about 100% of the nucleotides, at about 70% of the nucleotides to about 100% of the nucleotides, at about 80% of the nucleotides to about 100% of the nucleotides, at about 90% of the nucleotides to about 100% of the nucleotides, and at about 95% of the nucleotides to about 100% of the nucleotides

[0109] In certain exemplary embodiments, the protecting oligonucleotides and guide RNAs may comprise a chemically modified ribose group at about 50% of the nucleotides, at about 60% of the nucleotides, at about 70% of the nucleotides, at about 80% of the nucleotides, at about 90% of the nucleotides, at about 95% of the nucleotides, at about 99% of the nucleotides, or at 100% of the nucleotides.

[0110] In certain exemplary embodiments, the protecting oligonucleotides and guide RNAs may comprise a chemically modified ribose group at about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleotides.

[0111] Protecting oligonucleotides and guide RNAs that have at least about 80% of the ribose groups chemically modified to at least about 99% of the ribose groups chemically modified are considered heavily modified, as used herein.

[0112] Protecting oligonucleotides and guide RNAs that have 100% of the ribose groups chemically modified are considered fully modified, as used herein.

[0113] In certain exemplary embodiments, the protecting oligonucleotides and guide RNAs may comprise a chemically modified phosphate group at about 50% of the nucleotides to about 100% of the nucleotides, at about 60% of the nucleotides to about 100% of the nucleotides, at about 70% of the nucleotides to about 100% of the nucleotides, at about 80% of the nucleotides to about 100% of the nucleotides, at about 90% of the nucleotides to about 100% of the nucleotides, and at about 95% of the nucleotides to about 100% of the nucleotides

[0114] In certain exemplary embodiments, the protecting oligonucleotides and guide RNAs may comprise a chemically modified phosphate group at about 50% of the nucleotides, at about 60% of the nucleotides, at about 70% of the nucleotides, at about 80% of the nucleotides, at about 90% of the nucleotides, at about 95% of the nucleotides, at about 99% of the nucleotides, or at 100% of the nucleotides.

[0115] In certain exemplary embodiments, the protecting oligonucleotides and guide RNAs may comprise a chemically modified phosphate group at about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of nucleotides.

[0116] Protecting oligonucleotides and guide RNAs that have at least about 80% of the phosphate groups chemically modified to at least about 99% of the phosphate groups chemically modified are considered heavily modified, as used herein.

[0117] Protecting oligonucleotides and guide RNAs that have 100% of the phosphate groups chemically modified are considered fully modified, as used herein.

[0118] In certain exemplary embodiments, the protecting oligonucleotides and guide RNAs may comprise a chemically modified nucleobase at about 50% of the nucleotides to about 100% of the nucleotides, at about 60% of the nucleotides to about 100% of the nucleotides, at about 70% of the nucleotides to about 100% of the nucleotides, at about 80% of the nucleotides to about 100% of the nucleotides, at about 90% of the nucleotides to about 100% of the nucleotides, and at about 95% of the nucleotides to about 100% of the nucleotides.

[0119] In certain exemplary embodiments, the protecting oligonucleotides and guide RNAs may comprise a chemically modified nucleobase at about 50% of the nucleotides, at about 60% of the nucleotides, at about 70% of the nucleotides, at about 80% of the nucleotides, at about 90% of the nucleotides, at about 95% of the nucleotides, at about 99% of the nucleotides, or at 100% of the nucleotides.

[0120] In certain exemplary embodiments, the protecting oligonucleotides and guide RNAs may comprise a chemically modified nucleobase at about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleotides.

[0121] Protecting oligonucleotides and guide RNAs that have at least about 80% of the nucleobases chemically modified to at least about 99% of the nucleobases chemically modified are considered heavily modified, as used herein.

[0122] Protecting oligonucleotides and guide RNAs that have 100% of the nucleobases chemically modified are considered fully modified, as used herein.

[0123] In certain exemplary embodiments, the protecting oligonucleotides and guide RNAs may comprise any combination of chemically modified ribose groups, chemically modified phosphate groups, and chemically modified nucleobases at about 50% of the nucleotides to about 100% of the nucleotides, at about 60% of the nucleotides to about 100% of the nucleotides, at about 70% of the nucleotides to about 100% of the nucleotides, at about 80% of the nucleotides to about 100% of the nucleotides, at about 90% of the nucleotides to about 100% of the nucleotides, and at about 95% of the nucleotides to about 100% of the nucleotides.

[0124] In certain exemplary embodiments, the protecting oligonucleotides and guide RNAs may comprise any combination of chemically modified ribose groups, chemically modified phosphate groups, and chemically modified nucleobases at about 50% of the nucleotides, at about 60% of the nucleotides, at about 70% of the nucleotides, at about 80% of the nucleotides, at about 90% of the nucleotides, at about 95% of the nucleotides, at about 99% of the nucleotides, or at 100% of the nucleotides.

[0125] In certain exemplary embodiments, the protecting oligonucleotides and guide RNAs may comprise any combination of chemically modified ribose groups, chemically modified phosphate groups, and chemically modified nucleobases at about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleotides.

[0126] Protecting oligonucleotides and guide RNAs that have at least about 80% of any combination of the ribose groups, the phosphate groups, and the nucleobases chemically modified to at least about 99% of the nucleobases chemically modified are considered heavily modified, as used herein.

[0127] Protecting oligonucleotides and guide RNAs that have 100% of any combination of the ribose groups, the phosphate groups, and the nucleobases chemically modified are considered fully modified, as used herein.

[0128] The heavily and fully chemically modified protecting oligonucleotides and guide RNAs of the disclosure possess several advantages over the minimally modified protecting oligonucleotides and guide RNAs in the art. Heavily and fully chemically modified protecting oligonucleotides and guide RNAs are expected to ease chemical synthesis, further enhance in vivo stability, and provide a scaffold for terminally appended chemical functionalities that facilitate delivery and efficacy during clinical applications to genome editing.

[0129] The chemical modification pattern used in the guide RNA is such that activity of the guide RNA is maintained when paired with an RNA-guided DNA endonuclease, e.g., Cas9.

[0130] In an embodiment, the chemically modified guide RNAs of the disclosure comprise at least about 50% activity relative to an unmodified guide RNA (e.g., 50% activity, 60% activity, 70% activity, 80% activity, 90% activity, 95% activity, or 100% activity, relative to an unmodified guide RNA).

[0131] The activity of a guide RNA can be readily determined by any means known in the art. In an embodiment, % activity is measured with the traffic light reporter (TLR) Multi-Cas Variant 1 system (TLR-MCV1), described below. The TLR-MCV1 system will provide a % fluorescent cells which is a measure of % activity.

[0132] Exemplary chemical modification patterns are described in Table 1 and Table 2 below.

TABLE-US-00004 TABLE1 Exemplarychemicalmodificationpatterns forprotectingoligonucleotides. Name Sequence RC01 mAmAmAmCmNmNmNmNmN RC02 mAmAmAmAmCmNmNmNmNmN RC03 mAmAmAmCmNmNmNmNmNmN RC04 mAmAmAmAmCmNmNmNmNmNmN RC05 mUmAmAmAmAmCmNmNmNmNmNmN RC06 mAmAmAmAmCmNmNmNmNmNmNmN RC07 mUmAmAmAmAmCmNmNmNmNmNmNmN RC08 mCmUmAmAmAmAmCmNmNmNmNmNmNmN RC09 mUmAmAmAmAmCmNmNmNmNmNmNmNmN RC10 mCmUmAmAmAmAmCmNmNmNmNmNmNmNmN RC07-2PS mU#mA#mAmAmAmCmNmNmNmNmN#mN#mN RC07-3PS mU#mA#mA#mAmAmCmNmNmNmN#mN#mN#mN RC07-4xLNA lUlAmAmAmAmCmNmNmNmNmNmNlNlN RC07-2xLNA lUmAmAmAmAmCmNmNmNmNmNmNmNlN RC07-d(TT)- mUmAmAmAmAmCmNmNmNmNmNmNmN DHA dTdT-DHA RC07-d(TT)- mUmAmAmAmAmCmNmNmNmNmNmNmNdTdT- TegChol TegChol KEY: rN =RNA, dN =DNA, mN =2-O-methyl RNA, N =A, U, G, or C N#N =phosphorothioate linkage, l =an LNA modification

