METHOD FOR OPENING TIGHT JUNCTIONS

Abstract

A method of using RNA interference (RNAi) for the transient, reversible and controlled opening of the tight junctions of the blood brain barrier and/or the blood retinal barrier. This method may be used in the treatment of many diseases and disorders which require the opening of the blood brain barrier and/or blood retinal barrier. Such methods generally involve the use of an RNAi-inducing agent, such as siRNA, miRNA, shRNA or an RNAi-inducing vector whose presence within a cell results in production of an siRNA or shRNA, targeting tight junction proteins to open the blood brain barrier and/or blood retinal barrier.

Claims

1. A method for the treatment of a disease or disorder selected from a neurodegenerative disorder, a neuropsychiatric disorder, brain tumor, and retinal disorder, the method comprising the reversible, transient and controlled RNAi-mediated size selective opening of the paracellular pathway of the blood brain barrier wherein the method comprises: identifying a subject at risk for developing the disease or disorder; administering an effective amount of an RNAi inducing agent targeting tight junction proteins selected from occludin, claudin 1-19 or 21 by delivery of the RNAi inducing agent to result in the transient and reversible RNAi-mediated suppression of blood brain barrier tight junction protein transcripts in brain capillary endothelial or retinal endothelial cells and allow the permeation of active agents used in the treatment of the disease or disorder to the brain capillary endothelial and/or retinal cells; and administering an active agent suitable for the treatment of the disease or disorder.

2. The method according to claim 1 wherein the RNAi agent is: siRNA, shRNA or an RNAi-inducing vector whose presence within a cell results in production of an siRNA, shRNA or miRNA.

3. The method according to claim 1 involving systemic delivery of the RNAi inducing agent to the subject.

4. The method according to claim 1 wherein the RNAi inducing agent targeting the tight junction proteins transiently opens the blood brain barrier to allow delivery of the active agent across the blood brain barrier and the treatment comprises the simultaneous or sequential administration of the active agent and RNAi inducing agent.

5. The method according to claim 1 wherein a high concentration of the RNAi inducing agent is delivered to the subject.

6. The method according to claim 1 wherein systemic delivery takes place by hydrodynamic delivery or non-hydrodynamic delivery.

7. The method according to claim 1 wherein cationic polymers, modified cationic polymers, peptide molecular transporters, lipids, liposomes, non-cationic polymers and/or viral vectors are used for delivery of the RNAi inducing agent.

8. The method according to claim 1 wherein molecules less than approximately 1 kDa permeate across the brain capillary endothelial and/or retinal endothelial cells.

9. The method according to claim 1 wherein molecules less than approximately 800 Da, permeate across the brain capillary endothelial and/or retinal endothelial cells.

10. The method according to claim 1 wherein RNAi-mediated suppression commences from approximately 24 hours post delivery of the RNAi inducing agent and lasts up to approximately 72 hours post delivery of the RNAi inducing agent.

11. The method according to claim 1 wherein the RNAi inducing agent is siRNA.

12. The method according to claim 1 wherein the claudin is selected from claudin 1, claudin-5 and/or claudin-12.

13. The method according to claim 1 wherein the claudin is claudin-5.

14. The method according to claim 1 wherein the siRNA is selected from any one of SEQ ID Nos 1 and 2; 3 and 4; 5 and 6; 7 and 8; 9 and 10; 11 and 12; 13 and 14; 15 and 16; 17 and 18; 19 and 20; 21 and 22; 24 and 25; 26 and 27; 28 and 29; or 30 and 31.

15. The method according to claim 1 wherein one or more siRNAs targeting different TJ proteins are used.

16. The method of claim 1 which allows the permeation of active agents less than 15 kDa.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0165] FIGS. 1A and 1B show the results of the quantification of claudin-5 protein and mRNA levels.

[0166] FIG. 1A is a western blot analysis of claudin-5 expression 24, 48 and 72 hours post hydrodynamic tail vein delivery of siRNA. Controls used included an un-injected control, PBS injected control and non-targeting (Rhodopsin) siRNA injected control mice. Western blot analysis of claudin-5 expression 24 hours post delivery of siRNA, showed a decrease in expression when compared to un-injected, PBS injected and non-targeting siRNA injected mice. This suppression was also evident 48 post injection (CLDN5 A+B; lysates from 2 different mice). Levels of claudin-5 were similar to the control groups 72 hours and 1 week post delivery of caludin-5 siRNA when compared to the corresponding levels of -actin in the same lane (FIG. 1 A).

[0167] FIG. 1B shows RT-PCR analysis of claudin-5 mRNA post-injection of siRNA compared to the control groupsun-injected control, PBS injected control and non-targeting (Rhodopsin) siRNA injected control mice. RT-PCR analysis showed levels of claudin-5 mRNA to be significantly decreased 24 hours post-injection of siRNA compared to the control groups with P=0.0427 (*) following ANOVA with a Tukey-Kramer post-test, while also showing suppression at 48 hours post-injection of claudin-5 siRNA with P=0.0478 (*). Levels of claudin-5 mRNA, 72 hours (P=0.0627) and 1 week (P=0.2264) post injection were not significantly changed compared to the non-targeting control group, showing P values greater than 0.05, representing insignificance (FIG. 1 B).

[0168] FIG. 2 shows the results of immunohistochemical analysis of claudin-5 expression and localisation in the microvessels of the brain revealed a continuous and distinct pattern of staining in the microvasculature of the brain in the un-injected, PBS injected and non-targeting control mice at all time points (Red=Claudin-5; Blue-DAPI=nuclei). This pattern of staining appeared decreased and non-continuous 24 hours post delivery of claudin-5 siRNA, with a striking decrease in expression 48 hours after injection. The appearance of claudin-5 staining 72 hours post-injection of claudin-5 siRNA was evident, yet non-continuous, however, 1 week post-injection, claudin-5 expression appeared similar to that of the control groups. Scale bar approx. 20 m. These results are representative of at least 5 separate experiments.

[0169] FIGS. 3A and 3B show the results of Claudin-1, Tie-2 and Occludin expression following suppression of claudin-5. Western blot analysis of claudin-1 (23 kDa) expression 24, 48, 72 hours and 1 week post delivery of claudin-5 siRNA, showed no changes at any time points. When blots were probed with an anti-Tie-2 (140 kDa) antibody, no distinct changes in the levels of expression of this endothelial cell specific tyrosine kinase receptor were observable at any time point or with any treatment (FIG. 3A). Levels of expression of the tight junction protein occludin (approximately 60 kDA) were also shown to remain un-changed at all time points post-delivery of siRNA (FIG. 3B).

[0170] FIGS. 4A, 4B, 4C and 4D show the results of Claudin-1 and Claudin-5 double immunostaining in brain cryosections. Following injection of siRNA targeting claudin-5, and using the appropriate controls, brain cryosections were stained with a rat anti-claudin-1 antibody and a rabbit anti-claudin-5 antibody. Secondary antibodies used were rat IgG (Cy3; Red) and rabbit IgG (Cy2; Green). Similar to findings in FIG. 2, the pattern of claudin-5 staining appeared highly fragmented and discontinuous 48 hours (FIG. 4B) after injection of siRNA. The appearance of claudin-5 staining 72 hours post-injection of claudin-5 siRNA was evident, yet not as intense as the control groups (FIG. 4C). At each time point post-injection, levels of expression of claudin-1 appeared to remain similar to those observed in the control groups.

