PLANTS FOR PRODUCTION OF THERAPEUTIC PROTEINS
20210059142 ยท 2021-03-04
Inventors
- Luc Mathis (Le Kremlin Bicetre, FR)
- Daniel F. Voytas (Falcon Heights, MN)
- Jin Li (Shoreview, MN, US)
- Feng Zhang (Plymouth, MN)
- Thomas Stoddard (St. Louis Park, MN, US)
- Marc-Andre D'Aoust (Quebec, CA)
Cpc classification
C12N15/8218
CHEMISTRY; METALLURGY
C12N15/01
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N15/8258
CHEMISTRY; METALLURGY
C12N15/8257
CHEMISTRY; METALLURGY
A01H1/06
HUMAN NECESSITIES
International classification
A01H1/06
HUMAN NECESSITIES
C12N15/01
CHEMISTRY; METALLURGY
C12N15/82
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
Abstract
Materials and methods are provided for making plants (e.g., Nicotiana varieties) that are suitable for producing therapeutic polypeptides suitable for administration to humans and animals, particularly by making TAL effector endonuclease-induced mutations in genes encoding xylosyltransferases and fucosyltransferases.
Claims
1. A Nicotiana benthamiana plant or plant cell comprising transcription activator-like (TAL) effector endonuclease-induced mutations in each of a plurality of XylT1 and XylT2 alleles and in each of a plurality of FucT1 and FucT2 alleles, wherein said TAL effector endonuclease-induced mutations were induced by: (a) a first TAL effector endonuclease that binds to a first set of nucleic acid sequences selected from the group consisting SEQ ID NOs: 47 and 48, SEQ ID NOs: 49 and 50, and SEQ ID NOs: 51 and 52, each of said first pair of nucleic acid sequences located in the plurality of XylT1 and XylT2 alleles, and (b) a second TAL effector endonuclease that binds to a second set of nucleic acid sequences selected from the group consisting SEQ ID NOs: 53 and 54, SEQ ID NOs: 55 and 56, SEQ ID NOs: 57 and 58, SEQ ID NOs: 58 and 59, and SEQ ID NOs: 62 and 63, each of said second pair of nucleic acid sequences located in the plurality of FucT1 and FucT2 alleles, wherein levels of beta-1,2-xylosyl-sugars and core alpha-1,3-fucosyl-sugars on N-glycan structures of glycoproteins produced in said plant or plant cell are reduced as compared to a corresponding plant or plant cell that does not contain said TAL effector endonuclease-induced mutations.
2. The plant or plant cell of claim 1, wherein said plant or plant cell comprises a nucleic acid encoding a heterologous polypeptide.
3. The plant or plant cell of claim 1, wherein each of said mutations is a deletion of more than one nucleotide.
4. The plant or plant cell of claim 1, wherein each of said one or more XylT1 and XylT2 alleles and said one or more FucT1 and FucT2 alleles has a deletion of an endogenous nucleic acid sequence and does not include any exogenous nucleic acid.
5. The plant or plant cell of claim 1, wherein said first TAL effector endonuclease binds to SEQ ID NOs: 51 and 52, and wherein said second TAL effector endonuclease binds to SEQ ID NOs: 58 and 59.
6. The plant or plant cell of claim 1, wherein levels of beta-1,2-xylosyl-sugars on N-glycan structures of glycoproteins produced in said plant or plant cell are undetectable.
7. The plant or plant cell of claim 1, wherein said Nicotiana benthamiana plant cell is a protoplast.
8. A Nicotiana benthamiana plant comprising a mutation in each of a plurality of XylT1 and XylT2 alleles and a mutation in each of a plurality of FucT1 and FucT2 alleles, wherein said plant is produced by a method comprising: (a) contacting a population of Nicotiana benthamiana plant cells comprising functional XylT1 and XylT2 alleles and functional FucT1 and FucT2 alleles with (i) a first TAL effector endonuclease that binds to a first pair of nucleic acid sequences selected from the group consisting SEQ ID NOs: 47 and 48, SEQ ID NOs: 49 and 50, and SEQ ID NOs: 51 and 52, each of said first pair of nucleic acid sequences located in the plurality of XylT1 and XylT2 alleles, and (ii) a second TAL effector endonuclease that binds to a second pair of nucleic acid sequences selected from the group consisting SEQ ID NOs: 53 and 54, SEQ ID NOs: 55 and 56, SEQ ID NOs: 57 and 58, SEQ ID NOs: 58 and 59, and SEQ ID NOs: 62 and 63, each of said second pair of nucleic acid sequences located in the plurality of FucT1 and FucT2 alleles, (b) selecting, from said population, a cell in which each of said plurality of XylT1 and XylT2 alleles and each of said plurality of FucT1 and FucT2 alleles have been inactivated, and (c) regenerating said selected plant cell into the Nicotiana benthamiana plant, wherein said selected Nicotiana benthamiana plant produces reduced levels of beta-1,2-xylosyl-sugars and core alpha-1,3-fucosyl-sugars on N-glycan structures of glycoproteins compared to a corresponding plant that does not contain said mutations.
9. The plant of claim 8, wherein said plant comprises a nucleic acid encoding a heterologous polypeptide.
10. The plant of claim 8, wherein each of said mutations is a deletion of more than one nucleotide.
11. The plant of claim 8, wherein said first TAL effector endonuclease binds to SEQ ID NOs: 51 and 52, and wherein said second TAL effector endonuclease binds to SEQ ID NOs: 58 and 59.
12. A Nicotiana benthamiana plant cell comprising a mutation in each of a plurality of XylT1 and XylT2 alleles and a mutation in each of a plurality of FucT1 and FucT2 alleles, wherein said plant cell is produced by a method comprising: (a) contacting a population of Nicotiana benthamiana plant cells comprising functional XylT1 and XylT2 alleles and functional FucT1 and FucT2 alleles with (i) a first TAL effector endonuclease that binds to a first pair of nucleic acid sequences selected from the group consisting SEQ ID NOs: 47 and 48, SEQ ID NOs: 49 and 50, and SEQ ID NOs: 51 and 52, each of said first pair of nucleic acid sequences located in the plurality of XylT1 and XylT2 alleles, and (ii) a second TAL effector endonuclease that binds to a second pair of nucleic acid sequences selected from the group consisting SEQ ID NOs: 53 and 54, SEQ ID NOs: 55 and 56, SEQ ID NOs: 57 and 58, SEQ ID NOs: 58 and 59, and SEQ ID NOs: 62 and 63, each of said second pair of nucleic acid sequences located in the plurality of FucT1 and FucT2 alleles, (b) selecting, from said population, a cell in which each of said plurality of XylT1 and XylT2 alleles and each of said plurality of FucT1 and FucT2 alleles have been inactivated, wherein said selected Nicotiana benthamiana plant cell produces reduced levels of core alpha-1,3-fucosyl-sugars on N-glycan structures of glycoproteins compared to a corresponding plant cell that does not contain said mutations.
13. The plant cell of claim 12, wherein said plant cell comprises a nucleic acid encoding a heterologous polypeptide.
14. The plant cell of claim 12, wherein each of said mutations is a deletion of more than one nucleotide.
15. The plant cell of claim 12, wherein said first TAL effector endonuclease binds to SEQ ID NOS: 51 and 52, and wherein said second TAL effector endonuclease binds to SEQ ID NOS: 58 and 59.
16. A population of plant cells comprising one or more plant cell according to claim 12.
17. A Nicotiana benthamiana plant or plant cell comprising a modified glycoprotein, said modified glycoprotein comprising reduced levels of beta-1,2-xylosyl-sugars and core alpha-1,3-fucosyl-sugars on N-glycan structures, said plant or plant cell comprising transcription activator-like (TAL) effector endonuclease-induced mutations in each of a plurality of XylT1 and XylT2 alleles and in each of a plurality of FucT1 and FucT2 alleles, wherein said TAL effector endonuclease-induced mutations were induced by: (a) a first TAL effector endonuclease that binds to a first pair of nucleic acid sequences selected from the group consisting SEQ ID NOs: 47 and 48, SEQ ID NOs: 49 and 50, and SEQ ID NOs: 51 and 52, each of said first pair of nucleic acid sequences located in the plurality of XylT1 and XylT2, and a second TAL effector endonuclease that binds to a second pair of nucleic acids consisting SEQ ID NOs: 53 and 54, SEQ ID NOs: 55 and 56, SEQ ID NOs: 57 and 58, SEQ ID NOs: 58 and 59, and SEQ ID NOs: 62 and 63, each of said second pair of nucleic acid sequences located in the plurality of FucT1 and FucT2 alleles, wherein the reduced levels of beta-1,2-xylosyl-sugars and core alpha-1,3-fucosyl-sugars on said N-glycan structures of glycoproteins produced in said plant or plant cell are compared to a corresponding plant or plant cell that does not contain said TAL effector endonuclease-induced mutations.
