Wheat With New Alleles of RHT-B1

20210040497 ยท 2021-02-11

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention provides a wheat plant comprising an Rht-B1 allele which encodes an Rht-B1 (DELLA) polypeptide. Grain from a near-isogenic wheat line comprising the dwarfing Rht-B1c allele was subjected to sodium azide mutagenesis. Plants exhibiting early leaf elongation rates or mature plant height greater than the dwarf parent were selected and the Rht-B1 gene sequenced. This identified 35 mutated alleles of Rht-B1c. Similar methods were also used to identify mutant alleles of the dwarfing sln1d allele in barley, where DELLA is encoded by the sln1 gene.

Claims

1-30. (canceled)

31. A nucleic acid molecule which encodes an Rht-B1 polypeptide, the polypeptide comprising an N-terminal domain and a C-terminal domain, wherein the amino acid sequence of the C-terminal domain is at least 98% identical to amino acids 50-621 of SEQ ID NO:5, and wherein the amino acid sequence of the Rht-B1 polypeptide differs from the sequence set forth as SEQ ID NO:5 by at least (i) an insertion of one or more amino acids between amino acids 49 and 50 of SEQ ID NO:5, and (ii) one or more amino acid substitutions in the C-terminal domain relative to amino acids 50-621 of SEQ ID NO:5.

32. A nucleic acid molecule which encodes an Rht-B1 polypeptide, the polypeptide comprising an N-terminal domain and a C-terminal domain, wherein the amino acid sequence of the C-terminal domain is at least 98% identical to amino acids 50-621 of SEQ ID NO:5, wherein the amino acid sequence of the Rht-B1 polypeptide differs from the sequence set forth as SEQ ID NO:5 by at least an insertion of one or more amino acids between amino acids 49 and 50 of SEQ ID NO:5, and wherein the nucleotide sequence of the nucleic acid molecule differs from the nucleotide sequence set forth as SEQ ID NO:1 at least by the presence of an intron splice site mutation.

33. The nucleic acid molecule of claim 31 wherein the nucleic acid molecule has one or more of the following characteristics: the nucleic acid molecule encodes an Rht-B1 polypeptide comprising one or more amino acid substitutions in the N-terminal domain relative to amino acids 1 to 49 of SEQ ID NO:5, the nucleic acid molecule encodes an Rht-B1 polypeptide comprising an insertion of one or more amino acids between amino acids 49 and 50 of SEQ ID NO:5 that is an insertion of the sequence DSATPPDAPLVAAAGLAANETTHIKISANK (SEQ ID NO:14) or a variant thereof, wherein the sequence of the variant differs from SEQ ID NO:14 by amino acid substitutions, insertions or deletions of not more than 5 amino acids, the nucleic acid molecule encodes an Rht-B1 polypeptide comprising one or more amino acid substitutions in the C-terminal domain of the Rht-B1 polypeptide comprise a substitution of amino acid G260, V264, A271, G298, A299, A305, A310, P344, L346, G377, P394, R514, T524, 5528, G563, V286, D371, A310, E579, 5493, R283, R271, G274, A280, V234, R484, V285, G230, S488 or C240 with reference to SEQ ID NO:5, the nucleic acid molecule comprises a sequence variation relative to the nucleotide sequence of SEQ ID NO:1 which sequence variation is selected from the group consisting of G2715A, G2726A, G2747A, G2829A, G2831A, G2849A, C2865T, C2966T, C2972T, G3065A, C3117T, G3477A, C3507T, C3519T, G3624A, G2792A, CC2108TA, G3047A, G2864A, and G3671A, and the nucleic acid molecule comprises an Rht-B1 allele which encodes an Rht-B1 polypeptide, the polypeptide comprising an N-terminal domain and a C-terminal domain, wherein the amino acid sequence of the C-terminal domain is at least 98% identical to amino acids 50-621 of SEQ ID NO:5, wherein the amino acid sequence of the Rht-B1 polypeptide differs from the sequence set forth as SEQ ID NO:5 by at least an insertion of one or more amino acids between amino acids 49 and 50 of SEQ ID NO:5, and wherein the nucleotide sequence of the Rht-B1 allele differs from the nucleotide sequence set forth as SEQ ID NO:1 at least by the presence of an intron splice site mutation and the Rht-B1 allele comprises a sequence variation relative to SEQ ID NO:1 which sequence variation is selected from the group consisting of G148A, G148T, G147A, G2084A and G2083A.

34. (canceled)

35. An Rht-B1 polypeptide, comprising an N-terminal domain and a C-terminal domain, wherein the amino acid sequence of the C-terminal domain is at least 98% identical to amino acids 50-621 of SEQ ID NO:5, and wherein the amino acid sequence of the Rht-B1 polypeptide differs from the sequence set forth as SEQ ID NO:5 by at least (i) an insertion of one or more amino acids between amino acids 49 and 50 of SEQ ID NO:5, and (ii) one or more amino acid substitutions in the C-terminal domain relative to amino acids 50-621 of SEQ ID NO:5.

36. The polypeptide of claim 35, wherein the polypeptide has one or more of the following characteristics: the polypeptide comprises one or more amino acid substitutions in the N-terminal domain relative to amino acids 1 to 49 of SEQ ID NO:5, the insertion of one or more amino acids between amino acids 49 and 50 of SEQ ID NO:5 is an insertion of the sequence DSATPPDAPLVAAAGLAANETTHIKISANK (SEQ ID NO:14) or a variant thereof, wherein the sequence of the variant differs from SEQ ID NO:14 by amino acid substitutions, insertions or deletions of not more than 5 amino acids, the one or more amino acid substitutions in the C-terminal domain comprise a substitution of amino acid G260, V264, A271, G298, A299, A305, A310, P344, L346, G377, P394, R514, T524, 5528, G563, V286, D371, A310, E579, S493, R283, R271, G274, A280, V234, R484, V285, G230, S488 or C240 with reference to SEQ ID NO:5, the polypeptide is expressed from a nucleic acid sequence that comprises a sequence variation relative to SEQ ID NO:1 which sequence variation is selected from the group consisting of G2715A, G2726A, G2747A, G2829A, G2831A, G2849A, C2865T, C2966T, C2972T, G3065A, C3117T, G3477A, C3507T, C3519T, G3624A, G2792A, CC2108TA, G3047A, G2864A, and G3671A, the polypeptide is expressed from a nucleic acid molecule that differs from the nucleotide sequence set forth as SEQ ID NO:1 at least by the presence of an intron splice site mutation, and the polypeptide is expressed from a nucleic acid molecule that comprises a sequence variation relative to SEQ ID NO:1 which sequence variation is selected from the group consisting of G148A, G148T, G147A, G2084A and G2083A.

37-51. (canceled)

52. An isolated oligonucleotide which comprises at least 19 contiguous nucleotides of a polynucleotide according to claim 31, wherein the 19 contiguous nucleotides includes at least one of the nucleotide substitutions selected from the group consisting of G2715A, G2726A, G2747A, G2829A, G2831A, G2849A, C2865T, C2966T, C2972T, G3065A, C3117T, G3477A, C3507T, C3519T, G3624A, G2792A, CC2108TA, G3047A, G2864A, G3671A, G148A, G148T, G147A, G2084A and G2083A, with reference to SEQ ID NO:1, or which is fully complementary thereto.

53. The nucleic acid molecule of claim 31, which is operably linked to a promoter.

54. A transgene or a mutant gene that comprises the nucleic acid molecule of claim 31.

Description

BRIEF DESCRIPTION OF FIGURES

[0019] FIG. 1: Example of isolation of wheat overgrowth mutants by screening in flats. One mutant seedling characterized by increased growth rates is arrowed.

[0020] FIG. 2: Overgrowth mutants of wheat grown under controlled conditions, compared to parental (dwarf) and wild-type (tall) plants. From left to right, derivatives of Maringa carrying Rht-B1c (dwarf), Rht-B1a (tall), or three different overgrowth derivatives of Rht-B1c. The three overgrowth derivatives differ in their final height, and the arrows point to the heads of each line. Two of the derivatives are semi-dwarf, the third is a tall as the wild-type.

[0021] FIG. 3: Schematic of the sites of amino acid substitutions in overgrowth mutants of barley (upper arrows) and wheat (lower arrows) in the C-terminal GRAS domain of the DELLA polypeptides. Conserved amino acid regions are indicated.

[0022] FIG. 4: Barley seedlings at the same age (left to right) Himalaya (WT), M463 (grd2b), TR261 (grd2b, sln1m), M240 (sln1m), M640 (Sln1d), TR107 (Sln1d.10), TR60 (Sln1d.8).

[0023] FIG. 5: Altered morphology in some wheat mutant lines. An example of normal (left) and abnormal (right) morphologies, with the latter featuring narrow leaves, thin stems, a poorly developed root system and, in some cases, heads with fewer than normal grains.

[0024] FIG. 6: Duplex PCR analysis of DNA from (l to r): Maring rht-1, Maring Rht-B1c controls; two overgrowth lines with abnormal morphology; two overgrowth lines with normal morphology; no template control. Size markers on the left. The upper band represents amplification of a fragment of the Rht-B1c allele, and the lower band is a product of the Rht-D1 gene.

[0025] FIGS. 7A-7B: ClustalW alignment of amino acid sequences (SEQ ID NO: 31, consensus) encoded by Rht-A1a (JF930277), Rht-B1(JF930278) and Rht-D1a(JF930281) in wheat.

[0026] FIGS. 8A-8B: Alignment of wheat Rht-B1a polypeptide (SEQ ID NO: 5, upper sequence) and Arabidopsis thaliana GAI protein (Accession No. CAA75492, lower sequence) by Blastp. Asterisks indicate amino acids which are identical (conserved) between the two polypeptides, and + symbols indicate similar but not identical amino acids.

[0027] FIG. 9: An example of the results of a grain dormancy test is presented. Dormancy of grains of most of the mutant lines was assessed for grain harvested from two field seasons. In both seasons, the tall and Rht-B1b Maringa isolines showed low dormancy whereas the Rht-B1c isoline had relatively high dormancy. There were considerable differences in relative grain dormancy scores between different overgrowth lines.

NOTES ON THE SEQUENCE LISTING

[0028] SEQ ID NO:1 shows the 3892nt nucleotide sequence of the Rht-B1c gene from Maringa/Rht-B1c, starting at the ATG of the protein coding region to the TGA at the end of the coding region. The 2026nt insertion of the retrotransposon into the Rht-B1 gene to generate Rht-B1c occurs immediately after the first 147nt.

[0029] SEQ ID NO:2 shows the 1956nt nucleotide sequence of the cDNA corresponding to the Rht-B1c allele in wheat Maringa/Rht-B1c. The sequence is almost identical to the nucleotide sequence provided in Genbank Accession No. JN857971 (Wu et al., 2011), differing only by 2 nucleotides at positions 813 and 1851. The 90nt insertion in the cDNA relative to the cDNA from the Rht-B1a allele corresponds to nucleotides 148-237 of SEQ ID NO: 2.

[0030] SEQ ID NO:3 shows the amino acid sequence of the 651 amino acid polypeptide encoded by the Rht-B1c allele i.e. encoded by the gene having the nucleotide sequence of SEQID NO: 1 and the cDNA of SEQ ID NO: 2. The 30-amino acid insertion into the polypeptide relative to the Rht-B1a polypeptide are amino acids 50-79 of SEQ ID NO:3.

[0031] SEQ ID NO:4 shows the nucleotide sequence of the cDNA corresponding to the Rht-B1a (wild-type) allele, starting at the ATG translation start codon (Pearce et al., 2011) (Genbank Accession No. JF930278).

[0032] SEQ ID NO:5 shows the amino acid sequence of the Rht-B1a polypeptide (wild-type) (Genbank Accession No JF930278), 621 amino acids.

[0033] SEQ ID NO:6 shows the 7057nt nucleotide sequence of the Triticum aestivum Rht1-B1b gene for (Genbank Accession No. FN649763) from cultivar Xiaoyan54. Nucleotides 1-2136 correspond to the promoter and 5UTR of Rht-B1b, nucleotides 2137-4002 correspond to the protein coding region which is interrupted by the C to T nucleotide change at position 2326 relative to the wild-type, and nucleotides 4003-7057 correspond to the 3UTR of Rht-B1b and the region 3 of the gene.

[0034] SEQ ID NO:7 shows the 555 amino acid sequence of the polypeptide encoded by Rht-B1b, which is an N-terminal truncated Rht-B1 protein, having the first 66 amino acids truncated relative to the wild-type Rht-B1a. Translation re-initiates with amino acid 67.

[0035] SEQ ID NO:8 shows the 3463nt nucleotide sequence of the Triticum aestivum Rht-A1a gene (wild-type Rht-A1), (Genbank Accession No. JF930277) Nucleotides 1-1600 correspond to the promoter and 5UTR of Rht-A1a, and nucleotides 1601-3463 correspond to the protein coding region of Rht-A1a. The protein coding region is 96% identical to the Rht-B1a coding region.

[0036] SEQ ID NO:9 shows the 620 amino acid sequence of the Rht-A1a (wild-type) polypeptide.

[0037] SEQ ID NO:10 shows the 1872 nucleotide sequence of a cDNA corresponding to the Rht-D1a gene (Genbank Accession No AJ242531).

[0038] SEQ ID NO:11 shows the 623 amino acid sequence of the Rht-D1 polypeptide (Accession No. JF930281).

[0039] SEQ ID NO:12 shows the 618 amino acid sequence of the barley Sln1 gene (Accession No. AK372064).

[0040] SEQ ID NO:13 shows the 532 amino acid sequence of the Arabidopsis thaliana GAI polypeptide (Accession No. CAA75492).

[0041] SEQ ID NO:14 shows the amino acid sequence of the 30 amino acid insertion nto the Rht-B1c polypeptide.

[0042] SEQ ID NO:15 shows the 11 amino acid sequence of the Della motif in the wild-type Rht-B1a polypeptide in wheat, which is interrupted in the Rht-B1c polypeptide.

[0043] SEQ ID NO:16 shows the nucleotide sequence of the Rht-B1c gene (Accession No. JN857970, Wu et al., 2011). The cDNA corresponds to nucleotides 206 to 352 joined to 2289 to 4097.

[0044] SEQ ID NOs:17-30 show the nucleotide sequences of oligonucleotide primers.

DETAILED DESCRIPTION OF THE INVENTION

Plants

[0045] The present invention provides wheat plants, parts thereof such as wheat grain, products obtained from these plants and grain such as food ingredients and food products, and methods of producing and using the same. As used herein, the term wheat means a plant, plant part, grain or product derived therefrom of the species Triticum aestivum L. or Triticum turgidum ssp. durum or Triticale. Triticum aestivum L., also know as breadwheat, is a hexaploid wheat which has a genome organization of AABBDD, comprised of 42 chromosomes. The A, B and D subgenomes of Triticum aestivum L. are often referred to as genomes. Triticum turgidum ssp. durum, often referred to as durum wheat is a tetraploid wheat which has a genome organization of AABB, having 28 chromosomes. Diploid progenitors of hexaploid or tetraploid wheat include Triticum sp. such as T. uartu, T monococcum or T. boeoticum for the A genome, Aegilops speltoides for the B genome, and T. tauschii (also known as Aegilops squarrosa or Aegilops tauschii) for the D genome, but are not encompassed in wheat as used herein. However, plants that are produced by conventional techniques using Triticum aestivum L. as a parent in a sexual cross with the non-Triticum species Secale cereale (rye), which hybrid progeny are referred to herein as Triticale, are encompassed in wheat as used herein. Preferably, the wheat plant is suitable for commercial production of grain, such as commercial varieties of breadwheat or durum wheat, having suitable agronomic characteristics which are known to those skilled in the art.

[0046] In a first aspect, the present invention provides a wheat plant comprising an Rht-B1 allele which encodes a variant (non-wild-type) Rht-B1 polypeptide, preferably is homozygous for the Rht-B1 allele. In embodiments the wheat plant comprises an Rht-B1 allele selected from the group consisting of Rht-B1c.1, Rht-B1c.2, Rht-B1c.3, Rht-B1c.4, Rht-B1c.5, Rht-B1c.6, Rht-B1c.7, Rht-B1c.8, Rht-B1c.9, Rht-B1c.10, Rht-B1c.12, Rht-B1c.15, Rht-B1c.16, Rht-B1c.17, Rht-B1c.18, Rht-B1c.21, Rht-B1c.22, Rht-B1c.23, Rht-B1c.24, Rht-B1c.26, Rht-B1c.27, Rht-B1c.28, Rht-B1c.29, Rht-B1c.30 and Rht-B1c.32, and is preferably homozygous for the allele. In preferred embodiments, the wheat plant comprises an Rht-B1 allele selected from the group consisting of Rht-B1c.22, Rht-B1c.23, Rht-B1c.24 and Rht-B1c.26 and is preferably homozygous for the allele. In an embodiment, the Rht-B1 polypeptide comprises an N-terminal domain and a C-terminal domain, wherein the amino acid sequence of the C-terminal domain is at least 98% identical to amino acids 50-621 of SEQ ID NO:5, and wherein the amino acid sequence of the Rht-B1 polypeptide differs from the sequence set forth as SEQ ID NO:5 by at least (i) an insertion of one or more amino acids between amino acids 49 and 50 of SEQ ID NO:5, and (ii) one or more amino acid substitutions in the C-terminal domain relative to amino acids 50-621 of SEQ ID NO:5. SEQ ID NO:5 sets forth the amino acid sequence of a wild-type wheat Rht-B1a protein, with a length of 621 amino acids, which is encoded by a wild-type Rht-B1a allele in wheat, and which is used herein as the reference sequence for a wild-type Rht-B1 polypeptide.