[0171] FIG. 5 shows the results of an assessment of BBB integrity to a molecule of 443 Daltons. BBB integrity was observed as green fluorescence within the microvessels in all control groups. However, 24 hours post-injection of siRNA targeting claudin-5, fluorescence detected was diffuse and outside of the microvessels in contrast to the control groups at the same time point. At 48 hours post-injection of claudin-5 siRNA, the distribution of the biotinylated molecule was abundant in the brain parenchyma, while this permeability was still evident 72 hours post-delivery of siRNA when compared to the control groups. In mice 1 week post-injection of siRNA targeting claudin-5, it was observed that the biotinylated reagent did not deposit in the parenchyma following perfusion for 5 minutes. The EZ-Link TM Sulfo-NHS-Biotin was observed within the microvessels of the brain. Scale bar for 24 and 48 hour time points approx 200 m. Scale bar for 72 hour and 1 week time points approx 100 m. All tracer experiments were repeated in mice at least 5 times.

[0172] FIGS. 6A and 6B show the results of extravasation of Hoechst H33342 dye from brain and retinal microvessels, by showing Hoechst 33342 and FD-4 co-perfusion 24, 48, 72 and 1 week post-hydrodynamic tail delivery of Claudin-5 siRNA. Extravasation of Hoechst H33342 from the brain microvessels was manifested by distinct staining of nuclei in surrounding neural and glial cells 24 hours and 48 hours post delivery of claudin-5 siRNA when compared to control groups. This extravasation was not evident in sections 72 hours or 1 week post-injection of siRNA targeting claudin-5. No extravasation of FD-4 was observed in the brain parenchymal tissue at any time point following siRNA injection, or in the control groups. This highlights the size-selective nature of RNAi-mediated targeting of claudin-5. Scale bar approx. 20 m (FIG. 6A).

[0173] Extravasation of Hoechst was also evident in 12 m retinal cryosections, with the Inner Nuclear Layer (INL) appearing stained at 24 hours and distinct Outer Nuclear Layer (ONL) staining at 48 hours post delivery of CLDN5 siRNA. In all control groups, Hoechst staining was manifested solely in the nuclei of retinal blood vessels which diffuse within the retina as far as the Outer Plexiform Layer (OPL). Scale bar approx. 20 m. (IPL) Inner Plexiform Layer; (GCL) Ganglion Cell Layer (FIG. 6B).

[0174] FIG. 7A shows the results of an MRI Scan post injection to assess the blood brain barrier integrity in vivo. The magnetic resonance imaging (MRI) contrasting agent Gd-DTPA was used to ascertain BBB integrity in mice following ablation of claudin-5 transcripts compared to the control groupsun-injected control, PBS injected control and non-targeting (Rhodopsin) siRNA injected control mice. The image to the left of the figure is the contrasting of the mouse brain before injection of Gd-DTPA, while the image to the right is the contrasting of the mouse brain following injection of Gd-DTPA. The images are taken coronally moving from the ventral aspect of the brain to the dorsal aspect (Lower images), with intervening images showing contrasting within the hippocampal and cortex regions. At 24 & 48 hours post-injection of claudin-5 siRNA, it was observed that Gd-DTPA crossed the BBB and was deposited within the brain. Strong contrasting was also observed in the eye when compared to the control groups of animals at the 48 hour time point but not at the other time points. The most significant infiltration and deposition of Gd-DTPA (742 Da) into the parenchyma occurred at 24 and 48 hours post-injection of siRNA targeting claudin-5 (All MRI scans were repeated a minimum of twice). This infiltration of the contrasting agent was not present in the control groups of mice, nor was it present in mice 72 hours or 1 week post-injection of siRNA targeting claudin-5.

[0175] FIG. 7B shows the results of densitometric analysis of MRI imaging in mouse brain following systemic administration of siRNA targeting claudin-5. Densitometric analyses of MRI scans in selected regions of the Cerebellum, Hippocampus and Cortex for each time point and with each treatment were combined and are represented as a bar chart in FIG. 7B. There was a significant increase in contrasting within these regions at 24 hours (**P<0.05) and 48 hours (**P<0.05) post injection of claudin-5 siRNA when compared to the control groups.

[0176] FIG. 7C shows the results of quantitative MRI imaging. The image in FIG. 7C is represented as follows; the red end denotes very little change in the slope of the linear fit, determined for every pixel in the MRI scans of mice. The green areas show some change and blue areas denote a large change in the rate of Gd-DTPA deposition. The graph below the quantitative image in FIG. 7C shows the change in intensities in left ventricle over a 28-minute timecourse after Gd-DTPA injection. The data in the graph is plotted as the natural logarithm (In) of the signal intensity (y-axis) against time in minutes on the x-axis (each unit on the x-axis is 128 seconds long). The red line represents the non-targeting control siRNA injected mouse; the yellow line represents the 24 hours time point post-injection of siRNA targeting claudin-5; while the green line represents the 48 hour time point post-injection of claudin-5 siRNA. Thin lines=raw data of intensities at the 14 time points; Thick lines=mathematically calculated linear fit for the time points; Dotted lines=the standard error for the linear fit using chi-squared evaluation.

[0177] FIG. 8 shows the results of the administration of 20 mg/kg of TRH to mice following ablation of claudin-5 protein. This graph outlines the distinct changes in mobility observed upon administration of 20 mg/kg TRH in mice 48 hours after tail vein injection of a non-targeting siRNA and 48 hours post-injection of siRNA targeting claudin-5. When the BBB was compromised, the behavioural output following TRH injection 48 hours post delivery of siRNA targeting claudin-5 was manifested by a significant cessation of mobility that remains for up 5 times longer than that observed in the non-targeting control mice (**P=0.0041).

[0178] FIG. 9 shows endothelial cell morphology in liver cryosections. 12 m cryosections of mouse liver were prepared following injection of siRNA targeting claudin-5 and using the appropriate control groups. The brown/red-rose chromogenic staining in the sections represents the Griffonia simplicifolia-isolectin B4 binding in liver microvasculature and specifically the endothelial cells lining this microvasculature. In all sections and all treatments, the microvasculature of the liver appears similar and un-disrupted. Sections were counterstained with Hematoxylin.

[0179] FIG. 10 shows endothelial cell morphology in lung cryosections. Cryosections of mouse lung were stained with HRP-conjugated Griffonia simplicifolia-isolectin B4. It is clear that the lung tissue is highly perfused with microvessels; however the morphology of these vessels remains un-changed in all experimental groups and at all time points post-injection. Sections were counterstained with Hematoxylin.

[0180] FIG. 11 shows endothelial cell morphology in kidney cryosections. Mouse kidney cryosections were prepared following injection of siRNA and employing the appropriate control groups and subsequently stained with HRP-conjugated Griffonia simplicifolia-isolectin B4. Brown/red-rose staining showed intact kidney microvessels in all treatments and at all time points post siRNA injection. Sections were counterstained with Hematoxylin.

[0181] FIG. 12 shows endothelial cell morphology in heart cryosection. Mouse hearts were dissected following delivery of siRNA at 24, 48, 72 hours and 1 week, and using appropriate controls. 12 m sections were prepared and following staining with Griffonia simplicifolia-isolectin B4, heart associated microvessels showed similar morphology at all time points and with all siRNA treatments. Sections were counterstained with Hematoxylin.

[0182] FIG. 13 shows immunohistochemical analysis of occludin expression in brain cryosections. Immunohistochemical analysis of occludin expression and localisation in the microvessels of the brain revealed a continuous and distinct pattern of staining in the microvasculature of all mice and at all time points (Red; Alexa 568=Occludin; Blue-DAPI=nuclei).

[0183] FIG. 14 shows the results of Claudin-5 suppression in the retina following siRNA injection. Western blot analysis of claudin-5 expression in retinal protein lysates showed decreased expression 48 hours post hydrodynamic tail vein injection of siRNA directed against claudin-5. Levels of expression were observed to return to levels similar to un-injected, PBS-injected and non-targeting siRNA injected mice.