18. The plant or plant cell of claim 17, wherein said plant or plant cell comprises a nucleic acid encoding a heterologous polypeptide.
19. The plant or plant cell of claim 17, wherein each of said mutations is a deletion of more than one nucleotide.
20. The plant or plant cell of claim 17, wherein said first TAL effector endonuclease binds to SEQ ID NOS: 51 and 52, and wherein said second TAL effector endonuclease binds to SEQ ID NOS: 58 and 59.
Description
DESCRIPTION OF DRAWINGS
[0017]
[0018]
[0019]
[0020]
[0021]
[0022] The recognition site for the FucT2_T02 TAL effector endonuclease is underlined in each alignment.
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
DETAILED DESCRIPTION
[0029] This document provides plants of the genus Nicotiana that lack xylosyltransferase and fucosyltransferase activity, as well methods for generating such plants, and methods for using such plants for producing polypeptides suitable for administration to humans and animals. Members of the Nicotiana genus include, for example, the species benthamiana, tabacum, sylvestris, acaulis, acuminate, africana, alata, ameghinoi, amplexicaulis, arentsii, attenuate, azambujae, benavidesii, bonariensis, burbidgeae, cavicola, clevelandii, cordifolia, corymbosa, cutleri, debneyi, excelsior, exigua, forgetiana, fragrans, glauca, glutinosa, goodspeedii, gossei, hesperis, heterantha, ingulba, kawakamii, knightiana, langsdorffii, linearis, longibracteata, longiflora, maritime, megalosiphon, miersii, mutabilis, nesophila, noctiflora, nudicaulis, occidentalis, obtusifolia, otophora, paa, palmeri, paniculata, pauciflora, petuniodes, plumb aginifolia, quadrivalvis, raimondii, repanda, rosulata, rotundifolia, rustica, setchellii, simulans, solanifolia, spegazzinii, stenocarpa, stocktonii, suaveolens, thrysiflora, tomentosa, tomentosiformis, truncata, umbratica, undulate, velutina, wigandioides, and wuttkei.
[0030] In N. benthamiana, there are at least two members (XylT1 and XylT2) in the xylosyltransferase (XylT) gene family and at least two members (FucT1 and FucT2) in the fucosyltransferase (FucT) gene family. Representative examples of naturally occurring Nicotiana XylT and FucT nucleotide sequences are shown in Table 4. The Nicotiana plants, cells, plant parts, seeds, and progeny thereof provided herein can have a mutation in each of a plurality of the endogenous XylT and FucT alleles, such that expression of each gene is reduced or completely inhibited. The plants, cells, parts, seeds, and progeny do not exhibit detectable levels of beta-1,2-xylosyl- or core alpha-1,3-fucosyl-sugars on N-glycan structures of glycoproteins produced therein.
[0031] In some embodiments, the Nicotiana plants, cells, plant parts, seeds, and progeny thereof provided herein can have a mutation in one or more endogenous XylT alleles and one or more endogenous FucT alleles, such that expression of each gene is reduced (e.g., partially or completely reduced). The reduced level of expression can be sufficient to yield plants, cells, parts, seeds, and progeny that exhibit decreased levels of beta-1,2-xylosyl- and core alpha-1,3-fucosyl-sugars on N-glycan structures of glycoproteins produced therein, as compared to the levels of beta-1,2-xylosyl- and core alpha-1,3fucosyl-sugars on N-glycan structures of glycoproteins produced in corresponding control plants, cells, parts, seeds, and progeny that do not include the XylT and FucT mutations.
[0032] The plants, plant cells, plant parts, seeds, and plant progeny provided herein can be generated using a rare-cutting endonuclease, such as a TAL effector endonuclease system, to make targeted knockouts in the XylT and FucT genes. Thus, this disclosure provides materials and methods for using TAL effector endonucleases to generate plants and related products (e.g., seeds and plant parts) that are particularly suitable for production of human and animal therapeutic proteins due to targeted knockouts in all alleles of the XylT and FucT genes. Other rare-cutting, sequence-specific nucleases to be used to generate the desired plant material, including engineered homing endonucleases or zinc finger nucleases.
[0033] Plants and plant parts refers to cells, tissues, organs, seeds, and severed parts (e.g., roots, leaves, and flowers) that retain the distinguishing characteristics of the parent plant. Seed refers to any plant structure that is formed by continued differentiation of the ovule of the plant, following its normal maturation point at flower opening, irrespective of whether it is formed in the presence or absence of fertilization and irrespective of whether or not the seed structure is fertile or infertile.
[0034] The term allele(s) means any of one or more alternative forms of a gene at a particular locus. In a diploid (or amphidiploid) cell of an organism, alleles of a given gene are located at a specific location or locus on a chromosome. One allele is present on each chromosome of the pair of homologous chromosomes. Heterozygous alleles are two different alleles residing at a specific locus, positioned individually on corresponding pairs of homologous chromosomes. Homozygous alleles are two identical alleles residing at a specific locus, positioned individually on corresponding pairs of homologous chromosomes in the cell.
[0035] Wild type as used herein refers to a typical form of a plant or a gene as it most commonly occurs in nature. A wild type XylT allele is a naturally occurring XylT allele (e.g., as found within naturally occurring Nicotiana plants) that encodes a functional XylT protein, while a mutant XylT allele is a XylT allele that does not encode a functional XylT protein. Such a mutant XylT allele can include one or more mutations in its nucleic acid sequence, where the mutation(s) result in no detectable amount of functional XylT protein in the plant or plant cell in vivo. Similarly, a wild type FucT allele is a naturally occurring FucT allele that encodes a functional FucT protein, while a mutant FucT allele is a FucT allele that does not encode a functional FucT protein. Such a mutant FucT allele can include one or more mutations in its nucleic acid sequence, where the mutation(s) result in no detectable amount of functional FucT protein in the plant or plant cell in vivo.
[0036] The term rare-cutting endonucleases herein refer to natural or engineered proteins having endonuclease activity directed to nucleic acid sequences having a recognition sequence (target sequence) about 12-40 bp in length (e.g., 14-40 bp in length). Typical rare-cutting endonucleases cause cleavage inside their recognition site, leaving 4 nt staggered cut with 3 H or 5 H overhangs. These rare-cutting endonucleases may be meganucleases, such as wild type or variant proteins of homing endonucleases, more particularly belonging to the dodecapeptide family (LAGLIDADG (SEQ ID NO:79); see, WO 2004/067736) or may result from fusion proteins that associate a DNA binding domain and a catalytic domain with cleavage activity. TAL-effector endonucleases and zinc-finger-nucleases (ZFN) are examples of fusions of DNA binding domains with the catalytic domain of the endonuclease Fokl. Customized TAL effector endonucleases are commercially available under the trade name TALEN (Cellectis, Paris, France). For a review of rare-cutting endonucleases, see Baker, Nature Methods 9:23-26, 2012.
[0037] Mutagenesis as used herein refers to processes in which mutations are introduced into a selected DNA sequence. In the methods described herein, for example, mutagenesis occurs via a double stranded DNA breaks made by TAL effector endonucleases targeted to selected DNA sequences in a plant cell. Such mutagenesis results in TAL effector endonuclease-induced mutations and reduced expression of the targeted gene. Following mutagenesis, plants can be regenerated from the treated cells using known techniques (e.g., planting seeds in accordance with conventional growing procedures, followed by self-pollination).
[0038] In some cases, a nucleic acid can have a nucleotide sequence with at least about 75 percent sequence identity to a representative XylT or FucT nucleotide sequence. For example, a nucleotide sequence can have at least 75, at least 80, at least 85, at least 90, at least 91, at least 92, at least 93, at least 94, at least 95, at least 96, at least 97, at least 98, or at least 99 percent sequence identity to a representative, naturally occurring XylT or FucT nucleotide sequence
[0039] The percent sequence identity between a particular nucleic acid or amino acid sequence and a sequence referenced by a particular sequence identification number is determined as follows. First, a nucleic acid or amino acid sequence is compared to the sequence set forth in a particular sequence identification number using the BLAST 2 Sequences (B12seq) program from the stand-alone version of BLASTZ containing BLASTN version 2.0.14 and BLASTP version 2.0.14. This stand-alone version of BLASTZ can be obtained online at fr.com/blast or at ncbi.nlm.nih.gov. Instructions explaining how to use the B12seq program can be found in the readme file accompanying BLASTZ. B12seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. To compare two nucleic acid sequences, the options are set as follows: -i is set to a file containing the first nucleic acid sequence to be compared (e.g., C:\seql.txt); -j is set to a file containing the second nucleic acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastn; -o is set to any desired file name (e.g., C:\output.txt); -q is set to 1; -r is set to 2; and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two sequences: C:\B12seq -i c:\seql.txt -j c:\seq2.txt -p blastn -o c:\output.txt -q 1 -r 2. To compare two amino acid sequences, the options of B12seq are set as follows: -i is set to a file containing the first amino acid sequence to be compared (e.g., C:\seql.txt); -j is set to a file containing the second amino acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastp; -o is set to any desired file name (e.g., C:\output.txt); and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two amino acid sequences: C:\B12seq -i c:\seql.txt -j c:\seq2.txt -p blastp -o c:\output.txt. If the two compared sequences share homology, then the designated output file will present those regions of homology as aligned sequences. If the two compared sequences do not share homology, then the designated output file will not present aligned sequences.
