FLUORESCENT DYES AND METHODS OF USE THEREOF
20210079034 ยท 2021-03-18
Assignee
Inventors
Cpc classification
C07H21/00
CHEMISTRY; METALLURGY
C07D491/147
CHEMISTRY; METALLURGY
C07D405/12
CHEMISTRY; METALLURGY
C07H19/04
CHEMISTRY; METALLURGY
C09B11/24
CHEMISTRY; METALLURGY
C12Q1/707
CHEMISTRY; METALLURGY
C09B11/06
CHEMISTRY; METALLURGY
International classification
C07H21/00
CHEMISTRY; METALLURGY
C07H19/04
CHEMISTRY; METALLURGY
C09B11/06
CHEMISTRY; METALLURGY
C09B11/24
CHEMISTRY; METALLURGY
Abstract
Provided are methods for labeling target molecules, such as nucleic acids, with fluorescent dye compounds having the formula
##STR00001##
One method embodiment includes contacting reactive group Z of the fluorescent dye compound with the target molecule such that reactive group Z reacts with the target molecule to form a covalent bond between the group and the target molecule. Another method embodiment includes contacting a fluorescent dye compound that further includes a first member of a binding pair, with a target molecule that includes a second member of the binding pair. Also provided are target molecules labeled with the fluorescent dye compounds.
Claims
1. A method for fluorescently labeling a target molecule, comprising the steps of: providing a fluorescent dye compound having the formula: ##STR00031## wherein R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.7, R.sup.8, R.sup.9, and R.sup.10 are independently H, F, Cl, Br, I, CN, nitro, azido, hydroxyl, amino, hydrazino, (substituted) aryl, (substituted) aryloxy, alkenyl, alkynyl, alkyl, alkoxy, alkylamino, dialkylamino, arylamino, diarylamino, alkyl(aryl)amino, alkanoylamino, alkylthio, alkylcarbonyl, aryl carbonyl, alkylthiocarbonyl, arylthiocarbonyl, alkyloxycarbonyl, aroxycarbonyl, alkylaminocarbonyl, arylaminocarbonyl, dialkylaminocarbonyl, diarylaminocarbonyl, alkyl(aryl)aminocarbonyl, arylcarboxamido, or Q, the alkyl or alkoxy portions of which are saturated or unsaturated, linear or branched, unsubstituted or further substituted by F, Cl, Br, I, CN, OH, alkenyl, alkynyl, alkylcarbonyl, amide, thioamide, or Q; wherein Q is selected from the group consisting of a carboxyl group (CO.sub.2.sup.), a carbonate ester (COER.sup.11), a sulfonate ester (SO.sub.2ER.sup.11), a sulfoxide (SOR.sup.11), a sulfone (SO.sub.2CR.sup.11R.sup.12R.sup.13), a sulfonamide (SO.sub.2NR.sup.11R.sup.12), a phosphate (PO.sub.4.sup.=), a phosphate monoester (PO.sub.3.sup.ER.sup.11), a phosphate diester (PO.sub.2ER.sup.11ER.sup.12), a phosphonate (PO.sub.3.sup.32 ), a phosphonate monoester (PO.sub.2.sup.ER.sup.11) a phosphonate diester (POER.sup.11ER.sup.12), a thiophosphate (PSO.sub.3.sup.=), a thiophosphate monoester (PSO.sub.2.sup.31 ER.sup.11), a thiophosphate diester (PSOER.sup.11ER.sup.12), a thiophosphonate (PSO.sub.2), a thiophosphonate monoester (PSO.sup.ER.sup.11), a thiophosphonate diester (PSER.sup.11ER.sup.12), a phosphonamide (PONR.sup.11R.sup.12NR.sup.14R.sup.15), a phosphonamide thioanalogue (PSNR.sup.11R.sup.12NR.sup.14R.sup.15), a phosphoramide (PONR.sup.11R.sup.12NR.sup.13NR.sup.14R.sup.15), a phosphoramide thioanalogue (PSNR.sup.11R.sup.12NR.sup.13NR.sup.14R.sup.15S), a phosphoramidite (PO.sub.2R.sup.14NR.sup.11R.sup.12), and a phosphoramidite thioanalogue (POSR.sup.14NR.sup.11R.sup.12), wherein E can independently be O or S, and wherein the aryl portions of any of the above are optionally substituted by F, Cl, Br, I, CN, OH, alkenyl, alkynyl, alkylcarbonyl, amide, or thioamide; wherein R.sup.1 in combination with R.sup.2, R.sup.3 in combination with R.sup.4, R.sup.5 in combination with R.sup.6, or R.sup.9 in combination with R.sup.10 can independently form a 5-10 member ring structure which is saturated or unsaturated, and which is optionally further substituted with an alkyl, an aryl, an alkenyl, an alkynyl, an alkoxy, an aryloxy, a hydroxyl, F, Cl, Br, I, CN, a nitro, an alkylsulfonyl, an arylsulfonyl, an alkylsulfinyl, an arylsulfinyl, a (thio)carbonyl, a (thio)carboxylic acid, a (thio)carboxylic acid ester, a nitro, an amino, a (thio)amide, an azido, a hydrazino, or a (thio)phosphonate where each alkyl group or alkoxy group is independently saturated or unsaturated, linear or branched, or substituted or unsubstituted and each aryl group wherein is independently optionally substituted with F, Cl, Br, I, CN, OH, an alkyl, an alkenyl, an alkynyl, an alkoxy, an aryoxy, an alkylthio, an arylthio, a nitro, an azido, a hydrazino, a carboxyl, a thiocarboxyl, a carbonyl, a thiocarbonyl, a carboxylic acid ester, a thiocarboxylic acid ester, or an amino, amide, thioamide, or Q; R.sup.11, R.sup.12, R.sup.13, R.sup.14 and .sup.15 are independently hydrogen, a halogen, an amino group, an alkyl group wherein said alkyl group is saturated or unsaturated, linear or branched, or substituted or unsubstituted, an alkoxy group wherein said alkoxy group is saturated or unsaturated, branched or linear, or substituted or unsubstituted, an aryl group wherein said aryl group is unsubstituted or substituted; wherein R.sup.11 in combination with R.sup.12, R.sup.14 in combination with R.sup.15, R.sup.11 in combination with R.sup.13, R.sup.11 in combination with R.sup.14, R.sup.12 in combination with R.sup.15, or R.sup.13 in combination with R.sup.14 can independently form a 5-10 member ring; X is O, OR.sup.16, NR.sup.17R.sup.18 or N.sup.+R.sup.17R.sup.18; Y is O, OR.sup.16, NR.sup.19R.sup.20 or N.sup.