[0184] FIG. 15 shows the results of Claudin-5 expression in retinal flatmounts. Immunohistochemical analysis of claudin-5 expression in retinal flatmounts from mice receiving a non-targeting siRNA, and mice 24, 48 and 72 hours post claudin-5 siRNA injection showed a decreased localisation of claudin-5 at the periphery of endothelial cells lining the retinal microvessels. This decreased expression of claudin-5 was concomitant with increased retinal microvessel permeability.

[0185] FIG. 16 shows the results of MRI analysis of Gd-DTPA diffusion across the iBRB. Following contrast enhanced MRI-analysis; it was evident that the iBRB was compromised in mice 48 hours post-injection of siRNA targeting claudin-5. This manifested as increased contrasting within the vitreous of the eye as Gd-DTPA passed from the vasculature to the extravascular spaces.

[0186] FIG. 17 shows the results of retinal flatmounts following perfusion of mice with Hoechst 33352 (562 Da). Following perfusion of mice with Hoechst 33352, retinas were dissected out and flatmounted. Hoechst 33352 was shown to stain extravascular nuclei in the retinas of mice 24 and 48 hours post hydrodynamic tail vein injection of siRNA targeting claudin-5 when compared to un-injected mice, mice receiving PBS alone or mice receiving a hydrodynamic tail vein injection of a non-targeting siRNA.

[0187] FIG. 18 shows ERG results after GTP injections in IMPDH/ mice. Rod responses in a wild-type C-57 mouse were observed to be approximately 793 uV in both the left eye and the right eye. In an 11 month old IMPDH/ however, the rod responses were observed to be 50.8 uV and 2.48 uV in the right eye and left eye respectively. Following suppression of claudin-5 however, and injection of GTP at the point of doing a subsequent ERG, the rod tracings were shown to increase significantly, giving b-waves of 193 uV and 121 uV respectively for the right and left eyes. This increase in rod response were observed in a further 3 IMPDH/ mice post-suppression of claudin-5 and injection of GTP.

[0188] FIG. 19 shows the results of Western blot analysis of occludin expression following hydrodynamic tail vein delivery of occludin siRNA. Levels of expression of occludin were shown to decrease 24 hours post injection of occludin siRNA (4) and to a lesser extent with occludin siRNA (2). However, 48 hours post injection of occludin siRNA (1) and occludin siRNA (2), levels of occludin expression were significantly decreased compared to mice receiving an injection of a non-targeting siRNA.

[0189] FIG. 20 shows the results of Occludin immunohistochemistry following hydrodynamic delivery of occludin siRNA. The continuous pattern of staining of occludin in the brain microvasculature was observed to be disrupted 24 hours post-injection of occludin siRNAs. This discontinuous pattern of staining was also evident at the 48 hour time-point for occludin siRNAs (1) and (2). However the pattern of staining 48 hours post-injection of occludin siRNAs (3) and (4) had returned to levels similar to those observed in the non-targeting controls.

[0190] FIG. 21 shows the results of Albumin immunohistochemistry following suppression of occluding. Immunohistochemical analysis of albumin in brain vibratome sections revealed extravascular albumin 24 hours post-injection of siRNAs numbered (3) and (4). This suggests that 24 hours post siRNA injection, the paracellular pathway has been compromised enough to allow for the passage of molecules up to 70 kDa cross the BBB. Blue staining with Hoechst perfusion gives evidence for BBB compromise to a molecule of 562 Da.

[0191] FIG. 22 shows the results of immunoglobulin staining in brain vibratome sections following suppression of occluding. Staining of mouse brain sections for mouse immunoglobulins following suppression of occludin revealed no passage of IgG's into the brain. Mouse IgGs have a molecular weight of approximately 150000 Da and it is clear that they are still excluded from the brain when occludin is suppressed.

[0192] FIG. 23 shows the results of Western blot analysis of claudin-1 expression following hydrodynamic tail vein delivery of claudin-1 siRNA. Following hydrodynamic tail vein delivery of siRNA targeting claudin-1, it was observed that 24 hours post-injection, levels of claudin-1 were decreased when using siRNAs (2) and (4). This suppression was only evident in claudin-1 siRNA (4) at the 48 hour time point post-injection and although not evident at the 24 hour time-point for claudin-1 siRNA (1), this particular siRNA did significantly decrease claudin-1 expression 48 hours post injection.

[0193] FIG. 24 shows the results of Hoechst (562 Da) and FD-4 (4,400 Da) perfusion 24 and 48 hours post hydrodynamic tail vein delivery of claudin-1 siRNA. Following delivery of a range of siRNAs targeting claudin-1, a mixture of Hoechst and FD-4 were perfused in mice and vibratome sections of the brains were prepared. It was evident that in all claudin-1 siRNAs used, there was evidence of diffusion of Hoechst from the microvessels of the brain as the surrounding neuronal cells were clearly fluorescing blue when compared to the non-targeting control mice at the same time points. In all cases, FD-4 was observed to remain within the vessels.

[0194] FIG. 25 shows the position of one of the Claudin-5 siRNA used in the experiments (siRNA anti-sense sequence5-AGACCCAGAAUUUCCAACGUU-3 corresponding to SEQ ID No. 2), in the Mus musculus Claudin-5 mRNA. The target sequence for this siRNA in the Mus musculus Claudin-5 mRNA differs from 5-AACGTTGGAAATTCTGGGTCT-3 (SEQ ID NO: 43) in that the AA on the 5 end is replaced by AG in the Mus musculus Claudin-5 mRNA.

[0195] FIG. 26 shows T1-weighted MRI images of the Hippocampal region of the mouse brain 48 hours post-delivery of siRNA targeting claudin-5 clearly shows enhanced contrasting within the brain as Gd-DTPA extravasates from brain microvessels. Gd-DTPA has a molecular weight of 742 Daltons, and its permeation into the brain was only observed at 24 and 48 hours post delivery of siRNA.

[0196] FIG. 27 shows MRI information related to blood flow/volume changes within the brains of mice 24 and 48 hours post-high volume tail vein injection of siRNA targeting claudin-5. This data gives information on two things, the mean transit time (MTT) and capillary transit time (CTT). The MTT represents the time taken for the labelled spins to travel from the labelling plane (carotid artery 1 cm from imaging slice) to the imaging slice.

[0197] FIG. 28 shows the theoretical model for cerebral blood flow and cerebral blood volume fitted to the experimental data for each experimental group tested group. These are almost exactly the same for each group which agrees with the findings of the histograms presented in FIG. 27.

[0198] FIG. 29 shows the B-values (x-axis) plotted above with MRI signal intensity (y-axis) show no change in the rate of water diffusion in the brains of mice at 24 and 48 hours post injection of a non-targeting siRNA or siRNA targeting claudin-5. This constant rate of water diffusion from the brain to the blood suggests that the transient BBB opening in itself does not have any profound impact on water diffusion in the brains of mice.

[0199] FIG. 30 shows the results after hydrodynamic tail vein injection of siRNA targeting claudin-12. The pattern of claudin-12 staining was observed to be associated with the brain microvasculature 48 hours post-injection of a non-targeting control siRNA. However, 48 hours post-injection of siRNA targeting claudin-12, levels of expression at the microvessels of the brain were shown to be decreased in both siRNAs tested (i.e., CLDN12 siRNA (3) and CLDN12 siRNA (4)).