[0040] Once aligned, the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is presented in both sequences. The percent sequence identity is determined by dividing the number of matches either by the length of the sequence set forth in the identified sequence (e.g., SEQ ID NO:1), or by an articulated length (e.g., 100 consecutive nucleotides or amino acid residues from a sequence set forth in an identified sequence), followed by multiplying the resulting value by 100. For example, a nucleic acid sequence that has 80 matches when aligned with the sequence set forth in SEQ ID NO:1 is 88.9 percent identical to the sequence set forth in SEQ ID NO:1 (i.e., 8090100=88.9). It is noted that the percent sequence identity value is rounded to the nearest tenth. For example, 75.11, 75.12, 75.13, and 75.14 is rounded down to 75.1, while 75.15, 75.16, 75.17, 75.18, and 75.19 is rounded up to 75.2. It also is noted that the length value will always be an integer
[0041] Methods for selecting endogenous target sequences and generating TAL effector endonucleases targeted to such sequences can be performed as described elsewhere. See, for example, PCT Publication No. WO 201 1/072246, which is incorporated herein by reference in its entirety. TAL effectors are found in plant pathogenic bacteria in the genus Xanthomonas. These proteins play important roles in disease, or trigger defense, by binding host DNA and activating effector-specific host genes {see, e.g., Gu et al, Nature 435:1 122-1 125, 2005; Yang et al, Proc. Natl. Acad. Sci. USA 103:10503-10508, 2006; Kay et al. Science 318:648-651, 2007; Sugio et al, Proc. Natl. Acad. Sci. USA 104:10720-10725, 2007; and Romer et al. Science 318:645-648, 2007). Specificity depends on an effector-variable number of imperfect, typically 34 amino acid repeats (Schornack et al, J. Plant Physiol. 163:256-272, 2006; and WO 201 1/072246). Polymorphisms are present primarily at repeat positions 12 and 13, which are referred to herein as the repeat variable-diresidue (RVD).
[0042] The RVDs of TAL effectors correspond to the nucleotides in their target sites in a direct, linear fashion, one RVD to one nucleotide, with some degeneracy and no apparent context dependence. This mechanism for protein-DNA recognition enables target site prediction for new target specific TAL effectors, as well as target site selection and engineering of new TAL effectors with binding specificity for the selected sites.
[0043] TAL effector DNA binding domains can be fused to other sequences, such as endonuclease sequences, resulting in chimeric endonucleases targeted to specific, selected DNA sequences, and leading to subsequent cutting of the DNA at or near the targeted sequences. Such cuts (i.e., double-stranded breaks) in DNA can induce mutations into the wild type DNA sequence via NHEJ or homologous recombination, for example. In some cases, TAL effector endonucleases can be used to facilitate site directed mutagenesis in complex genomes, knocking out or otherwise altering gene function with great precision and high efficiency. As described in the Examples below, TAL effector endonucleases targeted to each of the N. benthamiana XylT and FucT alleles can be used to mutagenize the endogenous genes, resulting in plants without detectable expression of these genes. The fact that some endonucleases (e.g., Fokl) function as dimers can be used to enhance the target specificity of the TAL effector endonuclease. For example, in some cases a pair of TAL effector endonuclease monomers targeted to different DNA sequences (e.g., the underlined target sequences shown in
[0044] The term expression as used herein refers to the transcription of a particular nucleic acid sequence to produce sense or antisense mRNA, and/or the translation of a sense mRNA molecule to produce a polypeptide (e.g., a therapeutic protein), with or without subsequent post-translational events.
[0045] Reducing the expression of a gene or polypeptide in a plant or a plant cell includes inhibiting, interrupting, knocking-out, or knocking-down the gene or polypeptide, such that transcription of the gene and/or translation of the encoded polypeptide are reduced as compared to a corresponding wild type plant or plant cell. Expression levels can be measured using methods such as, for example, reverse transcription-polymerase chain reaction (RT-PCR), Northern blotting, dot-blot hybridization, in situ hybridization, nuclear run-on and/or nuclear run-off, RNase protection, or immunological and enzymatic methods such as ELISA, radioimmunoassay, and western blotting.
[0046] Methods for using TAL effector endonucleases to generate plants, plant cells, or plant parts having mutations in endogenous genes include, for example, those described in the Examples herein. For example, nucleic acids encoding TAL effector endonucleases targeted to selected XylT or FucT sequences (e.g., the XylT sequences shown in
[0047] The mutagenized population, or a subsequent generation of that population, can be screened for a desired trait(s) (e.g., a lack of xylosyltransferase and fucosyltransferase activities, or reduced xylosyltransferase and fucosyltransferase activities) resulting from the mutations. Alternatively, the mutagenized population, or a subsequent generation of that population, can be screened for a mutation in a XylT or FucT gene. For example, the progeny M.sub.2 generation of Mi plants may be evaluated for the presence of a mutation in a XylT or FucT gene. A population is any group of individuals that share a common gene pool. As used herein, M.sub.0 refers to plant cells (and plants grown therefrom) exposed to a TAL effector nuclease, while Mi refers to seeds produced by self-pollinated M.sub.0 plants, and plants grown from such seeds. M.sub.2 is the progeny (seeds and plants) of self-pollinated Mi plants, M.sub.3 is the progeny of self-pollinated M.sub.2 plants, and M.sub.4 is the progeny of self-pollinated M.sub.3 plants. M5 is the progeny of self-pollinated M.sub.4 plants. M.sub.6, M.sub.7, etc. are each the progeny of self-pollinated plants of the previous generation. The term selfed as used herein means self-pollinated.
[0048] One or more Mi tobacco plants can be obtained from individual, mutagenized (M.sub.0) plant cells (and plants grown therefrom), and at least one of the plants can be identified as containing a mutation in a XylT or FucT gene. An Mi tobacco plant may be heterozygous for a mutant allele at a XylT and/or a FucT locus and, due to the presence of the wild-type allele, exhibit xylosyl- or fucosyltransferase activity. Alternatively, an Mi tobacco plant may have a mutant allele at a XylT or FucT locus and exhibit the phenotype of lacking xylosyl- or fucosyltransferase activity. Such plants may be heterozygous and lack xylosyl- or fucosyltransferase activity due to phenomena such a dominant negative suppression, despite the presence of the wild-type allele, or may be homozygous due to independently induced mutations in both alleles at the XylT or FucT locus.
[0049] A tobacco plant carrying mutant XylT and FucT alleles can be used in a plant breeding program to create novel and useful lines, varieties and hybrids. Thus, in some embodiments, an Mi, M.sub.2, M.sub.3, or later generation tobacco plant containing at least one mutation in a XylT and at least one mutation in a FucT gene is crossed with a second Nicotiana plant, and progeny of the cross are identified in which the XylT and FucT gene mutations are present. It will be appreciated that the second Nicotiana plant can be one of the species and varieties described herein. It will also be appreciated that the second Nicotiana plant can contain the same XylT and FucT mutations as the plant to which it is crossed, different XylT and FucT mutations, or be wild-type at the XylT and/or FucT loci.
[0050] Breeding can be carried out via known procedures. DNA fingerprinting, SNP or similar technologies may be used in a marker-assisted selection (MAS) breeding program to transfer or breed mutant XylT and FucT alleles into other tobaccos. For example, a breeder can create segregating populations from hybridizations of a genotype containing a mutant allele with an agronomically desirable genotype. Plants in the F.sub.2 or backcross generations can be screened using markers developed from a XylT and FucT sequences or fragments thereof. Plants identified as possessing the mutant allele can be backcrossed or self-pollinated to create a second population to be screened. Depending on the expected inheritance pattern or the MAS technology used, it may be necessary to self-pollinate the selected plants before each cycle of backcrossing to aid identification of the desired individual plants. Backcrossing or other breeding procedure can be repeated until the desired phenotype of the recurrent parent is recovered.