+R.sup.19R.sup.20, wherein R.sup.16, R.sup.17, R.sup.18, R.sup.19 and R.sup.20 are independently H, alkyl, alkenyl, alkynyl, or aryl; or R.sup.17 in combination with R.sup.18, or R.sup.19 in combination with R.sup.20 can independently form a 5-10 member ring structure which is optionally further substituted with alkyl, alkenyl, alkynyl, aryl, alkoxy, F, Cl, Br, I, carboxylic acid or carboxylic acid ester, where the alkyl group is saturated or unsaturated, linear or branched, and is optionally further substituted by F, Cl, Br, I, CN, OH, alkenyl, alkynyl, nitro, azido, hydrazino, alkoxy, aryoxy, alkylthio, arylthio, thiocarboxyl, carbonyl, thiocarbonyl, thiocarboxylic acid ester, amino, amide, thioamide, or Q, and the aryl group wherein is optionally substituted by F, Cl, Br, I, CN, OH, alkoxy, aryoxy, alkylthio, arylthio, nitro, azido, hydrazino, carboxyl, thiocarboxyl, carbonyl, thiocarbonyl, carboxylic acid ester, thiocarboxylic acid ester, amino, amide, thioamide, or Q; wherein R.sup.17 in combination with R.sup.6, R.sup.18 in combination with R.sup.7, R.sup.19 in combination with R.sup.8, and R.sup.20 in combination with R.sup.9, can independently form a 5- to 10-member ring structure that is saturated or unsaturated and optionally further substituted with an alkyl, an aryl, an alkenyl, an alkynyl, an alkoxy, an aryloxy, a hydroxyl, F, Cl, Br, I, CN, a nitro, a carbonyl, a thiocarbonyl, a thiocarboxylic acid, a thiocarboxylic acid ester, a nitro, an amino, a (thio)amide, an azido, a hydrazino, or Q, wherein the alkyl group herein is saturated or unsaturated, linear or branched, substituted or unsubstituted, an alkoxy group wherein the alkoxy group is saturated or unsaturated, branched or linear, substituted or unsubstituted; and wherein the aryl group is optionally substituted with F, Cl, Br, I, CN, OH, alkenyl, alkynyl, alkoxy, aryoxy, alkylthio, arylthio, nitro, azido, hydrazino, carboxyl, thiocarboxyl, carbonyl, thiocarbonyl, carboxylic acid ester, thiocarboxylic acid ester, amino, amide, thioamide, or Q; A is O, S or NR.sup.21, wherein R.sup.21 is a hydrogen, an alkyl, an aryl, an alkenyl, an alkynyl, an alkylcarbonyl, an arylcarbonyl, an alkylaminocarbonyl, or an arylaminocarbonyl, the alkyl or aryl portions of which is optionally substituted by an alkyl, an aryl, an alkenyl, an alkynyl, F, Cl, Br, I, CN, OH, an alkoxy, an aryoxy, an alkylthio, an arylthio, a nitro, an azido, a hydrazino, a thiocarboxyl, a carbonyl, a thiocarbonyl, a thiocarboxylic acid ester, or an amino, amide, thioamide, or Q; B is an alkyl, an alkenyl, an alkynyl, or an aryl linker, the alkyl or aryl portions of which is optionally substituted by an alkyl, an alkenyl, an alkynyl, an aryl, F, Cl, Br, I, CN, OH, an alkoxy, an aryoxy, an alkylthio, an arylthio, a nitro, an azido, a hydrazino, a carboxyl, a thiocarboxyl, a carbonyl, a thiocarbonyl, a carboxylic acid ester, a thiocarboxylic acid ester, or an amino, amide, thioamide, or Q; or B in combination with A form an amide, a thioamide, a carboxylic acid ester, a carboxylic acid thioester, a thiocarboxylic acid ester, an imine, a hyrazone, or Q; and Z is a reactive group selected from the group consisting of an isocyanate, an isothiocyanate, a monochlorotriazine, a dichlorotriazine, a 4,6-dichloro-1,3,5-triazines, a mono- or di-halogen substituted pyridine, a mono- or di-halogen substituted diazine, a maleimide, a haloacetamide, an aziridine, a sulfonyl halide, a carboxylic acid, an acid halide, a phosphonyl halide, a phosphoramidite (PO.sub.2R.sup.14NR.sup.11R.sup.12), a phosphoramidite thioanalogue (POSR.sup.14NR.sup.11R.sup.12), a hydroxysuccinimide ester, a hydroxysulfosuccinimide ester, an imido ester, an azido, a nitrophenol ester, an azide, a 3-(2-pyridyl dithio)-propionamide, a glyoxal, an aldehyde, a thiol, an amine, a hydrazine, a hydroxyl, a terminal alkene, a terminal alkyne, a platinum coordinate group and an alkylating agent, wherein the carbon lengths for said alkenyl, alkynyl, and alkyl groups are in the range of 1 to 16; providing a target molecule to be labeled, wherein the target molecule is a peptide or a protein, and; contacting the fluorescent dye compound with the target molecule such that reactive group Z reacts with the target molecule to form a covalent bond between reactive group Z and the target molecule.
2. The method of claim 1, wherein ABZ is ##STR00032## wherein n is 1-10.
3. The method of claim 2, wherein n is 1-4.
4. The method of claim 2, wherein ABZ is ##STR00033##
5. The method of claim 1, wherein ABZ is ##STR00034##
6. The method of claim 1, wherein the fluorescent dye compound has the structure ##STR00035##
7. The method of claim 6, wherein R.sup.6 and R.sup.9 are both H or CH.sub.3.
8. The method of claim 6, wherein X and Y are (a) OH and O, respectively; (b) NHCH.sub.2CH.sub.3 and NCH.sub.2CH.sub.3, respectively; or (c) N(CH.sub.3).sub.2 and N.sup.+(CH.sub.3).sub.2, respectively.
9. The method of claim 1, wherein the fluorescent dye compound is selected from the group consisting of: ##STR00036## ##STR00037##
10. The method of claim 9, wherein the fluorescent dye compound is selected from the group consisting of: ##STR00038##
11. The method of claim 1, wherein the fluorescent dye compound is selected from the group consisting of: ##STR00039##
12. The method of claim 1, wherein the fluorescent dye compound is selected from the group consisting of: ##STR00040## ##STR00041## ##STR00042## ##STR00043## wherein E.sup. is an anion.
13. The method of claim 1, wherein the target molecule is a peptide.
14. The method of claim 1, wherein the target molecule is a protein.
15. The method of claim 14, wherein the target molecule is an antibody or an antibody fragment.
16. The method of claim 9, wherein the target molecule is an antibody or an antibody fragment.
17. The method of claim 12, wherein the target molecule is an antibody or an antibody fragment.
18. The method of claim 1, wherein the carbon lengths for said alkenyl, alkynyl, and alkyl groups are in the range of 1 to 10.
19. The method of claim 13, wherein the carbon lengths for said alkenyl, alkynyl, and alkyl groups are in the range of 1 to 10.
20. The method of claim 14, wherein the carbon lengths for said alkenyl, alkynyl, and alkyl groups are in the range of 1 to 10.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0039]
[0040]
[0041]
[0042]
[0043]
DETAILED DESCRIPTION
[0044] As used herein, the singular forms a, an and the are intended to include the plural forms as well, unless the context clearly indicates otherwise. Additionally, the use of or is intended to include and/or, unless the context clearly indicates otherwise.