[0200] FIG. 31 shows the results following hydrodynamic tail vein injection of a non-targeting siRNA or siRNA targeting claudin-12. Mice were perfused through the left ventricle with a solution containing FITC-dextran-4 and Hoechst 33342 (562 Da). It was observed that following injection of siRNA targeting claudin-12, there was extravasation of Hoechst from the microvasculature as evidenced by staining of the extravascular nuclei. FD-4 was observed in the microvessels and in both the non-targeting siRNA and following injection of siRNA targeting claudin-12.

EXAMPLES

Example 1: In Vivo Suppression of Claudin-5 Expression at the Blood Brain Barrier of C57/Bl-6 Mice Using Systemic Hydrodynamic Tail Vein Delivery of siRNA Targeting Claudin-5

Materials

[0201] Web-Based siRNA Design Protocols Targeting Claudin-5

[0202] siRNAs were selected targeting conserved regions of the published cDNA sequences. To do this, cDNA sequences from mouse were aligned for the Claudin-5 gene and regions of perfect homology subjected to updated web-based protocols (Dharmacon, Ambion, Genescript) originally derived from criteria as outlined by Reynolds et al., (2004). Sequences of the claudin-5 siRNA used in this study were as follows:

TABLE-US-00005 Sensesequence: (SEQIDNO.1) CGUUGGAAAUUCUGGGUCUUU Antisensesequence: (SEQIDNO.2) AGACCCAGAAUUUCCAACGUU

[0203] Non-targeting control siRNA targeting human rhodopsin was used as a non-targeting control since rhodopsin is only expressed in photoreceptor cells in the retina and at low levels in the pineal gland of the brain (O'Reilly, M et al., 2007):

TABLE-US-00006 Sensesequence: (SEQIDNO.44) CGCUCAAGCCGGAGGUCAA Antisensesequence: (SEQIDNO.45) UUGACCUCCGGCUUGAGCG

Protocol

[0204] In Vivo Delivery of siRNA to Murine BBB by Large Volume Hydrodynamic Injection and Subsequent RNA and Protein Analyses

[0205] Rapid high pressure, high volume tail vein injections were carried out (Kiang et al., 2005). Wild type C57/Bl6 mice of weight 20-30 g were individually restrained inside a 60-ml volume plastic tube. The protruding tail was warmed for 5 minutes prior to injection under a 60-W lamp and the tail vein clearly visualized by illumination from below. 20 micrograms of targeting siRNA, or non-targeting siRNA made up with PBS to a volume in mls of 10% of the body weight in grams or PBS alone, was injected into the tail vein at a rate of 1 ml/sec using a 26-gauge (26G 3/8) needle. After 24, 48, 72 hours and 1 week, protein was isolated from total brain tissue by crushing brains to a fine powder in liquid N.sub.2 and subsequently using lysis buffer containing 62.5 mM Tris, 2% SDS, 10 mM Dithiothreitol, 10 l protease inhibitor cocktail/100 ml (Sigma Aldrich, Ireland). The homogenate was centrifuged at 10,000 g for 20 mins @ 4 C., and the supernatant was removed for claudin-5 analysis.

[0206] Briefly, protein samples were separated on 12% SDS-PAGE gels and transferred to nitrocellulose membrane overnight using a wet electroblot apparatus. Efficiency of protein transfer was determined using Ponceau-S solution (Sigma Aldrich, Ireland). Non-specific binding sites were blocked by incubating the membrane at room temperature with 5% non-fat dry skimmed milk in Tris-buffered saline (TBS) (0.05 M Tris, 150 mM NaCl, pH 7.5) for 2 hours. Membranes were briefly washed with TBS, and incubated with polyclonal rabbit anti-claudin-5 (Zymed Laboratories, San Francisco, Calif.) (1:500) or polyclonal rabbit anti--actin (Abcam, Cambridge, UK) (1:1000). Antibodies were incubated with membranes overnight at 4 C. Membranes were washed with TBS, and incubated with a secondary anti-rabbit (IgG) antibody with Horse-Radish-Peroxidase (HRP) conjugates (1:2500), for 3 hours at room temperature. Immune complexes were detected using enhanced chemiluminescence (ECL).

[0207] At the same time points post-delivery of siRNA total RNA was isolated from brains using Trizol (Invitrogen). RNA was then treated with RNase-free DNase (Promega, Madison, Wis., USA) and then chloroform extracted, isopropanol precipitated, washed with 75% RNA grade ethanol and resuspended in 100 l RNase-free water.

Real-Time RT-PCR Analysis

[0208] RNA was analyzed by real-time RT-PCR using a Quantitect Sybr Green Kit as outlined by the manufacturer (Qiagen-Xeragon) on a LightCycler (Roche Diagnostics, Lewes, UK) under the following conditions: 50 C. for 20 min; 95 C. for 15 min; 38 cycles of 94 C. for 15 s, 57 C. for 20 s, 72 C. for 10 s.

[0209] Primers (Sigma-Genosys, Cambridge, UK) for the sequences amplified were as follows

TABLE-US-00007 CLDN5 Forward (SEQIDNO.46) 5-TTTCTTCTATGCGCAGTTGG-3 Reverse (SEQIDNO.47) 5-GCAGTTTGGTGCCTACTTCA-3 -actin Forward (SEQIDNO.48) 5-TCACCCACACTGTGCCCATCTA-3 Reverse (SEQIDNO.49) 5-CAGCGGAACCGCTCATTGCCA-3

[0210] cDNA fragments were amplified from claudin-5 and -actin for each RNA sample a minimum of four times. Results were expressed as a percentage of those from the similarly standardized appropriate control experiment. The reciprocal values compared to the non-targeting control siRNA gave percentage suppression of claudin-5 expression. Mean values, standard deviations, and pooled t tests were calculated using GraphPad Prism. Differences were deemed statistically significant at P<0.05.

Indirect Immunostaining for Claudin-5 using Confocal Laser Scanning Microscopy (CLSM) for Analysis

[0211] Brain cryosections were blocked with 5% Normal Goat Serum (NGS) in PBS for 20 mins at room temperature. Primary antibody (Rabbit anti-Claudin-5, Zymed, California) was incubated on sections overnight at 4 C. Following this incubation, sections were washed 3 times in PBS and subsequently blocked again with 5% NGS for 20 mins at room temperature. A secondary rabbit IgG-Cy3 antibody was incubated with the sections at 37 C. for 2 hours followed by 3 washes with PBS. All sections were counterstained with DAPI for 30 seconds at a dilution of 1:5000 of a stock 1 mg/ml solution. Analysis of stained sections was performed with an Olympus FluoView TM FV1000 Confocal microscope.

Assessment of BBB Integrity by Perfusion of a Biotinylated Tracer Molecule

[0212] Following RNAi-mediated ablation of transcripts encoding claudin-5, a tracer molecule was used to determine the extent to which the TJ's of the BBB had been affected. The biotinylated reagent EZ-Link TM Sulfo-NHS-Biotin (Pierce) (1 ml/g body weight of 2 mg/ml EZ-Link TM Sulfo-NHS-Biotin, 443 Da) was perfused for 5 minutes through the left ventricle of mice 24, 48, 72 hours and 1 week post-hydrodynamic delivery of claudin-5 siRNA. Following perfusion with the tracer molecule, the whole brain was dissected and placed in 4% PFA pH 7.4 overnight at 4 C. and subsequently washed 415 mins with PBS. Following cryoprotection with sucrose, frozen sections were cut on a cryostat at 20 C. and incubated with streptavidin conjugated to the fluorescent probe FITC. This allowed for the assessment of leakage of the biotinylated reagent of molecular weight 443 Da from the microvessels of the brain. All sections were counterstained with 4, 6-diamidine-2-phenylindole-dihydrochloride (DAPI; Sigma Aldrich, Ireland) for 30 seconds at a dilution of 1:5000 of a stock 1 mg/ml solution, and sections were visualized using an Olympus FluoView TM FV1000 Confocal microscope.