[0047] Alternatively, the amino acid sequence of the variant Rht-B1 polypeptide differs from the sequence set forth as SEQ ID NO:5 by at least an insertion of one or more amino acids between about amino acids 49 and 50 of SEQ ID NO:5 and the nucleotide sequence of the Rht-B1 allele encoding the variant Rht-B1 polypeptide differs from the nucleotide sequence set forth as SEQ ID NO:1 at least by the presence of a mutation at or adjacent to an intron splice site such that intron splicing of the RNA transcript of the Rht-B1 allele is affected. As used herein, an intron splice site means the 4 nucleotides spanning the intron junction, namely the 2 nucleotides to the 5 and the 2 nucleotides to the 3 side of the intron junction. As used herein, adjacent to an intron splice site means the 3 nucleotides to the 5 and the 3 nucleotides to the 3 side of the intron splice site. SEQ ID NO:1 sets forth the nucleotide sequence of the protein coding region of the Rht-B1c allele, derived from the wheat variety Maringa genetic background, starting at the translation initiation ATG to the translation termination codon TGA. SEQ ID NO:1 includes the 2026 nucleotide retrotransposon insertion (nucleotides 148-2173) which was inserted into the Rht-B1 gene to form the Rht-B1c allele (Wu et al., 2011). In this embodiment, the amino acid sequence of the polypeptide encoded by the Rht-B1 allele may be identical to SEQ ID NO:3, or it may be different. The Rht-B1 allele may comprise both the intron splicing mutation and encode a polypeptide having the differences of (i) and (ii) in the previous paragraph, or in a preferred embodiment, the polypeptide has the differences of (i) and (ii) above and is lacking any intron splice site mutation.

[0048] As used herein, an Rht-B1 polypeptide means a polypeptide which is encoded by an Rht-B1 allele in wheat. Typically, the Rht-B1 polypeptide has an N-terminal domain joined to a C-terminal domain of about 572 amino acids that is at least 98% identical in amino acid sequence to amino acids 50-621 of SEQ ID NO:5. The C-terminal domain includes what is commonly referred to as the GRAS domain. In an embodiment, the N-terminal domain is about 49 to about 79 amino acids in length. In a preferred embodiment, the N-terminal domain is about 79 amino acids in length having a sequence such as, for example, amino acids 1-79 of SEQ ID NO:3 or a variant with 1 to 5 amino acid substitutions with reference to amino acids 1-79 of SEQ ID NO:3. In an alternative embodiment, the Rht-B1 polypeptide is derived from the wild-type Rht-B1 polypeptide by a truncation at the N-terminal end such as, for example, the Rht-B1b polypeptide (SEQ ID NO:7) encoded by the Rht-B1b allele, also known as the Rht1 gene. In an embodiment, the Rht-B1 allele encodes an Rht-B1 polypeptide whose amino acid sequence is at least 98% identical with SEQ ID NO:3.

[0049] In an embodiment, the amino acid sequence of the Rht-B1 polypeptide is not identical to SEQ ID NO:5 and is not identical to SEQ ID NO:7, although it may encompass SEQ ID NO:7. In an embodiment, if the amino acid sequence of the polypeptide is identical to SEQ ID NO:3, then the Rht-B1 allele does not have the nucleotide sequence set forth as SEQ ID NO:1; instead it encodes a sequence variant of SEQ ID NO:1 having a mutation at or adjacent to an intron splicing site relative to SEQ ID NO:1. In a preferred embodiment, the amino acid sequence of the polypeptide is not identical to SEQ ID NO:3. That is, the polypeptide is different in sequence to each of the Rht-B1a (wild-type) polypeptide, the Rht-B1b polypeptide and the Rht-B1c polypeptide. In an embodiment, the amino acid sequence of the polypeptide differs from the Rht-B1a amino acid sequence set forth as SEQ ID NO:5 by at least (i) an insertion of one or more amino acids between amino acids 49 and 50 of SEQ ID NO:5, and (ii) one or more amino acid substitutions in a region of the polypeptide corresponding to amino acids 200 to 621 of SEQ ID NO:5. This region of the Rht-B1a polypeptide corresponds to the GRAS domain of the polypeptide.

[0050] In a preferred embodiment, the insertion relative to the Rht-B1a polypeptide ((i) above) of one or more amino acids between amino acids 49 and 50 of SEQ ID NO:5 is an insertion of about 30 amino acids, whose sequence is preferably DSATPPDAPLVAAAGLAANETTHIKISANK (SEQ ID NO: 14; corresponding to amino acids 50 to 79 of SEQ ID NO:3) or a variant thereof, wherein the sequence of the variant differs from SEQ ID NO:14 by amino acid substitutions, insertions or deletions of no more than 5 amino acids, preferably of 1 or 2 amino acid substitutions. The sequence DSATPPDAPLVAAAGLAANETTHIKISANK (SEQ ID NO:14) is the sequence of the insertion in the Rht-B1c polypeptide relative to the Rht-B1a polypeptide. This insertion of 30 amino acids resulted from the insertion into the Rht-B1 gene that formed the Rht-B1c allele. This insertion is within the so called DELLA motif (DELLAALGYKV; SEQ ID NO:15) of the Rht-B1 polypeptide which is thought to be required for interaction with the GA receptor protein, GID1, such that the polypeptide with the insertion no longer binds GID1. Variations of this inserted sequence may be obtained through mutagenesis, and substitutions, insertions or deletions of 1 to 5 amino acids are not expected to affect the loss of the interaction of the polypeptide with GID1.

[0051] In an embodiment, the polypeptide of the wheat plant further comprises one or more amino acid substitutions, preferably conservative amino acid substitutions, in a region of the polypeptide corresponding to amino acids 1 to 200 of SEQ ID NO:5, also referred to as the DELLA domain of the wild-type Rht-B1 polypeptide because it comprises the amino acid sequence DELLAALGYKV (SEQ ID NO:15), also referred to as the DELLA motif. It is preferred however, that the amino acid sequence of the Rht-B1 polypeptide of the invention is identical to SEQ ID NO:3 in the mutated DELLA domain, i.e. comprises amino acids 1-230 of SEQ ID NO:3.

[0052] In further preferred embodiments, the one or more amino acid substitutions in the C-terminal domain are in the region of the polypeptide corresponding to amino acids 200 to 621 of SEQ ID NO:5. In a preferred embodiment, the one or more amino acid substitutions comprise a substitution of an amino acid selected from the group consisting of G260, V264, A271, G298, A299, A305, A310, P344, L346, G377, P394, R514, T524, S528, G563, V286, D371, A310, E579, S493, R283, R271, G274, A280, V234, R484, V285, G230, S488 and C240 with reference to SEQ ID NO:3. It is preferred that the substitution is selected from the group consisting of G260E, V264M, A271T, G298D, A299T, A305T, A310V, P344S, L346F, G377R, P394L, R514H, T5241, S528F, G563D, V286M, D371N, A310T, E579K, S493F, R283H, R271H, G274D, A280T, V234M, R484H, V285F, G230E, S488F and C240Y. In a more preferred embodiment, the Rht-B1 allele of the wheat plant comprises a sequence variation relative to SEQ ID NO:1, which sequence variation is selected from the group consisting of G2715A, G2726A, G2747A, G2829A, G2831A, G2849A, C2865T, C2966T, C2972T, G3065A, C3117T, G3477A, C3507T, C3519T, G3624A, G2792A, CC2108TA, G3047A, G2864A, G3671A, G148A, G148T, G147A, G2084A and G2083A. These sequence variations correspond to the amino acid substitutions listed immediately above, see Table 3.

[0053] It is preferred that the wheat plant of the invention has an increased plant height relative to a wheat plant which is homozygous for the Rht-B1c allele and a decreased height relative to a wheat plant which is homozygous for the Rht-B1a allele when the plants are grown under the same conditions. Accordingly the wheat plant of the invention is referred to as semi-dwarf. In a preferred embodiment, the height of the wheat plant of the invention is between about 70% and about 94% of the height of the control plant which is homozygous for the Rht-B1a allele (tall phenotype), more preferably between about 75% and about 90% of the height of the plant which is homozygous for the Rht-B1a allele. In comparison, the height of the wheat plant which is homozygous for the Rht-B1c allele (dwarfed plant) is about 42% of the height of the plant which is homozygous for the Rht-B1a allele. The height of the wheat plant of the invention may be about the same or essentially the same as the height of a wheat plant which is homozygous for the Rht-B1b allele, which is about 80-81% of the height of the tall plants, or may be less than the height of the Rht-B1b plant, or greater than the height of the Rht-B1b plant. Plant height as used herein means the height of the mature plant from ground level to the top of the tallest stem, i.e. to the base of the head. The plants which are homozygous for the Rht-B1c, Rht-B1a or Rht-B1b alleles and which are used as controls in the comparison preferably have essentially the same genetic background, more preferably are near-isogenic lines, relative to the wheat plant of the invention; they are therefore termed a corresponding wheat plant which is homozygous for the Rht-B1c (or Rht-B1a or Rht-B1b) allele. Those skilled in the art are readily able to select a corresponding wheat plant which is suitable for the comparison. To make the comparison, the plant of the invention and the control plant are grown under essentially the same timing and environmental conditions, such as in a replicated field trial, including the same temperature regime, light conditions, nutrient and water supply and soil conditions. Preferably the plant height is measured for field grown plants, although glasshouse grown plants may also be used for the comparison, and grown according to field trials as known in the art. The plant heights may be measured at any point in the growth cycle, but are preferably measured at maturity of the plants.

[0054] In addition it is preferred that the wheat plant has increased fertility and/or produces an increased amount of grain relative to the wheat plant which is homozygous for the Rht-B1c allele and/or has increased coleoptile length relative to the wheat plant which is homozygous for the Rht-B1c allele and/or is capable of producing grain which has increased dormancy relative to grain obtained from the wheat plant which is homozygous for the Rht-B1a allele. Preferably, the amount of grain produced by the plant is essentially the same as, or greater than, a corresponding wheat plant which is homozygous for the Rht-B1b allele. As used herein, fertility is defined as the number of grains per head, and the amount of grain or yield of grain produced from a plant means the weight of mature grain that can be harvested from the plant. Such grain typically has a moisture content of about 10% to about 15% by weight. The wheat plants of the present invention also preferably have increased coleoptile length relative to a wheat plant which is homozygous for the Rht-B1c allele. Preferably the coleoptile length of the wheat plant of the present invention is between 70% and 120%, preferably between 80% and 100% of the coleoptile length of the plant which is homozygous for the Rht-B1a allele. Another preferred trait of the wheat plants of the present invention is dormancy of the grain obtained from the plant. It is preferred that the plants have increased grain dormancy relative to a wheat plant which is homozygous for the Rht-B1a allele. Preferably the wheat plant has between 50% and 100%, preferably 60% to 100%, of the level of dormancy of a wheat plant which is homozygous for the Rht-B1c allele. In an embodiment, the rate of germination of grain obtained from the wheat plant of the invention is intermediate between that of grain from a wheat plant which is homozygous for the Rht-B1a allele and grain from a wheat plant which is homozygous for the Rht-B1c allele. The rate of germination may be assayed as described in Example 1. For example, the time taken for populations of grains to reach 50% germination may be assayed. In a preferred embodiment, the grain of the wheat plant of the invention requires between 1 and 8 weeks longer, preferably between 2 and 5 weeks longer, of storage at room temperature (after-ripening period) for the rate of germination to reach 50% relative to grain from a corresponding wheat plant which is homozygous for the Rht-B1a allele.

[0055] As would be understood, where a comparison is made between the plants or grain of the present invention and those which are homozygous for the Rht-B1c allele or are homozygous for the Rht-B1a allele, the comparison is performed with plants grown under essentially identical growing conditions, growth time, temperature, water and nutrient supply, etc, and for grain obtained from such plants.

[0056] Grain In a second aspect, the invention provides wheat grain which is obtained from, or obtainable from, or which is part of, the wheat plants of the invention. As used herein, grain means grain as is typically harvested by farmers from mature wheat plants growing in the field, including grain used for food production or in food products, and germinated grain after it has been sowed but before emergence of seedlings. Grain also includes grain which has been processed for food production or which is an ingredient in a food product. The harvested wheat grain of the invention typically has a moisture content of about 10% to about 15% by weight. In an embodiment, the wheat grain comprises an Rht-B1 allele which encodes a variant (non-wild-type) Rht-B1 polypeptide, preferably the grain is homozygous for the allele. In an embodiment, the Rht-B1 polypeptide comprises an N-terminal domain and a C-terminal domain, wherein the amino acid sequence of the C-terminal domain is at least 98% identical to amino acids 50-621 of SEQ ID NO:5, and wherein the amino acid sequence of the Rht-B1 polypeptide differs from the sequence set forth as SEQ ID NO:5 by at least (i) an insertion of one or more amino acids between amino acids 49 and 50 of SEQ ID NO:5, and (ii) one or more amino acid substitutions in the C-terminal domain relative to amino acids 50-621 of SEQ ID NO:5. In embodiments the wheat grain comprises an Rht-B1 allele selected from the group consisting of Rht-B1c.1, Rht-B1c.2, Rht-B1c.3, Rht-B1c.4, Rht-B1c.5, Rht-B1c.6, Rht-B1c.7, Rht-B1c.8, Rht-B1c.9, Rht-B1c.10, Rht-B1c.12, Rht-B1c.15, Rht-B1c.16, Rht-B1c.17, Rht-B1c.18, Rht-B1c.21, Rht-B1c.22, Rht-B1c.23, Rht-B1c.24, Rht-B1c.26, Rht-B1c.27, Rht-B1c.28, Rht-B1c.29, Rht-B1c.30 and Rht-B1c.32, and is preferably homozygous for the allele. In preferred embodiments, the wheat grain comprises an Rht-B1 allele selected from the group consisting of Rht-B1c.22, Rht-B1c.23, Rht-B1c.24 and Rht-B1c.26 and is preferably homozygous for the allele.

[0057] Alternatively, the amino acid sequence of the variant Rht-B1 polypeptide of the grain differs from the sequence set forth as SEQ ID NO:5 by at least an insertion of one or more amino acids between amino acids 49 and 50 of SEQ ID NO:5 and the nucleotide sequence of the Rht-B1 allele encoding the variant Rht-B1 polypeptide differs from the nucleotide sequence set forth as SEQ ID NO:1 at least by the presence of a mutation at or adjacent to an intron splice site such that intron splicing of the RNA transcript of the Rht-B1 allele is affected. In this embodiment, the amino acid sequence of the polypeptide encoded by the Rht-B1 allele may be identical to SEQ ID NO:3, or it may be different. The Rht-B1 allele may comprise both the intron splicing mutation and encode a polypeptide having the differences of (i) and (ii) in the previous paragraph, or in a preferred embodiment, the polypeptide has the differences of (i) and (ii) above and is lacking any intron splice site mutation relative to SEQ ID NO:1.

[0058] The variant Rht-B1 polypeptide of the grain and the Rht-B1 allele encoding it may be further defined as described in the paragraphs above with respect to the wheat plant. In a preferred embodiment, the grain has increased dormancy relative to grain obtained from a wheat plant which is homozygous for the Rht-B1a allele. In an embodiment, the rate of germination of grain of the invention is intermediate between that of grain from a wheat plant which is homozygous for the Rht-B1a allele and grain from a wheat plant which is homozygous for the Rht-B1c allele. The rate of germination may be assayed as described in Example 1. For example, the time taken for populations of grains to reach 50% germination may be assayed. In a preferred embodiment showing increased dormancy, the grain of the invention requires between 1 and 8 weeks longer, preferably between 2 and 5 weeks longer, of storage at room temperature (after-ripening period) for the rate of germination to reach 50% relative to grain from a corresponding wheat plant which is homozygous for the Rht-B1a allele. It is also preferred that the wheat grain of the invention is capable of growing into a wheat plant when the grain is sown into soil, which plant has an increased height relative to a wheat plant which is homozygous for the Rht-B1c allele and a decreased height relative to a wheat plant which is homozygous for the Rht-B1a allele when the plants are grown under the same conditions. The wheat plant arising from the grain may have increased fertility and/or produces an increased amount of grain relative to the wheat plant which is homozygous for the Rht-B1c allele and/or has increased coleoptile length relative to the wheat plant which is homozygous for the Rht-B1c allele.