TABLE-US-00005 TABLE2 ExemplarychemicalmodificationpatternsforcrRNAs Name Sequence crRNA1 mN#mN#mN#mNmNmNmNmNmNmNrNrNrNrNrNmNmN mNrNmNmGrUrUrUmUmAmGmAmGmCmUmAmU#mG# mCmU(SEQIDNO:5) crRNA2 rNrNrNrNrNrNmNmNmNmNrNrNrNrNrNrNrNrNrNmNm GrUrUrUrUrAmGmAmGmCmUmAmU#mG#mCmU (SEQIDNO:6) crRNA3 rN#rN#rN#rNrNrNmNmNmNmNrNrNrNrNrNrNrNrNr NmNmGrUrUrUrUrAmGmAmGmCmUmAmU#mG#mCmU (SEQIDNO:7) crRNA4 mN#mN#mN#mNmNmNmNmNmNmNrNrNrNrNrNrNrNr NrNmNmGrUrUrUrUrAmGmAmGmCmUmAmU#mG#mC #mU(SEQIDNO:8) crRNA5 rN#rN#rN#rNrNrNmNmNmNmNrNrNrNrNrNrNmNm NrNmNmGrUrUrUrUrAmGmAmGmCmUmAmU#mG#mC#mU (SEQIDNO:9) crRNA6 rN#rN#rN#rNrNrNmNmNmNmNrNrNrNrNrNrNrNr NrNmNmGrUrUrUmUmAmGmAmGmCmUmAmU#mG#mC#mU (SEQIDNO:10) crRNA7 mN#mN#mN#mNmNmNmNmNmNmNrNrNrNrNrNrNmN mNrNmNmGrUrUrUrUrAmGmAmGmCmUmAmU#mG#m C#mU(SEQIDNO:11) crRNA8 mN#mN#mN#mNmNmNmNmNmNmNrNrNrNrNrNrNrNr NrNmNmGrUrUrUmUmAmGmAmGmCmUmAmU#mG#m C#mU(SEQIDNO:12) crRNA9 mN#mN#mN#mNmNmNmNmNmNmNrNrNrNrNrN#rN#r NrNrN#mNmGrU#rU#rU#mUmAmGmAmGmCmUmAmU #mG#mC#mU(SEQIDNO:13) crRNA10 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGrU#rU#rU#mUmAmGmAmGmCmUmAmU #mG#mC#mU(SEQIDNO:14) crRNA11 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#r N#rN#rN#mNmGrU#rU#rU#mUmAmGmAmGmCmUmAm U#mG#mC#mU(SEQIDNO:15) crRNA17 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGrU#rU#rU#mUrA#mGmAmGmCmUmAmU #mG#mC#mU(SEQIDNO:16) crRNA18 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGrU#rU#rU#rU#mAmGmAmGmCmUmAmU #mG#mC#mU(SEQIDNO:17) crRNA19 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGrU#rU#rU#rU#rA#mGmAmGmCmUmAmU #mG#mC#mU(SEQIDNO:18) crRNA20 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGrU#rU#rU#fUfAmGmAmGmCmUmAmU# mG#mC#mU(SEQIDNO:3) crRNA21 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNfNfNfNf NfNmNmGfUfUfUfUfAmGmAmGmCmUmAmU#mG#mC #mU(SEQIDNO:19) crRNA22 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGfUrU#fUfUfAmGmAmGmCmUmAmU#mG #mC#mU(SEQIDNO:20) crRNA23 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNmNrN#f NfNrN#mNmGrU#rU#rU#fUfAmGmAmGmCmUmAmU# mG#mC#mU(SEQIDNO:21) crRNA24 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#fNfNf NrN#mNmGrU#rU#rU#fUfAmGmAmGmCmUmAmU#mG #mC#mU(SEQIDNO:22) crRNA25 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNfNmNmGrU#rU#rU#fUfAmGmAmGmCmUmAmU#m G#mC#mU(SEQIDNO:23) crRNA26 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGfUrU#rU#fUfAmGmAmGmCmUmAmU#m G#mC#mU(SEQIDNO:24) crRNA27 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#NAmGrU#fUrU#fUfAmGmAmGmCmUmAmU#m G#mC#mU(SEQIDNO:25) crRNA28 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGrU#rU#rUfUfAmGmAmGmCmUmAmU#m G#mC#Mu(SEQIDNO:26) crRNA29 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#fNfNf NfNmNmGfUfUfUfUfAmGmAmGmCmUmAmU#mG#mC #mU(SEQIDNO:27) crRNA30 mN#mN#mN#rNrNrNmNmNmNmNrNrNrNrNrNrNrNrNrN mNmGrUrUrUrUrAmGmAmGmCmUmAmU#mG#mC#mU (SEQIDNO:28) crRNA31 mN#mN#mN#rNrNrNmNmNmNmNmNrNrNrNrNrNrNrNr NmNmGrUrUrUrUrAmGmAmGmCmUmAmU#mG#mC#m U(SEQIDNO:29) crRNA32 mN#mN#mN#rNrNrNmNmNmNmNmNrNmNmNrNrNrNr NrNmNmGrUrUrUrUrAmGmAmGmCmUmAmU#mG#mC #mU(SEQIDNO:30) crRNA33 mN#mN#mN#rN#rN#rN#mNmNmNmNrN#rN#rN#rN# rN#rN#rN#rN#rN#mNmGrU#rU#rU#rU#rA#mGm AmGmCmUmAmU#mG#mC#mU(SEQIDNO:31) crRNA34 mN#mN#mN#rN#rN#rN#mNmNmNmNrN#rN#rN#rN#rN# rN#rN#rN#rN#mNmGrUrUrUrUrAmGmAmGmCmUmAmU #mG#mC#mU(SEQIDNO:32) crRNA35 mN#mN#mN#rNrNrNmNmNmNmNrNrNrNrNrNrNrNrNrN mNmGrUrUrUmUmAmGmAmGmCmUmAmU#mG#mC# mU(SEQIDNO:33) crRNA36 mN#mN#mN#rN#rN#rN#mNmNmNmNrN#rN#rN#rN# rN#rN#rN#rN#rN#mNmGrUrUrUmUmAmGmAmGmCmUm AmU#mG#mC#mU(SEQIDNO:34) crRNA37 mN#mN#mN#rN#rN#rN#mNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGrU#rU#rU#mUmAmGmAmGmCmUmAmU #mG#mC#mU(SEQIDNO:35) crRNA38 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfNfNrN#rN# fNfNrN#mNmGrU#rU#rU#mUmAmGmAmGmCmUmAmU #mG#mC#mU(SEQIDNO:36) crRNA39 mN#mN#mN#rN#rN#rN#mNmNmNmNfNfNfNfNfNfNfNf NfNmNmGfUfUfUfUfAmGmAmGmCmUmAmU#mG#mC #mU(SEQIDNO:37) crRNA40 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfNfNfNfNfN fNfNmNmGfUfUfUfUfAmGmAmGmCmUmAmU#mG#mC #mU(SEQIDNO:38) crRNA41 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNdN#dN#f NfNdN#mNmGrU#rU#rU#fUfAmGmAmGmCmUmAmU# mG#mC#mU(SEQIDNO:39) crRNA42 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGdU#dU#dU#fUfAmGmAmGmCmUmAmU# mG#mC#mU(SEQIDNO:40) crRNA43 mN#mN#mN#mNmNmNmNmNmNmNfNrN#fNfNrN#rN#f NfNrN#mNmGrU#rU#rU#fUfAmGmAmGmCmUmAmU# mG#mC#mU(SEQIDNO:41) crRNA44 mN#mN#mN#mNmNmNmNmNmNmNfNdN#fNfNrN#rN# fNfNrN#mNmGrU#rU#rU#fUfAmGmAmGmCmUmAmU# mG#mC#mU(SEQIDNO:42) crRNA45 mN#mN#mN#fNfNfNmNmNmNmNfNfNfNfNfNfNfNfN fNmNmGfUfUfUfUfAmGmAmGmCmUmAmU#mG#mC#mU (SEQIDNO:43) crRNA46 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNmNrN#f NfNrN#mNmGrU#rUrU#fUfAmGmAmGmCmUmAmU#m G#mC#mU(SEQIDNO:44) crRNA47 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#mNf NfNrN#mNmGrU#rUrU#fUfAmGmAmGmCmUmAmU#m G#mC#mU(SEQIDNO:45) crRNA48 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#mNf NfNmNmNmGrU#rUrU#fUfAmGmAmGmCmUmAmU#m G#mC#mU(SEQIDNO:46) crRNA49 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGmUrU#rU#fUfAmGmAmGmCmUmAmU#m G#mC#mU(SEQIDNO:47) crRNA50 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGrU#mUrU#fUfAmGmAmGmCmUmAmU#m