[0051] Successful crosses yield Fi plants that are fertile and that can be backcrossed with one of the parents if desired. In some embodiments, a plant population in the F.sub.2 generation is screened for XylT and FucT gene expression, e.g., a plant is identified that fails to express XylT and FucT due to the absence of a XylT and FucT genes according to standard methods, for example, using a PCR method with primers based upon the nucleotide sequence information for XylT and FucT described herein. Selected plants are then crossed with one of the parents and the first backcross (BCi) generation plants are self-pollinated to produce a BCiF.sub.2 population that is again screened for variant XylT and FucT gene expression (e.g., null versions of the XylT and FucT genes). The process of backcrossing, self-pollination, and screening is repeated, for example, at least 4 times until the final screening produces a plant that is fertile and reasonably similar to the recurrent parent. This plant, if desired, can be self-pollinated, and the progeny subsequently can be screened again to confirm that the plant lacks XylT and FucT gene expression. Cytogenetic analyses of the selected plants optionally can be performed to confirm the chromosome complement and chromosome pairing relationships. Breeder's seed of the selected plant can be produced using standard methods including, for example, field testing, confirmation of the null condition for XylT and FucT, and/or analyses of cured leaf to determine the level of xylosyl- and fucosyltransferase activity.
[0052] In situations where the original Fi hybrid resulting from the cross between a first, mutant tobacco parent and a second, wild-type tobacco parent, is hybridized or backcrossed to the mutant tobacco parent, the progeny of the backcross can be self-pollinated to create a BCiF.sub.2 generation that is screened for the mutant XylT and FucT alleles.
[0053] The result of a plant breeding program using the mutant tobacco plants described herein can be novel and useful lines, hybrids and varieties. As used herein, the term variety refers to a population of plants that share constant characteristics which separate them from other plants of the same species. A variety is often, although not always, sold commercially. While possessing one or more distinctive traits, a variety can be further characterized by a very small overall variation between individuals within that variety. A pure line variety may be created by several generations of self-pollination and selection, or vegetative propagation from a single parent using tissue or cell culture techniques. A variety can be essentially derived from another line or variety. As defined by the International Convention for the Protection of New Varieties of Plants (Dec. 2, 1961, as revised at Geneva on Nov. 10, 1972, on Oct. 23, 1978, and on Mar. 19, 1991), a variety is essentially derived from an initial variety if: a) it is predominantly derived from the initial variety, or from a variety that is predominantly derived from the initial variety, while retaining the expression of the essential characteristics that result from the genotype or combination of genotypes of the initial variety; b) it is clearly distinguishable from the initial variety; and c) except for the differences which result from the act of derivation, it conforms to the initial variety in the expression of the essential characteristics that result from the genotype or combination of genotypes of the initial variety. Essentially derived varieties can be obtained, for example, by the selection of a natural or induced mutant, a somaclonal variant, a variant individual from plants of the initial variety, backcrossing, or transformation. A line as distinguished from a variety most often denotes a group of plants used non-commercially, for example in plant research. A line typically displays little overall variation between individuals for one or more traits of interest, although there may be some variation between individuals for other traits.
[0054] Hybrid tobacco varieties can be produced by preventing self-pollination of female parent plants (i.e., seed parents) of a first variety, permitting pollen from male parent plants of a second variety to fertilize the female parent plants, and allowing Fi hybrid seeds to form on the female plants. Self-pollination of female plants can be prevented by emasculating the flowers at an early stage of flower development. Alternatively, pollen formation can be prevented on the female parent plants using a form of male sterility. For example, male sterility can be produced by cytoplasmic male sterility (CMS), or transgenic male sterility wherein a transgene inhibits microsporogenesis and/or pollen formation, or self-incompatibility. Female parent plants containing CMS are particularly useful. In embodiments in which the female parent plants are CMS, pollen is harvested from male fertile plants and applied manually to the stigmas of CMS female parent plants, and the resulting Fi seed is harvested.
[0055] Varieties and lines described herein can be used to form single-cross tobacco Fi hybrids. In such embodiments, the plants of the parent varieties can be grown as substantially homogeneous adjoining populations to facilitate natural cross-pollination from the male parent plants to the female parent plants. The Fi seed formed on the female parent plants is selectively harvested by conventional means. One also can grow the two parent plant varieties in bulk and harvest a blend of Fi hybrid seed formed on the female parent and seed formed upon the male parent as the result of self-pollination. Alternatively, three-way crosses can be carried out wherein a single-cross Fi hybrid is used as a female parent and is crossed with a different male parent. As another alternative, double-cross hybrids can be created wherein the Fi progeny of two different single-crosses are themselves crossed. Self-incompatibility can be used to particular advantage to prevent self-pollination of female parents when forming a double-cross hybrid.
[0056] This disclosure also provides methods for producing polypeptides (e.g., therapeutic glycoproteins). In some cases, the plants, cells, plant parts, seeds, and progeny provided herein can contain a nucleic acid molecule encoding a heterologous polypeptide (e.g., a recombinant polypeptide). In some cases, the methods provided herein can include providing a Nicotiana plant, plant cell, or plant part having a TAL effector endonuclease-induced mutation in each of a plurality of the endogenous XylT and FucT alleles (e.g., in two or more of the endogenous XylT alleles and in two or more of the endogenous FucT alleles), where the plant, plant cell, or plant part further contains a nucleic acid encoding a heterologous polypeptide (e.g., a recombinant polypeptide). In some cases, the methods provided herein can include providing a Nicotiana plant, plant cell, or plant part having a TAL effector endonuclease-induced mutation in one or more of the endogenous XylT and FucT alleles (e.g., in one or more of the endogenous XylT alleles and in one or more of the endogenous FucT alleles), where the plant, plant cell, or plant part further contains a nucleic acid encoding a heterologous polypeptide (e.g., a recombinant polypeptide). The coding sequence for the heterologous polypeptide can be operably linked to a plant-expressible promoter, and also to a sequence involved in transcription termination and polyadenylation. In some cases, the methods also can include maintaining the plant or plant cell under conditions (e.g., suitable temperature, humidity, light/dark, airflow, and nutritional conditions, in a greenhouse and/or in aqueous conditions) and for a time (e.g., 6 to 12 hours, 12 to 24 hours, 24 to 48 hours, 48 hours to 7 days, 7 days to 30 days, or more than 30 days) sufficient for the polypeptide to be produced. In some cases, the methods for producing a polypeptide can further include isolating the expressed polypeptide from the plant or plant cell. Techniques for isolating such polypeptides can include, for example, conventional techniques such as extraction, precipitation, chromatography, affinity chromatography, and electrophoresis.
[0057] A plant-expressible promoter is a DNA sequence that is capable of controlling (initiating) transcription in a plant cell. This includes any promoter of plant origin, as well as any promoter of non-plant origin that is capable of directing transcription in a plant cell [e.g., promoters of viral or bacterial origin such as the CaMV35S promoter, T-DNA gene promoters, tissue-specific or organ-specific promoters such as seed-specific promoters, organ specific promoters (e.g., stem-, leaf-, root-, or mesophyll-specific promoters)].
[0058] In some cases, a Nicotiana plant, plant cell, plant part, seed, or progeny provided herein can contain a nucleic acid encoding a heterologous polypeptide. A heterologous polypeptide is a polypeptide that is not naturally occurring in the plant or plant cells. This is in contrast with homologous polypeptides, which are polypeptides naturally expressed by the plant or plant cells. Heterologous and homologous polypeptides that undergo post-translational N-glycosylation are referred to herein as heterologous or homologous glycoproteins, respectively.
[0059] Examples of heterologous polypeptides that can be produced using the plants and methods described herein for administration to humans or animals include, without limitation, cytokines, cytokine receptors, growth factors, growth factor receptors, growth hormones, insulin, pro-insulin, erythropoietin, colony stimulating factors, interleukins, interferons, tumor necrosis factor, tumor necrosis factor receptor, thrombopoietin, thrombin, natriuretic peptides, clotting factors, anti-clotting factors, tissue plasminogen activator, urokinase, follicle stimulating hormone, luteinizing hormone, calcitonin, CD proteins, CTLA proteins, T-cell and B-cell receptor proteins, bone morphogenic proteins, neurotrophic factors, rheumatoid factor, RANTES, albumin, relaxin, macrophage inhibitory protein, viral proteins or antigens, surface membrane proteins, enzymes, regulatory proteins, immunomodulatory proteins, homing receptors, transport proteins, superoxide dismutase, G-protein coupled receptor proteins, neuromodulatory proteins, antigens (e.g., bacterial or viral antigens), and antibodies or fragments thereof. In some cases, the plant-produced polypeptides can be used as vaccines.
[0060] Antibodies include antibodies of the classes IgD, IgG, IgA, IgM, IgE, as well as recombinant antibodies such as single-chain antibodies, chimeric and humanized antibodies, and multi-specific antibodies. The term antibody also refers to fragments and derivatives of all of the foregoing, and may further include any modified or derivatized variants thereof that retain the ability to specifically bind an epitope. Antibodies include monoclonal antibodies, polyclonal antibodies, humanized or chimeric antibodies, camelized antibodies, camelid antibodies, single chain antibodies (scFvs), Fab fragments, F(ab).sub.2 fragments, disulfide-linked Fvs (sdFv) fragments, anti-idiotypic antibodies, intra-bodies, synthetic antibodies, and epitope-binding fragments of any of the above. The term antibody also refers to fusion proteins that include a region equivalent to the Fc region of an immunoglobulin.