[0059] The present invention also provides a method of producing grain of the invention, the method comprising (i) growing a wheat plant of the present invention and (ii) harvesting grain from the plant. In some embodiments the wheat grain has been processed so that it is no longer able to germinate. This may be achieved by removal of the embryo from the seed, for example by milling, or by heat treatment or other processing of the grain. The grain may be kibbled, cracked, par-boiled, rolled, pearled, milled or ground grain.

[0060] The present invention also provides a method of producing flour, wholemeal, starch, starch granules or bran, the method comprising obtaining the grain of the present invention and processing the grain to produce the flour, wholemeal, starch, starch granules or bran. Such processing methods are well known in the art. The step of obtaining the grain may comprise, for example, harvesting grain from a wheat plant of the invention or purchasing the grain.

[0061] The present invention also provides products produced from the plants or grain of the present invention, such as a food product, which may be a food ingredient. Examples of food products include flour, starch, leavened or unleavened breads, pasta, noodles, animal fodder, breakfast cereals, snack foods, cakes, malt, pastries and foods containing flour-based sauces. The food product may be a bagel, a biscuit, a bread, a bun, a croissant, a dumpling, an English muffin, a muffin, a pita bread, a quickbread, a refrigerated/frozen dough product, dough, baked beans, a burrito, chili, a taco, a tamale, a tortilla, a pot pie, a ready to eat cereal, a ready to eat meal, stuffing, a microwaveable meal, a brownie, a cake, a cheesecake, a coffee cake, a cookie, a dessert, a pastry, a sweet roll, a candy bar, a pie crust, pie filling, baby food, a baking mix, a batter, a breading, a gravy mix, a meat extender, a meat substitute, a seasoning mix, a soup mix, a gravy, a roux, a salad dressing, a soup, sour cream, a noodle, a pasta, ramen noodles, chow mein noodles, lo mein noodles, an ice cream inclusion, an ice cream bar, an ice cream cone, an ice cream sandwich, a cracker, a crouton, a doughnut, an egg roll, an extruded snack, a fruit and grain bar, a microwaveable snack product, a nutritional bar, a pancake, a par-baked bakery product, a pretzel, a pudding, a granola-based product, a snack chip, a snack food, a snack mix, a waffle, a pizza crust, animal food or pet food. The food product may be prepared by mixing the grain, or flour, wholemeal or bran from said grain, with another ingredient. Another product is animal feed such as harvested grain, hay, straw or silage. The plants of the invention may be used directly as animal feed, for example when growing in the field.

[0062] Polynucleotides In a third aspect the present invention provides a nucleic acid molecule which encodes an Rht-B1 polypeptide of the invention. The nucleic acid molecule may be isolated from a wheat plant or comprised in a wheat plant or as an exogenous nucleic acid molecule in a plant, which may be any plant such as a cereal plant or a plant other than wheat. In an embodiment, the Rht-B1 polypeptide comprises an N-terminal domain and a C-terminal domain, wherein the amino acid sequence of the C-terminal domain is at least 98% identical to amino acids 50-621 of SEQ ID NO:5, and wherein the amino acid sequence of the Rht-B1 polypeptide differs from the sequence set forth as SEQ ID NO:5 by at least (i) an insertion of one or more amino acids between amino acids 49 and 50 of SEQ ID NO:5, and (ii) one or more amino acid substitutions in the C-terminal domain relative to amino acids 50-621 of SEQ ID NO:5. The Rht-B1 polypeptide of the invention may be further defined as described in the paragraphs above with respect to the wheat plant. In preferred embodiments the nucleic acid molecule comprises an Rht-B1 allele selected from the group consisting of Rht-B1c.1, Rht-B1c.2, Rht-B1c.3, Rht-B1c.4, Rht-B1c.5, Rht-B1c.6, Rht-B1c.7, Rht-B1c.8, Rht-B1c.9, Rht-B1c.10, Rht-B1c.12, Rht-B1c.15, Rht-B1c.16, Rht-B1c.17, Rht-B1c.18, Rht-B1c.21, Rht-B1c.22, Rht-B1c.23, Rht-B1c.24, Rht-B1c.26, Rht-B1c.27, Rht-B1c.28, Rht-B1c.29, Rht-B1c.30, and Rht-B1c.32. In more preferred embodiments, the nucleic acid molecule comprises an Rht-B1 allele selected from the group consisting of Rht-B1c.22, Rht-B1c.23, Rht-B1c.24 and Rht-B1c.26.

[0063] Polypeptides In a fourth aspect the present invention provides an Rht-B1 polypeptide which comprises an N-terminal domain and a C-terminal domain, wherein the amino acid sequence of the C-terminal domain is at least 98% identical to amino acids 50-621 of SEQ ID NO:5, and wherein the amino acid sequence of the Rht-B1 polypeptide differs from the sequence set forth as SEQ ID NO:5 by at least (i) an insertion of one or more amino acids between amino acids 49 and 50 of SEQ ID NO:5, and (ii) one or more amino acid substitutions in the C-terminal domain relative to amino acids 50-621 of SEQ ID NO:5. The Rht-B1 polypeptide of the invention may be further defined as described in the paragraphs above with respect to the wheat plant.

[0064] The present invention also provides a method of genotyping a wheat plant, the method comprising (i) obtaining a sample comprising nucleic acid or protein extracted from a wheat plant, and (ii) detecting in the sample a nucleic acid molecule or polypeptide of the present invention. In preferred embodiments the wheat plant comprises an Rht-B1 allele selected from the group consisting of Rht-B1c.1, Rht-B1c.2, Rht-B1c.3, Rht-B1c.4, Rht-B1c.5, Rht-B1c.6, Rht-B1c.7, Rht-B1c.8, Rht-B1c.9, Rht-B1c.10, Rht-B1c.12, Rht-B1c.15, Rht-B1c.16, Rht-B1c.17, Rht-B1c.18, Rht-B1c.21, Rht-B1c.22, Rht-B1c.23, Rht-B1c.24, Rht-B1c.26, Rht-B1c.27, Rht-B1c.28, Rht-B1c.29, Rht-B1c.30, and Rht-B1c.32.

[0065] The present invention also provides a method of introducing an Rht-B1 allele into a wheat plant lacking said allele, the method comprising i) crossing a first parent wheat plant with a second parent wheat plant, wherein the second plant is a wheat plant of the present invention, and ii) backcrossing a progeny plant of the cross of step i) with a plant of the same genotype as the first parent plant to produce a plant with a majority of the genotype of the first parent but comprising said Rht-B1 allele.

[0066] The nucleic acid molecule of the present invention may be operably linked to a promoter capable of directing expression of the nucleic acid molecule in a plant cell. Also provided is a vector comprising or encoding the nucleic acid molecule of the present invention and host cells comprising this vector and/or the nucleic acid molecule of the present invention

[0067] The present invention also provides a genetically modified plant where the plant has been transformed with the nucleic acid molecule of the present invention and progeny plants thereof comprising the nucleic acid molecule. In certain embodiments the genetically modified plant is a wheat or barley plant.

[0068] Cereals as used herein means plants or grain of the monocotyledonous families Poaceae or Graminae which are cultivated for the edible components of their seeds, and includes wheat, barley, maize, oats, rye, rice, sorghum, triticale, millet, buckwheat. Preferably, the cereal plant or grain is wheat or barley plant or grain, more preferably wheat plant or grain. In a further preferred embodiment, the cereal plant is not rice or maize or either of these.

[0069] As used herein, the term barley refers to any species of the Genus Hordeum, including progenitors thereof, as well as progeny thereof produced by crosses with other species. It is preferred that the plant is of a Hordeum species which is commercially cultivated such as, for example, a strain or cultivar or variety of Hordeum vulgare or suitable for commercial production of grain.

[0070] The wheat plants of the invention may have many uses other than uses for food or animal feed, for example uses in research or breeding. In seed propagated crops such as wheat, the plants can be self-crossed to produce a plant which is homozygous for the desired genes, or haploid tissues such as developing germ cells can be induced to double the chromosome complement to produce a homozygous plant.

[0071] The wheat plants of the invention may be crossed with plants containing a more desirable genetic background. The desired genetic background may include a suitable combination of genes providing commercial yield and other characteristics such as agronomic performance or abiotic stress resistance. The genetic background might also include other altered starch biosynthesis or modification genes, for example genes from other wheat lines. The genetic background may comprise one or more transgenes such as, for example, a gene that confers tolerance to a herbicide such as glyphosate.

[0072] As used herein, the term linked refers to a marker locus and a second locus being sufficiently close on a chromosome that they will be inherited together in more than 50% of meioses, e.g., not randomly. This definition includes the situation where the marker locus and second locus form part of the same gene. Furthermore, this definition includes the situation where the marker locus comprises a polymorphism that is responsible for the trait of interest (in other words the marker locus is directly linked to the phenotype). The term genetically linked as used herein is narrower, only used in relation to where a marker locus and a second locus being sufficiently close on a chromosome that they will be inherited together in more than 50% of meioses. Thus, the percent of recombination observed between the loci per generation (centimorgans (cM)), will be less than 50. In particular embodiments of the invention, genetically linked loci may be 45, 35, 25, 15, 10, 5, 4, 3, 2, or 1 or less cM apart on a chromosome. Preferably, the markers are less than 5 cM or 2 cM apart and most preferably about 0 cM apart.

[0073] As used herein, the other genetic markers may be any molecules which are linked to a desired trait of a cereal plant such as wheat. Such markers are well known to those skilled in the art and include molecular markers linked to genes determining traits such disease resistance, yield, plant morphology, grain quality, other dormancy traits such as grain colour, gibberellic acid content in the seed, plant height, flour colour and the like. Examples of such genes are stem-rust resistance genes Sr2 or Sr 38, the stripe rust resistance genes YrIO or Yr 17, the nematode resistance genes such as Cre1 and Cre3, alleles at glutenin loci that determine dough strength such as Ax, Bx, Dx, Ay, By and Dy alleles. With specific regard to grain dormancy, other markers include the R gene for red grain colour (Himi et al., 2002), as well as markers described by Mares et al. (2005), Li et al. (2004), Kato et al. (2001), Mori et al. (2005) and Prada et al. (2004).

[0074] The term plant as used herein as a noun refers to whole plants, but as used as an adjective refers to any substance which is present in, obtained from, derived from, or related to a plant, such as for example, plant organs (e.g. leaves, stems, roots, flowers), single cells (e.g. pollen), seeds, plant cells and the like. Plants provided by or contemplated for use in the practice of the present invention include both monocotyledons and dicotyledons. In preferred embodiments, the plants of the present invention are crop plants (for example, cereals and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, soybean millet, cassava, barley, or pea), or legumes. The plants may be grown for production of edible roots, tubers, leaves, stems, flowers or fruit.

[0075] The terms seed and grain as used herein have overlapping meanings. Grain includes seed which has been harvested from a plant and generally refers to mature, harvested grain but can also refer to grain after imbibition or germination, according to the context. Seed can refer to either mature grain, either before or after harvesting, or to immature seeds which are developing in planta. Mature grain commonly has a moisture content of, less than about 10-15%.

[0076] As used herein, the term gene is to be taken in its broadest context and includes the deoxyribonucleotide sequences comprising the protein coding region of a structural gene and including sequences located adjacent to the coding region on both the 5 and 3 ends for a distance of at least about 2 kb on either end. The sequences which are located 5 of the coding region and which are present on the mRNA are referred to as 5 non-translated sequences. The sequences which are located 3 or downstream of the coding region and which are present on the mRNA are referred to as 3 non-translated sequences. The term gene encompasses both cDNA and genomic forms of a gene. A genomic form or clone of a gene contains the coding region which may be interrupted with non-coding sequences termed introns or intervening regions or intervening sequences. Introns are segments of a gene which are transcribed into nuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers. Introns are removed or spliced out from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) transcript. The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide. The term gene includes a synthetic or fusion molecule encoding all or part of the proteins of the invention described herein and a complementary nucleotide sequence to any one of the above.

[0077] An allele is a variant of a gene at a single genetic locus. Hexaploid wheat such as Triticum aestivum L. has six sets of chromosomes with a genome organization of AABBDD. Each chromosome has one copy of each gene (one allele). If both alleles of a chromosome pair are the same, the organism is homozygous with respect to that gene, if the alleles are different, the organism is heterozygous with respect to that gene. The interaction between alleles at a locus is generally described as dominant or recessive.

[0078] The wheat plants of the invention can be produced and identified after mutagenesis. This may provide a wheat plant which is non-transgenic, which is desirable in some markets, or which is free of exogenous nucleic acid molecule. Generally, a progenitor plant cell, tissue, seed or plant may be subjected to mutagenesis to produce single or multiple mutations, such as nucleotide substitutions, deletions, additions and/or codon modification.

[0079] Mutagenesis can be achieved by chemical or radiation means, for example EMS or sodium azide (Zwar and Chandler, 1995) treatment of seed, or gamma irradiation, well know in the art. Chemical mutagenesis tends to favour nucleotide substitutions rather than deletions. Heavy ion beam (HIB) irradiation is known as an effective technique for mutation breeding to produce new plant cultivars, see for example Hayashi et al., 2007 and Kazama et al, 2008. Ion beam irradiation has two physical factors, the dose (gy) and LET (linear energy transfer, keV/um) for biological effects that determine the amount of DNA damage and the size of DNA deletion, and these can be adjusted according to the desired extent of mutagenesis.

[0080] Biological agents useful in producing site-specific mutants include enzymes that include double stranded breaks in DNA that stimulate endogenous repair mechanisms. These include endonucleases, zinc finger nucleases, TAL effectors, transposases and site-specific recombinases. Zinc finger nucleases (ZFNs), for example, facilitate site-specific cleavage within a genome allowing endogenous or other end-joining repair mechanisms to introduce deletions or insertions to repair the gap. Zinc finger nuclease technology is reviewed in Le Provost et al., 2009, See also Durai et al., 2005 and Liu et al., 2010.

[0081] Isolation of mutants may be achieved by screening mutagenised plants or seed. For example, a mutagenized population of wheat may be screened directly for the desired genotype or indirectly by screening for a phenotype such as plant height. Screening directly for the genotype preferably includes assaying for the presence of mutations which may be observed in PCR assays by the absence of markers as expected when some of the genes are deleted, or heteroduplex based assays as in Tilling, or by deep sequencing. Screening for the phenotype may comprise screening for out growth as described in the Examples. Using this methodology large populations of mutagenised seeds may be screened for increased growth providing increased plant height.

[0082] Identified mutations may then be introduced into desirable genetic backgrounds by crossing the mutant with a plant of the desired genetic background and performing a suitable number of backcrosses to cross out the originally undesired parent background.

[0083] In the context of this application, an induced mutation or introduced mutation is an artificially induced genetic variation which may be the result of chemical or radiation treatment of a progenitor seed or plant. Nucleotide insertional derivatives include 5 and 3 terminal fusions as well as intra-sequence insertions of single or multiple nucleotides. Insertional nucleotide sequence variants are those in which one or more nucleotides are introduced into a site in the nucleotide sequence, either at a predetermined site as is possible with zinc finger nucleases (ZFN), TAL effectors or homologous recombination methods, or by random insertion with suitable screening of the resulting product. Deletional variants are characterised by the removal of one or more nucleotides from the sequence. Preferably, a mutant gene has only a single insertion of a sequence of nucleotides relative to the wild-type gene and one or more substitution mutations. Substitutional nucleotide variants are those in which at least one nucleotide in the sequence has been removed and a different nucleotide inserted in its place. The preferred number of nucleotides affected by substitutions in a mutant gene relative to the wild-type gene is a maximum of ten nucleotides, more preferably a maximum of 9, 8, 7, 6, 5, 4, 3, or 2, or most preferably only one nucleotide.

[0084] The term mutation as used herein does not include silent nucleotide substitutions which do not affect the activity of the gene, and therefore includes only alterations in the gene sequence which affect the gene activity. The term polymorphism refers to any change in the nucleotide sequence including such silent nucleotide substitutions. Screening methods may first involve screening for polymorphisms and secondly for mutations within a group of polymorphic variants.

[0085] Marker assisted selection is a well recognised method of selecting for heterozygous plants required when backcrossing with a recurrent parent in a classical breeding program. The population of plants in each backcross generation will be heterozygous for the gene of interest normally present in a 1:1 ratio in a backcross population, and the molecular marker can be used to distinguish the two alleles of the gene. By extracting DNA from, for example, young shoots and testing with a specific marker for the introgressed desirable trait, early selection of plants for further backcrossing is made whilst energy and resources are concentrated on fewer plants. To further speed up the backcrossing program, the embryo from immature seeds (25 days post anthesis) may be excised and grown up on nutrient media under sterile conditions, rather than allowing full seed maturity.