G#mC#mU(SEQIDNO:48) crRNA51 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGrU#rU#mUfUfAmGmAmGmCmUmAmU#m G#mC#mU(SEQIDNO:49) crRNA52 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfNfNfN#fN# fNfNfN#mNmGfU#fU#fU#fU#fA#mGmAmGmCmUmAm U#mG#mC#mU(SEQIDNO:50) crRNA53 mN#mN#mN#dN#dN#dN#mN#mNmNmNfNfNfNfNfNfNf NfNfNmNmGfUfUfUfUfAmGmAmGmCmUmAmU#mG# mC#mU(SEQIDNO:51) crRNA54 mN#mN#mN#dN#dN#dN#mNmN#mNmNfNfNfNfNfNfNf NfNfNmNmGfUfUfUfUfAmGmAmGmCmUmAmU#mG# mC#mU(SEQIDNO:52) crRNA55 mN#mN#mN#dN#dN#dN#mNmNmN#mNfNfNfNfNfNfNf NfNfNmNmGfUfUfUfUfAmGmAmGmCmUmAmU#mG# mC#mU(SEQIDNO:53) crRNA56 mN#mN#mN#dN#dN#dN#mNmNmNmN#fNfNfNfNfNfNf NfNfNmNmGfUfUfUfUfAmGmAmGmCmUmAmU#mG# mC#mU(SEQIDNO:54) crRNA57 mN#mN#mN#dN#dN#dN#mNmNmNmNfN#fNfNfNfNfNf NfNfNmNmGfUfUfUfUfAmGmAmGmCmUmAmU#mG# mC#mU(SEQIDNO:55) crRNA58 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfN#fNfNfNfNf NfNfNmNmGfUfUfUfUfAmGmAmGmCmUmAmU#mG# mC#mU(SEQIDNO:56) crRNA59 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfN#fNfNfNf NfNfNmNmGfUfUfUfUfAmGmAmGmCmUmAmU#mG# mC#mU(SEQIDNO:57) crRNA60 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfNfN#fNfNf NfNfNmNmGfUfUfUfUfAmGmAmGmCmUmAmU#mG# mC#mU(SEQIDNO:58) crRNA61 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfNfNfNfNfN #fNfNmNmGfUfUfUfUfAmGmAmGmCmUmAmU#mG#m C#mU(SEQIDNO:59) crRNA62 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfNfNfNfNfN fN#fNmNmGfUfUfUfUfAmGmAmGmCmUmAmU#mG#m C#mU(SEQIDNO:60) crRNA63 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfNfNfNfNfN fNfNmN#mGfUfUfUfUfAmGmAmGmCmUmAmU#mG#m C#mU(SEQIDNO:61) crRNA64 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfNfNfNfNfN fNfNmNmG#fUfUfUfUfAmGmAmGmCmUmAmU#mG#m C#mU(SEQIDNO:62) crRNA65 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfNfNfNfNfN fNfNmNmGfUfUfUfUfAmG#mAmGmCmUmAmU#mG#m C#mU(SEQIDNO:63) crRNA66 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfNfNfNfNfN fNfNmNmGfUfUfUfUfAmGmA#mGmCmUmAmU#mG#m C#mU(SEQIDNO:64) crRNA67 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfNfNfNfNfN fNfNmNmGfUfUfUfUfAmGmAmG#mCmUmAmU#mG#m C#mU(SEQIDNO:65) crRNA68 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfNfNfNfNfN fNfNmNmGfUfUfUfUfAmGmAmGmC#mUmAmU#mG#m C#mU(SEQIDNO:66) crRNA69 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfNfNfNfNfN fNfNmNmGfUfUfUfUfAmGmAmGmCmU#mAmU#mG#m C#mU(SEQIDNO:67) crRNA70 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfNfNfNfNfN fNfNmNmGfUfUfUfUfAmGmAmGmCmUmA#mU#mG#m C#mU(SEQIDNO:68) crRNA71 mN#mN#mN#dN#dN#dN#mN#mN#mN#mNfNfNfNfNfN#f N#fNfNfN#mNmGfU#fU#fU#fU#fA#mGmAmGmCmUmA mU#mG#mC#mU(SEQIDNO:69) crRNA72 mN#mN#mN#dN#dN#dN#mNmNmNmN#fN#fN#fNfNfN#f N#fNfNfN#mNmGfU#fU#fU#fU#fA#mGmAmGmCmUmA mU#mG#mC#mU(SEQIDNO:70) crRNA73 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfN#fN#fN#f N#fNfNfN#mNmGfU#fU#fU#fU#fA#mGmAmGmCmUmA mU#mG#mC#mU(SEQIDNO:71) crRNA74 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfNfNfN#fN# fN#fN#fN#mNmGfU#fU#fU#fU#fA#mGmAmGmCmUmA mU#mG#mC#mU(SEQIDNO:72) crRNA75 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfNfNfN#fN# fNfNfN#mN#mGfU#fU#fU#fU#fA#mGmAmGmCmUmAm U#mG#mC#mU(SEQIDNO:73) crRNA76 mN#mN#mN#dN#dN#dN#mN#mN#mN#mNfNfNfNfNfNf NfNfNfNmNmGfUfUfUfUfAmGmAmGmCmUmAmU#mG #mC#mU(SEQIDNO:74) crRNA77 mN#mN#mN#dN#dN#dN#mN#mN#mN#mN#fN#fN#fNfNf NfNfNfNfNmNmGfUfUfUfUfAmGmAmGmCmUmAmU# mG#mC#mU(SEQIDNO:75) crRNA78 mN#mN#mN#dN#dN#dN#mN#mN#mN#mN#fN#fN#fN#f N#fN#fN#fNfNfNmNmGfUfUfUfUfAmGmAmGmCmUmA mU#mG#mC#mU(SEQIDNO:76) crRNA79 mN#mN#mN#dN#dN#dN#mN#mN#mN#mN#fN#fN#fN#f N#fN#fN#fN#fN#fN#mNmGfUfUfUfUfAmGmAmGmCmU mAmU#mG#mC#mU(SEQIDNO:77) crRNA80 mN#mN#mN#dN#dN#dN#mN#mN#mN#mN#fN#fN#fN#f N#fN#fN#fN#fN#fN#mN#mG#fU#fU#fU#fU#fA#mGm GAmmCmUmAmU#mG#mC#mU(SEQIDNO:78) crRNA81 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfNfNfN#fN# fNfNfN#mNmGfU#fU#fU#fU#fA#mGmAmGmC#mU#mA #mU#mG#mC#mU(SEQIDNO:79) crRNA82 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfNfNfN#fN# fNfNfN#mNmGfU#fU#fU#fU#fA#mG#mA#mG#mCmUm AmU#mG#mC#mU(SEQIDNO:80) crRNA83 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfNfNfN#fN# fNfNfN#mNmG#fU#fU#fU#fU#fA#mGmAmGmCmUmAm U#mG#mC#mU(SEQIDNO:81) crRNA84 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfNfNfNfNfN fNfNmNmGfUfUfUfUfAmGmAmGmC#mU#mA#mU#mG #mC#mU(SEQIDNO:82) crRNA85 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfNfNfNfNfN fNfNmNmGfUfUfUfUfA#mG#mA#mG#mC#mU#mA#mU #mG#mC#mU(SEQIDNO:83) crRNA86 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfNfNfNfNfN fNfNmNmGfU#fU#fU#fU#fA#mG#mA#mG#mC#mU#mA #mU#mG#mC#mU(SEQIDNO:84) crRNA87 mN#mN#mN#dN#dN#dN#mN#mN#mNmNfNfNfNfNfNfN fNfNfNmNmGfUfUfUfUfAmGmAmGmCmU#mA#mU#m G#mC#mU(SEQIDNO:85) crRNA88 mN#mN#mN#dN#dN#dN#mN#mN#mN#mN#fNfNfNfNfNf NfNfNfNmNmGfUfUfUfUfAmGmAmG#mC#mU#mA#mU #mG#mC#mU(SEQIDNO:86) crRNA89 mN#mN#mN#dN#dN#dN#mN#mN#mN#mN#fN#fN#fNfNf NfNfNfNfNmNmGfUfUfUfUfAmG#mA#mG#mC#mU#mA #mU#mG#mC#mU(SEQIDNO:87) crRNA90 mN#mN#mN#dN#dN#dN#mN#mN#mN#mN#fN#fN#fN#f N#fNfNfNfNfNmNmGfUfUfUfU#fA#mG#mA#mG#mC#m U#mA#mU#mG#mC#mU(SEQIDNO:88) crRNA91 mN#mN#mN#dN#dN#dN#mN#mN#mN#mN#fN#fN#fN#f N#fN#fN#fNfNfNmNmGfUfU#fU#fU#fA#mG#mA#mG# mC#mU#mA#mU#mG#mC#mU(SEQIDNO:89) crRNA92 