[0045] Provided herein are novel rhodamine dyes that are useful for, e.g., labeling nucleic acids or other molecules. In some embodiments, the present invention provides a compound comprising:
##STR00003##
wherein
[0046] R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.7, R.sup.8, R.sup.9, and R.sup.10 are independently H, F, Cl, Br, I, CN, nitro, azido, hydroxyl, amino, hydrazino, (substituted) aryl, (substituted) aroxyl, alkenyl, alkynyl, alkyl, alkoxy, alkylamino, dialkylamino, arylamino, diarylamino, alkyl(aryl)amino, alkanoylamino, alkylthio, alkylcarbonyl, aryl carbonyl, alkylthiocarbonyl, arylthiocarbonyl, alkyloxycarbonyl, aroxycarbonyl, alkylaminocarbonyl, arylaminocarbonyl, dialkylaminocarbonyl, diarylaminocarbonyl, alkyl(aryl)aminocarbonyl, arylcarboxamido, or Q, the alkyl or alkoxy portions of which are saturated or unsaturated, linear or branched, unsubstituted or further substituted by F, Cl, Br, I, CN, OH, alkenyl, alkynyl, alkylcarbonyl, amide, thioamide, or Q; wherein Q comprises a carboxyl group (CO.sub.2.sup.), a carbonate ester (COER.sup.11), a sulfonate ester (SO.sub.2ER.sup.11), a sulfoxide (SOR.sup.11), a sulfone (SO.sub.2CR.sup.11R.sup.12R.sup.13), a sulfonamide (SO.sub.2NR.sup.11R.sup.12), a phosphate (PO.sub.4.sup.=), a phosphate monoester (PO.sub.3.sup.ER.sup.11), a phosphate diester (PO.sub.2ER.sup.11ER.sup.12), a phosphonate (PO.sub.3.sup.=), a phosphonate monoester (PO.sub.2.sup.ER.sup.11), a phosphonate diester (POER.sup.11ER.sup.12), a thiophosphate (PSO.sub.3.sup.=), a thiophosphate monoester PSO.sub.2.sup.ER.sup.11), a thiophosphate diester (PSOER.sup.11ER.sup.12), a thiophosphonate (PSO.sub.2.sup.=), a thiophosphonate monoester (PSO.sup.ER.sup.11), a thiophosphonate diester (PSER.sup.11ER.sup.12), a phosphonamide (PONR.sup.11R.sup.12NR.sup.14R.sup.15), a phosphonamide thioanalogue (PSNR.sup.11R.sup.12NR.sup.14R.sup.15), a phosphoramide (PONR.sup.11R.sup.12NR.sup.13NR.sup.14R.sup.15), a phosphoramide thioanalogue (PSNR.sup.11R.sup.12NR.sup.13NR.sup.14R.sup.15), a phosphoramidite (PO.sub.2R.sup.14NR.sup.11R.sup.12) or a phosphoramidite thioanalogue (POSR.sup.14NR.sup.11R.sup.12), where E can be independently O or S, and where the aryl portions of any of the above are optionally substituted by F, Cl, Br, I, CN, OH, alkenyl, alkynyl, alkylcarbonyl, amide, or thioamide;
[0047] wherein R.sup.1 in combination with R.sup.2, R.sup.3 in combination with R.sup.4, R.sup.5 in combination with R.sup.6, or R.sup.9 in combination with R.sup.10 can independently form a 5-10 member ring structure which is saturated or unsaturated, and which is optionally further substituted with an alkyl, an aryl, an alkenyl, an alkynyl, an alkoxy, an aroxyl, a hydroxyl, an F, a Cl, a Br, an I, a CN, a nitro, an alkylsulfonyl, an arylsulfonyl, an alkylsulfinyl, an arylsulfinyl, a (thio)carbonyl, a (thio)carboxylic acid, a (thio)carboxylic acid ester, a nitro, an amino, a (thio)amide, an azido, a hydrazino, or a (thio)phosphonate where each alkyl group or alkoxy group is independently saturated or unsaturated, linear or branched, or substituted or unsubstituted and each aryl group wherein is independently optionally substituted with an F, a Cl, a Br, an I, a CN, an OH, an alkyl, an alkenyl, an alkynyl, an alkoxy, an aryoxy, an alkylthio, an arylthio, a nitro, an azido, a hydrazino, a carboxyl, a thiocarboxyl, a carbonyl, a thiocarbonyl, a carboxylic acid ester, a thiocarboxylic acid ester, or an unsubstituted or substituted amino, amide, thioamide, or Q;
[0048] R.sup.11, R.sup.12, R.sup.13, R.sup.14 and R.sup.15 are independently a hydrogen, a halogen, an amino group, an alkyl group wherein said alkyl group is saturated or unsaturated, linear or branched, or substituted or unsubstituted, an alkoxy group wherein said alkoxy group is saturated or unsaturated, branched or linear, or substituted or unsubstituted, an aryl group wherein said aryl group is unsubstituted or substituted; wherein R.sup.11 in combination with R.sup.12, R.sup.14 in combination with R.sup.15, R.sup.11 in combination with R.sup.13, R.sup.11 in combination with R.sup.14, R.sup.12 in combination with R.sup.15, or R.sup.13 in combination with R.sup.14 can independently form a 5-10 member ring;
[0049] X is O, OR.sup.16, NR.sup.17R.sup.18 or N.sup.+R.sup.17R.sup.18; Y is O, OR.sup.16, NR.sup.19R.sup.20 or N.sup.+R.sup.19R.sup.20, wherein R.sup.16, R.sup.17, R.sup.18, R.sup.19 and R.sup.20 are independently H, alkyl, alkenyl, alkynyl, or aryl; or R.sup.17 in combination with R.sup.18, or R.sup.19 in combination with R.sup.20 can independently form a 5-10 member ring structure which is optionally further substituted with alkyl, alkenyl, alkynyl, aryl, alkoxy, F, Cl, Br, I, carboxylic acid or carboxylic acid ester, where the alkyl group is saturated or unsaturated, linear or branched, and is optionally further substituted by F, Cl, Br, I, CN, OH, alkenyl, alkynyl, nitro, azido, hydrazino, alkoxy, aryoxy, alkylthio, arylthio, thiocarboxyl, carbonyl, thiocarbonyl, thiocarboxylic acid ester, unsubstituted or substituted amino, amide, thioamide, or Q, and the aryl group wherein is optionally substituted by F, Cl, Br, I, CN, OH, alkoxy, aryoxy, alkylthio, arylthio, nitro, azido, hydrazino, carboxyl, thiocarboxyl, carbonyl, thiocarbonyl, carboxylic acid ester, thiocarboxylic acid ester, unsubstituted or substituted amino, amide, thioamide, or Q; d
[0050] wherein R.sup.17 in combination with R.sup.6, R.sup.18 in combination with R.sup.7, R.sup.19 in combination with R.sup.8, or R.sup.20 in combination with R.sup.9, can independently form a 5- to 10-member ring structure that is saturated or unsaturated and optionally further substituted with an alkyl, an aryl, an alkenyl, an alkynyl, an alkoxy, an aroxyl, a hydroxyl, an F, a Cl, a Br, an I, a CN, a nitro, a carbonyl, a thiocarbonyl, a thiocarboxylic acid, a thiocarboxylic acid ester, a nitro, an amino, a (thio)amide, an azido, a hydrazino, or Q, wherein the alkyl group herein is saturated or unsaturated, linear or branched, substituted or unsubstituted, an alkoxy group wherein the alkoxy group is saturated or unsaturated, branched or linear, substituted or unsubstituted; and wherein the aryl group is optionally substituted with F, Cl, Br, I, CN, OH, alkenyl, alkynyl, alkoxy, aryoxy, alkylthio, arylthio, nitro, azido, hydrazino, carboxyl, thiocarboxyl, carbonyl, thiocarbonyl, carboxylic acid ester, thiocarboxylic acid ester, unsubstituted or substituted amino, amide, thioamide, or Q;
[0051] A is O, S or NR.sup.21, wherein R.sup.21 is a hydrogen, an alkyl, an aryl, an alkenyl, an alkynyl, an alkylcarbonyl, an arylcarbonyl, an alkylaminocarbonyl, or an arylaminocarbonyl, the alkyl or aryl portions of which is optionally substituted by an alkyl, an aryl, an alkenyl, an alkynyl, an F, a Cl, a Br, an I, a CN, an OH, an alkoxy, an aryoxy, an alkylthio, an arylthio, a nitro, an azido, a hydrazino, a thiocarboxyl, a carbonyl, a thiocarbonyl, a thiocarboxylic acid ester, or an unsubstituted or substituted amino, amide, thioamide, or Q;
[0052] B is an alkyl, an alkenyl, an alkynyl, or an aryl linker, the alkyl or aryl portions of which is optionally substituted by an alkyl, an alkenyl, an alkynyl, an aryl, an F, a Cl, a Br, an I, a CN, an OH, an alkoxy, an aryoxy, an alkylthio, an arylthio, a nitro, an azido, a hydrazino, a carboxyl, a thiocarboxyl, a carbonyl, a thiocarbonyl, a carboxylic acid ester, a thiocarboxylic acid ester, or an unsubstituted or substituted amino, amide, thioamide, or Q; or
[0053] B in combination with A form an amide, a thioamide, a carboxylic acid ester, a carboxylic acid thioester, a thiocarboxylic acid ester, an imine, a hyrazone, or Q; and
[0054] Z is a reactive group comprising an isocyanate, an isothiocyanate, a monochlorotriazine, a dichlorotriazine, a 4,6-dichloro-1,3,5-triazines, a mono- or di-halogen substituted pyridine, a mono- or di-halogen substituted diazine, a maleimide, a haloacetamide, an aziridine, a sulfonyl halide, a carboxylic acid, an acid halide, a phosphonyl halide, a phosphoramidite (PO.sub.2R.sup.14NR.sup.11R.sup.12), a phosphoramidite thioanalogue (POSR.sup.14NR.sup.11R.sup.12), a hydroxysuccinimide ester, a hydroxysulfosuccinimide ester, an imido ester, an azido, a nitrophenol ester, an azide, a 3-(2-pyridyl dithio)-propionamide, a glyoxal, an aldehyde, a thiol, an amine, a hydrazine, a hydroxyl, a terminal alkene, a terminal alkyne, a platinum coordinate group or an alkylating agent.