Assessment of BBB/BRB Permeability to Molecules of 562 Daltons and 4,400 Daltons

[0213] In order to determine the permeability of brain and retinal microvessels to a molecule of 562 Daltons, mice were perfused through the left ventricle with 500 l/g body weight of PBS containing 100 g/ml Hoechst stain H33342 (Sigma Aldrich, Ireland) and 1 mg/ml FITC-Dextran-4 (FD-4) 24, 48, 72 hours and 1 week post-hydrodynamic delivery of claudin-5 siRNA. Following perfusion, the whole brain was dissected and placed in 4% PFA pH 7.4 overnight at 4 C. and subsequently washed 415 mins with PBS. Brains were then embedded in 4% agarose and 50 m sections were cut using a Vibratome. Whole eyes were removed and fixed with 4% PFA, and following washing with PBS and cryoprotection using a sucrose gradient, 12 m cryosections were cut using a cryostat. Following analysis of retinal cryosections with an Olympus FluoView TM FV1000 Confocal microscope, images were oriented correctly using Adobe Photoshop.

Magnetic Resonance Imaging

[0214] Following injection of siRNA and using appropriate controls, BBB integrity was assessed in vivo via MRI, using a dedicated small rodent Bruker BioSpec 70/30 (i.e. 7T, 30 cm bore) with an actively shielded USR Magnet. Mice were anaesthetised with isofluorane, and physiologically monitored (ECG, respiration and temperature) and placed on an MRI-compatible support cradle, which has a built-in system for maintaining the animal's body temperature at 37 C. The cradle was then positioned within the MRI scanner. Accurate positioning is ensured by acquiring an initial rapid pilot image, which is then used to ensure the correct geometry is scanned in all subsequent MRI experiments. Upon insertion into the MRI scanner, high resolution anatomical images of the brain were acquired (100 m in-plane and 500 m through-plane spatial resolution). BBB integrity was then visualised in high resolution T.sub.1 weighted MR images before and after injection of a 0.1 mM/L/kg bolus of Gd-DTPA (Gadolinium diethylene-triamine pentaacetic acid), administered via the tail vein.

Electroretinographic Analysis of IMPDH/ Mice and GTP Injection

[0215] IMPDH/ mice that had received a hydrodynamic injection of siRNA targeting claudin-5 were dark-adapted overnight and prepared for electroretinography under dim red light. Pupillary dilation was carried out by installation of 1% cyclopentalate and 2.5% phenylephrine. Animals were anesthetized by intraperitoneal injection of ketamine (2.08 mg per 15 g body weight) and xylazine (0.21 mg per 15 g body weight). Once the animal was anaesthetized, GTP was injected intraperitoneally. The ERG commenced ten minutes after administration of anesthetic. Standardised flashes of light were presented to the mouse in a Ganzfeld bowl to ensure uniform retinal illumination. The ERG responses were recorded simultaneously from both eyes by means of gold wire electrodes (Roland Consulting Gmbh) using Vidisic (Dr Mann Pharma, Germany) as a conducting agent and to maintain corneal hydration. The eye was maintained in a proptosed position throughout the examination by means of a small plastic band placed behind the globe. Reference and ground electrodes were positioned subcutaneously, approximately 1 mm from the temporal canthus and anterior to the tail respectively. Body temperature was maintained at 37 C. using a heating device controlled by a rectal temperature probe. Responses were analysed using a RetiScan RetiPort electrophysiology unit (Roland Consulting Gmbh). The protocol was based on that approved by the International Clinical Standards Committee for human electroretinography.

Immunohistochemical Analysis of Flatmounted Retinas

[0216] Whole eyes were fixed for 4 hours in 4% paraformaldehyde followed by 3 washes with phosphate buffered saline (PBS). Retinas were dissected out of the eyes and blocked/permeabilised by incubation with PBS containing 0.5% Triton X-100 and 5% normal goat serum (NGS). Retinas were subsequently incubated overnight in permeabilisation buffer containing 1% NGS and a 1:50 dilution of Rabbit anti-claudin-5 antibody (Zymed). Following 10 washes with PBS over a period of 2 hours, retinas were incubated for 6 hours at room temperature with a rabbit IgG antibody conjugated with the fluorescent probe Cy-3. Following 10 washes with PBS over a period of 2 hours, retinas were flatmounted and viewed using a confocal microscope.

Endothelial Cell Morphology of Major Organs

[0217] Following hydrodynamic injection of siRNA targeting claudin-5, cryosections were prepared of all the major organs, the heart, liver, lung and kidney. Sections were incubated overnight at 4 C. with HRP-conjugated Griffonia simplicifolia-isolectin B4 in order to stain the endothelial cells of organs.

Results

[0218] Hydrodynamic Tail Vein Injection of CLDN5 siRNA Attenuates Claudin-5 Expression

[0219] Following delivery of 20 g claudin-5 siRNA, mice were left for 24, 48, 72 hours and 1 week, after which time brains were dissected and protein and RNA isolated as described previously. After 24 hours, levels of expression of Claudin-5 were markedly decreased when compared to Control (Un-injected), PBS injected and Non-targeting (Rhodopsin) controls. Mice injected with CLDN5 siRNA and subsequently left for 48 hours also showed significant decreases in Claudin-5 expression when compared to the controls employed. At 72 hours post-injection, this observed decrease in Claudin-5 expression was less evident, and levels of expression appeared similar to those observed in the control groups. One week post injection of claudin-5 siRNA, levels of expression of claudin-5 were similar to those in the control groups of animals. All blots are representative of at least 3 separate experiments (FIG. 1A).

[0220] Levels of claudin-5 mRNA were determined by RT-PCR analysis and showed a significant decrease 24 hours post-injection of siRNA targeting claudin-5. This highly significant decrease was not observed at the later time points, and showed claudin-5 mRNA levels suppressed up to 95% with respect to the non-targeting control siRNA (FIG. 1 B). Levels of claudin-5 mRNA 48 hours, 72 hours and 1 week post injection were similar to those observed in the control groups (FIG. 1B).

Claudin-5 Expression and Localisation Becomes Altered in Brain Capillary Endothelial Cells Following Injection of Claudin-5 siRNA

[0221] The level of expression of claudin-5 at the TJ in brain capillary endothelial cells changed dramatically following suppression of claudin-5 expression. As shown in FIG. 2, immunohistochemical analysis of claudin-5 expression and localisation in the microvessels of the brain which revealed a linear and distinct pattern of staining at the periphery of endothelial cells of the BBB in the un-injected, PBS injected and non-targeting control (Rhodopsin) mice at all time points after injection.

[0222] Claudin-5 expression was linear and intense at the periphery of endothelial cells lining the microvessels of the un-injected, PBS injected and non-targeting siRNA (Rhodopsin) injected control groups. However, 24 hours post injection of claudin-5 siRNA, this staining pattern appeared less intense, and by 48 hours post-injection there was a marked decrease in the presence of claudin-5 expression at the periphery of brain capillary endothelial cells throughout the brain when compared to un-injected, PBS-injected or non-targeting siRNA injected mice. At 72 hours post-injection, claudin-5 expression was still attenuated, yet a linear pattern of staining was evident in the cryosections (FIG. 2).