mN#mN#mN#dN#dN#dN#mN#mN#mN#mN#fN#fN#fN#f N#fN#fN#fN#fN#fN#mNmGfU#fU#fU#fU#fA#mG#m A#mG#mC#mU#mA#mU#mG#mC#mU(SEQIDNO:90) crRNA93 mN#mN#mN#dN#dN#dN#mN#mN#mN#mN#fN#fN#fN#f N#fN#fN#fN#fN#fN#mN#mG#fU#fU#fU#fU#fA#mG# mA#mG#mC#mU#mA#mU#mG#mC#mU(SEQIDNO:91) crRNA94 mN#mN#mN#mN#mN#mN#mNmNmNmNfNfNfNfNrN#r N#fNfNrN#mNmGrU#rU#rU#fUfAmGmAmGmCmUmAm U#mG#mC#mU(SEQIDNO:92) crRNA95 mN#mN#mN#mN#mN#mN#mN#mNmNmNfNfNfNfNrN#r N#fNfNrN#mNmGrU#rU#rU#fUfAmGmAmGmCmUmAm U#mG#mC#mU(SEQIDNO:93) crRNA96 mN#mN#mN#mN#mN#mN#mNmNmNmNfNfNfNfNrN#r N#fNfNrN#mNmGrU#rU#rU#fUfAmGmAmGmC#mUmA mU#mG#mC#mU(SEQIDNO:94) crRNA97 mN#mN#mN#mN#mN#mN#mNmNmNmNfNfNfNfNrN#r N#fNfNrN#mNmGrU#rU#rU#fUfAmGmAmGmCmU#mA mU#mG#mC#mU(SEQIDNO:95) crRNA98 mN#mN#mN#mN#mN#mN#mNmNmNmNfNfNfNfNrN#r N#fNfNrN#mGNmGrU#rU#rU#fUfAmGmAmGmCmUmA #mU#mG#mC#mU(SEQIDNO:96) crRNA99 mN#mN#mN#mN#mN#mN#mNmNmNmNfNfNfNfNrN#r N#fNfNrN#mNmGrU#rU#rU#fU#fA#mGmAmGmCmUmA mU#mG#mC#mU(SEQIDNO:97) crRNA100 mN#mN#mN#mN#mN#mN#mNmNmNmNfNfNfNfNrN#r N#fNfNrN#mNmGrU#rU#rU#fU#fA#mGmAmGmC#mU# mA#mU#mG#mC#mU(SEQIDNO:98) crRNA101 mN#mN#mN#mN#mN#mN#mNmNmNmNfNfNfNfNrN#r N#fNfNrN#mNmGrU#rU#rU#fU#fA#mG#mA#mG#mCmU mAmU#mG#mC#mU(SEQIDNO:99) crRNA102 mN#mN#mN#mN#mN#mN#mNmNmNmNfNfNfNfNrN#r N#fNfNrN#mNmG#rU#rU#rU#fU#fA#mGmAmGmCmUm AmU#mG#mC#mU(SEQIDNO:100) crRNA103 mN#mN#mN#mN#mN#mN#mNmNmNmNfNfNfNfNrN#r N#fNfNrN#mNmGrU#rU#rU#fUfAmGmAmGmC#mU#mA #mU#mG#mC#mU(SEQIDNO:101) crRNA104 mN#mN#mN#mN#mN#mN#mNmNmNmNfNfNfNfNrN#r N#fNfNrN#mNmGrU#rU#rU#fUfA#mG#mA#mG#mC#mU #mA#mU#mG#mC#mU(SEQIDNO:102) crRNA105 mN#mN#mN#rN#rN#rN#mN#mNmNmNfNfNfNfNfNfNfN fNfNmNmGfUfUfUfUfAmGmAmGmCmUmAmU#mG#mC #mU(SEQIDNO:103) crRNA106 mN#mN#mN#rN#rN#rN#mNmNmNmNfNfNfNfNfNfNfNf NfNmNmGfUfUfUfUfAmGmAmGmCmUmA#mU#mG#m C#mU(SEQIDNO:104) crRNA107 mN#mN#mN#rN#rN#rN#mNmNmNmNfNfNfNfNfN#fN#f N#fN#fN#mNmGfU#fU#fU#fU#fA#mGmAmGmCmUmA mU#mG#mC#mU(SEQIDNO:105) crRNA108 mN#mN#mN#rN#rN#rN#mNmNmNmNfNfNfNfNfN#fN#f NfNfN#mNmGfU#fU#fU#fU#fA#mGmAmGmC#mU#mA# mU#mG#mC#mU(SEQIDNO:106) crRNA109 mN#mN#mN#rN#rN#rN#mNmNmNmNfNfNfNfNfN#fN#f NfNfN#mNmGfU#fU#fU#fU#fA#mG#mA#mG#mCmUmA mU#mG#mC#mU(SEQIDNO:107) crRNA110 mN#mN#mN#rN#rN#rN#mNmNmNmNfNfNfNfNfN#fN#f NfNfN#mNmG#fU#fU#fU#fU#fA#mGmAmGmCmUmAm U#mG#mC#mU(SEQIDNO:108) crRNA111 mN#mN#mN#rN#rN#rN#mNmNmNmNfNfNfNfNfNfNfNf NfNmNmGfUfUfUfUfAmGmAmGmC#mU#mAmU#mG#m C#mU(SEQIDNO:109) crRNA112 mN#mN#mN#rN#rN#rN#mNmNmNmNfNfNfNfNfNfNfNf NfNmNmGfUfUfUfUfA#mG#mA#mG#mC#mU#mAmU#m G#mC#mU(SEQIDNO:110) crRNA113 mN#mN#mN#dN#dN#dN#mNmNmNmNfNfNfNfNdN#dN #fNfNdN#mNmGdU#dU#dU#fUfAmGmAmGmCmUmAm U#mG#mC#mU(SEQIDNO:111) crRNA114 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNaNmNmGaUaUaUfUfAmGmAmGmCmUmAmU#mG# mC#mU(SEQIDNO:112) crRNA115 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNaNmNmGrU#rU#rU#fUfAmGmAmGmCmUmAmU#m G#mC#mU(SEQIDNO:113) crRNA116 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGaUrU#rU#fUfAmGmAmGmCmUmAmU#m G#mC#mU(SEQIDNO:114) crRNA117 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGrU#aUrU#fUfAmGmAmGmCmUmAmU#m G#mC#mU(SEQIDNO:115) crRNA118 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGrU#rU#aUfUfAmGmAmGmCmUmAmU#m G#mC#mU(SEQIDNO:116) crRNA119 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNsN#mNmGsU#sU#sU#fUfAmGmAmGmCmUmAmU# mG#mC#mU(SEQIDNO:117) crRNA120 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNsNmNmGsUsUsUfUfAmGmAmGmCmUmAmU#mG# mC#mU(SEQIDNO:118) crRNA121 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNsNmNmGrU#rU#rU#fUfAmGmAmGmCmUmAmU#m G#mC#mU(SEQIDNO:119) crRNA122 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGsUrU#rU#fUfAmGmAmGmCmUmAmU#m G#mC#mU(SEQIDNO:120) crRNA123 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGrU#sUrU#fUfAmGmAmGmCmUmAmU#m G#mC#mU(SEQIDNO:121) crRNA124 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGrU#rU#sUfUfAmGmAmGmCmUmAmU#m G#mC#mU(SEQIDNO:122) crRNA125 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGsUrU#sUfUfAmGmAmGmCmUmAmU#mG #mC#mU(SEQIDNO:123) crRNA126 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGsUsUrU#fUfAmGmAmGmCmUmAmU#mG #mC#mU(SEQIDNO:124) crRNA127 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGrU#sUsUfUfAmGmAmGmCmUmAmU#mG #mC#mU(SEQIDNO:125) crRNA128 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGaUaUaUfUfAmGmAmGmCmUmAmU#mG #mC#mU(SEQIDNO:126) crRNA129 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGsU#sU#sU#fUfAmGmAmGmCmUmAmU# mG#mC#mU(SEQIDNO:127) crRNA130 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGsUsUsUfUfAmGmAmGmCmUmAmU#mG# mC#mU(SEQIDNO:128) crRNA131 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#aNfN fNrN#mNmGrU#rU#rU#fUfAmGmAmGmCmUmAmU#m G#mC#mU(SEQIDNO:129) crRNA132 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNaNmNmGrU#rU#rU#fUfAmGmAmGmCmUmAmU#m G#mC#mU(SEQIDNO:113) crRNA133 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#aN#f NfNaN#mNmGrU#rU#rU#fUfAmGmAmGmCmUmAmU# mG#mC#mU(SEQIDNO:130) crRNA134 mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#f NfNrN#mNmGaUaUaUfUfAmGmAmGmCmUmAmU#mG #mC#mU(SEQIDNO:126) KEY: rN =RNA, mN =2-O-methyl RNA, fN =2-fluoro RNA, aN =2-NH.sub.2 (2-amino RNA), sN =4-thio RNA, dN =2-deoxy RNA N =A, U, G, or C N#N =phosphorothioate linkage