[0055] In some of these embodiments, ABZ is
##STR00004##
where n is 1-10, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10, for example 1-4. In certain of these embodiments, ABZ is
##STR00005##
providing a reactive hydroxysuccinimide ester group for coupling to amine moieties, as is known in the art. In more specific embodiments, ABZ is
##STR00006##
[0056] Some compounds of these embodiments comprise
##STR00007##
[0057] In certain embodiments of those compounds, R.sup.6 and R.sup.9 are both H, or both CH.sub.3. In other embodiments of those compounds, X and Y are [0058] (a) OH and O, respectively; [0059] (b) NHCH.sub.2CH.sub.3 and NCH.sub.2CH.sub.3, respectively; or [0060] (c) N(CH.sub.3).sub.2 and N.sup.(CH.sub.3).sub.2, respectively.
[0061] Specific examples of the compounds of these embodiments comprise
##STR00008## ##STR00009##
Other specific examples comprise
##STR00010##
Still other specific examples comprise
##STR00011## ##STR00012## ##STR00013## ##STR00014##
wherein E.sup. comprises an anion.
[0062] In some embodiments, any of the compounds described is a fluorescent dye.
[0063] Examples 1-16 below describe some of the methods available for synthesizing several of the above dyes. Other methods are known in the art.
[0064] For purposes of synthesis of these dyes, reactive thiol, amine or hydroxyl groups can be protected during various synthetic steps and the reactive groups generated after removal of the protective group. Use of a terminal alkene or alkyne groups for attachment of markers is disclosed for example in U.S. Patent Publication 2003/0225247. The use of platinum coordinate groups for attachment of other dyes is disclosed for example in U.S. Pat. No. 5,580,990, and the use of alkyl groups is disclosed for example in U.S. Pat. No. 6,593,465.
[0065] In various embodiments, the dyes provided herein further comprise a member of a binding pair, to provide additional binding capabilities. The member of the binding pair can be covalently bound to any portion of the dye. In some of these embodiments, the member of a binding pair is covalently bound to the fluorescent dye through reactive group Z.
[0066] Any binding pair now known or later discovered can be utilized in these embodiments. Nonlimiting examples include sugar/lectins, antigen/antibodies, hapten/antibodies, ligand/receptors, hormone/receptors, enzyme/substrates, biotin/avidin, and biotin/streptavidin.
[0067] Any one of the dyes of the instant invention can be utilized with another dye to form a fluorescence energy transfer system, where the signal is influenced by Frster resonance energy transfer (also known as fluorescence resonance energy transfer, or FRET). FRET uses two fluorophores (an energy transfer pair) where the emission spectrum of one fluorophore (the donor) is of higher energy (having a shorter wavelength) and overlaps the absorption spectrum of the other fluorophore (the acceptor). When the two fluorophores are brought within about 10-100 and the donor fluorophore is excited, the energy of the donor is transferred to the acceptor by a resonance induced dipole-dipole interaction. This interaction is observed by fluorescence quenching of the donor fluorophore and/or emission of the acceptor fluorophore. FRET interactions are utilized with many assays, particularly in molecular biology. See, e.g., U.S. Pat. Nos. 4,868,103; 5,237,515; and 6,117,635, U.S. Patent Publications 2005/0176014 and 2005/0042618, and references cited therein.
[0068] Thus, in some embodiments, a fluorescence energy transfer system is provided. The fluorescence energy transfer system comprises any of the above-described fluorescent dyes and a second dye that is capable of energy transfer with the fluorescent dye. Such a system is utilized in Example 19, where PCR amplification of HCV RNA was performed with one HCV primer labeled with Dye 1 (Example 4) as a FRET acceptor and another HCV primer labeled with fluorescein as a FRET donor. The primers are extended in the presence of HCV RNA and the extended primers hybridize, bringing the acceptor and donor dyes together to undergo a FRET interaction.
[0069] In various embodiments, any of the fluorescent dyes described above is bound to a target molecule. In some of these embodiments, the dye is covalently bound to the target molecule, e.g., by contacting reactive group Z with the target molecule such that reactive group Z reacts with the target molecule to form a covalent bond between reactive group Z and the target molecule. In other of these embodiments, the dye is noncovalently bound to the target molecule, e.g., through a first member of a binding pair on the target molecule and a second member of the binding pair bound to the fluorescent dye through reactive group Z. This latter case is not narrowly limited to the use of any particular binding pair. Nonlimiting examples of binding pair members that may be utilized here are sugars, lectins, antigens, haptens, antibodies, receptors ligands, hormone ligands, hormone receptors, enzymes, enzyme substrates, biotin, avidin, and streptavidin.
[0070] As used herein, a target molecule encompasses a moiety that specifically binds to an analyte. Thus, binding between the analyte-specific moiety (target) and its corresponding analyte may be monitored by essentially determining the presence or amount of dye that is bound to the analyte. Examples of such assays include hybridizations between complementary nucleic acids as well as binding between antibodies and their corresponding antigens. Other binding pairs that may be of interest include but are not limited to ligand/receptor, hormone/hormone receptor, antibody/antigen, carbohydrate/lectin and enzyme/substrate. Assays may be carried out where one component is fixed to a solid support and a corresponding partner is in solution. By binding to the component fixed to the support, the partner becomes attached to the support as well. A well-known example of this method is microarray assays where labeled analytes become bound to discrete sites on the microarray. Homogeneous probe-dependent assays are also well known in the art and may take advantage of the present invention. Examples of such methods are energy transfer between adjacent probes (U.S. Pat. No. 4,868,103), the Taqman exonuclease assay (U.S. Pat. Nos. 5,538,848 and 5,210,015), Molecular Beacons (U.S. Pat. Nos. 5,118,801 and 5,925,517) and various real time assays (U.S. Patent Publication 2005/0137388).
[0071] These embodiments can utilize any target molecule now known or later discovered. Examples of useful target molecules to which the dye can be bound include but are not limited to a nucleoside, nucleotide, oligonucleotide, polynucleotide, peptide nucleic acid, protein, peptide, enzyme, antigen, antibody, hormone, hormone receptor, cellular receptor, lymphokine, cytokine, hapten, lectin, avidin, streptavidin, digoxigenin, carbohydrate, oligosaccharide, polysaccharide, lipid, glycolipid, viral particle, viral component, bacterial cell, bacterial component, eukaryotic cell, eukaryotic cell component, natural drug, synthetic drug, glass particle, glass surface, natural polymers, synthetic polymers, plastic particle, plastic surface, silicaceous particle, silicaceous surface, organic molecule, dyes and derivatives thereof. Where the target is a nucleoside, nucleotide, oligonucleotide, or polynucleotide, such a target can comprise one or more ribonucleoside moieties, ribonucleotide moieties, deoxyribonucleoside moieties, deoxyribonucleotide moieties, modified ribonucleosides, modified ribonucleotides, modified deoxyribonucleosides, modified deoxyribonucleotides, ribonucleotide analogues, deoxyribonucleotide analogues or any combination thereof.
[0072] The dyes of the present invention may have dyes as targets, thereby creating composite dyes. By joining the dyes of the present invention to another dye, unique properties may be enjoyed that are not present in either dye alone. For instance, if one of the dyes of the present invention is joined to another dye such that it creates an extended conjugation system, the spectral characteristics of the dye may be different than either dye component. Another example of this method is where the conjugation systems do not overlap but the proximity allows an internal energy transfer to take place thereby extending the Stokes shift. See, e.g., U.S. Pat. Nos. 5,401,847; 6,008,373; and 5,800,996. Other properties may also be enhanced by this joining, for example, the joining together of two ethidium bromide molecules generating a dye that has enhanced binding to nucleic acids (U.S. Patent Publication 2003/0225247). Other composite dyes have been described that simultaneously enjoy both properties, i.e. enhanced binding and energy transfer (U.S. Pat. No. 5,646,264). Furthermore, these composite dyes are not limited to binary constructs of only two dyes, but may comprise oligomeric or polymeric dyes. These composite dyes may be comprised of the same dye or different dyes may be joined together depending upon the properties desired.