[0223] These results are representative of at least 5 separate experiments

Claudin-5 siRNA Causes Increased Permeability at the BBB

[0224] FIG. 5 shows the results of the assessment of the blood brain barrier integrity by perfusion of a biotinylated tracer molecule. EZ-Link TM Sulfo-NHS-Biotin was perfused through the left ventricle in mice following exposure to experimental conditions. Upon incubation of cryosections with streptavidin conjugated to the fluorescent probe FITC, the integrity of the BBB was observed as green fluorescence within the microvessels in the control groups (un-injected, PBS injected and a non-targeting siRNA. However, 24 hours post-injection of siRNA targeting claudin-5, it was observed that the fluorescence detected was diffuse and outside of the microvessels in contrast to the control groups at the same time point. At 48 hours post-injection of claudin-5 siRNA, the distribution of the biotinylated molecule was abundant in the brain parenchyma, while this permeability was still evident 72 hours post-delivery of siRNA when compared to the control groups at the same time points. In mice 1 week post-injection of siRNA targeting claudin-5, it was observed that the primary amine-reactive biotinylated reagent did not deposit in the parenchyma following perfusion for 5 minutes. The EZ-Link TM Sulfo-NHS-Biotin was observed to remain in the microvessels of the brain due to an intact BBB.

[0225] All tracer experiments were repeated in mice at least 5 times.

[0226] In summary, upon delivery of siRNA targeting claudin-5 to brain capillary endothelial cells, an increase in permeability to a small biotinylated molecule (443 Da) was observed after 24 hours. The passage of this molecule across the BBB became very distinct 48 hours post-injection, with large quantities of EZ-Link TM Sulfo-NHS-Biotin infiltrating the parenchymal tissue of the brain. The passage of this molecule across the BBB was still evident 72 hours post-injection of claudin-5 siRNA, however 1 week post-injection, there was no evidence for BBB compromise and the EZ-Link TM Sulfo-NHS-Biotin was shown to remain within the microvessels of the brain (FIG. 5).

[0227] FIGS. 6A, and 6B show the results of the assessment of the blood brain barrier integrity by perfusion of a biotinylated tracer molecule at a high magnification. It was observed that upon perfusion of the primary amine reactive biotinylated reagent (443 Da) for 5 minutes 24 hours post-injection of siRNA targeting claudin-5 caused an infiltration of the molecule into the parenchyma of the brain when compared to the un-injected, PBS injected and non-targeting siRNA injected mice. This infiltration was detected in abundance 48 hours post-delivery of siRNA, and was still evidenced up to and including 72 hours following injection of claudin-5 siRNA. In mice 1 week post-injection of claudin-5 siRNA, it was observed that the EZ-Link TM Sulfo-NHS-biotin remained in the microvessels of the brain and failed to deposit in the parenchyma.

[0228] In summary, upon analysis of brain cryosections at a higher magnification in the dentate gyrus region of the hippocampus (for ease of recognition), it was apparent that 1 week post-injection of claudin-5 siRNA, the BBB did not allow for the passage of EZ-Link TM Sulfo-NHS-Biotin that was so clearly evidenced 48 hours post-injection of siRNA (FIGS. 6A and 6B).

Claudin-5 siRNA Causes Increased Permeability at the BBB and BRB to a Molecule of 562 Daltons

[0229] Intriguingly, upon perfusion of the nuclear stain Hoechst H33342 (562 Daltons) and the FITC labelled dextran, FD-4 (4,400 Daltons), extravasation of Hoechsct was observed up to and including 48 hours post-delivery of siRNA targeting claudin-5, however, unlike EZ-Link TM Sulfo-NHS-Biotin, this extravasation was not evident 72 hours post siRNA delivery, suggesting a restoration of barrier integrity to a molecule of 562 Daltons, and implying a time dependent and size-selective opening of the BBB. Hoechst H33342 dye extravasation from the brain microvessels was manifested by nuclear staining of surrounding neural and glial cells in the parenchyma. FD-4 remained within the microvessels of the brain vasculature and no extravasation was evident at any time point post-injection of siRNA (FIG. 6B).

[0230] Moreover, upon analysis of retinal cryosections, we observed that Hoechst H33342 extravasated from the retinal microvessels, staining the Inner Nuclear Layer (INL) and Outer Nuclear Layer (ONL) of the retina up to 48 hour post-delivery of siRNA targeting claudin-5 (FIG. 6A).

MRI Analysis Showed Impairment of BBB Integrity 48 Hours Post-Injection of Claudin-5 siRNA

[0231] FIG. 7A shows the results of an MRI Scan post injection to assess the blood brain barrier integrity in vivo. The magnetic resonance imaging (MRI) contrasting agent Gd-DTPA was used to ascertain BBB integrity in mice following ablation of claudin-5 transcripts. At 48 hours post-injection of claudin-5 siRNA, it was observed that Gd-DTPA crossed the BBB and was deposited in the parenchymal tissue of the brain. The image to the left of the figure is the contrasting of the mouse brain before injection of Gd-DTPA, while the image to the right is the contrasting of the mouse brain following injection of Gd-DTPA. The images are taken coronally moving from the ventral aspect of the brain to the dorsal aspect, and reveal significant deposition of Gd-DTPA (742 Da) in the parenchyma 48 hours post-injection of siRNA targeting claudin-5.

[0232] This infiltration of the contrasting agent was not present in the un-injected, PBS injected or non-targeting siRNA injected mice, nor was it present in mice 72 hours or 1 week post-injection of siRNA targeting claudin-5.

[0233] In summary, infiltration of Gd-DTPA into the brain parenchymal tissue was observed as widespread and intense contrasting throughout the brain when compared to un-injected, PBS injected and non-targeting siRNA injected mice, indicating that the BBB was compromised enough to allow for the passage of a molecule of 742 Da in size. MRI scans on mice 72 hours and 1 week post-injection of claudin-5 siRNA revealed an intact barrier with no deposition of Gd-DTPA in the parenchymal tissue, highlighting this BBB disruption as a transient event (FIG. 7A).

Conclusion

[0234] As shown in Example 1, the hydrodynamic approach for delivery of siRNA's to endothelial cells of the brain microvasculature is highly efficient in suppressing claudin-5 expression (FIGS. 1A and 1B). This method of delivery caused little harm and was well tolerated in mice. The Western data showed that maximum suppression of claudin-5 was achieved 48 hours after delivery of the siRNA, with levels of expression of claudin-5 returning to normal between 72 hours and 1 week after injection. Thus, the reversible RNAi-mediated opening of the BBB using siRNA targeting claudin-5 is now possible.

[0235] It was then determined whether similar to the claudin-5 knockout mouse, the BBB became compromised to small molecules when claudin-5 expression was suppressed. At the periphery of endothelial cells in the brain microvasculature, levels of claudin-5 appeared strong and linear-like upon immunohistochemical analysis of all the control groups employed. However, when claudin-5 was targeted, this linear appearance of expression became discontinuous and fragmented, with levels appearing dramatically reduced 48 hours after injection of claudin-5 siRNA (FIG. 2). Moreover, upon perfusion of mice with the biotinylated molecule EZ-Link TM Sulfo-NHS-Biotin for 5 minutes, a significant compromise in barrier function was observed up to and including 72 hours post delivery of siRNA targeting claudin-5. EZ-Link TM Sulfo-NHS-Biotin has a molecular weight of 443 Da, and will normally not cross the BBB if the TJ's are intact as observed in the control groups. Interestingly, 1 week after delivery of claudin-5 siRNA, this molecule no longer crossed the BBB, suggesting that consistent with Real-Time PCR and Western analyses, this compromise in BBB function is a transient and reversible process.

[0236] During this study, no distinct or noticeable behavioural changes in these mice, while the gross histology of both vibratome and cryosections of the brain appeared normal under all experimental conditions.