[0133] It will be understood to those of skill in the art that the base sequence of the first 20 nucleotides of the exemplary crRNAs recited in Table 2 above are directed to a specific target. This 20-nucleotide base sequence may be changed based on the target nucleic acid, however the chemical modifications remain the same. An exemplary unmodified crRNA sequence, from 5 to 3, is

TABLE-US-00006 (SEQIDNO:1) NNNNNNNNNNNNNNNNNNNNGUUUUAGAGCUAUGCU,
where N corresponds to any nucleotide (e.g., A, U, G, or C). An exemplary unmodified tracrRNA sequence, from 5 to 3, is

TABLE-US-00007 (SEQIDNO:2) AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUC AACUUGAAAAAGUGGCACCGAGUCGGUGCUUU.

[0134] It will be further understood to those of skill in the art that the guide sequence may be 10-30 nucleotides in length, preferably 16-24 nucleotides in length (for example, 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides in length), and is at or near the 5 terminus of a Cas9 gRNA.

[0135] Chemically modified guide RNAs, including chemically modified crRNAs and tracrRNAs, are described in more detail in US20210363518 and US20210388348, each of which is incorporated herein by reference.

[0136] The protecting oligonucleotides described herein may be designed to bind to any region of the crRNA modification patterns that contain at least one unmodified ribose group, thereby conferring nuclease resistance to the crRNA.

High-Affinity Repeat/Anti-Repeat Guide RNA Modifications

[0137] A crRNA and a tracrRNA hybridize together by forming a duplex between the repeat region of the crRNA and the anti-repeat region of the tracrRNA. In certain embodiments, modular, or dual RNA, guide RNAs are provided with modifications in the repeat region and the anti-repeat region to enhance the affinity between the two regions and form a stronger duplex.

[0138] The high-affinity interaction may be enhanced by increasing the GC nucleotide content in the duplex formed by the repeat regions and the anti-repeat region. Nucleotide modifications, such as 2-Fluoro and 2-O-Methyl modifications, may also be introduced, which increase the melting temperature (Tm) of the duplex. Further modifications include the use of orthogonal and non-naturally occurring nucleotides. The various repeat region/anti-repeat region modifications described herein enhance the stability of the duplex, helping to prevent the crRNA and tracrRNA from folding into sub-optimal structures and therefore promoting higher genome editing efficacy.

Conjugates

[0139] The protecting oligonucleotides and/or crRNAs of the disclosure may be modified with terminally conjugated moieties. As used herein, a terminally conjugated moiety or moiety refers to a compound which may be linked or attached to the 5 and/or 3 end of the crRNA and/protecting oligonucleotide. Terminally conjugated moieties can provide increased stability, increased ability to penetrate cell membranes, increase cellular uptake, increase circulation time in vivo, act as a cell-specific directing reagent, and/or provide a means to monitor cellular or tissue-specific uptake.

[0140] In certain embodiments, the terminally conjugated moiety is conjugated to the 5 end of the crRNA. In certain embodiments, the terminally conjugated moiety is conjugated to the 3 end of the crRNA. In certain embodiments, the terminally conjugated moiety is conjugated to the 5 end of the protecting oligonucleotide. In certain embodiments, the terminally conjugated moiety is conjugated to the 3 end of the protecting oligonucleotide.

[0141] In certain exemplary embodiments, a terminally conjugated moiety includes, but is not limited to, fatty acid, steroid, secosteroid, lipid, ganglioside analog, nucleoside analogs, endocannabinoid, vitamin, receptor ligand, peptide, aptamer, alkyl chain, fluorophore, antibody, nuclear localization signal, and the like.

[0142] In certain exemplary embodiments, a terminally conjugated moiety includes, but is not limited to, cholesterol, cholesterol-triethylene glycol (TEGChol), docosahexaenoic acid (DHA), docosanoic acid (DCA), lithocholic acid (LA), GalNAc, amphiphilic block copolymer (ABC), hydrophilic block copolymer (HBC), poloxamer, Cy5, Cy3, and the like.

[0143] In certain exemplary embodiments, the at least one terminally conjugated moiety is a modified lipid, including a branched lipid (such as the structure shown in Formula I) or a headgroup-modified lipid (such as the structure shown in Formula II).

X-MC(Y)M-Z-[L-MC(Y)M-R]nFormula I

where X is a moiety that links the lipid to the guide RNA, each Y is independently oxygen or sulfur, each M is independently CH.sub.2, NH, O or S, Z is a branching group which allows two or three (n) chains to be joined to the rest of the structure, L is an optional linker moiety, and each R is independently a saturated, monounsaturated or polyunsaturated linear or branched moiety from 2 to 30 atoms in length, a sterol, or other hydrophobic group.

X-MC(Y)M-Z-[L-MC(Y)M-R]n-L-K-JFormula II

where X is a moiety that links the lipid to the guide RNA, each Y is independently oxygen or sulfur, each M is independently CH.sub.2, NH, N-alkyl, O or S, Z is a branching group which allows two or three (n) chains to be joined to the rest of the structure, each L is independently an optional linker moiety, and R is a saturated, monounsaturated or polyunsaturated linear or branched moiety from 2 to 30 atoms in length, a sterol, or other hydrophobic group, K is a phosphate, sulfate, or amide and J is an aminoalkane or quaternary aminoalkane group.

[0144] The moieties may be attached to the terminal nucleotides of the guide RNA via a linker. Exemplary linkers include, but are not limited to, an ethylene glycol chain, an alkyl chain, a polypeptide, a polysaccharide, a block copolymer, and the like.

[0145] In certain embodiments, the moiety is conjugated to the 5 end and/or 3 end of any one of RC01 to RC10 (i.e., RC01, RC02, RC03, RC04, RC05, RC06, RC07, RC08, RC09, or RC10).

Chemically Modified Single Guide RNA

[0146] As described herein, the chemically modified guide RNAs of the disclosure may be constructed as single guide RNAs (sgRNAs) by linking the 3 end of a crRNA to the 5 end of a tracrRNA. The linker may be an oligonucleotide loop, including a chemically modified oligonucleotide loop. In certain embodiments, the oligonucleotide loop comprises a GAAA tetraloop. The linker may be a non-nucleotide chemical linker, including, but not limited to, ethylene glycol oligomers (see, e.g., Pils et al. Nucleic Acids Res. 28(9): 1859-1863 (2000)).

RNA-Guided Nucleases

[0147] RNA-guided nucleases according to the present disclosure include, without limitation, naturally-occurring Type II CRISPR nucleases such as Cas9, as well as other nucleases derived or obtained therefrom. Exemplary Cas9 nucleases that may be used in the present disclosure include, but are not limited to, S. pyogenes Cas9 (SpCas9), S. aureus Cas9 (SaCas9), N. meningitidis Cas9 (NmCas9), C. jejuni Cas9 (CjCas9), and Geobacillus Cas9 (GeoCas9). In functional terms, RNA-guided nucleases are defined as those nucleases that: (a) interact with (e.g., complex with) a gRNA; and (b) together with the gRNA, associate with, and optionally cleave or modify, a target region of a DNA that includes (i) a sequence complementary to the targeting domain of the gRNA and, optionally, (ii) an additional sequence referred to as a protospacer adjacent motif, or PAM, which is described in greater detail below. As the following examples will illustrate, RNA-guided nucleases can be defined, in broad terms, by their PAM specificity and cleavage activity, even though variations may exist between individual RNA-guided nucleases that share the same PAM specificity or cleavage activity. Skilled artisans will appreciate that some aspects of the present disclosure relate to systems, methods and compositions that can be implemented using any suitable RNA-guided nuclease having a certain PAM specificity and/or cleavage activity. For this reason, unless otherwise specified, the term RNA-guided nuclease should be understood as a generic term, and not limited to any particular type (e.g., Cas9 vs. Cpf1), species (e.g., S. pyogenes vs. S. aureu ) or variation (e.g., full-length vs. truncated or split; naturally-occurring PAM specificity vs. engineered PAM specificity).

[0148] Various RNA-guided nucleases may require different sequential relationships between PAMs and protospacers. In general, Cas9s recognize PAM sequences that are 5 of the protospacer as visualized relative to the top or complementary strand.