[0073] Antibodies labeled with dyes of the present invention may be used in various formats. For example, an antibody with one of the dyes of the present invention may be used in an immunofluorescent plate assay or in situ analysis of the cellular location and quantity of various antigenic analytes. Antibodies labeled with dyes may also be used free in solution in cell counting or cell sorting methods that use a flow cytometer or for in vitro or in vivo imaging of animal models. The presence or absence of a signal may then be used to indicate the presence or absence of the analyte itself. An example of this is a test where it is sufficient to know whether a particular pathogen is present in a clinical specimen. Quantitative assays may also be carried out where the amount of target is being determined. An example of this is the previously cited microarray assay where the rise or fall in the amount of particular mRNA species may be of interest.
[0074] In another embodiment of the present invention, the dyes described above may be attached to a carrier with a more general affinity. Dyes may be attached to intercalators that in themselves do not provide signal generation but by virtue of their binding may bring a dye in proximity to a nucleic acid. A further example is attachment of dyes to SDS molecules thereby allowing dyes to be brought into proximity to proteins. Thus this embodiment describes the adaptation of a dye or dyes that lack affinity to a general class of molecules may be adapted by linking them to non-dye molecules or macromolecules that can convey such properties. Various applications may enjoy the benefits of binding the dyes of the present invention to appropriate targets. As described above, staining of macromolecules in a gel is a methodology that has a long history of use. More recent applications that also may find use are real time detection of amplification (U.S. Pat. Nos. 5,994,056 and 6,174,670, and U.S. Patent Publication 2005/0137388), and binding of nucleic acids to microarrays. In situ assays may also find use where the binding of dyes of the present invention is used to identify the location or quantity of appropriate targets.
[0075] The present invention also provides a kit for labeling a target molecule. The kit comprises any of the above-described fluorescent dyes, with additional reagents useful for labeling the target molecule. The target molecule in these embodiments is not narrowly limited to any particular type of compound. Non-limiting examples include a nucleoside, nucleotide, oligonucleotide, polynucleotide, peptide nucleic acid, protein, peptide, enzyme, antigen, antibody, hormone, hormone receptor, cellular receptor, lymphokine, cytokine, hapten, lectin, avidin, streptavidin, digoxigenin, carbohydrate, oligosaccharide, polysaccharide, lipid, glycolipid, viral particle, viral component, bacterial cell, bacterial component, eukaryotic cell, eukaryotic cell component, natural drug, synthetic drug, glass particle, glass surface, natural polymers, synthetic polymers, plastic particle, plastic surface, silicaceous particle, silicaceous surface, organic molecule, dyes and derivatives thereof. Where the target is a nucleoside, nucleotide, oligonucleotide, or polynucleotide, such a target can comprise one or more ribonucleoside moieties, ribonucleotide moieties, deoxyribonucleoside moieties, deoxyribonucleotide moieties, modified ribonucleosides, modified ribonucleotides, modified deoxyribonucleosides, modified deoxyribonucleotides, ribonucleotide analogues, deoxyribonucleotide analogues or any combination thereof. In some of these embodiments, the target molecule is a nucleic acid, a nucleic acid analog, a protein, a peptide, an antibody, an antibody fragment, a carbohydrate, a polysaccharide, an oligosaccharide, a nucleotide, a nucleotide analog, a hapten, or an organic compound less than 2000 daltons. In particularly useful embodiments, the target molecule is a nucleic acid or a protein.
[0076] The additional reagents of these kits can include any reagents necessary for labeling any target molecule, such as a buffer, an enzyme, one or both of a binding pair (as described above), chemical reagents to effect the binding of the dye to the target molecule, and/or the target molecule itself. In some embodiments, the kit also includes instructions for labeling the target molecule.
[0077] Additionally provided is another kit for labeling a target molecule. The kit in these embodiments comprises a first fluorescent dye and a second fluorescent dye that form an energy transfer pair, wherein the first fluorescent dye is any of the fluorescent dyes described above. In some embodiments, the kit also comprises additional reagents and/or instructions useful for labeling target molecules with the energy transfer pair. The additional reagents of these kits can include any reagents necessary for labeling any target molecule, such as a buffer, an enzyme, one or both of a binding pair (as described above), chemical reagents to effect the binding of the dye to the target molecule, and/or the target molecule itself.
[0078] As with the previously described kits, the target molecule in these embodiments is not narrowly limited to any particular type of compound, and could include, e.g., any of the target molecules discussed previously. In some embodiments, the target molecule is a nucleic acid or a protein.
[0079] The present invention is also directed to a target molecule labeled with any of the fluorescent dyes described above.
[0080] The target molecule in these embodiments is not narrowly limited to any particular type of compound. Non-limiting examples include a nucleoside, nucleotide, oligonucleotide, polynucleotide, peptide nucleic acid, protein, peptide, enzyme, antigen, antibody, hormone, hormone receptor, cellular receptor, lymphokine, cytokine, hapten, lectin, avidin, streptavidin, digoxigenin, carbohydrate, oligosaccharide, polysaccharide, lipid, glycolipid, viral particle, viral component, bacterial cell, bacterial component, eukaryotic cell, eukaryotic cell component, natural drug, synthetic drug, glass particle, glass surface, natural polymers, synthetic polymers, plastic particle, plastic surface, silicaceous particle, silicaceous surface, organic molecule, dyes and derivatives thereof. Where the target is a nucleoside, nucleotide, oligonucleotide, or polynucleotide, such a target can comprise one or more ribonucleoside moieties, ribonucleotide moieties, deoxyribonucleoside moieties, deoxyribonucleotide moieties, modified ribonucleosides, modified ribonucleotides, modified deoxyribonucleosides, modified deoxyribonucleotides, ribonucleotide analogues, deoxyribonucleotide analogues or any combination thereof. In some of these embodiments, the target molecule is a nucleic acid, a nucleic acid analog, a protein, a peptide, an antibody, an antibody fragment, a carbohydrate, a polysaccharide, an oligosaccharide, a nucleotide, a nucleotide analog, a hapten, or an organic compound less than 2000 daltons. In particularly useful embodiments, the target molecule is a nucleic acid or a protein.
[0081] In some of these embodiments, the fluorescent dye is covalently bound to the target molecule, for example through reactive group Z.
[0082] In other embodiments, the fluorescent dye is noncovalently bound to the target molecule, for example through a binding pair, e.g., where one member of the binding pair is covalently bound to the dye through reactive group Z and the other member of the binding pair is covalently bound to the target, by any means known in the art. The binding pair in these embodiments can be any binding pair now known or later discovered. Nonlimiting examples include a sugar/lectin, an antigen/antibody, a hapten/antibody, a ligand/receptor, a hormone/receptor, an enzyme/substrate, biotin/avidin, or biotin/streptavidin.
[0083] In some of these embodiments, the labeled target molecule further comprises a second dye such that the second dye forms an energy transfer pair with the fluorescent dye. Examples of such compositions are well known in the art. See, e.g., U.S. Patent Publication 2005/0137388, describing nucleic acids labeled with both a donor and an acceptor dye.
[0084] The labeled target molecule of these embodiments can also be part of a composition that further comprises a second labeled target molecule, where the label on the labeled target molecule and the label on the second labeled target molecule form an energy transfer pair. Examples include two labeled primers, where the two labels form an energy transfer pair, or an antibody labeled with one member of an energy transfer pair and the corresponding antigen labeled with the other member of the energy transfer pair. See, e.g., U.S. Patent Publication 2005/0137388, PCT Publication W099/47700 and US Patents 5,237,515 and 4,868,103.