[0086] Any molecular biological technique known in the art which is capable of detecting alleles of Rht-B1 can be used in the methods of the present invention. Such methods include, but are not limited to, the use of nucleic acid amplification, nucleic acid sequencing, nucleic acid hybridization with suitably labeled probes, single-strand conformational analysis (SSCA), denaturing gradient gel electrophoresis (DGGE), heteroduplex analysis (HET), chemical cleavage analysis (CCM), catalytic nucleic acid cleavage or a combination thereof (see, for example, Lemieux, 2000; Langridge et al., 2001).

[0087] The polymerase chain reaction (PCR) is a reaction in which replicate copies are made of a target polynucleotide using a pair of primers or set of primers consisting of upstream and a downstream primer, and a catalyst of polymerization, such as a DNA polymerase, and typically a thermally-stable polymerase enzyme. Methods for PCR are known in the art, and are taught, for example, in PCR (Ed. M J. McPherson and S. G Moller (2000) BIOS Scientific Publishers Ltd, Oxford).

[0088] A primer is an oligonucleotide sequence that is capable of hybridising in a sequence specific fashion to the target sequence and being extended during the PCR. Amplicons or PCR products or PCR fragments or amplification products are extension products that comprise the primer and the newly synthesized copies of the target sequences. Multiplex PCR systems contain multiple sets of primers that result in simultaneous production of more than one amplicon. Primers may be perfectly matched to the target sequence or they may contain internal mismatched bases that can result in the introduction of restriction enzyme or catalytic nucleic acid recognition/cleavage sites in specific target sequences. Primers may also contain additional sequences and/or contain modified or labelled nucleotides to facilitate capture or detection of amplicons. Repeated cycles of heat denaturation of the DNA, annealing of primers to their complementary sequences and extension of the annealed primers with polymerase result in exponential amplification of the target sequence. The terms target or target sequence or template refer to nucleic acid sequences which are amplified.

[0089] The terms transgenic plant and transgenic wheat plant as used herein refer to a plant that contains a gene construct (transgene) not found in a wild-type plant of the same species, variety or cultivar. That is, transgenic plants (transformed plants) contain genetic material that they did not contain prior to the transformation. A transgene as referred to herein has the normal meaning in the art of biotechnology and refers to a genetic sequence which has been produced or altered by recombinant DNA or RNA technology and which has been introduced into a progenitor plant cell, which cell is used to produce a new plant. The transgene may include genetic sequences obtained from or derived from a plant cell, or another plant cell, or a non-plant source, or a synthetic sequence. Typically, the transgene has been introduced into the plant by human manipulation such as, for example, by transformation but any method can be used as one of skill in the art recognizes. The genetic material is typically stably integrated into the genome of the plant. The introduced genetic material may comprise sequences that naturally occur in the same species but in a rearranged order or in a different arrangement of elements, for example an antisense sequence or a sequence encoding a double-stranded RNA or an artificial microRNA precursor. Plants containing such sequences are included herein in transgenic plants. Transgenic plants as defined herein include all progeny of an initial transformed and regenerated plant (T0 plant) which has been genetically modified using recombinant techniques, where the progeny comprise the transgene. Such progeny may be obtained by self-fertilisation of the primary transgenic plant or by crossing such plants with another plant of the same species. In an embodiment, the transgenic plants are homozygous for each and every gene that has been introduced (transgene) so that their progeny do not segregate for the desired phenotype. Transgenic plant parts include all parts and cells of said plants which comprise the transgene such as, for example, seeds, cultured tissues, callus and protoplasts. A non-transgenic plant, preferably a non-transgenic wheat plant, is one which has not been genetically modified by the introduction of genetic material by recombinant DNA techniques.

[0090] As used herein, the term corresponding non-transgenic plant refers to a plant which is the same or similar in most characteristics, preferably isogenic or near-isogenic relative to the transgenic plant, but without the transgene of interest. Preferably, the corresponding non-transgenic plant is of the same cultivar or variety as the progenitor of the transgenic plant of interest, or a sibling plant line which lacks the construct, often termed a segregant, or a plant of the same cultivar or variety transformed with an empty vector construct, and may be a non-transgenic plant. Wild-type, as used herein, refers to a cell, tissue or plant that has not been modified according to the invention. Wild-type cells, tissue or plants known in the art and may be used as controls to compare levels of expression of an exogenous nucleic acid or the extent and nature of trait modification with cells, tissue or plants modified as described herein. As used herein, wild-type wheat grain means a corresponding non-mutagenized, non-transgenic wheat grain. Specific wild-type wheat grains as used herein include but are not limited to Sunstate.

[0091] Any of several methods may be employed to determine the presence of a transgene in a transformed plant. For example, polymerase chain reaction (PCR) may be used to amplify sequences that are unique to the transformed plant, with detection of the amplified products by gel electrophoresis or other methods. DNA may be extracted from the plants using conventional methods and the PCR reaction carried out using primers that will distinguish the transformed and non-transformed plants. An alternative method to confirm a positive transformant is by Southern blot hybridization, well known in the art. Wheat plants which are transformed may also be identified i.e. distinguished from non-transformed or wild-type wheat plants by their phenotype, for example conferred by the presence of a selectable marker gene, or by immunoassays that detect or quantify the expression of an enzyme encoded by the transgene, or any other phenotype conferred by the transgene.

[0092] The wheat plants of the present invention may be grown or harvested for grain, primarily for use as food for human consumption or as animal feed, or for fermentation or industrial feedstock production such as ethanol production, among other uses. Alternatively, the wheat plants may be used directly as feed. The plant of the present invention is preferably useful for food production and in particular for commercial food production. Such food production might include the making of flour, dough, semolina or other products from the grain that might be an ingredient in commercial food production. The invention also provides flour, meal or other products produced from the grain. These may be unprocessed or processed, for example by fractionation or bleaching.

[0093] The terms polypeptide and protein are generally used interchangeably herein. The terms proteins and polypeptides as used herein also include variants, mutants, modifications and/or derivatives of the polypeptides of the invention as described herein. As used herein, substantially purified polypeptide refers to a polypeptide that has been separated from the lipids, nucleic acids, other peptides and other molecules with which it is associated in its native state. Preferably, the substantially purified polypeptide is at least 60% free, more preferably at least 75% free, and more preferably at least 90% free from other components with which it is naturally associated. By recombinant polypeptide is meant a polypeptide made using recombinant techniques, i.e., through the expression of a recombinant polynucleotide in a cell, preferably a plant cell and more preferably a wheat cell.

[0094] The % identity of a polypeptide relative to another polypeptide can be determined by GAP (Needleman and Wunsch, 1970) analysis (GCG program) with a gap creation penalty=5, and a gap extension penalty=0.3. The query sequence is at least 250 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 250 amino acids. Most preferably, two polypeptides in question are aligned over their full length amino acid sequences.

[0095] With regard to a defined polypeptide, it will be appreciated that % identity figures higher than those provided above will encompass preferred embodiments. Thus, where applicable, in light of the minimum % identity figures, it is preferred that the polypeptide comprises an amino acid sequence which is at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the relevant nominated SEQ ID NO.

[0096] Amino acid sequence deletions generally range from about 1 to 15 residues, more preferably about 1 to 10 residues and typically about 1 to 5 contiguous residues. Substitution mutants have at least one amino acid residue in the polypeptide molecule removed and a different residue inserted in its place.

[0097] By isolated is meant material that is substantially or essentially free from components that normally accompany it in its native state. As used herein, an isolated polynucleotide or isolated nucleic acid molecule means a polynucleotide which is at least partially separated from, preferably substantially or essentially free of, the polynucleotide sequences of the same type with which it is associated or linked in its native state. For example, an isolated polynucleotide includes a polynucleotide which has been purified or separated from the sequences which flank it in a naturally occurring state, e.g., a DNA fragment which has been removed from the sequences which are normally adjacent to the fragment. Preferably, the isolated polynucleotide is also at least 90% free from other components such as proteins, carbohydrates, lipids etc. The term recombinant polynucleotide as used herein refers to a polynucleotide formed in vitro by the manipulation of nucleic acid into a form not normally found in nature. For example, the recombinant polynucleotide may be in the form of an expression vector. Generally, such expression vectors include transcriptional and translational regulatory nucleic acid operably connected to the nucleotide sequence to be transcribed in the cell.

[0098] The present invention refers to use of oligonucleotides which may be used as probes or primers. As used herein, oligonucleotides are polynucleotides up to 50 nucleotides in length. They can be RNA, DNA, or combinations or derivatives of either. Oligonucleotides are typically relatively short single stranded molecules of 10 to 30 nucleotides, commonly 15-25 nucleotides in length, typically comprised of 10-30 or 15-25 nucleotides which are identical to, or complementary to, the sequence of interest. When used as a probe or as a primer in an amplification reaction, the minimum size of such an oligonucleotide is the size required for the formation of a stable hybrid between the oligonucleotide and a complementary sequence on a target nucleic acid molecule. Preferably, the oligonucleotides are at least 15 nucleotides, more preferably at least 18 nucleotides, more preferably at least 19 nucleotides, more preferably at least 20 nucleotides, even more preferably at least 25 nucleotides in length. Polynucleotides used as a probe are typically conjugated with a detectable label such as a radioisotope, an enzyme, biotin, a fluorescent molecule or a chemiluminescent molecule.

[0099] The terms polynucleotide variant and variant and the like refer to polynucleotides displaying substantial sequence identity with a reference polynucleotide sequence and which are able to function in an analogous manner to, or with the same activity as, the reference sequence. These terms also encompass polynucleotides that are distinguished from a reference polynucleotide by the addition, deletion or substitution of at least one nucleotide, or that have, when compared to naturally occurring molecules, one or more mutations. Accordingly, the terms polynucleotide variant and variant include polynucleotides in which one or more nucleotides have been added or deleted, or replaced with different nucleotides. In this regard, it is well understood in the art that certain alterations inclusive of mutations, additions, deletions and substitutions can be made to a reference polynucleotide whereby the altered polynucleotide retains the biological function or activity of the reference polynucleotide. Accordingly, these terms encompass polynucleotides that encode polypeptides that exhibit enzymatic or other regulatory activity, or polynucleotides capable of serving as selective probes or other hybridising agents. The terms polynucleotide variant and variant also include naturally occurring allelic variants. Mutants can be either naturally occurring (that is to say, isolated from a natural source) or synthetic (for example, by performing site-directed mutagenesis on the nucleic acid). Preferably, a polynucleotide variant of the invention which encodes a polypeptide with enzyme activity is greater than 400, more preferably greater than 500, more preferably greater than 600, more preferably greater than 700, more preferably greater than 800, more preferably greater than 900, and even more preferably greater than 1,000 nucleotides in length, up to the full length of the gene.

[0100] A variant of an oligonucleotide of the invention includes molecules of varying sizes which are capable of hybridising, for example, to the wheat genome at a position close to that of the specific oligonucleotide molecules defined herein. For example, variants may comprise additional nucleotides (such as 1, 2, 3, 4, or more), or less nucleotides as long as they still hybridise to the target region. Furthermore, a few nucleotides may be substituted without influencing the ability of the oligonucleotide to hybridise to the target region. In addition, variants may readily be designed which hybridise close (for example, but not limited to, within 50 nucleotides) to the region of the plant genome where the specific oligonucleotides defined herein hybridise.

[0101] By corresponds to or corresponding to in the context of polynucleotides or polypeptides is meant a polynucleotide (a) having a nucleotide sequence that is substantially identical or complementary to all or a portion of a reference polynucleotide sequence or (b) encoding an amino acid sequence identical to an amino acid sequence in a peptide or protein. This phrase also includes within its scope a peptide or polypeptide having an amino acid sequence that is substantially identical to a sequence of amino acids in a reference peptide or protein. Terms used to describe sequence relationships between two or more polynucleotides or polypeptides include reference sequence, comparison window, sequence identity, percentage of sequence identity, substantial identity and identical, and are defined with respect to a defined minimum number of nucleotides or amino acid residues or preferably over the full length. The terms sequence identity and identity are used interchangeably herein to refer to the extent that sequences are identical on a nucleotide-by-nucleotide basis or an amino acid-by-amino acid basis over a window of comparison. Thus, a percentage of sequence identity is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U) or the identical amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.

[0102] The % identity of a polynucleotide can be determined by GAP (Needleman and Wunsch, 1970) analysis (GCG program) with a gap creation penalty=5, and a gap extension penalty=0.3. Unless stated otherwise, the query sequence is at least 45 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 45 nucleotides. Preferably, the query sequence is at least 150 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 150 nucleotides. More preferably, the query sequence is at least 300 nucleotides in length and the GAP analysis aligns the two sequences over a region of at least 300 nucleotides, or at least 400, 500 or 600 nucleotides in each case. Reference also may be made to the BLAST family of programs as for example disclosed by Altschul et al., 1997. A detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubel et al., 1994-1998, Chapter 15.

[0103] Nucleotide or amino acid sequences are indicated as essentially similar when such sequences have a sequence identity of at least about 98%, more particularly at least about 98.5%, quite particularly about 99%, especially about 99.5%, more especially about 100%, quite especially are identical. It is clear that when RNA sequences are described as essentially similar to, or have a certain degree of sequence identity with, DNA sequences, thymine (T) in the DNA sequence is considered equal to uracil (U) in the RNA sequence.

[0104] With regard to the defined polynucleotides, it will be appreciated that % identity figures higher than those provided above will encompass preferred embodiments. Thus, where applicable, in light of the minimum % identity figures, it is preferred that the polynucleotide comprises a polynucleotide sequence which is at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the relevant nominated SEQ ID NO.

[0105] In some embodiments, the present invention refers to the stringency of hybridization conditions to define the extent of complementarity of two polynucleotides. Stringency as used herein, refers to the temperature and ionic strength conditions, and presence or absence of certain organic solvents, during hybridization. The higher the stringency, the higher will be the degree of complementarity between a target nucleotide sequence and the labelled polynucleotide sequence. Stringent conditions refers to temperature and ionic conditions under which only nucleotide sequences having a high frequency of complementary bases will hybridize. As used herein, the term hybridizes under low stringency, medium stringency, high stringency, or very high stringency conditions describes conditions for hybridization and washing. Guidance for performing hybridization reactions can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6, herein incorporated by reference. Specific hybridization conditions referred to herein are as follows: 1) low stringency hybridization conditions in 6 sodium chloride/sodium citrate (SSC) at about 45 C., followed by two washes in 0.2SSC, 0.1% SDS at 50-55 C.; 2) medium stringency hybridization conditions in 6SSC at about 45 C., followed by one or more washes in 0.2SSC, 0.1% SDS at 60 C.; 3) high stringency hybridization conditions in 6SSC at about 45 C., followed by one or more washes in 0.2SSC, 0.1% SDS at 65 C.; and 4) very high stringency hybridization conditions are 0.5 M sodium phosphate, 7% SDS at 65 C., followed by one or more washes at 0.2SSC, 1% SDS at 65 C.

[0106] As used herein, a chimeric gene or genetic construct refers to any gene that is not a native gene in its native location i.e. it has been artificially manipulated, including a chimeric gene or genetic construct which is integrated into the wheat genome. Typically a chimeric gene or genetic construct comprises regulatory and transcribed or protein coding sequences that are not found together in nature. Accordingly, a chimeric gene or genetic construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. The term endogenous is used herein to refer to a substance that is normally produced in an unmodified plant at the same developmental stage as the plant under investigation, preferably a wheat plant. An endogenous gene refers to a native gene in its natural location in the genome of an organism preferably in a wheat plant. As used herein, recombinant nucleic acid molecule refers to a nucleic acid molecule which has been constructed or modified by recombinant DNA technology. The terms foreign polynucleotide or exogenous polynucleotide or heterologous polynucleotide and the like refer to any nucleic acid which is introduced into the genome of a cell by experimental manipulations, preferably the wheat genome, but which does not naturally occur in the cell. These include modified forms of gene sequences found in that cell so long as the introduced gene contains some modification, e.g. an introduced mutation or the presence of a selectable marker gene, relative to the naturally-occurring gene. Foreign or exogenous genes may be genes found in nature that are inserted into a non-native organism, native genes introduced into a new location within the native host, or chimeric genes or genetic constructs. A transgene is a gene that has been introduced into the genome by a transformation procedure. The term genetically modified includes introducing genes into cells, mutating genes in cells and altering or modulating the regulation of a gene in a cell or organisms to which these acts have been done or their progeny.