[0237] Similar to claudin-5 knockout mouse, the MRI contrasting agent Gd-DTPA was also found to cross the BBB and deposit in the parenchymal tissue of the brain post siRNA injection. In fact extremely large quantities of Gd-DTPA were deposited in the brain 48 hours post delivery of claudin-5 siRNA. This BBB breakage to a molecule of 742 Da was a transient event, as 72 hours and 1 week post injection of siRNA targeting claudin-5, there appeared to be no deposition of Gd-DTPA. The significance of these results was that as well as being a transient event, suppression of claudin-5 appeared to be causing a size-selective change in the permeability of the barrier, as evidenced from the observation that while a molecule of 443 Da crossed the BBB 72 hours post delivery of siRNA, a molecule of 742 Da failed to do so at the same time point (FIG. 7A), and a molecule of 562 Da crossed the BBB at 24 and 48 hours post delivery of siRNA while a molecule of 4,400 Da failed to do so (FIGS. 6A and 6B).

[0238] As siRNA was administered via the tail vein, and given the fact that claudin-5 is expressed in microvascular endothelial cells of the lung and the heart, we wished to assess whether siRNA targeting claudin-5 would adversely affect endothelial cell morphology in the liver, lung, kidney or heart. Cryosections of each of these organs were prepared at all time points following injection of siRNA targeting claudin-5 and incorporating the appropriate controls. Sections were stained with HRP-conjugated Griffonia simplicifolia-isolectin B4, which binds to intact endothelial cells, and showed that endothelial cell morphology appeared similar at all time points and in all major organs following siRNA injection when compared to the control groups (FIGS. 9-12). The role of claudin-5 in organs other than the brain and eye has not been well characterised, and it is important to note that it does not appear to be fundamental in maintaining the size-selective properties of the tight junctions associated with these other organs.

[0239] In conclusion, it is now possible to systemically deliver siRNA molecules to the endothelial cells of the BBB and BRB. Targeted suppression of the TJ protein claudin-5 causes both a transient and size-selective increase in paracellular permeability of the barrier, which may allow for the delivery of molecules which would otherwise be excluded from the brain.

Example 2: Delivery of Thyrotropin Releasing Hormone (TRH) Across the Blood Brain Barrier (BBB) to Claudin-5 Suppressed Mice

Materials and Methods

Thyrotropin Releasing Hormone (TRH) (Sigma Aldrich, Ireland)

[0240] TRH has been proposed as having distinct neuroprotective effects. It also induces wet dog shake behavioural outputs when administered to rats. However, TRH has several disadvantages, including its instability and resulting short duration of action and its slow permeation across the BBB.

Delivery of TRH to Claudin-5 Suppressed Mice

[0241] The protocol of Example 1 was followed to produce transiently claudin-5 suppressed mice.

[0242] 48 hours post-delivery of siRNA targeting claudin-5 or a non-targeting siRNA, a 200 l of a solution containing 20 mg/kg Thyrotropin Releasing Hormone (TRH) was injected to the claudin-5 suppressed mice. TRH was injected in the tail vein and immediately, the behavioural output of mice was assessed by filming them in a clear Perspex box.

Results and Conclusion

[0243] As shown in FIG. 8, following ablation of claudin-5 protein, a distinct increase in the length of time C57/Bl6 mice remain immobile upon administration of 20 mg/kg TRH was observed.

[0244] This behavioural output was significantly different from the behaviour observed in the non-targeting control mice, and clearly suggested that delivery of TRH was significantly enhanced when the BBB was compromised.

[0245] These results show that the protocol of Example 1 can be used to open the BBB to allow delivery of compositions to the BBB which previously would not have been possible. These results clearly suggest that delivery of TRH (359.5 Da) was significantly enhanced when the BBB was reversibly, transiently opened in a controlled size selective manner.

Example 3

[0246] In Vivo Suppression of Claudin-1 Expression at the Blood Brain Barrier of C57/Bl-6 Mice Using Systemic Hydrodynamic Tail Vein Delivery of siRNA Targeting Claudin-1

Materials

[0247] Web-Based siRNA Design Protocols Targeting Claudin-1

TABLE-US-00008 CLDN1(1)targetsequence: (SEQIDNO.32): GCAAAGCACCGGGCAGAUA Sensesequence: (SEQIDNO.9) AUAGACGGGCCACGAAACGUU Anti-sensestrand: (SEQIDNO.10) CGUUUCGUGGCCCGUCUAUUU CLDN1(2)targetsequence: (SEQIDNO.33) GAACAGUACUUUGCAGGCA: Sensestrand: (SEQIDNO.11) ACGGACGUUUCAUGACAAGUU Anti-sensestrand: (SEQIDNO.12) CUUGUCAUGAAACGUCCGUUU CLDN1(4)targetsequence: (SEQIDNO.34): UUUCAGGUCUGGCGACAUU Sensesequence: (SEQIDNO.13) UUACAGCGGUCUGGACUUUUU Anti-sensestrand: (SEQIDNO.14) AAAGUCCAGACCGCUGUAAUU

Methods

[0248] The protocols used were identical to the protocols used in Example 1.

Results and Conclusions

[0249] Results are shown in FIGS. 3A, 23 and 24.

[0250] This example shows that siRNA directed against claudin-1 causes an increase in paracellular permeability at the BBB to a molecule of 562 Daltons but not 4,400 Daltons. Suppression of claudin-1 appears to cause a size-selective opening of the BBB in a manner similar to that observed when claudin-5 was suppressed.

Example 4

[0251] In Vivo Suppression of Occludin Expression at the Blood Brain Barrier of C57/BL-6 Mice Using Systemic Hydrodynamic Tail Vein Delivery of siRNA Targeting Occludin

Materials

[0252] Web-Based siRNA Design Protocols Targeting Occludin

TABLE-US-00009 Occl(1)targetsequence: (SEQIDNO.35): GUUAUAAGAUCUGGAAUGU Sensesequence: (SEQIDNO.15) UGUAAGGUCUAGAAUAUUGUU Anti-sensesequence: (SEQIDNO.16) CAAUAUUCUAGACCUUACAUU Occl(2)targetsequence: (SEQIDNO.36): GAUAUUACUUGAUCGUGAU Sensesequence: (SEQIDNO.17) UAGUGCUAGUUCAUUAUAGUU Anti-sensesequence: (SEQIDNO.18) CUAUAAUGAACUAGCACUAUU Occl(3)targetsequence: (SEQIDNO.37): CAAAUUAUCGCACAUCAAG Sensesequence: (SEQIDNO.19) GAACUACACGCUAUUAAACUU Anti-sensesequence: (SEQIDNO.20) GUUUAAUAGCGUGUAGUUCUU Occl(4)targetsequence: (SEQIDNO.38): AGAUGGAUCGGUAUGAUAA Sensesequence: (SEQIDNO.21) AAUAGUAUGGCUAGGUAGAUU Anti-sensesequence: (SEQIDNO.22) UCUACCUAGCCAUACUAUUUU

Methods

[0253] The protocols used were identical to the protocols used in Example 1.

Results and Conclusions

[0254] Results are shown in FIGS. 3B, 19, 20, 21 and 22

[0255] This example shows that siRNA directed against Occludin causes an increase in paracellular permeability at the BBB to molecules greater than 70,000 Daltons, as this is the approximate weight of albumin. Suppression of occludin at the BBB does produce a larger size-exclusion limit however. It was observed that while albumin deposition occurred 24 hours post-injection of occludin siRNAs 3 & 4, there was no extravasation of immunoglobulins (IgGs) in the blood. IgG's have an approximate molecular weight of 120,000 daltons.