[0061] The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
EXAMPLES
Example 1Engineering Sequence-Specific Nucleases to Mutagenize the FucT and XylT Gene Families
[0062] In N. benthamiana, mutations were sought in two FucT genes (FucT1 and FucT2) and two XylT genes (XylT1 and XylT2). Since each gene has two alleles, inactivation of these genes required the introduction of mutations at eight target sites.
[0063] To completely inactivate or knock-out the members of the XylT gene family in N. benthamiana, sequence-specific nucleases were designed that target the protein coding region in the vicinity of the start codon. The first 90-bp of the coding sequences are identical between the XylT1 and XylT2 genes (
[0064] The first 130-bp of the coding sequences for the FucT1 and FucT2 genes are conserved but not identical (
Example 2FucT and XylT TAL Effector Endonuclease Activity in Yeast
[0065] To assess the activity of the TAL effector endonucleases targeting the XylT and FucT genes, activity assays were performed in yeast by methods similar to those described elsewhere (Christian et al, Genetics 186:757-761, 2010). For these assays, a target plasmid was constructed with the TAL effector endonuclease recognition site cloned in a non-functional -galactosidase reporter gene. The target site was flanked by a direct repeat of -galactosidase coding sequence such that if the reporter gene was cleaved by the TAL effector endonuclease, recombination would occur between the direct repeats and function would be restored to the -galactosidase gene. -galactosidase activity, therefore, served as a measure of TAL effector endonuclease cleavage activity.
[0066] In the yeast assay, two of the XylT TAL effector endonuclease pairs (XYL_T03 and XYL T04) exhibited high cleavage activity under two distinct temperature conditions (i.e., 37 C. and 30 C.). Five of the FucT TAL effector endonuclease pairs (two for target site 1, two for target site 2, and one for target site 4) exhibited high cleavage activities at both 37 C. and 30 C. Cleavage activities were normalized to the benchmark nuclease, I-Scel. Results are summarized in Table 2.
Example 3Activity of the FucT and XylT TAL Effector Endonucleases at Their Endogenous Target Sites in N. benthamiana
[0067] TAL effector endonuclease activity at endogenous target sites in N. benthamiana was measured by expressing the TAL effector endonucleases in protoplasts and surveying the TAL effector endonuclease target sites for mutations introduced by NHEJ. Methods for protoplast preparation were performed as described elsewhere (Wright et al, Plant J. 44:693-705, 2005). Briefly, seeds were sterilized by washing them successively with 100% ethanol, 50%>bleach and then sterile distilled water. The sterilized seeds were planted on MS agarose medium supplemented with iron. Protoplasts were isolated from young expanded leaves using the protocol described by Wright et al. {supra).
[0068] TAL effector endonuclease-encoding plasmids together with a YFP-encoding plasmid were introduced into N. benthamiana protoplasts by PEG-mediated transformation as described elsewhere (Yoo et al, Nature Protocols 2:1565-1572, 2007). Twenty-four hours after treatment, transformation efficiency was measured by evaluating an aliquot of the transformed protoplasts using a flow cytometer to monitor YFP fluorescence. The remainder of the transformed protoplasts was harvested, and genomic DNA was prepared by a CTAB-based method. Using the genomic DNA prepared from the protoplasts as a template, an approximately 300-bp fragment encompassing the TAL effector endonuclease recognition site was amplified by PCR. The PCR product was then subjected to 454 pyro-sequencing. Sequencing reads with insertion/deletion (indel) mutations in the spacer region were considered as having been derived from imprecise repair of a cleaved TAL effector endonuclease recognition site by NHEJ. Mutagenesis frequency was calculated as the number of sequencing reads with NHEJ mutations out of the total sequencing reads. The values were then normalized by the transformation efficiency.
[0069] The activity of the TAL effector endonuclease pairs, XylT03 and XylT04, against their target genes is summarized in Table 3. Both TAL effector endonuclease pairs induced very high frequencies of NHEJ mutations in both XylT1 and XylT2, ranging from 28.2% to 73.8%. Examples of TAL effector endonuclease-induced mutations in XylT1 and XylT2 are shown in
Example 4N. benthamiana Lines with TAL Effector Endonuclease-Induced Mutations in XylT or FucT
[0070] N. benthamiana lines were created with mutations in the XylT or FucT genes. Based on the 454 pyro-sequencing data, the TAL effector endonuclease pairs with the highest cleavage activity (XylT_T04 and FucT2_T02), were chosen to mutagenize the XylT and FucT genes. Protoplasts were isolated from sterile leaves, and transformed with plasmids encoding one of the following: (i) TAL effector endonuclease XylT_T04; (ii) TAL effector endonuclease FucT2_T02; or (iii) YFP. Transformation efficiencies were monitored by the delivery of the YFP plasmid, which was visualized using a fluorescent microscope or by flow cytometry as described above.
[0071] After transformation, protoplast-derived calli were generated (Van den Elzen et al, Plant Mol. Biol. 5:299-302, 1985) Immediately after PEG-mediated transformation, protoplasts were re-suspended in K3G1 media at the cell density of 110.sup.5/ml in a small petri dish, and stored at 25 C. in the dark. At day 4 after transformation, when the majority of the protoplasts were beginning their first cell division, the protoplast culture was diluted four-fold in Media C (Van den Elzen et al, supra). At day 7 and day 10, the protoplast cultures were diluted two-fold in MS media. At day 18 after transformation, calli were identified under the light microscope, and one month after transformation, protoplast-derived calli were visible to the eye. These visible calli were transferred to shoot-inducing medium. After shoots of a few cm in length emerged, they were cut at the base and transferred to root-inducing medium. Once roots formed, they were transferred to soil.
[0072] A small piece of leaf tissue was used to prepare genomic DNA from the regenerated plants. DNA samples were assessed by PCR amplification of the target locus and DNA sequencing to identify those plants with mutations in XylT or FucT. As shown in
Example 5N. benthamiana Lines with TAL Effector Endonuclease-Induced Mutations in XylT and FucT
[0073] To create N. benthamiana lines with mutations in all alleles of all four XylT and FucT genes, protoplasts were transformed with both TAL effector endonucleases, XylT_T04 and FucT2_T02 (Yoo et al, Nature Protocols 2:1565-1572, 2007; and Zhang et al, Plant Physiol. 161:20-27, 2012). As described above (Van den Elzen et al, Plant Mol. Biol. 5:299-302, 1985), plantlets were regenerated and screened for mutations in the XylT and FucT genes. Screening was performed by PCR amplification of the target and DNA sequence analysis of the amplification products.
[0074] Using this approach, plant line NB14-29a was identified that as having deletion mutations in all eight alleles of four loci. This plant line is homozygous for a 44 bp deletion at FucT1 and heterozygous for 2 bp and 40 bp deletions at FucT2 (
[0075] In alternative studies, N. benthamiana lines with mutations in one or more XylT alleles are crossed with the N. benthamiana lines having mutations in one or more FucT alleles. In subsequent generations, the resulting progeny are screened for those individuals that are homozygous for all mutations present in the parental lines. Additional crosses may be performed with other lines that have mutations in other FucT or XylT genes. Such iterative crossing is used to generate plants that are homozygous for mutant alleles of XylT and FucT. Screening for mutations is performed by PCR amplification and direct DNA sequencing of the PCR products from individual plants.
Example 6Mutant N. benthamiana Lines with Reduced Levels of a1,3-Fucose and Lacking Detectable pi,2-Xylose
[0076] The presence of a1,3-fucose and pi,2-xylose on endogenous proteins in the mutant N. benthamiana lines was assessed by mass spectrometry (North et al, Curr. Opin. Struct. Biol. 19:498-506, 2009). Using a similar approach (Strasser et al, Plant Biotechnol. J. 6:392-402, 2008), soluble proteins were isolated from green leaves of NB13-105a, NB13-213a, NB15-1 1d, NB12-1 13c, and wild type N. benthamiana. N-glycans were released from proteins by digestion with peptide-N-giyeosidase A and F. Released N-glycans were purified using Ultra Clean SPE Carbograph columns (Alltech) and methylated in vitro. Permethylated N-glycans were analyzed via MALDI TOF MS (Matrix-assisted laser desorption-ionization time-of-flight mass spectrometry) (Karas and Hillenkamp, Anal. Chem. 60:259-280, 1988).