[0107] Operably connecting a promoter or enhancer element to a transcribable polynucleotide means placing the transcribable polynucleotide (e.g., protein-encoding polynucleotide or other transcript) under the regulatory control of a promoter, which then controls the transcription of that polynucleotide. In the construction of heterologous promoter/structural gene combinations, it is generally preferred to position a promoter or variant thereof at a distance from the transcription start site of the transcribable polynucleotide, which is approximately the same as the distance between that promoter and the gene it controls in its natural setting; i.e., the gene from which the promoter is derived. As is known in the art, some variation in this distance can be accommodated without loss of function.

[0108] With regard to cereal plants, as used herein the term germination refers to the emergence of the coleorhiza from the seed coat after imbibition.

[0109] The rate of germination of a seed refers to the percentage of seeds in a population which have germinated over a period of time, for example up to 21 days, or in the period 1 to 10 days, after the beginning of imbibition. A population of seeds can be assessed daily over several days to determine the germination percentage over time. Certain aspects of the invention relate to altering/modulating the rate of germination of a seed. This alteration/modulation may be transient during the life span of a seed. For example following harvest a seed of transgenic plant of the invention may have an altered rate of germination when compared to a seed of a corresponding non-transgenic plant upon harvest, however, following six months storage in a silo the seed of the same transgenic plant of the invention may have the same rate of germination when compared to a seed of a corresponding non-transgenic plant following six months storage in a silo, or vice versa. In other words, at some point in the life span of the seed it will have an altered rate of germination when compared to a suitable control (non-transgenic or wild type etc.) which has been exposed to the same conditions.

[0110] As used herein, the term dormant refers to the failure of the viable, intact seeds of a plant to germinate under specified favourable conditions, particularly in terms of temperature and in the presence of moisture. Dormancy is a quantitative trait. With regard to barley and wheat, seeds of a plant are considered dormant if less than 90% of viable, intact seeds germinate after 7 days at 20 C. following the beginning of imbibition. Viable seeds are those which are able to germinate after dormancy breaking, for example a substantial period (weeks or months) of storage at room temperature or heat treatment, well known in the art.

[0111] As used herein, the term non-dormant refers to the ability of the seeds of a plant to germinate under specified favourable conditions. With regard to barley and wheat, seeds of a plant are considered non-dormant if at least 90% of the viable, intact seeds germinate after 7 days at 20 C. following the beginning of imbibition.

[0112] As used herein, the term nucleic acid amplification refers to any in vitro method for increasing the number of copies of a nucleic acid molecule with the use of a DNA polymerase. Nucleic acid amplification results in the incorporation of nucleotides into a DNA molecule or primer thereby forming a new DNA molecule complementary to a DNA template. The newly formed DNA molecule can be used a template to synthesize additional DNA molecules.

[0113] The present invention includes the production of various transgenic plants. These include, but are not limited to, plants that have one or more of the desirable traits exhibited by the wheat plants of the present invention.

[0114] Nucleic acid constructs useful for producing the above-mentioned transgenic plants can readily be produced using standard techniques. To ensure appropriate expression of the gene encoding an mRNA of interest, the nucleic acid construct typically comprises one or more regulatory elements such as promoters, enhancers, as well as transcription termination or polyadenylation sequences. Such elements are well known in the art. The transcriptional initiation region comprising the regulatory element(s) may provide for regulated or constitutive expression in the plant. The regulatory elements may be selected from, for example, seed-specific promoters, or promoters not specific for seed cells (such as ubiquitin promoter or CaMV35S or enhanced 35S promoters). Examples of seed specific promoters useful for the present invention include, but are not limited to, the wheat low molecular weight glutenin promoter (Colot et al., 1987), the promoter expressing -amylase in wheat seeds (Stefanov et al., 1991), and the hordein promoter (Brandt et al., 1985). The promoter may be modulated by factors such as temperature, light or stress. Ordinarily, the regulatory elements will be provided 5 of the genetic sequence to be expressed. The construct may also contain other elements that enhance transcription such as the nos 3 or the ocs 3 polyadenylation regions or transcription terminators.

[0115] Typically, the nucleic acid construct comprises a selectable marker. Selectable markers aid in the identification and screening of plants or cells that have been transformed with the exogenous nucleic acid molecule. The selectable marker gene may provide antibiotic or herbicide resistance to the wheat cells, or allow the utilization of substrates such as mannose. The selectable marker preferably confers hygromycin resistance to the wheat cells.

[0116] Preferably, the nucleic acid construct is stably incorporated into the genome of the plant. Accordingly, the nucleic acid comprises appropriate elements which allow the molecule to be incorporated into the genome, or the construct is placed in an appropriate vector which can be incorporated into a chromosome of a plant cell.

[0117] One embodiment of the present invention includes a recombinant vector, which includes at least one polynucleotide molecule of the present invention, inserted into any vector capable of delivering the nucleic acid molecule into a host cell. Such a vector contains heterologous nucleic acid sequences, that is nucleic acid sequences that are not naturally found adjacent to nucleic acid molecules of the present invention and that preferably are derived from a species other than the species from which the nucleic acid molecule(s) are derived. The vector can be either RNA or DNA, either prokaryotic or eukaryotic, and typically is a virus or a plasmid.

[0118] Another embodiment of the present invention includes a recombinant cell comprising a host cell transformed with one or more recombinant molecules of the present invention. Transformation of a nucleic acid molecule into a cell can be accomplished by any method by which a nucleic acid molecule can be inserted into the cell. Transformation techniques include, but are not limited to, transfection, electroporation, microinjection, lipofection, adsorption, and protoplast fusion. A recombinant cell may remain unicellular or may grow into a tissue, organ or a multicellular organism. Transformed nucleic acid molecules of the present invention can remain extrachromosomal or can integrate into one or more sites within a chromosome of the transformed (i.e., recombinant) cell in such a manner that their ability to be expressed is retained. Preferred host cells are plant cells, more preferably cells of a cereal plant, more preferably barley or wheat cells, and even more preferably a wheat cell.

[0119] Preferably, the transgenic plant is a cereal plant. Examples of cereal plants include, but are not limited to, wheat, barley, sorghum oats, and rye. More preferably, the cereal plant is wheat or barley. In a further preferred embodiment, the cereal plant is not rice.

[0120] Transgenic plants, as defined in the context of the present invention include plants and their progeny which have been genetically modified using recombinant techniques. This would generally be to modulate the production of at least one polypeptide defined herein in the desired plant or plant organ. Transgenic plant parts include all parts and cells of said plants such as, for example, cultured tissues, callus and protoplasts. Transformed plants contain genetic material that they did not contain prior to the transformation. The genetic material is preferably stably integrated into the genome of the plant. The introduced genetic material may comprise sequences that naturally occur in the same species but in a rearranged order or in a different arrangement of elements, for example an antisense sequence. Such plants are included herein as transgenic plants. A non-transgenic plant is one which has not been genetically modified with the introduction of genetic material by recombinant DNA techniques. In a preferred embodiment, the transgenic plants are homozygous for each and every gene that has been introduced (transgene) so that their progeny do not segregate for the desired phenotype.

[0121] Several techniques exist for introducing foreign genetic material into a plant cell. Such techniques include acceleration of genetic material coated onto microparticles directly into cells (see, for example, U.S. Pat. Nos. 4,945,050 and 5,141,131). Plants may be transformed using Agrobacterium technology (see, for example, U.S. Pat. Nos. 5,177,010, 5,104,310, 5,004,863, 5,159,135). Electroporation technology has also been used to transform plants (see, for example, WO 87/06614, U.S. Pat. Nos. 5,472,869, 5,384,253, WO 92/09696 and WO 93/21335). In addition to numerous technologies for transforming plants, the type of tissue which is contacted with the foreign genes may vary as well. Such tissue would include but would not be limited to embryogenic tissue, callus tissue type I and II, hypocotyl, meristem, and the like. Almost all plant tissues may be transformed during development and/or differentiation using appropriate techniques described herein.

[0122] A number of vectors suitable for stable transfection of plant cells or for the establishment of transgenic plants have been described in, e.g., Pouwels et al., Cloning Vectors: A Laboratory Manual, 1985, supp. 1987; Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989; and Gelvin et al., Plant Molecular Biology Manual, Kluwer Academic Publishers, 1990. Typically, plant expression vectors include, for example, one or more cloned plant genes under the transcriptional control of 5 and 3 regulatory sequences and a dominant selectable marker. Such plant expression vectors can also contain a promoter regulatory region (e.g., a regulatory region controlling inducible or constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal.

[0123] Any of several methods may be employed to determine the presence of a transformed plant. For example, polymerase chain reaction (PCR) may be used to amplify sequences that are unique to the transformed plant, with detection of the amplified products by gel electrophoresis or other methods. DNA may be extracted from the plants using conventional methods and the PCR reaction carried out using primers that will distinguish the transformed and non-transformed plants. For example, primers may be designed that will amplify a region of DNA from the transformation vector reading into the construct and the reverse primer designed from the gene of interest. These primers will only amplify a fragment if the plant has been successfully transformed. An alternative method to confirm a positive transformant is by Southern blot hybridization, well known in the art. Plants which are transformed may also be identified i.e. distinguished from non-transformed or wild-type plants by their phenotype, for example conferred by the presence of a selectable marker gene, or conferred by the phenotype of a desired seed dormancy.

[0124] Methods for transformation of cereal plants such as wheat and barley for introducing genetic variation into the plant by introduction of an exogenous nucleic acid and for regeneration of plants from protoplasts or immature plant embryos are well known in the art, see for example, Wan and Lemaux (1994), Tingay et al., (1997), Canadian Patent Application No. 2,092,588, Australian Patent Application No 61781/94, Australian Patent No 667939, U.S. Pat. No. 6,100,447, International Patent Application PCT/US97/10621, U.S. Pat. Nos. 5,589,617, 6,541,257, and other methods are set out in Patent specification WO99/14314. Preferably, transgenic wheat or barley plants are produced by Agrobacterium tumefaciens mediated transformation procedures. Vectors carrying the desired nucleic acid construct may be introduced into regenerable wheat cells of tissue cultured plants or explants, or suitable plant systems such as protoplasts.

[0125] The regenerable wheat cells are preferably from the scutellum of immature embryos, mature embryos, callus derived from these, or the meristematic tissue.

[0126] Marker assisted selection is a well recognised method of selecting for heterozygous plants required when backcrossing with a recurrent parent in a classical breeding program. The population of plants in each backcross generation will be heterozygous for the gene of interest normally present in a 1:1 ratio in a backcross population, and the molecular marker can be used to distinguish the two alleles of the gene. By extracting DNA from, for example, young shoots and testing with a specific marker for the introgressed desirable trait, early selection of plants for further backcrossing is made whilst energy and resources are concentrated on fewer plants. To further speed up the backcrossing program, the embryo from immature seeds (25 days post anthesis) may be excised and grown up on nutrient media under sterile conditions, rather than allowing full seed maturity.

[0127] Any molecular biological technique known in the art which is capable of detecting Rht-B1 alleles can be used in the methods of the present invention. Such methods include, but are not limited to, the use of nucleic acid amplification, nucleic acid sequencing, nucleic acid hybridization with suitably labeled probes, single-strand conformational analysis (SSCA), denaturing gradient gel electrophoresis (DGGE), heteroduplex analysis (HET), chemical cleavage analysis (CCM), catalytic nucleic acid cleavage or a combination thereof (see, for example, Lemieux, 2000; Langridge et al., 2001). The invention also includes the use of molecular marker techniques to detect polymorphisms linked to Rht-B1 alleles. Such methods include the detection or analysis of restriction fragment length polymorphisms (RFLP), RAPD, amplified fragment length polymorphisms (AFLP) and microsatellite (simple sequence repeat, SSR) polymorphisms. The closely linked markers can be obtained readily by methods well known in the art, such as Bulked Segregant Analysis, as reviewed by Langridge et al., (2001).

[0128] Throughout this specification the word comprise, or variations such as comprises or comprising, will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

[0129] All publications mentioned in this specification are herein incorporated by reference. Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed in Australia or elsewhere before the priority date of each claim of this application.

[0130] As used in the subject specification, the singular forms a, an and the include plural aspects unless the context clearly dictates otherwise. Thus, for example, reference to a includes a single as well as two or more; reference to an includes a single as well as two or more; reference to the includes a single as well as two or more and so forth.

[0131] Having generally described the invention, the same will be more readily understood by reference to the following examples, which are provided by way of illustration and are not intended as limiting.

EXAMPLES

Example 1. Materials and Methods

Plant Material

[0132] Grains of the tall wheat variety Maring (Rht-B1a) and a near-isogenic dwarf line (Rht-B1c) in the Maringa genetic background were obtained from the Australian Winter Cereals Collection, Tamworth, NSW, Australia. Maring is a Brazilian breadwheat variety. The near-isogenic dwarf line was produced by seven backcrosses (BC7) with recurrent selection of the dwarf allele (Rht-B1c) into Maring (Hoogendoorn et al. 1988).

[0133] Himalaya barley and three previously characterised dwarf mutant derivatives are described in Table 1. Plants were grown either in a greenhouse in 20 cm pots containing a compost-based mix under natural light with daylength extension to 14 hours provided during winter months, or in the field at Black Mountain or at Ginninderra Experimental Station, both located in Canberra, Australia.

Mutagenesis

[0134] The method for mutagenesis of barley and wheat grains was a simplification of a procedure used previously (Zwar and Chandler, 1995). 1-2 kg of grain of each line was imbibed in twice its mass of water at 4 C. overnight. They were transferred to 2-litre measuring cylinders filled with water, and aerated with pressurised air for 8 h, with one change of fresh water given after 4 h. Grains were then incubated for 2 h in freshly-prepared 1 mM Na azide dissolved in 0.1 M K phosphate buffer pH 3.0, and then washed extensively in running water for 2 h, placed in a fume hood to dry overnight, and sown in the field within several days of treatment.

Construction of Derivative Lines Carrying Overgrowth Alleles

[0135] The barley overgrowth alleles were back-crossed, inter-crossed and out-crossed to generate a set of lines suitable for detailed physiological characterisation. Four of the new Sln1 overgrowth alleles occurred in either grd2b or gse1n dwarfing backgrounds and were back-crossed two generations to the WT allowing overgrowth phenotypes to be compared in tall and dwarf backgrounds. The loss of the original dwarfing allele was confirmed by PCR. The remaining seven new Sln1 overgrowth alleles occurred in the Sln1d dwarf background, and four of these (Sln1d.7, Sln1d.8, Sln1d.9 and TR103) have been through two generations of back-crossing to the WT.

-Amylase Production by Endosperm Half-Grains

[0136] Endosperm half-grains were prepared and incubated with or without GA.sub.3 (1 M) at 22 C. for 0, 42 or 72 h. To each sample, 1.5 mL of a solution of 10 mm CaCl.sub.2 was added, the half-grains were homogenised, and an aliquot of 1 mL was clarified by centrifugation (20,000 g for 5 min). The supernatant was analyzed for -amylase activity using the Megazyme alpha-amylase (Ceralpha) procedure.

Assessment of Grain Dormancy

[0137] Plants were grown as single rows in the field, and heads were inspected twice per week to monitor drying. When all green colour had been lost from the heads, they were judged to be physiologically mature and were excised and taken to the lab. Heads were placed in a fume hood for 48 h to promote final drying, especially of basal grains that tended to remain moist, and were then threshed by hand. The grains were placed in a manila envelope and left in the lab environment for different periods of after-ripening. Germination was assessed by incubating 100 grains of each line on moist filter paper in a 20 C. environment with low intensity fluorescent lighting. The percentage germination of each grain sample was assessed after 7 days incubation Germination is defined in this context as emergence of the root radicle from the seed coat. In a first season's experiment, many grain samples, especially from tall wheat plants, showed low dormancy and there was considerable germination (at least 50% of grains germinated) after only 13-19 days after-ripening. These lines were generally not tested again. Other grain samples had low germination after 13-19 days after-ripening, and these were tested again after 32-33 days, and if germination was still low, again after 48-49 days after-ripening. Relative dormancy scores were given on a scale of 1 (least dormant) to 4 (highest dormancy).

[0138] In a second season's experiment, dormancy assessments focused on semidwarf and control lines, and germination was determined weekly from harvest until either dormancy was lost, or up to 12 weeks after-ripening. An example of the results of a grain dormancy test is given in FIG. 9. One measure of the grain dormancy was determined as the number of weeks of storage of the grain (also termed after-ripening) at room temperature in order for at least 50% of the grains in a grain population to germinate, as assessed by the method described in the previous paragraph.

Coleoptile Lengths of Barley and Wheat Overgrowth Lines

[0139] Coleoptile lengths were determined on wheat and barley seedlings after 21 days growth in the dark with a daily temperature program of 12 h at 12 C. and 12 h at 8 C., in the presence of fully adequate supplies of water.