Example 5

[0256] In Vivo Suppression of Claudin 12 Expression at the Blood Brain Barrier of C57/BL-6 Mice Using Systemic Hydrodynamic Tail Vein Delivery of siRNA Targeting Claudin-12

Materials

[0257] Web-Based siRNA Design Protocols Targeting Claudin 12

TABLE-US-00010 CLDN12SIRNA(3)Targetsequence: (SEQIDNO.41) GUAACACGGCCUUCAAUUC (SEQIDNo.28) 5-GUAACACGGCCUUCAAUUCUU-3 (SEQIDNo.29) 5-GAAUUGAAGGCCGUGUUACUU-3 CLDN12SIRNA(4)Targetsequence: (SEQIDNO.42) GGUCUUUACCUUUGACUAU (SEQIDNo.30) 5-AAUCUUUACCUUUGACUAUUU-3 (SEQIDNo.31) 5-AUAGUCAAAGGUAAAGAUUUU-3

Methods

[0258] The protocols used were identical to the protocols used in Example 1.

Results and Conclusions

[0259] Claudin-12 levels were shown to decrease following hydrodynamic tail vein injection of siRNA targeting claudin-12 (FIG. 12). The pattern of claudin-12 staining was observed to be associated with the brain microvasculature 48 hours post-injection of a non-targeting control siRNA. However, 48 hours post-injection of siRNA targeting claudin-12, levels of expression at the microvessels of the brain were shown to be decreased in both siRNAs tested (i.e., CLDN12 siRNA (3) and CLDN12 siRNA (4)).

[0260] Following hydrodynamic tail vein injection of a non-targeting siRNA or siRNA targeting claudin-12, mice were perfused through the left ventricle with a solution containing FITC-dextran-4 and Hoechst 33342 (562 Da). It was observed that following injection of siRNA targeting claudin-12, there was extravasation of Hoechst from the microvasculature as evidenced by staining of the extravascular nuclei. FD-4 was observed in the microvessels and in both the non-targeting siRNA and following injection of siRNA targeting claudin-12 (FIG. 31).

Example 6

[0261] Gd-DTPA 48 Hours Post-Delivery of siRNA Targeting Claudin-5

Materials and Methods

[0262] The protocol of Example 1 was followed to produce transiently claudin-5 suppressed mice. 48 hours post-delivery of siRNA targeting claudin-5 or a non-targeting siRNA, a solution containing Gd-DTPA injected to the claudin-5 suppressed mice. Gd-DTPA was injected in the tail vein to assess whether Gd-TPA would permeate across the BBB. Following injection of siRNA and using appropriate controls, BBB integrity to a molecule of 742 Daltons (Gd-DTPA) was assessed via MRI, using a dedicated small rodent Bruker BioSpec 70/30 (i.e. 7T, 30 cm bore) with an actively shielded USR Magnet. Mice were anaesthetised with isofluorane, and physiologically monitored (ECG, respiration and temperature) and placed on an MRI-compatible support cradle, which has a built-in system for maintaining the animal's body temperature at 37 C. The cradle was then positioned within the MRI scanner. Accurate positioning is ensured by acquiring an initial rapid pilot image, which is then used to ensure the correct geometry is scanned in all subsequent MRI experiments. Upon insertion into the MRI scanner, high resolution anatomical images of the brain were acquired (100 m in-plane and 500 m through-plane spatial resolution). BBB integrity was then visualised in high resolution T.sub.1 weighted MR images before and after injection of a 0.1 mM/L/kg bolus of Gd-DTPA (Gadolinium diethylene-triamine pentaacetic acid), administered via the tail vein. Following injection of Gd-DTPA, repeated 3 minute T.sub.1-weighted scans were performed over a period of 30 minutes, and images shown are representative of the final scans of this 30 minute period. Statistical analysis of all densitometric results of combined regions of the Cerebellum, Hippocampus and Cortex was performed using ANOVA, with significance represented by a P value of 0.05, and results are presented both graphically and in a quantitative image depicting the rate of Gd-DTPA deposition within the brain. All MRI scans were performed on 2 mice from each experimental treatment.

Results

[0263] FIG. 26 shows T1-weighted MRI images of the Hippocampal region of the mouse brain 48 hours post-delivery of siRNA targeting claudin-5 clearly shows enhanced contrasting within the brain as Gd-DTPA extravasates from brain microvessels. Gd-DTPA has a molecular weight of 742 Daltons, and its permeation into the brain was only observed at 24 and 48 hours post delivery of siRNA.

[0264] FIG. 27 shows MRI information related to blood flow/volume changes within the brains of mice 24 and 48 hours post-high volume tail vein injection of siRNA targeting claudin-5. This data gives information on two things, the mean transit time (MTT) and capillary transit time (CTT). The MTT represents the time taken for the labelled spins to travel from the labelling plane (carotid artery 1 cm from imaging slice) to the imaging slice.

[0265] This is calculated from the first moment or mean of the curve. From the second moment of the curve (variance) we get the CTT, which is the time taken for the labelled spins to be distributed over the imaging slice by exchange from capillary bed to tissue. With up to 8 animals per group, we are seeing no significant differences in blood flow within the major vessels in the brain or the capillaries, which is quite promising given the high volume of injection required to deliver claudin-5 siRNA to brain microvascular endothelial cells.

[0266] FIG. 28 shows the theoretical model for cerebral blood flow and cerebral blood volume fitted to the experimental data for each experimental group tested group. These are almost exactly the same for each group which agrees with the findings of the histograms presented in FIG. 27.

Conclusion

[0267] In conclusion, these results show that we are not observing any difference in blood flow or blood volume in the large vessels in the brain or in the microvasculature and suggests that in cases of cerebral oedema, claudin-5 siRNA may in fact allow for an increased rate water diffusion at the site of injury in the brain.

Example 7

[0268] Water Diffusion in the Brains of Mice 24 and 48 Hours after Receiving Non-Targeting or Claudin-5 siRNA

Materials and Methods

[0269] The protocol of Example 1 was followed to produce transiently claudin-5 suppressed mice.

[0270] 24 and 48 hours post-delivery of siRNA targeting claudin-5 or a non-targeting siRNA mice were anaesthetised with isofluorane, and physiologically monitored (ECG, respiration and temperature) and placed on an MRI-compatible support cradle, which has a built-in system for maintaining the animal's body temperature at 37 C. The cradle was then positioned within the MRI scanner. Accurate positioning is ensured by acquiring an initial rapid pilot image, which is then used to ensure the correct geometry is scanned in all subsequent MRI experiments. Upon insertion into the MRI scanner, high resolution anatomical images of the brain were acquired (100 m in-plane and 500 m through-plane spatial resolution). Water diffusion scans were subsequently undertaken. Using a standard diffusion imaging sequence such as a spin-echo EPI imaging sequence with diffusion gradients (Stejskal-Taner gradients) in order to acquire images over a large range of b-values. In this way, the effect of the technique in the vascular compartment and in the brain parenchymal tissue can be compared. All experiments were carried out on a 7T Brker small-bore system with 400 mT/m maximum gradient strength. Image processing and calculation of ADCs was carried out using IDL.

Results

[0271] FIG. 29 shows the B-values (x-axis) plotted above with MRI signal intensity (y-axis) show no change in the rate of water diffusion in the brains of mice at 24 and 48 hours post injection of a non-targeting siRNA or siRNA targeting claudin-5. This constant rate of water diffusion from the brain to the blood suggests that the transient BBB opening in itself does not have any profound impact on water diffusion in the brains of mice.

[0272] In conclusion, the results shown in FIG. 30 show the rates of water diffusion in the brains of mice 24 and 48 hours after receiving non-targeting or claudin-5 siRNA. Essentially, there are no changes in diffusion in any mice under these experimental conditions. This is another important observation and as Example 6 also suggests that in cases of cerebral oedema, claudin-5 siRNA may in fact allow for an increased rate of water diffusion at the site of injury in the brain.