[0077] N-glycosylation analysis showed reduced levels (more than 60%) of fucosylation in NB13-105a and NB13-213a compared to wild type N. benthamiana (
[0078] N-glycosylation analysis also was performed on endogenous proteins purified from line NB14-29a, which has mutations in all eight alleles of the FucT and XylT genes (
Example 7Mutant N. benthamiana Lines have Reduced Levels of a1,3-Fucose and pi,2-Xylose on Expressed Polypeptides
[0079] The presence of a1,3-fucose and pi,2-xylose on heterologous polypeptides expressed in the mutant N. benthamiana lines is assessed by mass spectrometry (Strasser et al, Plant Biotechnol. J. 6:392-402, 2008). A heterologous polypeptide, such as a human immunoglobulin (e.g., IgG), is expressed by introducing into the mutant N. benthamiana lines the coding sequence for the polypeptide by, for example, agrobacterium infiltration (Yang et al., Plant J. 22:543-551, 2000) or electroporation of protoplasts derived from mutant lines. Nine days after agrobacterium infiltration or 48 hours after electroporation, total polypeptides are extracted from mutant plants, and IgG is purified using protein G. The heavy chain of the purified antibody is isolated by cutting the corresponding band from a reduced SDS-PAGE gel. The heavy chain protein in this band is used for glycan analysis by LC-MS as described by Strasser et al. {supra).
TABLE-US-00001 TABLE1 TALeffectorendonucleasetargetsequences SEQ SEQ Target ID Target ID Gene sequence NO: sequence2 NO: XylT_T01 TGAACAAGA 45 TCTTCCCTC 46 AAAAGCTG TCAACTCA XylT_T02 TGAAAATTC 47 AACTCAATC 48 TTGTTTCT ACTCTCTA XylT_T03 TTCTTGTTT 49 ATCACTCTC 50 CTCTCTTC TATCTCTA XylT_T04 TCTCTTCGC 51 CTCTACTTC 52 TCTCAACT TCTTCCCA FucT1_T01 TGAGATCGG 53 AATAAGCAA 54 CGTCAAAT TGGCGCAA FucT2_T01 TGAGATCGT 55 GATAAACAA 56 CGTCAAAT TGGCGCAA FucT1_J02 TTCAAACGC 57 CTCTGTTCG 58 ACCCAATA TTGCCCTA FucT2_T02 TTCAAACGC 59 CTCTGTTCG 58 ACCCGATA TTGCCCTA FucT1_T03 TCTGTTCGT 60 TTTCTTTTC 61 TGCCCTAG TGGTTCGA FucT2_T03 TCTGTTCGT 60 TTTCTTTTC 61 TGCCCTAG TGGTTCGA FucT1_J04 TTGCCTCTG 62 TTTCTGGTT 63 TTCGTTGC CGACTCGA FucT2_J04 TTGCCTCTG 62 TTTCTGGTT 63 TTCGTTGC CGACTCGA
TABLE-US-00002 TABLE2 XylTandFucTTALeffectorendonucleaseactivityinyeast Activity SEQ in TALeffector ID yeast.** Name endonucleasetarget* NO: Comment 37C. 30C. XylTT03 TTCTTGTTTCTCTCTTCGCTCTC 64 Conservedfor 0.9 0.7 AACTCAATCACTCFCTATGTCTA bothXylT1 andXylT2 XylT_T04 TCTCTTCGCTCTCAACTCAATCA 65 Conservedfor 0.9 0.9 CTCTCTATCTCTACTTCTCTTCC bothXylT1 CA andXylT2 FucT1_T01 TGAGATCGGCGTCAAATTCAAAC 66 Variationin 0.8 0.6 GCACCCACTAAGCAATGGCGCAA DNAbinding FucT2T01 TGAGATCGTCGTCAAATTCAAAC 67 domain 0.9 0.8 GCACCCGATAAACAATGGCGCAA FucT1_T02 TTCAAACGCACCCAATAAGCANT 68 Variationin 0.9 0.7 GGCGCAATTGGTTGCCTCTGTTC DNAbinding GTTGCCCTA domain FucT2T02 TTCAAACGCACCCGATAAACAAT 69 0.9 0.7 GGCGCAATTGGTTGCCTCTGTTC GTTGCCCTA FucT1T04 TTGCCTCTGTTCGTTGCCCTAGT 70 Conservedin 0.6 0.5 GATTATAGCTGAGTTTTCTTTTC binding TGGTTCGACTCGA domain, FucT2T04 TTGCCTCTGTTCGTTGCCCTAGT 71 variationin 0.6 0.5 TGTTATAGCAGAAATTTCTTTTC spacer TGCTFFCGACTCGA {circumflex over ()}Underlining indicates variations **Normalized to I-Scel (max =1.0)
TABLE-US-00003 TABLE 3 454 Pyro-Sequencing Data for XylT and FucT TAL effector endonudeases NHEJ mutagenesis TAL effector freq. with TAL NHEJ mutagenesis Protoplast endonuclease Location of effector freq. with transformation name target site endonuclease* negative control** efficiency XylT T03 XylT1 34.4% (3169) 0.36% 81% XylT2 28.2% (420) 0.06% 81% XylT T04 XylT1 73.8% (1615) 0.36% 84% XylT2 63.9% (464) 0.06% 84% FucT1_T02 FucT1 39.2% (27470) 0.79% 87% FucT2 24.7% (7259) 0.14% 87% FucT2_T02 FucT1 46.5% (12295) 0.79% 87% FucT2 45.0% (6457) 0.14% 87% *NHEJ mutagenesis frequency was obtained by normalizing the percentage of 454 reads with NHEJ mutations to the protoplast transformation efficiency. The total number of 454 sequencing reads used for this analysis was indicated in parentheses. **Negative controls were obtained from protoplasts transformed only by the YFP-coding plasmid.
TABLE-US-00004 TABLE4 RepresentativeXylTandFucTsequences N.benthamianaXylT1(GenBankEF562628.1;SEQIDNO:72) gatccagaaaagcactgaacgttgtttaaccctctgtagtctactctgtactaagtagtacacacgaaaacagccagtcggagagagtagaagatgaacaag ataaagctgaaaattcttgttTctctcttcgctctcaactcaatcactctctatctctacttctcttcccaccctgatcacaaatccc{circumflex over ()}ccaaaaccacttt tccttgtcggaaaaccaccatcataatttccactcttcaatcacttctcaatattccaagccttggcctattttgccctcctacctcccttggtctcaaaac cctaatgttgcttggagatcgtgcgagggttacttcggtaatgggtttactctcaaagttgaccttctcaaaacttcgccggagtttcaccggaaattcggc gataacaccgtctccggtgacggcggatggtttaggtgttttttcagtgagactttgcagagttcgatctgcgagggaggcgcaatacgaatgaatccggac gatattttgatgtctcgtggaggtgagaaattggagtcggttattggtaggaatgaagatgatgagctgcccatgacaaaaatggagctaccaaattgaagt tactgataaactgaaaattgggaaaaaactagtggataaaaaattatgaataaatacttaccgggaggtgcgatttcaaggcacactatgcgtgagttaatt gactctattcagttggttggcgccgatgaatttcactgttctgagtggogaggagccgtcacttttgattacacgatttgagtatgcaaaccttttccacac agttaccgattggtatagtgcatacgcggcatccagggttactggtttgcccagtcggccaaataggtttttgtagatggccattgtgagacacaattggag gaaacatggaaagcacttttttcaagcctcactta{circumflex over ()}gctaagaactttagtggcccagtagtaccgtcatgctgtcctctcgcctttaggatatgaaactgc cctgtttaagggactgtcagaaactatagattgtaatggagcttctgctcatgatagtggcaaaagcctgatgataaaaaaactgcacggttgtccgagttt ggggagatgatcagggcagcctttggatttcctgtggatagacagaacatcccaaggacagtcacaggccctaatgtcctctttgttagacgtgaggattat ttagctcacccacgtcatggtggaaaggtacagtctaggcttagcaatgaagagctagtatttgattccataaagagctgggccttgaaccactcggagtgt aaattaaatgtaattaacggattgtttgcccacatgtccatgaaagagcaagttcgagcaatccaagatgatctgtcattgttggtgctcatggagcaggtc taactcacatagtt{circumflex over ()}{circumflex over ()}tgcagcaccaaaagctgtaatactagaaattataagCagcgaatataggcgcccccattttgctctgattgcacaatggaaaggat tggagtaccatcccatatatttggaggggtatatgcggatcctccagttgtgatcacaagctcagcagcattttgaggagtcttgggtgctaaatctgctcg