Emergence From Deep Sowing Under Dry Conditions

[0140] Grain samples were sown at a depth of 10 cm in soil (standard potting soil) in the greenhouse. The initial soil moisture content was 12-14% (w/w). Germination, early growth and seedling establishment, until emergence of the third leaf, occured without any additional watering to simulate dry sowing conditions in the field. The percentage of grains that yielded emerged seedlings and the timing of emergence were evaluated.

Leaf Elongation Rates and GA Dose-Response Curves

[0141] The methods have been previously described (Chandler and Robertson, 1999). Curves were fitted to data points using a 4-parameter Hill equation.

Root Length Measurements

[0142] Root growth is assessed under controlled conditions and in plants growing in the field. In the former case, root lengths are assessed by scanning, while in the field, 2 m cores are taken and root numbers assessed at 10 cm intervals along the cores.

PCR Amplification of DNA and Sequencing

[0143] DNA was prepared from barley or wheat leaves by the method of Ellis et al., 2005. Wheat sequences were amplified using primer pairs in which one primer was specific for the Rht-B1 gene (Table 2). The 3 half of the gene was amplified using conserved forward primers and reverse primers that were specific to B gene sequences in the 3 UT region. PCR amplification of barley sequences used primers specific for the Sln1, Spy1 and Gse1 genes. Amplified fragments were treated with Exosap-IT (Affymetrix) to remove primers, and then sequenced using Big Dye Terminator (Applied Biosystems).

DNA Sequences

[0144] The sequences of the Rht-A1a, Rht-B1a and Rht-D1b genes of wheat and the proteins encoded thereby are in accessions JF930277, JF930278 and JF930281 respectively. The amino acid sequences are aligned by ClustalW, showing the amino acids that differ (FIG. 7). The partial nucleotide sequence of the Rht3-B1c gene in the dwarf Maringa derivative is shown in SEQ ID NO. 1.

[0145] The sequence of the Rht-B1c protein encoded by the Rht-B1c allele is shown in SEQ ID NO. 3.

[0146] The sequence accessions for the Sln1 and Spy1 genes of barley are AK372064 and AF035820 respectively.

Example 2. Isolation of Wheat Mutants Comprising New Alleles of Rht-B1

[0147] Grains of a wheat variety Maring, which comprised an Rht-B1c allele that caused severe plant dwarfing, were treated with sodium azide as described in Example 1. The mutagenized grains were sown in the field and the resultant M.sub.1 plants allowed to self-fertilise. M.sub.2 grains were harvested from the M.sub.1 plants upon maturity. M.sub.2 seeds were sown in the field or at high density in flats (FIG. 1) in the greenhouse and screened for increased height either during early growth or when mature in the field. About 1.6 million M.sub.2 plants were screened by these methods. FIG. 1 shows how readily mutants could be identified. Approximately 400 plants were selected which exhibited either early leaf elongation rates or mature plant height that ranged from slightly greater than the dwarf parent variety Maringa (Rht-B1c) to as tall as the near-isogenic, Rht-B1a (wild-type allele) plants. These were self-fertilised and progeny plants grown under controlled conditions and compared to the parental (Rht-B1c) and wild-type (Rht-B1a) plants (FIG. 2). These plants were termed overgrowth mutants because they grew at increased rates or to increased mature height relative to the parental variety.

[0148] The dwarfing mutation in the Rht-B1c allele was due to a 2026bp insertion in the Rht-B1 gene in Maringa (Wu et al., 2011). PCR testing revealed that about half of the 400 selected mutant plants were positive for the presence of the insertion in this gene; such plants had retained an Rht-B1 gene. The remainder of the selected plants were negative for the PCR assay and appeared to lack the Rht-B1 gene entirely, although the homoeologous gene encoded by the D genome (Rht-D1) was still present based on positive PCR amplifications. Many in this latter group had distinct morphological alterations and poor spike fertility. It is likely that they represented deletions of the Rht-B1 gene along with varying amounts of flanking chromosomal DNA. These deletion lines were not studied further.

[0149] The Rht-B1 gene in each of 139 non-deletion mutants was sequenced by amplifying regions of the gene by PCR. Thirty-five new derivative alleles of Rht-B1c were identified, each one a variant of the Rht-B1c allele in Maringa. These were designated Rht-B1c.1, Rht-B1c.2, Rht-B1c.3 etc. They are listed in Table 3. Many of the 35 alleles were represented by multiple lines containing an identical specific mutation. In some cases, these multiple lines could be siblings, whereas in other cases they must have represented independent mutational events. There was a total of 62 independent events that generated the 35 alleles.

[0150] The mutants exhibited three different classes of mutation responsible for the overgrowth phenotype. In a first class, ten alleles comprised premature translation termination codons in the Rht-B1 gene. In most cases, the mutant codon was from a TGG codon (encoding Trp) to a TGA (stop codon). In barley, premature stop codons in DELLA result in an elongated slender phenotype and male sterility. In contrast, plants of these ten mutant wheat lines, with one exception, grew to a height that was the same or nearly the as of the tall (wild-type) isoline and showed a similar fertility to the wild-type. Presumably the expression of the A and/or D genome Rht-1 proteins in those mutants provided genetic compensation for the B genome null mutant genes and limited the phenotypic expression to tall rather than slender. The one exception, plants of the sole Rht-B1c.22 representative (line TR544) were semidwarf rather than tall. This phenotype might have been due to altered splicing of the mutated Rht-B1c.22 gene in these plants that generated a Rht-B1 protein with a different in-frame insertion (discussed below).

[0151] The second class comprised amino acid substitutions in the Rht-B1 protein encoded by the B genome. Twenty examples are listed in Table 3. It was of interest to compare these 20 substitutions to the DELLA substitution mutants isolated in barley (Example 5), see FIG. 3. Across the two species, there were 31 single amino acid substitutions, including four sites where identical amino acid changes occurred. It was also noted that identical, though independent, mutations occurred within barley and within wheat, where the same mutation was found at corresponding positions in lines derived from different sub-populations of M.sub.2 grains.

[0152] FIG. 3 schematically shows the sites of amino acid substitutions in the mutants relative to the position of conserved motifs in the in the C-terminal region of the barley and wheat proteins. The observation that the overgrowth mutations were distributed throughout much of the C-terminal region indicated that there was considerable potential for alterations in the binding of the DELLA proteins to interacting protein partners.

[0153] The third class of mutants included 5 alleles which each contained a mutation in regions of Rht-B1 predicted to be involved in excision of most of the insertion in the Rht-B1 gene which generated the Rht-B1c allele (Table 3). These alleles each affected one of the four nucleotides immediately adjacent to the splicing donor and acceptor sites. In some cases including for the Rht-B1c.22 allele, and depending on which splicing prediction software was used, there was the potential for these sequence alterations to alter the preferred site of splicing, thereby generating Rht-B1 proteins with slightly larger or smaller in-frame insertions. These splicing alleles presumably produced less of the Rht-B1 protein containing the 30 amino acid insertion and/or produced modified Rht-B1 proteins with altered in-frame insertions. Experimental evidence for alteration in the splicing efficiency was obtained by examining the RNA by RT-PCR methods.

Example 3. Phenotypic Testing of Wheat Mutants Comprising New Alleles of Rht-B1

[0154] The overgrowth mutants of wheat comprising new alleles of Rht-B1 were tested for a number of traits that were relevant for practical applications in the field for commercial production of wheat. The lengths of mature stems, the lengths of coleoptiles, and the relative grain dormancy for grain obtained from the mutant plants were measured and compared to control plants. The data are included in Table 4. The stem lengths of mature plants were assessed in different, irrigated field conditions (i.e. well watered) and in different seasons. In most cases, four independent data points were obtained and used to calculate the means shown in Table 4, which are expressed as a percentage relative to Rht-B1a plants. Different alleles led to different stem lengths, with some examples (e.g. Rht-B1c.6, c.8, c.21) being quite dwarfed, and others (Rht-B1c.11, c.25, c.31) as tall as the Rht-B1a isoline. In most cases, there was little variation between lines which carried the same allele. Based on the semi-dwarfing observed for plants of the Rht-B1b isoline which were approximately 81% the height of the wild-type (tall) plants, there were 15 new alleles that caused a similar extent of dwarfing, e.g. in the range 75-91% of the tall height.

[0155] Coleoptile lengths were also measured for the mutant plants, and calculated as a percentage of the average coleoptile length for Rht-B1a plants. The values of means from between 2 and 4 independent measurements are shown in Table 4. There was more variation for coleoptile lengths within a line than found for stem length. In part this may have related to differences between grains from field and greenhouse sources. Field-grown grains are available for the vast majority of lines in the next planting season, and further coleoptile measurements are carried out. It is expected these will show less variation. Overall there was a general positive correlation between stem lengths and coleoptile lengths. Further work is required to assess the statistical significance of differences in some cases where the correlation appears to break down.

[0156] Dormancy of grains of most of the mutant lines was assessed for grain harvested from two field seasons. In both seasons, the tall and Rht-B1b Maringa isolines showed low dormancy whereas the Rht-B1c isoline had relatively high dormancy. There were considerable differences in relative grain dormancy scores between different overgrowth lines. Data are presented in FIG. 9 for some of the lines, compared to the controls. Of particular interest were alleles that provided a suitable semidwarf plant height and which retained considerable grain dormancy such as Rht-B1c.9, c.17, c.22, c.23, c.24, c.26, c.27). These included the four semidwarfing lines currently being back-crossed into elite varieties.

[0157] Many of the lines were tested in a third season in the field. The data for plant height and dormancy score are shown in Table 8. The results were consistent in trend with the previous two seasons, showing that grain of some mutant lines required considerably longer in storage (after-ripening) for 50% of the grains to germinate in the standard germination test (Example 1). Although the trend in dormancy between the lines and the controls was the same from season to season, the absolute numbers for any one line varied from season to season.

Example 4. Isolation of Overgrowth Mutants in Barley

[0158] To isolate overgrowth mutants in barley, three dwarf mutants of Himalaya barley were chosen as starting material. Each mutant comprised a defined single nucleotide substitution in a gene involved in (i) GA biosynthesis, namely Grd2 that encodes GA3-oxidase, (ii) the GA receptor GID1, encoded by the Gse1 gene, and (iii) GA response, namely the Sln1 gene encoding the DELLA protein in barley. Grains of each dwarf line were treated with sodium azide, sown in the field, and allowed to self-fertilise to produce M1 seed. These were sown to produce M1 plants, from which M.sub.2 grains were harvested. Resultant M.sub.2 seedlings growing in soil were screened at the second-leaf stage for those showing more rapid growth than their dwarf siblings. Three different categories of mutant were recovered from a total of about 10.sup.6 grains sown, representing about 50,000 M.sub.1 spikes.

[0159] The first category, of most relevance to this application, included 22 plants that grew more rapidly than their dwarf siblings. These were fully fertile and their progeny plants were uniform and showed rapid growth. In each case the presence of the original dwarfing mutation was confirmed by sequencing the appropriate PCR fragment. Their leaf elongation rates were higher than expected based on a dwarfing mutation being present. They showed a range in extent of growth enhancement, some with leaf elongation rates slightly but significantly faster than their dwarf parent, and others that elongated as fast as or even slightly faster than the corresponding tall wild-type plants (see below). Heights at maturity of the different overgrowth mutants ranged from intermediate between the dwarf parent and wild-type to as tall as the wild-type.

[0160] The second category, recovered only in the Sln1d dwarf background, included three plants that grew more rapidly than their dwarfed siblings but still retained some degree of dwarfism. In the next generation the progeny of these plants consisted of dwarfs and typical elongated slender plants in an approximate 3:1 ratio. Further analysis (below) showed that they comprised new sln1 alleles in which a second mutation functioned as an intragenic suppressor of the Sln1d mutation.

[0161] The third category, observed in the GA biosynthesis and GA receptor dwarf backgrounds, consisted of typical elongated slender mutants. These were easily recognised by their distinctive highly elongated phenotype and pale green colour and, following transplantation, by their highly elongated stems and sterility. This class of mutant was expected because elongated sln1 null alleles are epistatic to defects in either GA biosynthesis or GA receptor function (Chandler and Robertson, 1999).

Example 5. Identification of Barley Mutations and Genetic Linkage Studies

[0162] DNA was prepared from slender plants of the three segregating lines in the Sln1d dwarf background (second category above) and the Sln1 gene was sequenced. Plants of each line contained a different, new mutation in the Sln1 gene resulting in a premature translation termination codon within the open reading frame (ORF). The new mutant alleles were derivatives of Sln1d and were therefore named Sln1d.1, Sln1d.2, Sln1d.3 (Table 1). They represented new intra-allelic mutations, where a second mutation converted the Sln1d dwarfing locus into a typical loss-of-function elongated sln1 allele. These plants were not studied further.

[0163] The entire Sln1 gene was sequenced in each of the overgrowth mutants (first category above), to confirm that the Sln1d allele was still present and to determine whether other mutations occurred in this gene since it was one of several candidate genes in which a new mutation might lead to an overgrowth phenotype. New mutations in the Sln1 ORF were found in 20 of the 22 plants. The mutations defined eleven new alleles of the Sln1 gene. Some of the plants carried identical mutations and were presumably siblings. Seven of the new Sln1 overgrowth alleles occurred in the Sln1d dwarf background and were therefore alleles comprising intra-genic suppressor mutations. These were named Sln1d.4-Sln1d.10. Three mutations occurred in the grd2b background (sln1m, sln1o, sln1s), and one occurred in the gse1n background (sln1n). Each of the new alleles differed from its parental allele by a single nucleotide substitution which resulted in a single amino acid substitution in the SLN1 protein sequence. The amino acid substitutions that were obtained are listed in Table 1 (TR lines). They all occurred in the C-terminal 60% of the SLN1 protein, corresponding to the GRAS domain, and all of them corresponded to analogous mutations in the wheat mutants described above. Two identical mutational events were observed that resulted in the G829A amino acid substitution, one occurring in the Sln1d.7 mutant population and the other in the sln1s population. These were independent mutational events since the former was a derivative of the Sln1d allele, whereas the latter occurred in a wild type Sln1 gene in the grd2b dwarf background.

[0164] The two remaining overgrowth lines (TR26, TR103) lacked any new mutation in the Sln1 ORF and potentially represented mutations in other genes. They occurred in a Sln1d dwarf background. Plants of these lines were crossed to Himalaya, together with Sln1d.5 as a positive control, to assess genetic linkage between the Sln1d dwarfing allele and the new overgrowth allele. The F.sub.2 population from the control WTSln1d.5 cross showed the expected 3:1 (Sln1d.5:WT) distribution in maximal leaf elongation rates. There were no F2 individuals with the slow growth rate of the Sln1d parent, indicating complete linkage in this relatively small population between the original dwarfing mutation and the secondary overgrowth mutation. The secondary mutation was therefore an intra-genic suppressor mutation. A similar result was observed for the TR103WT F.sub.2 population, indicating that the overgrowth mutation in TR103 showed complete linkage to Sln1d. In contrast, the TR26WT F.sub.2 population included a majority of seedlings with growth rates the same as Sln1d, about 25% with growth rates the same as WT, and some seedlings with intermediate growth rates. These results were consistent with the overgrowth mutation in TR26 being in a gene that was unlinked to Sln1.

[0165] Several other candidate GA signalling genes in TR26 were sequenced. The GA receptor (Gse1) and two F-box candidate genes were the same in sequence as in the wild-type, but the sequence of Spindly1 revealed a single nucleotide substitution (spy1a, Table 1) that resulted in an amino acid substitution in the sixth TPR motif of SPY1. In Arabidopsis this region is important for SPY activity because it includes several mutant alleles (Silverstone et al., 2007). SPY1 encodes a negative regulator of GA signalling that was first identified in Arabidopsis, but functionally-related genes were later shown to exist in barley (Robertson et al., 1998) and rice (Shimada et al., 2006).

[0166] In summary, the 22 barley overgrowth mutants represented 13 independent mutational events. Eleven of these were new Sln1 alleles that caused single amino acid substitutions in SLN1. The twelfth was tightly linked to Sln1 but in an unidentified region, possibly a promoter mutation, and the thirteenth was a new allele in an unlinked gene, Spy1.

Example 6. Leaf Elongation Rates of Barley Comprising New Sln1 Alleles

[0167] The maximal daily rate of elongation (LER.sub.max) achieved by the first leaf under standard conditions was a robust measure of GA responsiveness (Chandler and Robertson, 1999) and was therefore determined for all of the barley overgrowth lines and their parents (Table 5). The thirteen original overgrowth lines all had significantly higher LER.sub.max values than their respective dwarf parent, although the extent of growth enhancement varied in an allele-dependent manner. Three overgrowth alleles (sln1m, sln1n and sln1s) were compared in both their original dwarfing genetic background as well as after back-crossing to the tall WT background. Growth rates were consistently lower in dwarf backgrounds, indicating that overgrowth alleles were still subject to decreased GA signalling resulting from either impaired GA biosynthesis or GA receptor function. In a wild-type background, the overgrowth alleles tended to enhance growth rates.