[0085] In further embodiments, the invention is directed to a method of labeling a target molecule. The method comprises contacting reactive group Z of any of the above-described fluorescent dyes with the target molecule such that reactive group Z reacts with the target molecule to form a covalent bond between reactive group Z and the target molecule.
[0086] The target molecule in these embodiments is not narrowly limited to any particular type of compound. Non-limiting examples include a nucleoside, nucleotide, oligonucleotide, polynucleotide, peptide nucleic acid, protein, peptide, enzyme, antigen, antibody, hormone, hormone receptor, cellular receptor, lymphokine, cytokine, hapten, lectin, avidin, streptavidin, digoxigenin, carbohydrate, oligosaccharide, polysaccharide, lipid, glycolipid, viral particle, viral component, bacterial cell, bacterial component, eukaryotic cell, eukaryotic cell component, natural drug, synthetic drug, glass particle, glass surface, natural polymers, synthetic polymers, plastic particle, plastic surface, silicaceous particle, silicaceous surface, organic molecule, dyes and derivatives thereof. Where the target is a nucleoside, nucleotide, oligonucleotide, or polynucleotide, such a target can comprise one or more ribonucleoside moieties, ribonucleotide moieties, deoxyribonucleoside moieties, deoxyribonucleotide moieties, modified ribonucleosides, modified ribonucleotides, modified deoxyribonucleosides, modified deoxyribonucleotides, ribonucleotide analogues, deoxyribonucleotide analogues or any combination thereof. In some of these embodiments, the target molecule is a nucleic acid, a nucleic acid analog, a protein, a peptide, an antibody, an antibody fragment, a carbohydrate, a polysaccharide, an oligosaccharide, a nucleotide, a nucleotide analog, a hapten, or an organic compound less than 2000 daltons. In particularly useful embodiments, the target molecule is a nucleic acid or a protein.
[0087] In some of these embodiments, the target molecule further comprises a second dye such that the fluorescent dye and the second dye form an energy transfer pair.
[0088] The present invention further provides another method of labeling a target molecule. In these embodiments, the method comprises contacting any of the above-described fluorescent dyes with the target molecule, wherein the target molecule comprises a second member of the binding pair. The dye in these embodiments comprises the first member of the binding pair. As such, when the dye is combined with the target molecule, the first and second members of the binding pair bind together, thus noncovalently labeling the target molecule with the dye.
[0089] These embodiments encompass the use of any target molecule now known or later discovered, e.g., as described above. In some embodiments, the target molecule is a nucleic acid, a nucleic acid analog, a protein, a peptide, an antibody, an antibody fragment, a carbohydrate, a polysaccharide, an oligosaccharide, a nucleotide, a nucleotide analog, a hapten, or an organic compound less than 2000 daltons. In particularly useful embodiments, the target molecule is a nucleic acid or a protein, as described above.
[0090] As with above-described embodiments, any binding pair now known or later discovered can be utilized for these methods. Nonlimiting examples of useful binding pairs are a sugar/lectin, an antigen/antibody, a hapten/antibody, a ligand/receptor, a hormone/receptor, an enzyme/substrate, biotin/avidin, or biotin/streptavidin.
[0091] Preferred embodiments are described in the following examples. Other embodiments within the scope of the claims herein will be apparent to one skilled in the art from consideration of the specification or practice of the invention as disclosed herein. It is intended that the specification, together with the examples, be considered exemplary only, with the scope and spirit of the invention being indicated by the claims, which follow the examples.
EXAMPLE 1
Synthesis of 7-methoxy-2,2,4-trimethyl-1,2-dihydroquinoline
[0092] The compound m-anisidine (26 ml, 0.23 mol) was slowly added to acetic acid (2.6 ml) with stirring, followed by slow addition of mesityl oxide (27 ml, 0.23 mol). After the mixture was stirred at room temperature overnight, concentrated hydrobromic acid (50 ml) was added. The mixture was stirred for an additional hour. The precipitate was then filtered and washed with acetone. The resulting solid was then dissolved in water (100 ml) and neutralized to pH 7 with lON aqueous sodium hydroxide. The resulting solution was extracted with chloroform (350 mL) and dried over anhydrous sodium sulfate. After filtering off the sodium sulfate, the solution was evaporated under vacuum to give crude product, which was recrystalized with hexanes to give a yellowish solid (15.5 g, 33% yield). The structure of 7-methoxy-2,2,4-trimethyl-1,2-dihydroquinoline is:
##STR00015##
EXAMPLE 2
Synthesis of 1-ethyl-7-methoxy-2,2,4-trimethyl-1,2-dihydroquinoline
[0093] The compound 7-methoxy-2,2,4-trimethyl-1,2-dihydroquinoline (5.0 g, 24.6 mmols) from Example 1 was dissolved in anhydrous DMF (40 ml). Calcium carbonate (3.0 g, 30 mmols) and ethyl iodide (4.7 g, 30 mmols) were subsequently added. The mixture was heated at 120 C. with vigorous stirring for 18 hours. After the mixture was cooled to room temperature, it was poured into water (300 mL). The suspension was filtered through a pad of celite then extracted with chloroform (3100 mL). The combined chloroform layer was washed with water (3200 mL) and then dried with anhydrous sodium sulfate. The solvent was evaporated under vacuum to give a dark green oil (5.72 g, 100% yield). The structure of 1-ethyl-7-methoxy-2,2,4-trimethyl-1,2-dihydroquinoline is:
##STR00016##
EXAMPLE 3
Synthesis of 1-ethyl-2,2,4-trimethyl-1,2-dihydroquinolin-7-ol
[0094] The compound1-ethyl-7-methoxy-2,2,4-trimethyl-1,2-dihydroquinoline (5.72 g) from Example 2 was added to a mixture of concentrated hydrobromic acid (13 mL) and glacial acetic acid (13 mL). After the mixture was stirred at reflux for 6 hours, it was cooled with ice and neutralized with 10 N aqueous sodium hydroxide to pH 7. The mixture was then extracted with chloroform (350 ml) and dried over anhydrous sodium sulfate, then filtered and evaporated to give a sticky green oil as the crude product (6.02 g), which was used without further purification. The structure of 1-ethyl-2,2,4-trimethyl-1,2-dihydroquinolin-7-ol is given below:
##STR00017##
EXAMPLE 4
Synthesis of Dye 1 (EZRed620)
[0095] The compounds 1-ethyl-2,2,4-trimethyl-1,2-dihydroquinolin-7-ol (220 mg, 1.0 mmol) (Example 3) and 2-(4-formylphenoxy)acetic acid (61 mg, 0.34 mmol) were mixed thoroughly and heated at 150 C. with vigorous stirring for 15 min in a microwave reactor. After the mixture was cooled to room temperature, methanol (5%) in chloroform (total 5 ml) was added, followed by the addition of tetrachloro-1,4-benzoquinone (25.5 mg, 0.51 mmol). This mixture was stirred at room temperature for 20 min. The solvent was then removed under vacuum and the residue purified by flash chromatography. The solvent was removed to give Dye 1 (shown below) as a dark solid (32.2 mg, yield: 16%). .sub.abs=594 nm (in methanol), .sub.em=611 nm (in methanol).
##STR00018##
EXAMPLE 5
Synthesis of Dye 2
[0096] Dye 2 (shown below) was prepared using the procedure described in Example 4 except that 1-ethyl-1,2,3,4-tetrahydroquinolin-7-ol substituted for 1-ethyl-2,2,4-trimethyl-1,2-dihydroquinolin-7-ol. Yield: 25%. .sub.abs=558 nm (in methanol), .sub.em=574 nm (in methanol).
##STR00019##
EXAMPLE 6
Synthesis of 2-(4-(3-hydroxy-6-oxo-6H-xanthen-9-yl)phenoxy)acetic acid (Dye 3)
[0097] Dye 3 (shown below) was prepared using the procedure described in Example 4 except that 2-(4-formylphenoxy)acetic acid and resorcinol substituted for 1-ethyl-2,2,4-trimethyl-1,2-dihydroquinolin-7-ol and 2-(4-formylphenoxy)acetic acid. Yield: 34%. .sub.abs=485 nm (in methanol), .sub.em=511 nm (in methanol).