[0149] In addition to recognizing specific sequential orientations of PAMs and protospacers, RNA-guided nucleases generally recognize specific PAM sequences. S. aureus Cas9, for example, recognizes a PAM sequence of NNGRRT, wherein the N sequences are immediately 3 of the region recognized by the gRNA targeting domain. S. pyogenes Cas9 recognizes NGG PAM sequences. It should also be noted that engineered RNA-guided nucleases can have PAM specificities that differ from the PAM specificities of similar nucleases (such as the naturally occurring variant from which an RNA-guided nuclease is derived, or the naturally occurring variant having the greatest amino acid sequence homology to an engineered RNA-guided nuclease). Modified Cas9s that recognize alternate PAM sequences are described below.

[0150] RNA-guided nucleases are also characterized by their DNA cleavage activity: naturally-occurring RNA-guided nucleases typically form DSBs in target nucleic acids, but engineered variants have been produced that generate only SSBs (discussed above; see also Ran 2013, incorporated by reference herein), or that do not cut at all.

[0151] The RNA-guided nuclease Cas9 may be a variant of Cas9 with altered activity. Exemplary variant Cas9 nucleases include, but are not limited to, a Cas9 nickase (nCas9), a catalytically dead Cas9 (dCas9), a hyper accurate Cas9 (HypaCas9) (Chen et al. Nature, 550(7676), 407-410 (2017)), a high fidelity Cas9 (Cas9-HF) (Kleinstiver et al. Nature 529(7587), 490-495 (2016)), an enhanced specificity Cas9 (eCas9) (Slaymaker et al. Science 351(6268), 84-88 (2016)), and an expanded PAM Cas9 (xCas9) (Hu et al. Nature doi: 10.1038/nature26155 (2018)).

[0152] The RNA-guided nucleases may be combined with the chemically modified guide RNAs of the present disclosure to form a genome-editing system. The RNA-guided nucleases may be combined with the chemically modified guide RNAs to form an RNP complex that may be delivered to a cell where genome-editing is desired. The RNA-guided nucleases may be expressed in a cell where genome-editing is desired with the chemically modified guide RNAs delivered separately. For example, the RNA-guided nucleases may be expressed from a polynucleotide such as a vector or a synthetic mRNA. The vector may be a viral vector, including, be not limited to, an adeno-associated virus (AAV) vector or a lentivirus (LV) vector.

[0153] It will be readily apparent to those skilled in the art that other suitable modifications and adaptations of the methods described herein may be made using suitable equivalents without departing from the scope of the embodiments disclosed herein. Having now described certain embodiments in detail, the same will be more clearly understood by reference to the following examples, which are included for purposes of illustration only and are not intended to be limiting.

EXAMPLES

Example 1Genome Editing Efficiency of Chemically Modified crRNA and tracrRNA

[0154] To test the compatibility between a certain chemical modification of the crRNA and SpyCas9/base editor (BE) activity, we established a scenario in which cell lines stably express either SpyCas9 nuclease or base editor, tracrRNA, and a fluorescent reporter gene (FIG. 1A and FIG. 1B), but do not express a crRNA. We first screened the activities of different chemically modified crRNAs designed previously (described in WO 2019/183000 A1 and WO 2021/231606 A2, incorporated herein by reference) by electroporation into the stable cell lines and quantifying the percentage of fluorescence-positive cells (which reports on editing activity) using fluorescent activated cell sorting (FACS). Compared to the end-modified C0 crRNA, the heavily modified C20 showed significantly enhanced activity, while all the fully modified crRNAs showed reduced activity (FIG. 1C). This conclusion was further confirmed using crRNAs targeting various endogenous genomic loci (FIG. 1D). We next compared the stabilities of the heavily and fully modified crRNAs by incubating them with fetal bovine serum (FBS). We found that only the fully modified crRNAs are stable in the FBS (FIG. 1E). We note that C20 has six ribose residues that include a 3-phosphorothioate; phosphorothioate modifications improves stability relative to unmodified phosphate linkages, but substantial degradation does still occur. Therefore, our most active CRISPR guide (C20) requires further stabilization.

[0155] The protecting oligonucleotides used in the Examples are recited below in Table 3. Table 4 below recites crRNAs used in the Examples.

TABLE-US-00008 TABLE3 ExemplaryProtectingOligonucleotides Name Sequence RC04_MCV1 mAmAmAmAmCmCmGmAmGmGmCmA(SEQID a NO:131) RC05_MCV1 mUmAmAmAmAmCmCmGmAmGmGmCmA(SEQID a NO:132) RC06_MCV1 mAmAmAmAmCmCmGmAmGmGmCmAmG(SEQID a NO:133) RC07_MCV1 mUmAmAmAmAmCmCmGmAmGmGmCmAmG(SEQID a NO:134) RC08_MCV1 mCmUmAmAmAmAmCmCmGmAmGmGmCmAmG(SEQ a IDNO:135) RC09_MCV1 mUmAmAmAmAmCmCmGmAmGmGmCmAmGmG(SEQ a IDNO:136) RC10_MCV1 mCmUmAmAmAmAmCmCmGmAmGmGmCmAmGmG(S a EQIDNO:137) RC07_MCV1 mUmAmAmAmAmCmCmGmAmGmGmCmAmG- a-TegChol TegChol(SEQIDNO:134) RC07_MCV1 mUmAmAmAmAmCmCmGmAmGmGmCmAmGdTdT- a-dT- TegChol(SEQIDNO:138) TegChol RC07_MCV1 lUlAmAmAmAmCmCmGmAmGmGmClAlG(SEQID a-4xLNA NO:139) RC07_MCV1 lUmAmAmAmAmCmCmGmAmGmGmCmAlG(SEQID a-2xLNA NO:140) Cy5- Cy5-mUmAmAmAmAmCmCmGmAmGmGmCmAmG- RC07_MCV1 TegChol(SEQIDNO:134) a-TegChol RC07_dGFP mUmAmAmAmAmCmAmCmCmAmCmAmUmG(SEQID NO:141) RC08_dGFP mCmUmAmAmAmAmCmAmCmCmAmCmAmUmG (SEQIDNO:142) RC09_dGFP mUmAmAmAmAmCmAmCmCmAmCmAmUmGmA (SEQIDNO:143) RC10_dGFP mCmUmAmAmAmAmCmAmCmCmAmCmAmUmGmA (SEQIDNO:144) RC07- mUmAmAmAmAmCmAmCmCmAmCmAmUmG- GalNac_dGF GalNac(SEQIDNO:141) P RC08- mCmUmAmAmAmAmCmAmCmCmAmCmAmUmG- GalNac_dGF GalNac(SEQIDNO:142) P RC09- mUmAmAmAmAmCmAmCmCmAmCmAmUmGmA- GalNac_dGF GalNac(SEQIDNO:143) P RC10- mCmUmAmAmAmAmCmAmCmCmAmCmAmUmGmA- GalNac_dGF GalNac(SEQIDNO:144) P RC07- mUmAmAmAmAmCmAmCmCmAmCmAmUmG- DHA_dGFP DHAvl(SEQIDNO:141) RC08- mCmUmAmAmAmAmCmAmCmCmAmCmAmUmG- DHA_dGFP DHAvl(SEQIDNO:142) RC09- mUmAmAmAmAmCmAmCmCmAmCmAmUmGmA- DHA_dGFP DHAvl(SEQIDNO:143) RC10- mCmUmAmAmAmAmCmAmCmCmAmCmAmUmGmA- DHA_dGFP DHAvl(SEQIDNO:144) RC07-dT- mUmAmAmAmAmCmAmCmCmAmCmAmUmGdTdT- DHA_dGFP DHAvl(SEQIDNO:145) RC08-dT- mCmUmAmAmAmAmCmAmCmCmAmCmAmUmGdTdT- DHA_dGFP DHAvl(SEQIDNO:146) RC09-dT- mUmAmAmAmAmCmAmCmCmAmCmAmUmGmAdTdT DHA_dGFP -DHAvl(SEQIDNO:147) RC10-dT- mCmUmAmAmAmAmCmAmCmCmAmCmAmUmGmAd DHA_dGFP TdT-DHAvl(SEQIDNO:148) RC07- mUmAmAmAmAmCmAmCmCmAmCmAmUmG-TegChol TegChol_dG (SEQIDNO:141) FP RC08- mCmUmAmAmAmAmCmAmCmCmAmCmAmUmG- TegChol_dG TegChol(SEQIDNO:142) FP RC07-dT- mUmAmAmAmAmCmAmCmCmAmCmAmUmGdTdT- TegChol_dG TegChol(SEQIDNO:145) FP RC08-dT- mCmUmAmAmAmAmCmAmCmCmAmCmAmUmGdTdT- TegChol_dG TegChol(SEQIDNO:146) FP RC09-dT- mUmAmAmAmAmCmAmCmCmAmCmAmUmGmAdTdT TegChol_dG -TegChol(SEQIDNO:147) FP RC10-dT- mCmUmAmAmAmAmCmAmCmCmAmCmAmUmGmAd TegChol_dG TdT-TegChol(SEQIDNO:148) FP RC07- mU#mA#mAmAmAmCmAmCmCmAmCmA#mU#mG 2PS_dGFP (SEQIDNO:149) RC07- mU#mA#mA#mAmAmCmAmCmCmAmC#mA#mU#mG 3PS_dGFP (SEQIDNO:150) RC07- mU#mA#mAmAmAmCmAmCmCmAmCmA#mU#mGdTd dT_2PS- T-TegChol(SEQIDNO:151) TegChol_dG FP RC07-2PS- mU#mA#mAmAmAmCmAmCmCmAmCmA#mU#mG- TegChol_dG TegChol(SEQIDNO:149) FP KEY: rN =RNA, mN =2-O-methyl RNA, fN =2-fluoro RNA, aN =2-NH.sub.2 (2-amino RNA), sN =4-thio RNA, dN =2-deoxy RNA, N =A, U, G, or C N#N =phosphorothioate linkage