Example 7. -Amylase Production by Endosperm Half-Grains

[0168] The production of -amylase by endosperm half-grains of wild-type barley is dependent on the presence of an active GA. Therefore, monitoring -amylase activity in the absence of an active GA provided a convenient measure of the extent of basal GA signaling in the mutants. Two control lines with normal GA sensitivity (WT, grd2b) showed a near 15-fold increase in -amylase activity over basal levels after 72 h incubation with GA.sub.3 (Table 5). When overgrowth mutants and their dwarf parents were examined, the initial amount of -amylase activity in mature endosperm half-grains was very low, but with incubation some overgrowth lines (Sln1d.4, Sln1d.7, Sln1d.8, Sln1d.9; Sln1d,spy1a; grd2b,sln1m; grd2b,sln1o; grd2b,sln1s) showed enhanced production of -amylase relative to their dwarf parent, whereas others (Sln1d.5, Sln1d.6, Sln1d.10; gse1n,sln1n) did not. Among the overgrowth derivatives of Sln1d, the Sln1d.9 derivative was exceptional, accumulating very high levels of -amylase at both 42 h and 72 h incubation, despite this line showing only a modest restoration of growth rate (Table 5).

Example 8. Other Traits Associated With Overgrowth Alleles

[0169] Plants of the overgrowth lines were close to normal in appearance during growth and at maturity, apart from differences in overall height. There was a range in heights among the nine overgrowth derivatives of Sln1d, although none were as tall as wild-type at maturity. Coleoptile lengths of overgrowth lines varied in general accordance with LER.sub.max values, and with final plant height.

[0170] One general feature of the overgrowth mutant barley plants was that they produced larger grains than their dwarf parents. In different harvests across different growing seasons, grain sizes were generally intermediate between the parental dwarf (grain mass about 40 mg) and the tall wild-type (grain mass about 55 mg). However several of the overgrowth lines that were as tall as wild-type at maturity had considerably larger heads and grains. In different greenhouse generations, the grains of grd2b and sln1m averaged 40% larger than those of the grd2b dwarf parent. When back-crossed to the Himalaya background, there was a 20% average increase observed in grain weight, and on outcrossing to the commercial variety Sloop, a 15% increase was observed in BC.sub.2 material. A full analysis is made when BC.sub.3 sister lines of Sloop are available.

Example 9. Description of Some Perfect Markers

[0171] The new alleles of Rht-B1c in wheat or barley are readily introduced into breeding programs and can be followed by marker assisted selection using a generic perfect marker for the overgrowth alleles. For example for wheat this involves PCR amplification between two primers, one of which is in the 2062bp insertion in the Rht-B1c gene and the other of which is outside of the insertion, such as in the Rht-B1 coding region. Amplification of the appropriate product will only occur when the template DNA is from plant material that contains at least one copy of the overgrowth allele. Two examples of these are given in Table 2. These amplifications can be used to easily distinguish the new alleles derived from Rht-B1c from the other semi-dwarfing allele Rht-B1b and the Rht-D1b semidwarfing gene. Markers for the Rht-B1 gene other than the Rht-B1c allele or its derivative alleles can be generated easily by using a primer pair that flanks the insertion site in Rht-B1c.

Example 10. Backcrossing of Selected Alleles to Other Wheat Varieties

[0172] Crossing studies in barley as described above showed 100% coinheritance between the mutant Rht-B1 alleles and the overgrowth phenotype. In wheat, two crossing experiments were carried out. In the first, plants of six overgrowth lines were crossed with Maringa homozygous for the Rht-B1b allele (semidwarf), and plants of another four lines were crossed with Maringa homozygous for the wild-type Rht-B1a allele (tall). F1 progeny were selfed to produce F2 plants. In no case was the presence of any dwarf (homozygous Rht-B1c) plant detected in the F2 generation, indicating that for each of the ten lines, 100% genetic linkage was observed between the new Rht-B1 alleles and the overgrowth phenotype, and the new mutation suppressing dwarfism was in the Rht-B1 gene rather than being elsewhere in the genome. In the crosses with Rht-B1b, the expected inheritance patterns was shown for the overgrowth alleles and Rht-B1b in F.sub.2 progeny, i.e. a 1:2:1 homozygous:heterozygous:homozygous ratio. In one of the crosses, the overgrowth parent (line TR550, Rht-B1c.8) was observed considerably more dwarfed than Rht-B1b, and the F.sub.2 population showed segregation for height (homozygous overgrowth=65 cm, heterozygous=80-85 cm, homozygous Rht-B1b=95-100 cm) in a ratio not significantly different from 1:2:1, indicating the phenotype was determined by a single gene difference. Importantly, this moderately dwarfed overgrowth allele was associated with high dormancy in line TR550. Moreover, the F3 grain populations from field-grown F2 plants showed high dormancy for Rht-B1c.8 homozygous F2 plants, intermediate dormancy for Rht-B1c.8/Rht-B1b heterozygous F2 plants, and low dormancy for Rht-B1b homozygous F2 plants. This result indicated that the overgrowth allele was determining both the height and the dormancy phenotypes after crossing.

[0173] The four lines crossed with Maringa Rht-B1a were the lines designated 544, 612, 705 and 791 (Table 4), comprising the Rht-B1 alleles Rht-B1c.22, RhtB1c.23, Rht-B1c.24 and Rht-B1c.26, respectively. In each case, the expected genotypic segregation ratio was observed in the F2 generation. The F2 plants homozygous for the overgrowth allele showed the expected height reduction and the enhanced dormancy, indicating that the mutant Rht-B1 alleles could be crossed into other genetic backgrounds and retain the phenotypic effect. This also indicated the genetic linkage of the two phenotypes, namely the semi-dwarf plant height and the enhanced dormancy, caused by the mutant Rht-B1 alleles.

[0174] In the second experiment, selected overgrowth alleles were introduced into elite breeding lines by backcrossing, with the intention of replacing their existing semidwarfing gene (either Rht-B1b or Rht-D1b) with a new overgrowth allele. This was done in order to combine the phenotype of semidwarf height at maturity with other beneficial traits such as improved emergence and higher levels of grain dormancy. Crosses were made using plants of lines 544, 612, 705 and 791 as pollen donors with plants of 10 different elite wheat varieties, namely Crusader, EGA Gregory, Espada, Lincoln, Magenta, Yitpi, Young, KWS Chasmin, KWS Scirocco, McNeal and Outlook. F.sub.1 grains were obtained from all crosses, and for three of the donor alleles were sown for further back-crossing to the recurrent parents. PCR markers were used to confirm that the F1 plants were hybrid. One of the four donors was slightly taller than plants having Rht-B1b, but three of the four donors were very similar in height to each other and to plants having Rht-B1b (semidwarf). One or two additional alleles that are slightly more dwarfed than Rht-B1b, and which have excellent grain dormancy are included in crossing experiments, such as Rht-B1c.3 and/or Rht-B1c.17.

Discussion

[0175] Overgrowth mutants of barley and wheat were isolated following mutagenesis of dwarf varieties containing a severely dwarfing allele. The mutants of interest retained the mutation that caused the severe dwarfing in the parental varieties, but grew faster than the parental plants because of a newly-induced mutation in the same Rht-B1 or Sln1 gene. They were characterised by enhanced GA signalling, although the extent of the enhancement was specific for both the allele and the GA response being considered. The results indicated that the Della genes (Sln1 in barley, Rht-B1 in wheat) were the most frequent sites of overgrowth mutations. In only a single case was a different gene implicatedin barley one of the overgrowth mutants was due to a new mutation in Spy1.

[0176] Five independent lines of evidence supported the conclusion that the new mutations in the Della genes identified here were responsible for the overgrowth phenotypes, rather than an unlinked mutation or a mutation in a different gene, or simply being a general consequence of treatment with mutagen. First, for each of the 13 barley mutants a control gene (Gse1) of about the same length as Sln1 was sequenced, and in no case was a base change detected. Second, the observed mutations were almost exclusively (in 30 of 31 mutants) a substitution of G to A, assuming that C to T represents G to A in the opposite DNA strand, similar to previous observations on azide-induced mutants at other loci including Gse1 (GA receptor), Sln1, genes for GA biosynthesis and starch biosynthesis. The redundancy in the genetic code predicted that with random G to A changes, 33% would have no corresponding amino acid substitution. However not a single case was observed of a silent nucleotide substitution in more than 90 newly-induced mutants each comprising a mutation in an open reading frame in these different barley genes. This absence indicated that mutations were recovered only where an amino acid change impaired protein function, leading to changes in phenotype. Third, the identified mutations nearly always involved amino acid residues that were conserved. For instance, the DELLA mutations involved amino acid residues that were identical, with only two or three exceptions, between cereal species and the taxonomically distant Arabidopsis. This can be seen in FIG. 8 which shows an alignment of wheat Rht-B1a and Arabidopsis GAI proteins, showing the conserved identical amino acids between the two sequences. Substitution of highly conserved amino acid residues would be much more likely to result in functional disruption to protein activity than changes in poorly conserved residues. Fourth, independent mutagenesis treatments gave examples of identical mutations, and therefore the corresponding identical amino acid substitutions, induced within barley, between barley and wheat, and within wheat. Fifth, following crossing and subsequent segregation, 100% linkage was always observed between the mutant phenotypes and the mutant gene sequences where linkage studies were completed.

[0177] Overgrowth alleles enhanced GA signalling and so were most likely to reduce either the amount of DELLA protein or its functional activity, the latter probably involving its interactions with other proteins. In some cases of differential splicing, there was also the potential for DELLA proteins with different in-frame amino acid insertions to be produced. For example, the mutants on occasions produced insertions either shorter or longer than the 30-amino acid insertion in the Rht-B1c protein. Amino acid substitutions could lead to increased degradation of DELLA if they resulted in a stronger affinity for either the GA-GID1 complex or the F-box subunit. Random changes were unlikely to strengthen protein interactions, although with an efficient mutant screen very rare events might still be recovered. Previous attempts to determine the contents of DELLA protein in different parts of the wheat plant by antibody procedures have been unsuccessful (Pearce et al., 2011). The inventors think it more likely that mutant DELLA proteins generated as described above have reduced affinity for other interacting protein partners. A considerable number of amino acid substitutions occurred in the LHR1 motif, a region which in Arabidopsis is involved in interactions with PIF4 and PIL5 (de Lucas et al., 2008; Feng et al., 2008). The differential effects of particular overgrowth alleles on growth versus -amylase production in barley suggested that different regions of the DELLA protein interact with different protein partners to regulate these two responses.

[0178] It was unexpected that almost all of the identified overgrowth mutants were in a single gene, especially one that had been demonstrated to be of fundamental importance in growth control in a range of plant species under both controlled and field conditions. The preponderance of new alleles in the DELLA-encoding gene in both wheat and barley highlighted the importance of this gene in growth control. For instance, among overgrowth derivatives of the GA biosynthetic dwarf, mutants which might have increased the content of active GAs such as, for example, mutations in GA-catabolic genes were not identified despite the numbers of mutants analysed. The success in isolating many new mutants in wheat stemmed from the fact that the dwarfism due to semi-dominant alleles such as Rht-B1c was effectively a diploid trait, involving only one of the three genomes. This allowed selection of a range of loss-of-function (relative to Rht-B1c) derivative alleles, many of which involved intra-genic secondary mutations.

[0179] In both species, new alleles were recovered for an agronomically important trait, namely plant height. In addition, variation was observed in other GA-influenced traits, some of which were of practical interest. In barley larger grain size and increased production of -amylase without the need for GA supplementation were both observed. Both traits were considered to be useful, for example for improved early seedling vigour and improved malting performance, respectively. The large collection of wheat mutants included mutants with a range in the extent of dwarfism beyond that of the existing Rht-1 semi-dwarfing alleles, which are expected to be of value in targeting specific alleles to specific environments (Flintham et al., 1997). There was also considerable variation observed in other GA traits of practical importance, e.g. increased coleoptile length relative to plants homozygous for Rht-1, and increased grain dormancy relative to plants homozygous for either Rht-B1a or Rht-B1b. These alleles should function as major genetic determinants for introducing a set of traits into breeding lines, expedited by the perfect molecular markers available for the gene.

[0180] The DELLA genes are highly conserved across various species. Sequence comparisons between wheat Rht-B1a protein Arabidopsis thaliana GAI proteins are shown in FIG. 8. As can be seen, there was a large degree of identity between these protein sequences across different species. Importantly, of the 20 amino acid substitutions found in the wheat overgrowth mutants, all except two or three were in amino acids conserved between the polypeptides encoded by the wheat and Arabidopsis genes. This was strongly supportive of the residues at these particular positions in the DELLA proteins in various species being particularly important to activity.

TABLE-US-00001 TABLE 1 Barley lines, genotypes and mutations Mutation.sup.1 Line Genotype Nucleotide Amino acid Reference Himalaya WT Sln1d and derivatives M640 Sln1d G137A G46E Chandler et al., 2002 M763seg.sup.2 Sln1d/Sln1d.1 G294A.sup.3 W98ter.sup.3 This study M778seg.sup.2 Sln1d/Sln1d.2 G1041A.sup.3 W347ter.sup.3 M783seg.sup.2 Sln1d/Sln1d.3 G1839A.sup.3 W613ter.sup.3 TR1 Sln1d.4 C1469T.sup.3 S490F.sup.3 TR9 Sln1d. 5 G839A.sup.3 R280H.sup.3 TR13 Sln1d. 6 G803A.sup.3 R268H.sup.3 TR26 Sln1d, spy1a G812A (Spy7) G271D (SPY1) TR56.sup.4 Sln1d.7 G829A.sup.3 A277T.sup.3 TR60.sup.4 Sln1d.8 G691A.sup.3 V231M.sup.3 TR100.sup.4 Sln1d.9 G1442A.sup.3 R481H.sup.3 TR103.sup.4 TR107 Sln1d.10 G844T.sup.3 V282F.sup.3 grd2b and derivatives M463 grd2b Wolbang et al., 2004 TR216 grd2b, sln1s G829A A277T This study TR261 grd2b, sln1m G680A G227E TR305 grd2b, sln1o C1454T S485F gseln and derivatives M693 gse1n Chandler et al., 2008 TR407 gse1n, sln1n G710A C237Y This study Other derived lines M240.sup.4 sln1m As above This study M242.sup.4 sln1n M243.sup.4 sln1s M244seg.sup.2 sln1s/Sln1d.7 M247.sup.4 spy1a M248 grd2b, spy1a M249 gse1l, spy1a Footnotes .sup.1Coordinates refer to the positions in the HvSln1 coding sequence or SLN1 amino acid sequence from Himalaya (Genbank accession AK372064) starting at ATG and ending at TGA. For TR26, the coordinate refers to the position in the HvSpy1 (AF035820) coding sequence or SPY1 amino acid sequence, starting at ATG and ending at TGA. .sup.2Grains are progeny from heterozygotes segregating at the Sln1 locus as indicated (the homozygous elongated slender plants are sterile). .sup.3Sln1d.1-Sln1d.10 are derivatives of Sln1d, and contain the original Sln1d mutation in addition to the new substitutions indicated. Only the overgrowth lines (Sln1d.4-Sln1d.10) can be maintained as homozygotes. .sup.4Lines established after two backcrosses to Himalaya before selecting for homozygosity of the allele shown.