##STR00020##
EXAMPLE 7
Synthesis of 2-(4-(3-(ethylamino)-6-(ethylimino)-2,7-dimethyl-6H-xanthen-9-yl)phenoxy)acetic acid (Dye 4)
[0098] Dye 4 (shown below) was prepared using the procedure described in Example 4 except that 3-(ethylamino)-4-methylphenol and 2-(4-formylphenoxy)acetic acid substituted for 1-ethyl-2,2,4-trimethyl-1,2-dihydroquinolin-7-ol and 2-(4-formylphenoxy)acetic acid. Yield: 12%. .sub.abs=525 nm (in methanol), .sub.em=540 nm (in methanol).
##STR00021##
EXAMPLE 8
Synthesis of Dye 5
[0099] Dye 5 (shown below) was prepared using the procedure described in Example 4 except that 2-(4-formylphenoxy)acetic acid and 8-hydroxyjulolidine substituted for 1-ethyl-2,2,4-trimethyl-1,2-dihydroquinolin-7-ol and 2-(4-formylphenoxy)acetic acid. Yield: 22%. .sub.abs=570 nm (in methanol), .sub.em=584 nm (in methanol).
##STR00022##
EXAMPLE 9
Synthesis of N-(9-(4-(carboxymethoxy)phenyl)-6-(dimethylamino)-311-xanthen-3-ylidene)-N-methylmethanaminium (Dye 6)
[0100] Dye 6 (shown below) was prepared using the procedure described in Example 4 except that 2-(4-formylphenoxy)acetic acid and 3-(dimethylamino)phenol substituted for 1-ethyl-2,2,4-trimethyl-1,2-dihydroquinolin-7-ol and 2-(4-formylphenoxy)acetic acid. Yield: 36%. .sub.abs=548 nm (in methanol), .sub.em=566 nm (in methanol).
##STR00023##
EXAMPLE 10
Synthesis of 5-(4-formylphenoxy)pentanoic acid
[0101] Methyl 5-bromovelerate (13.4 g, 68.6 mmol) and anhydrous potassium carbonate (18.93 g, 137 mmol) was added to a solution of 4-hydroxybenzaldehyde (8.38 g, 68.6 mmol) in anhydrous acetone (140 ml). The mixture was heated at reflux for 16 hours with vigorous stirring. After the mixture was cooled to room temperature and filtered, the solvent was removed under vacuum. The residue was dissolved in dichloromethane (200 mL) and washed sequentially with aqueous sodium hydroxide (1 N, 200 ml), water (200 ml) and brine (200 ml). The solvent was evaporated under vacuum to give a yellowish crystal. The crystal was dissolved in a mixture of THF (200 ml) and hydrochloric acid (6 N, 30 ml). The mixture was then heated to reflux for 3 hours, after which the THF was removed under vacuum. The oil was then extracted with chloroform (450 ml). The combined chloroform layer was washed with water (2150 ml) and brine (200 ml), and then dried with anhydrous sodium sulfate. After the solvent was removed, the acid was obtained as a yellow liquid. The structure of 5-(4-formylphenoxy)pentanoic acid is:
##STR00024##
EXAMPLE 11
Synthesis of Dye 7
[0102] Dye 7 (shown below) was prepared using the procedure described in Example 4 except that 5-(4-formylphenoxy)pentanoic acid and 1-ethyl-2,2,4-trimethyl-1,2-dihydroquinolin-7-ol substituted for 1-ethyl-2,2,4-trimethyl-1,2-dihydroquinolin-7-ol and 2-(4-formylphenoxy)acetic acid. Yield: 17%. .sub.abs=590 nm (in methanol), .sub.em=613 nm (in methanol).
##STR00025##
EXAMPLE 12
Synthesis of Dye 8
[0103] Dye 8 (shown below) was prepared using the procedure described in Example 4 except that 5-(4-formylphenoxy)pentanoic acid and 1-ethyl-1,2,3,4-tetrahydroquinolin-7-ol substituted for 1-ethyl-2,2,4-trimethyl-1,2-dihydroquinolin-7-ol and 2-(4-formylphenoxy)acetic acid. Yield: 23%. .sub.abs=559 nm (in methanol), .sub.em=574 nm (in methanol).
##STR00026##
EXAMPLE 13
Synthesis of 5-(4-(3-hydroxy-6-oxo-6H-xanthen-9-yl)phenoxy)pentanoic acid (Dye 9)
[0104] Dye 9 (shown below) was prepared using the procedure described in Example 4 except that 5-(4-formylphenoxy)pentanoic acid and resorcinol substituted for 1-ethyl-2,2,4-trimethyl-1,2-dihydroquinolin-7-ol and 2-(4-formylphenoxy)acetic acid. Yield: 26%. .sub.abs=486 nm (in methanol), .sub.em=513 nm (in methanol).
##STR00027##
EXAMPLE 14
Synthesis of (Z)-5-(4-(3-(ethylamino)-6-(ethylimino)-2,7-dimethyl-6H-xanthen-9-yl)phenoxy)pentanoic acid (Dye 10)
[0105] Dye 10 (shown below) was prepared using the procedure described in Example 4 except that 3-(ethylamino)-4-methylphenol and 5-(4-formylphenoxy)pentanoic acid substituted for 1-ethyl-2,2,4-trimethyl-1,2-dihydroquinolin-7-ol and 2-(4-formylphenoxy)acetic acid. Yield: 17%. .sub.abs=524 nm (in methanol), .sub.em=541 nm (in methanol).
##STR00028##
EXAMPLE 15
Synthesis of Dye 11
[0106] Dye 11 (shown below) was prepared using the procedure described in Example 4 except that 5-(4-formylphenoxy)pentanoic acid and 8-hydroxyjulolidine substituted for 1-ethyl-2,2,4-trimethyl-1,2-dihydroquinolin-7-ol and 2-(4-formylphenoxy)acetic acid. Yield: 28%. .sub.abs=569 nm (in methanol), .sub.em=584 nm (in methanol). The structure of dye 11 is given below:
##STR00029##
EXAMPLE 16
Synthesis of N-(9-(4-(4-carboxybutoxy)phenyl)-6-(dimethylamino)-3H -xanthen-3-ylidene)-N-methylmethanaminium (Dye 12)
[0107] Dye 12 (shown below) was prepared using the procedure described in Example 4 except that 5-(4-formylphenoxy)pentanoic acid and 3-(dimethylamino)phenol substituted for 1-ethyl-2,2,4-trimethyl-1,2-dihydroquinolin-7-ol and 2-(4-formylphenoxy)acetic acid. Yield: 23%. .sub.abs=547 nm (in methanol), .sub.em=565 nm (in methanol). The structure of dye 12 is given below:
##STR00030##
EXAMPLE 17
Comparison of spectra of Dye 1 (EZRed620) with Roche LC-Red 640 Dye
[0108] Spectral properties of Dye 1 (Example 4) were determined and compared to Roche LC-Red 640. The UV-Vis spectra of EZRed620 and LC Red 640 were recorded in methanol with a NanoDrop ND-1000 Spectrophotometer. The wavelengths of maximum absorption of EZRed620 and LC Red 640 were at 589 nm and 613 nm, respectively. The fluorescence spectra were recorded in methanol with Photo Technology International (PTI) fluorometer. The maximum emission wavelengths of EZRed620 and LC Red 640 were 611 nm and 637 nm under these conditions, respectively. Graphs of the results of these studies are shown in
EXAMPLE 18
Bioconjugation of Dye 1 to oligonucleotide
[0109] Dye 1 (2 mol) was dissolved in amine-free DMF (140 l), followed by the addition of 2-succinimido-1,1,3,3-tetramethyluronium tetrafluoroborate (2.4 mols) and diisopropylethylamine (4.4 mols). The mixture was stirred at room temperature for 30 min, and then added to a solution of oligonucleotide containing an amine linker (80 nmols) in 0.9 M sodium borate buffer (320 L, pH 8.5). The mixture was stirred at room temperature for 16 h. The solvent was removed under vacuum and the residue pellet was purified by HPLC using a gradient of triethylammoniumacetate (0.1 M, pH 6.9) and acetonitrile as eluting solvents. The fractions containing pure conjugates were combined and evaporated, and then coevaporated with water to remove excessive salt. The final blue pellet was dissolve in water and stored at 20 C.