TABLE-US-00009 TABLE4 ExemplarycrRNAs. Name Sequence CO mG#mA#mG#rArCrArArArUrCrArCrCrUrGrCrCr UrCrGrGrUrUrUrUrArGrArGrCrUrAmU#mGm#mC #mU(SEQIDNO:152) C20 mG#mA#mG#mAmCmAmAmAmUmCfAfCfCfUrG#rC#fC fUrC#mGmGrU#rU#rU#fUfAmGmAmGmCmUmAmU#mG #mC#mU(SEQIDNO:153) C20- mG#mA#mG#mAmCmAmAmAmUmCfAfCfCfUrG#rC#fC GalNac fUrC#mGmGrU#rU#rU#fUfAmGmAmGmCmUmAmU#mG #mC#mU-GalNac(SEQIDNO:153) C20- mG#mA#mG#mAmCmAmAmAmUmCfAfCfCfUrG#rC#fC TegChol fUrC#mGmGrU#rU#rU#fUfAmGmAmGmCmUmAmU#mG #mC#mU-TegChol(SEQIDNO:153) C20- mG#mA#mG#mAmCmAmAmAmUmCfAfCfCfUrG#rC#fC Cy3_MCV1a fUrC#mGmGrU#rU#rU#fUfAmGmAmGmCmUmAmU#mG #mC#mU-Cy3(SEQIDNO:153) C20- mG#mU#mC#mGmUmGmCmUmAmCfUfUfCfArU#rG#fU GalNac_ fGrG#mUmGrU#rU#rU#fUfAmGmAmGmCmUmAmU#m dGFP G#mC#mU-GalNac(SEQIDNO:154) C20- mG#mU#mC#mGmUmGmCmUmAmCfUfUfCfArU#rG#fU DHA_dGFP fGrG#mUmGrU#rU#rU#fUfAmGmAmGmCmUmAmU#m G#mC#mU-DHAv1(SEQIDNO:154) C20-dT- mG#mU#mC#mGmUmGmCmUmAmCfUfUfCfArU#rG#fU DHA_dGFP fGrG#mUmGrU#rU#rU#fUfAmGmAmGmCmUmAmU#m G#mC#mUdTdT-DHAv1(SEQIDNO:155) C20- mG#mU#mC#mGmUmGmCmUmAmCfUfUfCfArU#rG#fU TegChol_ fGrG#mUmGrU#rU#rU#fUfAmGmAmGmCmUmAmU#m dGFP G#mC#mU-TegChol(SEQIDNO:154) C20-dT- mG#mU#mC#mGmUmGmCmUmAmCfUfUfCfArU#rG#fU TegChol_ fGrG#mUmGrU#rU#rU#fUfAmGmAmGmCmUmAmU#m dGFP G#mC#mUdTdT-TegChol(SEQIDNO:155) KEY: rN =RNA, mN =2-O-methyl RNA, fN =2-fluoro RNA, aN =2-NH.sub.2 (2-amino RNA), sN =4-thio RNA, dN =2-deoxy RNA, N =A, U, G, or C N#N =phosphorothioate linkage

Example 2Protecting Oligos Enhance the Stability of crRNA Without Compromising Activity and Enhance the Potency of crRNA

[0156] Inspired by the design of short DNA/RNA heteroduplex oligonucleotide (HDO) (Nishina et al., Nature Communications, 2015) and by the well-established observation that double-stranded RNAs are more resistant to nuclease degradation than single-stranded RNAs (Lam et al., Molecular Therapy Nucleic Acids, 2015), we sought to enhance the crRNA stability by designing short, fully chemically stabilized oligos that can protect the unmodified regions of C20 (FIG. 2A). We anticipated that the protecting oligo will be displaced by tracrRNA strand invasion during pairing of the crRNA repeat region with the tracrRNA anti-repeat region, thereby still allowing the crRNA/tracrRNA complex to form, as required for Cas9 editing. Formation of the crRNA/tracrRNA duplex would simultaneously induce dissociation of the protecting oligo. We found that when annealed to C20, oligos equal to or longer than 12 nt can protect C20 from degradation by nucleases in the FBS (FIG. 2B). By electroporating the C20-protecting oligo complexes into the stable cell line, we confirmed that protecting oligos do not interfere with SpyCas9 activity (FIG. 2C).

Protecting Oligos Enhance the Potency of crRNA

[0157] To test whether protecting oligos that enhanced C20 stability can also increase its potency, we electroporated the C20-protecting oligo complexes at non-saturating dosages. We found that protecting oligos significantly enhanced the potency of C20 (FIG. 3A and FIG. 3B).

Example 3Conjugation to Protecting Oligos Enhanced Cellular Uptake Without Interfering With crRNA Activity

[0158] Addition of conjugations such as N-acetylgalactosamine (GalNac) and Cholesterol (TegChol) to therapeutic oligonucleotide is critical for achieving potent and targeted in vivo delivery. To test whether conjugations interfere with the crRNA activity, we synthesized both crRNA and protecting oligos with either GalNac or Cholesterol conjugation and tested the activity via electroporation in the stable cell line. We found that while directly conjugating of Cholesterol to C20 significantly compromised the activity, C20 with Cholesterol-conjugated protecting oligos did not show reduced activity (FIG. 4A). While C20 with cholesterol conjugation showed significantly reduced editing efficiency, conjugating cholesterol onto the protecting oligonucleotides did not interfere with the activity (FIG. 4B).

[0159] To directly visualize enhanced cellular uptake of C20 by conjugated protecting oligos in vivo, we delivered Cy3-labeled C20 with and without cholesterol- or DHA-conjugated protecting oligos in adult mouse brains by intrastriatal (IS) injection. We found that compared to unconjugated protecting oligos, both cholesterol- and DHA-conjugated protecting oligos significantly enhanced the in vivo distribution and cellular uptake of C20 (FIG. 4C). These data suggest that the protecting oligos allows various types of conjugations and can be used as a delivery vehicle to enhance cellular uptake of crRNA without interfering with the Cas9 activity. Moreover, we demonstrated that our engineered crRNA-protecting oligo complex can be efficiently taken up into cultured mammalian cells without transfection reagents (FIG. 4D).

Example 4Chemically Modified crRNAs With Varied Phosphorothioate Content

[0160] To test if the C20-protecting oligo complex can be taken up into cells passively (simply by adding it to the media, without electroporation or transfection), escape from endosomes, and support editing, we incubated the stable cell line shown in FIG. 1B with 1.5 M C20-protecting oligo targeting the inactivated GFP reporter. Optimal duplex stability between protecting oligo and crRNA may be required for efficient editing (FIG. 6). We observed 7% editing efficiency (FIG. 5). Because cholesterol can be critical for siRNA uptake in cultured cells [Ly et al., Molecular Therapy Nucleic Acids 2020], further enhancement of editing efficiency can be achieved by using Cholesterol-conjugated protecting oligo as shown in FIG. 4A.

Example 5In Vivo Genome Editing in Adult Mouse CNS by Co-Delivery of AAV and Self-Delivering crRNA

[0161] We tested whether the C20-protecting oligo complex can support genome editing by AAV co-delivery in vivo. We chose to test in a double transgenic reporter mouse model, Cas9/mTmG+/+. This mouse model was generated by crossing the homozygous Cas9+/+ mice68 with the homozygous mTmG+/+ reporter mice (Muzumdar et al. Genesis. 45: 593-605. 2007). The Cas9+/+ mouse model constitutively expresses SpyCas9, and the only transgene delivered from an AAV vector is the tracrRNA, which simplified the experimental process. The mTmG+/+ reporter consists of loxP sites on either side of a membrane-targeted tdTomato (mT) cassette, which constitutively expresses red fluorescent, and a downstream membrane-targeted EGFP (mG) that cannot be expressed until the mT cassette was deleted (FIG. 7A).