TABLE-US-00002 TABLE2 NucleotidesequencesofPCR primersusedhereinSEQIDNO(5to3) Sequencingprimers SEQIDNO 1 Rht3F40 GGCAAGCAAAAGCTTGAGATAGAT SEQIDNO:17 Rht3R55 GGTGCAGGGCAATAAGATG SEQIDNO:18 2 Rht3F54 GACAGCACCAGACGCTCAC SEQIDNO:19 Rht3R2 GCTCTCGACCCAGGAGGAG SEQIDNO:20 3 Rht3F48 TGGAGCAGCTGGAGATGG SEQIDNO:21 Rht3R8 TAGGGGCAGGACTCGTAGAA SEQIDNO:22 4 Rht3F13 GCGCTGGTGAAGCAGATAC SEQIDNO:23 Rht3R40 TTCAAACTCGCGGTCACG SEQIDNO:24 Insertprimers 1 NHBF.2 TCTCCTCCCTCCCCACCCCAAC SEQIDNO:25 Rht3R5 GCGTCCGGTGGAGTTGCC SEQIDNO:26 2 Rht3F6 GTGTTTTTCCCAGCCCTCTT SEQIDNO:27 Rht3R2 GCTCTCGACCCAGGAGGAG SEQIDNO:28 D-genomespecificprimers Rht-D1F GAGGTAGCTCGCGGATCA SEQIDNO:29 Rht-D1R CGTTCAAAACTCGCGAGA SEQIDNO:30

TABLE-US-00003 TABLE 3 Wheat lines, Rht-B1 genotype and mutations Rht-Bl allele Mutation in Rht-B1c Amino acid substitution or effect Rht-B1a wild-type none Rht-B1b Rht-B1c Insertion Insertion Rht-B1c.1 G2715A G260E Rht-B1c.2 G2726A V264M Rht-B1c.3 G2747A A271T Rht-B1c.4 G2829A G298D Rht-B1c.5 G2831A A299T Rht-B1c.6 G2849A A305T Rht-B1c.7 C2865T A310V Rht-B1c.8 C2966T P344S Rht-B1c.9 C2972T L346F Rht-B1c.10 G3065A G377R Rht-B1c.11 G3076A W380ter Rht-B1c.12 C3117T P394L Rht-B1c.13 G3190A W418ter Rht-B1c.15 G3477A R514H Rht-B1c.16 C3507T T524I Rht-B1c.17 C3519T S528F Rht-B1c.18 G3624A G563D Rht-B1c.19 G3697A W587ter Rht-B1c.20 G3874A W646ter Rht-B1c.21 G2792A V286M Rht-B1c.22 CC2108TA P58ter Rht-B1c.23 G3047A D371N Rht-B1c.24 G2864A A310T Rht-B1c.25 C3071T Q379ter Rht-B1c.26 G3671A E579K Rht-B1c.27 G148A splicing Rht-B1c.28 G148T splicing Rht-B1c.29 G147A splicing Rht-B1c.30 G2084A splicing Rht-B1c.31 G2335A W133ter Rht-B1c.32 G2083A Splicing Rht-B1c.33 G3841A W635ter Rht-B1c.34 G3290T E452ter Rht-B1c.35 C2705T Q257ter

TABLE-US-00004 TABLE 4 Phenotypes of overgrowth lines according to allele Mature Coleoptile Dormancy Dormancy Rht-B1 TR height length Score Score allele lines (% tall) (% tall) Season 1 Season 2 Rht-B1a 100 100 1.0 1.0 Rht-B1b 81 84 1.0 1.0 Rht-B1c 42 63 4.0 4.0 Rht-B1c.1 704 90 91 2.0 713 90 91 2.0 714 92 83 2.0 761 89 94 1.0 762 92 97 2.0 778 95 88 779 98 93 1 781 93 83 1 793 76 86 2.0 804 99 87 1.0 811 92 89 1.0 813 93 101 2 827 92 96 2.0 830 95 99 845 96 73 2 873 98 97 1 879 88 93 1.0 Rht-B1c.1 Mean 92 91 1.5 2.0 Rht-B1c.2 610 93 102 2.0 618 96 98 1.0 675 96 82 1.0 881 88 89 1 884 97 105 1 947 97 96 2.0 982 98 93 Rht-B1c.2 Mean 95 95 1.3 Rht-B1c.3 917 70 75 4.0 2.0 920 71 78 2.0 2.0 Rht-B1c.3 Mean 70 76 3.0 2.0 Rht-B1c.4 885 67 85 4.0 Rht-B1c.5 725 65 67 3.0 Rht-B1c.6 875 59 70 2.0 983 71 84 2.0 Rht-B1c.6 Mean 65 77 2.0 Rht-B1c.7 543 77 91 1.0 2.0 602 92 95 1.0 606 90 97 1.0 608 95 88 3.0 641 89 92 646 89 94 3.0 679 90 79 1.0 680 93 90 1.0 710 91 95 2.0 784 98 102 1.0 785 94 91 1.0 790 97 92 1.0 943 82 88 1.0 1.0 950 95 108 1.0 Rht-B1c.7 Mean 91 93 1.4 Rht-B1c.8 550 59 80 4.0 3.0 770 59 86 Rht-B1c.8 Mean 59 83 4.0 3.0 Rht-B1c.9 703 86 90 3.0 3.0 730 91 86 2.0 2.0 Rht-B1c.9 Mean 88 88 2.5 2.5 Rht-B1c.10 886 64 80 3.0 Rht-B1c.11 615 100 94 1.0 701 93 82 1.0 712 98 96 2.0 771 102 95 1.0 777 103 96 1.0 782 98 99 1.0 786 99 97 1.0 792 100 93 875 Rht-B1c.11 Mean 99 94 1.1 Rht-B1c.12 687 53 76 4.0 Rht-B1c.13 692 80 104 1.0 810 96 103 1.0 846 101 89 1.0 870 99 108 1.0 882 87 87 1.0 890 90 100 979 97 105 1.0 990 90 91 Rht-B1c.13 Mean 92 98 1.0 Rht-B1c.14 973 57 82 4.0 Rht-B1c.15 911 90 95 3.0 Rht-B1c.16 510 89 92 2.0 2.0 Rht-B1c.17 603 78 84 1.0 3.0 672 80 85 3.0 3.0 686 76 89 2.0 3.0 842 80 81 2.0 3.0 Rht-B1c.17 Mean 78 85 2.0 3.0 Rht-B1c.18 613 96 94 4.0 671 93 88 3.0 783 99 97 1.0 805 94 105 1.0 Rht-B1c.18 Mean 96 96 2.3 Rht-B1c.19 508 85 95 2.0 2.0 611 94 97 1.0 648 97 112 2.0 667 98 98 1.0 Rht-B1c.19 Mean 93 100 1.5 Rht-B1c.20 601 93 90 614 97 93 1.0 622 97 90 1.0 647 99 92 2.0 649 102 95 1.0 664 97 98 1.0 666 98 98 1.0 674 99 84 1.0 677 99 96 1.0 682 95 97 1.0 683 98 90 1.0 684 99 87 1.0 685 103 84 889 90 910 95 94 1.0 986 95 122 989 84 91 Rht-B1c.20 Mean 96 94 1.1 Rht-B1c.21 878 58 74 3.0 981 63 82 2.0 Rht-B1c.21 Mean 60 78 2.5 Rht-B1c.22 544 84 86 4.0 1.0 Rht-B1c.23 612 74 82 2.0 3.0 623 76 80 3.0 3.0 Rht-B1c.23 Mean 75 81 2.5 3.0 Rht-B1c.24 542 81 88 688 85 92 3.0 705 77 90 3.0 3.0 722 82 84 4.0 3.0 723 84 84 2.0 3.0 741 97 85 1.0 877 81 88 3.0 2.0 Rht-B1c.24 Mean 84 87 2.6 2.8 Rht-B1c.25 774 102 85 1.0 776 100 90 1.0 Rht-B1c.25 Mean 101 88 1.0 Rht-B1c.26 717 74 78 2.0 3.0 773 76 75 2.0 791 80 83 3.0 3.0 815 78 80 3.0 Rht-B1c.26 Mean 77 79 2.7 2.7 Rht-B1c.27 507 77 67 1.0 1.0 605 76 73 4.0 1.0 624 84 76 2.0 1.0 880 77 75 1.0 1.0 Rht-B1c.27 Mean 79 73 2.0 1.0 Rht-B1c.28 645 81 73 1.0 1.0 Rht-B1c.29 901 83 72 1.0 1.0 Rht-B1c.30 670 84 92 1.0 1.0 678 82 85 1.0 1.0 690 80 78 1.0 752 86 82 1.0 1.0 Rht-B1c.30 Mean 83 84 1.0 1.0 Rht-B1c.31 872 102 89 1 902 100 92 1 912 101 84 1 Rht-B1c.31 Mean 101 88.3 1.0 Rht-B1c.32 913 91 87 1.0 987 82 88 Rht-B1c.32 Mean 87 87.5 1.0 Rht-B1c.33 644 98 101 1.0 729 98 112 1.0 750 95 92 1.0 789 95 91 1.0 Rht-B1c.33 Mean 97 99 1.0 Rht-B1c.34 728 98 91 1.0 745 95 89 1.0 Rht-B1c.34 Mean 96 90 1.0 Rht-B1c.35 914 95 87 971 96 92 1.0 Rht-B1c.35 Mean 96 89.5 1.0

TABLE-US-00005 TABLE 5 Leaf elongation rates and -amylase production of barley overgrowth mutants -Amylase (Ceralpha units/grain) at: Genotype LER.sub.max 0 h Line LER (mm .Math. d.sup.1) (10.sup.3) 42 h 72 h Him WT 34.6 0.9 1.6 0.36 0.08 1.7 0.09 Him WT 52.3 0.1 nd 9.81 0.86 23.1 2.8 (GA.sub.3) M640 Sln1d 9.2 0.2 1.6 0.21 0.01 0.19 0.05 M640 Sln1d 12.1 0.3 nd nd nd (GA.sub.3) TR1 Sln1d.4 23.8 0.5 2.5 0.26 0.01 2.88 0.27 TR9 Sln1d.5 15.5 0.7 1.6 0.21 0.01 0.16 0.04 TR13 Sln1d.6 15.8 0.6 1.8 0.20 0.02 0.19 0.04 TR26 See Table 6 TR56 Sln1d.7 16.7 0.6 2.7 0.93 0.22 3.24 0.47 TR60 Sln1d.8 28.6 0.9 3.6 0.82 0.13 3.76 0.23 TR100 Sln1d.9 20.2 0.6 3.2 4.34 0.13 14.6 0.39 TR103 16.1 0.4 3.4 0.74 0.10 0.39 0.1 TR107 Sln1d.10 13.2 0.3 2.4 0.39 0.07 0.17 0.03 M463 grd2b 16.9 0.8 2.5 0.67 0.04 1.3 0.2 M463 grd2b 49.8 0.8 nd 7.20 0.73 18.9 1.4 (GA.sub.3) TR216 grd2b, sln1s 23.2 0.6 4.1 1.01 0.12 4.16 0.55 TR261 grd2b, sln1m 38.4 1.5 3.8 7.50 0.24 18.1 0.8 TR305 grd2b, sln1o 32.9 0.9 3.8 9.85 0. 43 16.9 1.2 M693 gse1n 19.7 0.4 2.5 0.29 0.05 0.11 0.01 M693 gse1n 35.3 1.2 nd nd nd (GA.sub.3) TR407 gse1n, sln1n 29.3 0.5 9.9 0.27 0.03 0.26 0.13 M240 sln1m 42.2 1.6 6.5 11.6 1.4 22.6 2.3 M242 sln1n 44.3 3.1 3.0 1.07 0.08 6.39 1.52 M243 sln1s 35.4 0.9 3.8 3.66 0.53 15.4 0.9

TABLE-US-00006 TABLE 6 Effect of spy1a on growth rates and -amylase production -Amylase (Ceralpha units/grain) at: Genotype 0 h Line LER.sub.max (mm .Math. d.sup.1) (10.sup.3) 42 h 72 h Himalaya WT 34.6 0.9 1.6 0.36 0.08 1.7 0.09 M247 spy1a 37.6 0.7 4.6 3.33 0.22 12.5 1.2 M640 Sln1d 9.2 0.2 1.6 0.21 0.01 0.19 0.05 TR26 Sln1d, 17.1 0.4 2.3 0.66 0.10 2.84 0.46 spy1a M463 grd2b 17.7 0.6 2.1 0.53 0.1 3.7 0.3 M248 grd2b, 23.4 0.5 3.6 10.2 0.9 15.0 1.8 spy1a M691 gse1l 20.6 0.4 1.6 0.07 0.01 0.13 0.03 M249 gse1l, 25.8 0.5 2.1 1.2 0.2 7.2 1.0 spy1a

TABLE-US-00007 TABLE 7 Coleoptile lengths (in mm) of barley overgrowth lines Line Genotype Coleoptile lenth (mm) Himalaya WT 100.3 1.6 M640 Sln1d 32.6 1.8 TR1 Sln1d.4 65.8 3.1 TR9 Sln1d.5 40.7 2.4 TR13 Sln1d.6 45.2 1.8 TR26 Sln1d, spy1a 50.9 1.0 TR56 Sln1d.7 60.7 2.1 TR60 Sln1d.8 80.7 2.5 TR100 Sln1d.9 66.9 1.7 TR103 58.5 1.5 TR107 Sln1d.10 44.6 2.0 M463 grd2b 62.4 2.2 TR216 grd2b, sln1s 84.1 1.7 TR261 grd2b, sln1m 96.4 3.5 TR305 grd2b, sln1o 104.4 2.0 M693 gse1n 72.0 1.5 TR407 gse1n, sln1n 89.7 1.5 M240 sln1m 123.3 2.7 M242 sln1n 119.8 2.3 M243 sln1s 112.9 4.6 M247 spy1a 101.6 2.5

TABLE-US-00008 TABLE 8 Plant height relative to tall variety (Rht-B1a allele) and grain dormancy scores for wheat plants of the mutant lines Dormancy score* Rht allele Height (% tall) 2012 Rht-B1a 100 0 Rht-B1b 81 0 Rht-B1c 42 8 Rht-B1c.1 93 2 Rht-B1c.2 95 0 Rht-B1c.3 71 2 Rht-B1c.4 67 4 Rht-B1c.5 65 5 Rht-B1c.6 71 5 Rht-B1c.7 91 1.5 Rht-B1c.8 59 5 Rht-B1c.9 88 2 Rht-B1c.14 57 3 Rht-B1c.15 90 0.5 Rht-B1c.16 89 0 Rht-B1c.17 78 4 Rht-B1c.18 96 1.5 Rht-B1c.21 60 4 Rht-B1c.22 84 1 Rht-B1c.23 75 3 Rht-B1c.24 82 3.5 Rht-B1c.26 77 3.5 Rht-B1c.27 81 1.5 Rht-B1c.28 81 0 Rht-B1c.29 83 0.5 Rht-B1c.30 83 1 Rht-B1c.36 55 4 *Dormancy score calculated as the number of weeks of storage of the grain in order for 50% of the grains to germinate in the germination test

REFERENCES

[0181] Achard et al., (2009). J. Exptl Bot. 60, 1085-1092. [0182] Arana et al., (2011). Proc. Natl. Acad. Sci. USA. 108, 9292-9297. [0183] Asano et al., (2009). Mol. Genet Genomics 281, 223-231. [0184] Carol et al., (1995Planta 197, 414-417. [0185] Chandler et al., (1999). Plant Physiol. 120, 623-632. [0186] Chandler et al., (2002). Plant Physiol 129, 181-190. [0187] Chandler et al., (2008). Mol. Plant. 1, 285-294. [0188] de Lucas M et al., (2008). Nature 451, 480-484. [0189] Dill et al., (2004). Plant Cell 16, 1392-1405. [0190] Ellis et al., (2005). Theor Appl Genet 111, 423-430. [0191] Feng et al., (2008). Nature 451, 475-479. [0192] Flintham et al., (1997). J. Agric. Sci. 128, 11-25. [0193] Fu et al., (2002). Plant Cell 14, 3191-3200. [0194] Griffiths et al., (2006). Plant Cell 18, 3399-3414. [0195] Hartweck, (2008). Planta 229, 1-13. [0196] Hirano et al., (2010). Plant Cell 22, 2680-2696. [0197] Hoogendoorn et al., (1988). In Miller T. E., Koebner, R. M. D., Proceedings of the Seventh International Wheat Genetics Symposium, Institute of Plant Science Research, Cambridge, U.K., pp. 1093-1100. [0198] Ikeda et al., (2001). Plant Cell, 13, 999-1010. [0199] Kuppusamy et al., (2009). Plant Mol. Biol. 69, 375-381. [0200] Monna et al., (2002). DNA Res. 9, 11-17. [0201] Murase et al., (2008). Nature 456, 459-463. [0202] Pearce et al., (2011). Plant Physiol. DOI:10.1104/pp. 111.183657. [0203] Peng et al., J (1999 Nature 400, 256-261. [0204] Robertson et al., (1998). Plant Cell 10, 995-1007. [0205] Sasaki et al., (2002). Nature 416, 701-702. [0206] Sasaki et al., (2003). Science 299, 1896-1898. [0207] Shimada et al., (2006). Plant J. 48, 390-402. [0208] Shimada et al., (2008 Nature 456, 520-544. [0209] Silverstone et al., (1997). Genetics 146, 1087-1099. [0210] Silverstone et al., (2007). Plant Physiol. 143, 987-1000. [0211] Spielmeyer et al., (2002). Proc Natl Acad Sci (USA) 99, 9043-9048. [0212] Sun, (2010). Plant Physiol 154, 567-570. [0213] Ueguchi-Tanaka et al., (2005). Nature 437, 693-698. [0214] Willige et al., (2007). Plant Cell 19, 1209-1220. [0215] Wilson et al., (1995). Plant Physiol 108: 495-502. [0216] Wolbang et al., (2004). Plant Physiol 134, 769-776. [0217] Wu et al., (2011) Plant Physiol DOI:10.1104/pp. 111.185272. [0218] Yamaguchi, (2008). Annu. Rev. Plant Biol. 59, 225-251. [0219] Yamamoto et al., (2010). Plant Cell 22, 3589-3602. [0220] Zwar et al., (1995). Planta 197, 39-48.