EXAMPLE 19
HCV test with Dye 1 (EZRed620)
[0110] RNA was isolated from 400 l plasma or serum from each sample using a QIAamp MinElute Virus Spin Kit in a QIAcube system (QIAGEN, Valencia Calif.) according to the manufacturer's protocol. The resulting RNA was eluted in 50 l elution buffer. Five l of the eluate was subjected to RT-PCR to amplify the HCV target sequence GAGGAACUACUGUCUUCACGCAGAAAGCGUCUAGCCAUGGCGUUAGUAUGAGUG UCG (SEQ ID NO:1). The PCR forward primer was GAGGAACTACTGTCTTCACGCAGAAAGCG (SEQ ID NO:2); the reverse primer was CGACACTCATACTAACGCCATGGCTAG (SEQ ID NO:3). The forward primer was labeled on the underlined/bolded C with Dye 1 (EZRed620) as a FRET acceptor; the reverse primer was labeled on the underlined/bolded T with fluorescein as a FRET donor. Reverse transcription and PCR amplification was carried out in either a Roche Light Cycler or a Qiagen Rotor-Gene Q RealTime PCR machine. Reverse transcription was performed at 50 C. for 30 min. PCR amplification was conducted at 95 C. for 15 sec to denature and 66 C. for 60 sec. for annealing/extension, with a total of 50 or 60 cycles. RealTime RT-PCR progress was monitored through measuring the strength of the EZRed620 signal. When the Roche Light Cycler system was used, Channel F2 was chosen to measure the EZRed620 signal; when the Qiagen Rotor-gene Q system was used, 470 nm was used for excitation and either 610 nm or 660 nm was used to measure the EZRed620 emission.
Comparison of EZRed620/Rotor-Gene Q with LCRed640/COBAS AmpliPrep for Determination of HCV Viral Load in Clinical Samples
[0111] Sixty samples, numbered 101 to 160, were tested as positive using the Roche COBAS AmpliPrep. Those samples were subsequently tested using (a) the EZRed620/Rotor-Gene Q system as described above and (b) the LCRed640/COBAS system as per the manufacturer's instructions. Four additional samples, numbered 201 to 204, were also tested. Sample 204 was tested negative with both platforms. All samples were run with negative control samples of water or elution buffer and a known positive sample. Results of the HCV viral load determination for the above-described samples using both platforms is provided in Table 1. The covariance between the EZRed620/Rotor-Gene Q system and the LCRed640/COBAS system was 1.077, r=0.95. This shows that the EZRed620/Rotor-Gene Q system can reliably substitute for the LCRed640/COBAS system with similar results.
TABLE-US-00001 TABLE 1 Comparison of RT-PCR HIV viral load determination using two systems. EZRed620 LCRed640 Rotor-Gene COBAS Sample # Log.sub.10 Log.sub.10 101 6.55 6.62 102 6.36 6.02 103 5.14 5.06 104 6.22 6.43 105 6.02 5.29 106 6.37 6.85 107 6.21 5.94 108 6.49 6.25 109 6.29 6.10 110 6.35 5.68 121 4.41 3.84 122 6.35 6.71 123 2.67 2.02 124 4.85 4.29 125 7.09 7.58 126 4.40 4.94 127 6.26 6.36 128 6.02 5.80 129 6.30 6.92 130 5.08 4.81 131 5.76 5.48 132 5.36 4.99 133 6.08 5.85 134 6.83 7.26 135 6.73 6.88 136 6.78 7.61 137 6.02 6.03 138 6.54 6.96 139 6.54 6.86 140 5.34 5.23 141 4.37 4.83 142 2.86 3.22 143 5.59 5.12 144 6.23 5.91 145 5.59 4.95 146 6.34 6.22 147 5.62 5.64 148 7.02 6.95 149 6.76 6.56 150 6.95 6.85 151 6.60 7.01 152 5.53 5.25 153 6.60 6.60 154 6.46 6.24 155 6.61 6.42 156 6.05 6.06 157 6.81 6.73 158 5.62 5.40 159 5.03 4.96 160 6.84 7.45 201 6.31 6.26 202 5.56 5.40 203 3.12 3.02
REFERENCES
[0112] Ernst, et al. (1989) Cytometry 10:3-10. [0113] Mujumdar, et al. (1989) Cytometry 10:11-19. [0114] Mujumdar et al. (1993) Bioconjugate Chemistry 4:105-111. [0115] Southwick, et al. (1990) Cytometry 11:4187-430. [0116] Zhu et al. (1994) Nucl. Acid Res. 22:3418-3422. [0117] European Patent Publication 0 070 685. [0118] European Patent Publication 0 543 333. [0119] European Patent Publication 0 567 622. [0120] European Patent Publication 0 971 039. [0121] PCT Publication WO99/47700. [0122] PCT Publication WO 99/28500. [0123] U.S. Pat. No. 4,683,202. [0124] U.S. Pat. No. 4,711,955. [0125] U.S. Pat. No. 4,868,103. [0126] U.S. Pat. No. 4,952,685. [0127] U.S. Pat. No. 5,013,831. [0128] U.S. Pat. No. 5,047,519. [0129] U.S. Pat. No. 5,118,801. [0130] U.S. Pat. No. 5,130,238. [0131] U.S. Pat. No. 5,210,015. [0132] U.S. Pat. No. 5,237,515. [0133] U.S. Pat. No. 5,241,060. [0134] U.S. Pat. No. 5,268,486. [0135] U.S. Pat. No. 5,270,184. [0136] U.S. Pat. No. 5,401,847. [0137] U.S. Pat. No. 5,455,166. [0138] U.S. Pat. No. 5,455,175. [0139] U.S. Pat. No. 5,494,810. [0140] U.S. Pat. No. 5,538,848. [0141] U.S. Pat. No. 5,580,990. [0142] U.S. Pat. No. 5,627,027. [0143] U.S. Pat. No. 5,646,264. [0144] U.S. Pat. No. 5,800,996. [0145] U.S. Pat. No. 5,866,336. [0146] U.S. Pat. No. 5,925,517. [0147] U.S. Pat. No. 5,948,648. [0148] U.S. Pat. No. 5,994,056. [0149] U.S. Pat. No. 6,004,286. [0150] U.S. Pat. No. 6,008,373. [0151] U.S. Pat. No. 6,110,630. [0152] U.S. Pat. No. 6,114,350. [0153] U.S. Pat. No. 6,117,635. [0154] U.S. Pat. No. 6,174,670. [0155] U.S. Pat. No. 6,184,379. [0156] U.S. Pat. No. 6,323,337. [0157] U.S. Pat. No. 6,552,199. [0158] U.S. Pat. No. 6,593,465. [0159] U.S. Pat. No. 6,743,605. [0160] U.S. Patent Publication 2003/0225247. [0161] U.S. Patent Publication 2005/0137388 [0162] U.S. Patent Publication 2005/0176014. [0163] U.S. Patent Publication 2005/0042618. [0164] U.S. Patent Publication 2003/0225247. [0165] U.S. Patent Publication 2005/0137388.
[0166] In view of the above, it will be seen that several objectives of the invention are achieved and other advantages attained.
[0167] As various changes could be made in the above methods and compositions without departing from the scope of the invention, it is intended that all matter contained in the above description and shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense.
[0168] All references cited in this specification are hereby incorporated by reference. The discussion of the references herein is intended merely to summarize the assertions made by the authors and no admission is made that any reference constitutes prior art. Applicants reserve the right to challenge the accuracy and pertinence of the cited references.