[0162] First, we injected scAAV9 that expresses tracrRNA into adult Cas9/mTmG+/+ mouse brain by IS injection. Two weeks later, we performed IS injection again to deliver naked C20, which targets the two loxP sites to generate block deletion of the mT cassette and allow the mG expression. We then detected GFP expression by performing Immunohistochemistry (IHC) on formalin-fixed mouse brain sections using anti-EGFP antibodies.

[0163] We chose to test both cholesterol and DHA conjugates, and both cleavable and stable linkers for the protecting oligos. We also included C20 with protecting oligos without any conjugation and C20 without protecting oligos as controls.

[0164] By IHC staining using an anti-EGFP antibody, we found that C20 without protecting oligos did not generate any editing in the brain. At the same time, we only observed a few EGFP-positive cells around the injection site with C20 and protecting oligos with no conjugation. In contrast, C20 with either DHA or cholesterol conjugation and with either cleavable or stable linker generated more efficient editing with broader distribution (FIG. 7B), which was consistent with the in vivo distribution results quantified in FIG. 4B. When quantifying the percentage of EGFP positive cells within 1 mm.sup.2 around the site-of-injection, we found that the DHA conjugation performed better than the cholesterol conjugation and having a cleavable linker further improves the distribution and the editing efficiency (FIG. 7C).

Example 6Chemically Modified crRNAs With Varied Phosphorothioate Content

[0165] Using the adult wild-type B6 mice, we tested C20 targeting the mouse Pcsk9 gene with either 14 nucleotides or 16 nucleotides protecting oligo having a trivalent GalNac conjugation. We also included a non-targeting control C20, and PBS as controls. First, we injected adult mice with AAV to express either SpyCas9-ABE8e and tracrRNA (FIG. 8A), or SpyCas9 nuclease and tracrRNA (FIG. 8B) through retro-orbital (RO) injection and incubated five weeks to allow the effector protein to express and accumulate. We then injected C20 with and without GalNac-conjugated protecting oligo via a single RO injection at 80 mg/kg. The editing efficiency was assessed by extracting genomic DNA from the mouse liver tissue and performing targeted amplicon deep sequencing. We found low yet significant editing at the target genomic locus by C20 with both lengths of protecting oligo, while no editing was observed for the non-targeting control C20-injected mice (FIG. 8A and FIG. 8B).

[0166] Next, we tested whether our co-delivery approach can generate therapeutic-relevant editing by testing in the mouse model of HT1. The HT1 mouse model used in this study is the Fah.sup.PM/PM mouse, which possesses a G-to-A point mutation in the last nucleotide of exon 8 of the Fah gene, which encodes fumarylacetoacetate hydrolase. This point mutation generates exon 8 skipping and causes FAH deficiency (FIG. 8C). Because FAH catalyzes one step of the tyrosine catabolic pathway, FAH deficiency leads to accumulations of toxic fumarylacetoacetate and succinyl acetoacetate, causing damage in multiple organs. The Fah.sup.PM/PM mouse can be treated with 2-(2-nitro-4-trifluoromethylbenzoyl)-1,3-cyclohexanedione (NTBC), an inhibitor of an enzyme upstream within the tyrosine degradation pathway to prevent toxin accumulation. Without such treatment, the mice will rapidly lose weight and die. Previously, studies showed that the point mutation in the Fah.sup.PM/PM mouse could be corrected by SpyCas9-ABE delivered by either lipid nanoparticle carrying mRNA and sgRNA or plasmid hydrodynamic tail-vein injection.

[0167] We first injected AAV to express SpyCas9-ABE8e and tracrRNA by RO injection. After five weeks, we performed RO injections of C20 with a previously validated spacer sequence targeting the point mutation in the Fah.sup.PM/PM mouse, with either 14 nucleotides or 16 nucleotides trivalent GalNac-conjugated protecting oligos, at a single 80 mg/kg dose. The mice were kept on NTBC the whole time to maintain their body weight and allow time for the genome editing to occur. We then sacrificed three mice from each group and extracted liver genomic DNA to measure the editing efficiency by targeted amplicon deep sequencing, as well as detecting FAH-positive hepatocytes via IHC staining using anti-FAH antibodies. For the remaining mouse from each group, we cycled NTBC off and on (7-10 days off followed by 2 days on) for three months to allow FAH-positive hepatocytes to expand and monitor the mouse body weight to test if genome editing by our co-delivery approach can correct the phenotypes of this mouse model (FIG. 8D). Before NTBC withdrawal, we observed low yet significant on-target editing in the co-delivery-treated groups (FIG. 8E). After NTBC withdrawal, the PBS-injected mouse rapidly lost body weight and was humanely sacrificed after the body weight dropped below 80% and moribund. The mice treated with AAV-expressed SpyCas9-ABE8e and tracrRNA, and C20 with protecting oligos gradually gained body weight over time (FIG. 8F). The mice were then sacrificed after three months of NTBC cycles, and IHC staining was performed on liver sections using anti-FAH antibodies. We observed the expansion of FAH-positive hepatocytes in the liver tissue treated with AAV co-delivery (FIG. 8G). These data suggested that systemic delivery of C20 and GalNac-conjugated protecting oligos, with AAV-expressed effector protein and tracrRNA, can achieve in vivo genome editing in the liver and offer therapeutic benefits.

Example 6Improving the Editing Efficiency Through Optimization of the Dosing Regimen

[0168] The editing efficiency we achieved in the liver, though significant, was low. We then sought to improve the efficiency by optimizing the dosing regimen. The asialoglycoprotein receptor (ASGPR), which is expressed on the surface of the hepatocytes and responsible for the uptake of GalNac-conjugated oligos, has a recycle time of around 10-15 minutes. Data from previous studies also showed that due to ASGPR saturation, the hepatocytes can only uptake limited amount of the GalNac-conjugated molecules after bolus intravenous injection.77 Our initial study injected a single dose of C20 with GalNac-conjugated protecting oligo at 80 mg/kg, far beyond the capacity of available ASGPR. We reasoned that instead of a single large dose, dividing the oligos into three consecutive daily RO injections with one-third of the previous dose (26 mg/kg) may be able to deliver more oligos into the hepatocyte, thus boosting the editing efficiency (FIG. 9A).

[0169] To test this idea, we first RO injected AAV to express SpyCas9-ABE8e and tracrRNA in the B6 mice. Then, after five weeks, we performed three consecutive daily RO injections of C20 targeting the Pcsk9 gene complexed with a 14 nt GalNac-conjugated protecting oligos at 26 mg/kg. We then harvested the mouse liver genomic DNA and performed targeted amplicon deep sequencing to measure the editing efficiency. We found that compared to a single dose of 80 mg/kg oligo, three consecutive daily doses at 26 mg/kg significantly improved the editing efficiency (FIG. 9B). In addition, we did not observe any sign of toxicity in the liver by redosing, and the oligo-treated mice were in good health, similar to the PBS-injected mice. These data indicate that repeat crRNA dosing is possible and can be well-tolerated, and optimizations of the dosing regimen will likely further increase the editing efficiency.

Example 7Improving the In Vivo Editing Efficiency Through Optimization of the Dosing Regimen

[0170] We then further explored the mechanisms of protecting oligo activity. We compared the activities of C20 with protecting oligonucleotides of different lengths or that anneal to different regions of C20 (FIG. 10). We found that protecting oligos as short as 10 nucleotides (P01) enhanced C20 potency, although to a lesser extent than the 14 nucleotides protecting oligo (P07), possibly because the lower melting temperature limited the degree of C20 protection. Conversely, we found that longer P.O.s (up to 22 nucleotides for P016, with a nucleotide sequence of 5-GC ACAAAAACNNNN NNN-3) (SEQ ID NO:156) reduced C20 potency, possibly due to the strong binding affinity that inhibited initial tracrRNA annealing, protecting oligo displacement, or both. Furthermore, the positions where the protecting oligo binds are also important (FIG. 10A). A 16 nt protecting oligo (B10 with a sequence of 5-ACCAUAGCUCUAAAAC-3) (SEQ ID NO:157) that leaves no toe-hold for initial tracrRNA annealing also leads to reduced activity, consistent with our hypothesis that the protecting oligo need to be displaced by tracrRNA before C20 can become active (FIG. 10A). Finally, we showed that the protecting oligo neither inhibited nor enhanced the potency of a fully modified and stabilized crRNA (C40), implying that the potency increase conferred by the protecting oligo resulted from C20 stabilization (FIG. 10B).