acagtttagttcggcttttctctaaaagattgggaaggatagaggaattcggggactggaacttggagcctgggaattgtgtaaaatatgtacac{circumflex over ()}cgcagt tctatagtcaattgctgcaatctggtgttcataagcttggaatttttccagcagctactaacttattagcccactctgactcagttatggactaccagagag caattcacaagtaacacgtgtatgtgaaagatccatt N.benthamianaXylT2(GenBankEF562629.1;SEQIDNO:73) agtacagacgaaaacagcccgtgagagagagagagagaggagaagaagatgaacaagaaaaagctgaaaattatgtactctcttcgctctcaactcaatcac tctctatctctacttctcttcccUccctgatcactctcgtcgcaaatccccccagaaccacttacctcgtcggaaaaccaccatcataattt{circumflex over ()}cactcttca atcacttcccaatattccaggccttggcctattttgccctcctacctcccttggtctcaaaaccdaatgttgcttggagatcatgcgagggttacttcggta atggttttactctcaaagttgatcttctcaaaacttcgccggagatcaccggaaattcggcgaaaacaccgtatcggagacggcggatggtaaggtgtttct tcagtgagactagcagagttcgatctgcgagggaggcgcaatacgaatgaatccagacgagattttgatgtctcgtggaggtgagaaattggagtcggttat tggtaggagtgaagatgatgaggtgcccgcgttcaaaactggagcttttcagattaaagttactgataaactgaaatttgggaaaaaattagtggatgaaaa cttcttgaataaatacttaccggaaggtgcaatttcaaggcacactatgcgtgagttaatcgactctattcagttggttggcgccaatgattttcactgttc tgagtggattgaggagccgtcacttttgattacacgatttgagtatgcaaaccttttccacacaattaccgattggtatagtgcatacgt{circumflex over ()}gcatcgagggt tactggcttgcccagtcggccacataggtttttgtagatggccattgtgagacacaattggaggaaacatggaaagcactttatcaagcctcacttatgcta agaactttagtggcccagtttgtttccgtcttgccgtcctctcgcctttgggatatgaaactgccctgtttaagggactgtcagaaactatagattgtaatg gagatctgctcatgatagtggcaaaatcctgatgataagaaaactgcacggttatccgagtaggggagatgatcagggcagcctaggatacctgttgataga cagaacatcccaaggacagtcacaggccctaatgtcctctttgttagacgtgaggattatttagctcacccacgtcatggtggaaaggtacagtctagg{circumflex over ()}a gcaatgaacaagtatttgattccataaagagctgggccttaaaccactcggagtgcaaattaaatgtaattagtggatttgtttgcccacatgtccatgaaa gagcaagttcgagcaatccaagatgcttctgtcattgttggtgctcatggagcaggtctaacccacatagtttctgcagcaccaaaagctgtaatactagaa attataagcagcgaatataggcgcccccattttgctctgattgctcaatggaaaggattggagtaccatcccatatatttggaggggtcttatgcggatcct ccagttgtgatcgacaagctcagcagcattagaggagtcttgggtgctaaatctgctcgacagtagaatagattagtttttgtctaaaagactgggaaggaa agtgaggagtttggggttctgcaacatggagcatgagaattgtgtaaaatatgtttcacacgcagttctatagtcaattgctgcaatctggtgtttataagc ttggaaatttccagcagctactagcttattagcccactctgactcagttatggactaccagagcaatcatatcaaatgggagcatggaatcctgattgtgga attgtgatctcattgaagagcatattctttaaggtgttgaagattacagttgaccagtaacacgtgtatgtgaaagattaggttgttacactttcttgcaat tcattgtcaatttattattaatggtcataggataagaacatgagaaaaccatc{circumflex over ()}gtgttctgtgttgttttcccatcaatctggccaccctctttcctcctt atgttgagatg N.tabacumXylT(GenBankDQ192540.1;SEQIDNO:74) gtcagagagagaagaagatgaacaagaaaaagctgaaatttcttgtactctcttcgctctcaactcaatcactctctatctctacttctcttcccactctga tcacttccgtcacaaatccccccaaaaccactttcctaatacccaaaaccactattccctgtcggaaaaccaccatgataatttccactcttctgte{circumflex over ()}cttc ccaatataccaagccttggccaattttgccctcctacctcccctggtctcagaatcctaatgtttctttgagatcgtgcgagggttacttcggtaatgggtt tactctcaaagagatcttctcaaaacttcgccggagcttcaccagaaattcggcgaaaacaccgtatccggcgacggcggatggtttaggtgttttttcagt ga{circumflex over ()}actttgcagagttcgatttgcgagggaggtgctatacgaatgaatccggacgagattagatgtctcgtggaggcgagaaattggagtcggttattggta ggagtgaagatgatgagctgcccgtgttcaaaaatggagcttttcagattaaagttactgataaactgaaaattgggaaaaaattagtggatgaaaaaatct tgaataaatacttaccggaaggtgcaatttcaaggcacactatgcgtgaattaattgactctattcagttagaggcgccgatgaatttcactgactgagtgg attgaggagccgtcacttagattacacgatttgagtatgcaaaccttttccacacagttaccgattggtatagtgcatacgtggcatccagggttactggct tgcccagtcggccacatttggtttagtagatggccattgtgagacacaattggaggaaacatggaaagcactcttttcaagcctcacttatgctaagaactt tagtggcccagtagtttccgtcacgccgttctct{circumflex over ()}gcctttgggatatgaaactgccctgtttaagggactgacagaaactatagattgtaatggagcttct gcccatgatagtggcaaaatcctgatgataagagaactgcacggagtccgagtaggggagatgatcagggcagcctttggaatcctgtggatagacagaaca tcccaaggacagtcacaggccctaatgtcctctagttagacgtgaggattatttagctcacccacgtcatggtggaaaggtacagtctaggcttagcaatga agagcaagtatttgattccataaagagctgggccttgaaccactcggagtgcaaattaaatgtaattaacggattgtagcccacatgtccatgaaagagcaa gttcgagcaatccaagatgcttctgtcatagttggtgctcatggagcaggtctaactcacatagtactgcagcaccaaaagctgtaatactagaaattataa gcagcgaatataggcgcccccattagctctaattgcacaatggaaaggattggagtaccatcccatatataggaggggtcttat{circumflex over ()}cggatcctccagagtga tcgacaagctcagcagcattagaggagtcttgggtgctaaatctgctc{circumflex over ()}acagtttagttggtcttttctctaaaagactgggaaggaragaggaattcggg gttctggaacctggagcctgggaattgtgtaaaatatgtttcacacgcagttctatagtcaattgctgcaatctggtgttcataagcttggaaatttccagc agctactaacttattagcccactctgactcagttatggactaccagagcaatcatatcaaatgggagcatggaatcctgattgtggaatggtgagctcattg aagagcatattctttatggtgttgaagattacagttgacgagtaacacgtgtatgtgaaagattaggagttacacttt{circumflex over ()}gcaattcattgtcaattgtatt cgtcattcttattaatgatcataggataagaacatgagaaaaccatccatgttctcgttgtLttcccatcaatctggccaccctctttcctctttatgtaga gatgtttcaacagagtttgttttgtagttgtaatacttgtactcacagttactgttagcattcatcccatcagatgtcgaagaagcagattaacaagaacgt cagtatgatgtttcagtgaatatatggttgtaacttgtaaccaaacaaaagaaatgagactt{circumflex over ()}gaccaaagattttgtcacaaaaaaaaaaaa N.tabacumputativeXylT(GenBankAJ627182;SEQIDNO:75) agtcagagagagaagaagatgaacaagaaaaagctgaaatttcttgtttctctcttcgctctcaactcaatcactctctatctctacttctcttcccactct gatcacttccgtcacaaatccccccaaaaccactttcctaatacccaaaaccactattccctgtcggaaaaccaccatgataatttccactcttctgtcact t{circumflex over ()}ccaatataccaagccttggccaattttgccctcctacctcccctggtctcagaatcctaatgtnctttgagatcgtgcgagggttacttcggtaatgggt ttactctcaaagagatcttctcaaaacttcgccggagcttcaccagaaattcggcgaaaacaccgtatccggcgacggcggatggtttaggtgttttttcag tgagactttgcagagttcgatttgcgagggaggtgctatacgaatgaatccggacgagattttgatgtctcgtggaggcagaaattggagtcggttattggt aggagtgaagatgatgagctgcccgtgttcaaaaatggagcttttcagattaaagttactgataaactgaaaattgggaaaaaattagtggatgaaaaaatc ttgaataaatacttaccggaaggtgcaatttcaaggcacactatgcgtgaattaattgactctattcagttagttggcgccgatgaatttcactgttctgag tggattgaggagccgtcacttagattacacgatttgagtatgcaaaccttttccacacagttaccgattggtatagtgcatacgtggcatccagggttactg gctt{circumflex over ()}cccagtcggccacataggtttagtagatggccattgtgagacacaattggaggaaacatggaaagcactcttcgagoctcacttatgctaagaactt tagtggcccagtttgtttccgtcacgccgttctctcgcctttgggatatgaaactgccctgtttaagggactgacagaaactatagattgtaatggagcttc tgcccatgattt{circumflex over ()}{circumflex over ()}ggcaaaatcctgatgataagagaactgcacggttgtctgagtttggggagatgatcagggcagcctttggatttcctgtggatagaca gaacatcccaaggacagtcacaggccctaatgtcctctagttagacgtgaggattatttagctcacccacgtcatggtggaaaggtacagtctaggcttagc aatgaagagcaagtatttgattccataaagagctgggccttgaaccactcggagtgcaaattaaatgtaattaacggattgtagcccacatgtccatgaaag agcaagttcgagcaatccaagatgcttctgtcatagttggtgctcagagcaggtctaactcacatagtttctgcagcaccaaaagctgtaatactagaa attataagcagcgaatataggcgcccccattttgctctgattgcacaatggaaaggattggagtaccatcccatatatttggaggggtcttatgcggatcct ccagttgtgatcgacaggctcagcagcattagaggagtcttgggtgctaagtcc{circumflex over ()}{circumflex over ()}tcgacagtttgaatagttcggcttttctctaaaagacggggaagga tagaggaattcggggttctggaacttggagcctgggaattagataaatatgtacacacgcagttctgtagtcaatggttgcaatrt{circumflex over ()}ggcctcaatctggtg ttgataagcttggcaatttccagcagctactaatttattagcccgctctgactcggttatggactaccagagcaatcatatcaaatggaagcatggaatcct gattgtggaatggtgagctcattgaagagcatattctttatggtgttgaagattacaattcacaattaacacgtgtatgtgaaagattaggttgtttacact tacttacaattcattgtcaattgtttttcattattctcattaatgatcataggataagaacatgagaaaaccatccatgttctgtgttgttttcccatcaat ccggccaccctcttccctcottatgtagagatgatttcaacagagtttgttttgtagttgtaacacttgcactcccagttacagttagcattcgacacattc atcccatcagatgtcaagtttaaaggcataagacatttgacatattgaagaagcagattaacacgaacgtcagtatgatgcttcagtgaagatatggttgta acttgtaaccaaacaaaagaaatgagactttgacaaaaaaaaaaaaaaaaaaaaaaaaaaa N.benthamianaFucT1(GenBankEF562630.1;SEQIDNO:76) atgagatcggcgtcaaattcaaacgcacccaataagcaatggcgcaattggttgcctctgttcgttgccctagtgattatagctgagttttcttttctggtt cgactcgacgtagctgaaaaagccaac{circumflex over ()}cttgggccgaatcgttttatcagttcaccacggcctatggtccacctctaaactggctgtt{circumflex over ()}accacgttcgac gttgaggagtttccattttgttgtgtttttagtggttagttcgattcatgttcttcgtacctgggagttgcgaggagtggaggaaagggaagattctgtggc ttattcgagggattagataatgaaccaatttttgacatgggcctggacaggaattgaaatatgaccataggatgtaagtaggaacagattccaataagaagc ctgatgcagcatttcggctaccacaacaagctggcacagctagtgtgctacggtcgatggagtcagctcaatactatgcagagaacaacattactaggcacg acgaaggggatatgatgttgtaatgacaacaagcctctcttcagatgttcctgaggatacttctcttgggctgagtatgatatcatggctccagtagaacct aaaacagagaatgccttggcagcggattcatactaattgtggtgctcgcaacttccgtt{circumflex over ()}gcaagctttagatgcccttgaaagggcaaatatcagaattga ctatatggaagttgtcatcataacagggatggaagagttgacaaagtgggagcactgaagggttaccagtttagcttgggttttgagaattctaatgaggag gagtatgtaactgaaaaattattcagtctctggtagctgggtcaatccctgtggtggaggtgctcc{circumflex over ()}aacatccaagactttgcgccttctcctaattcagt tttacacattaaagagataaaagatgctgaatcamtgccaataccatgaagtaccttgctcaaaaccctattgcatataatgagtcattaaggtggaagttt gagggcccatctgatgccttcaaagcccttgttgatatggcagcagttcattcatcttgtcgtttgtgcatcttcttggcaagtaggatccgggaaagagaa gagcagagtccaaaatttatgaagcgtccctgcaaatgtaccagagggactgaaactgtatatcatgtatatgtaggtgaaagaggcaggtagagatggatt ccattacttaag{circumflex over ()}gagtgatagtattgaaggcgtttgaatctgctatcctctcgaggttcaagtctgttaaacatgacctgtaggaaggaggaaagacctc aagtactacgaggtggtgatgaactcaaact{circumflex over ()}acaaagtatatcctgttggcttgacacagagacaagcattgttaccttcagattcaacggggatactgag tttaacaattacattcaaagccacccatgtgcaaaatttgaagccatcttcgtatag N.benthamianaFucT(pseudogene,GenBankEF562631.1;SEQIDNO:77) atgagatcgtcgtcaaattcaaacgcacccgataaacaatggcgcaattggttgcctctgacgttgccctagttgttatagcagaaatacttactggttcga ctcgacgtggctgaaaaagccgactcttgggctgagtcgttttatcagttcaccacggcgtcttggtcaacctccaaactggctgttgacggcggcgatgtt gatgaggtcctgttgggtgttagagtggtgagtagatcagggcttgctaccttggagttgcgaggagtggttggaaagggaagattatgtggcttattcgag ggattagataatgaaccaatttttgacatgggcctggacaggaattgaaatcttgaccataggatgtaagtaggaacagattccaataagaagcctgatgca gcatttcggctaccacaacaagctggcacagctagtgtgctacggtcgatggagtcagctcaatactatgcagagaacaacattactaggcacgacgaaggg gatatgatgttgtaatgacaacaagcctctcttcagatgttcctgaggatacttctcttgggctgagtatgatatcatggctccagtagaacctaaaacaga gaatgccttggcagcggctttcatttctaattgtggtgctcgcaactt{circumflex over ()}cgtttgcaagctttagaagccottgaaagggcaaatatcagaattgactatat ggaagttgtcatcataacagggatggaagagtagacaaagtggcagcactgaagcgttacaagtttagcttggatttgagaattctaatgaggaggactatg taaccgaaaaattattcagtctctggtagctgggtcaatccctgtggtggaggtgctccaaacatccaagactagcgccttctcctaattcagttttacaca ttaaagagataaaagatgctgaattagttgccaataccatgacgtaccttgctcaaaaccctattgcatctaatgagtcattaaggtggaagtagagggccc atttgatgccttcaaagccctggagatatggcagcagttcattcatcttgccgtagtgcate{circumflex over ()}tcttggcaagtaggatccaggaaagagaagagcatagtc caaaataacgaagcgcccctgcaaatgtaccagagagactgaaactgtctatcatgtatatgtacgtgaaagagggaggtagagatggattccattacttaa ggtcgagtgatagtattaaaggcgtagaatctgctattctctcgaggacaagtctgaaaacatgttcctgtttggagggaggaaagacctcaagtactacga ggtggtgatgaactcaaactttanaagtatatcctgttggatgacacagagacaagcattgttaccacagattcaacggggatactgagtaaagaattacat tcaaagccacccatgtgcaaaatagaagccatcacgtatag N.tabacumFucT(GenBankAB498916.1;SEQIDNO:78) aacccccccccccccccacccccaactgtcccaccaaatgaagaattcccaaaccctctgaagaagaagaaaaaaagatcacatctttagctattttacttc cacaaaaagaacaaaatttcgagttattaatggcaacagttattccaattcaaaggttaccaagatttgaaggtgttgggtcatcatcacctacaaacgttg cgcttaagaaatggtccagttgggtacctctagtagttgcagttgtggttatagttgaaattacatttctgggtcgactggacatggctgaaaaagccaacc tggtcaactcttggactgactcattttaccagtttacgacgtcgtatggtcaacctccaaagtggaaattagtgagactgggagggtgtgagaggagtagtg aggttgatcggaataggaaactgggagctgtgaggagtggttggaaaaggaggattctgtggagtattctagagattagacaaagacccaatttttgacatg gcggcgaaaaggattggaagtcttgtgccgtaggatgtaactttggtgtggattctgaaaagaagcctgatgcggcatttgggacaccacaacaggctggca cggctagcgtgatcggtcaatggagtcagctcaatactatcctgagaacaacatcgttatggcacga{circumflex over ()}gaaggggatatgatattgtaatgacaacaagcct ctatcggatgttcctgttgggtacttctcttgggcggagtatgatataatggctccagtgcaacctaaaactgagaatgcgttagcagctgcttttatttct aattgtggtgctcgcaacttccggttacaggctatgaagtccttgaaagggcaaatatcaagattgattcttaggcagagtcatcgtaaccgggatggaaat gtggacaaagtggaaactctcaagcgctataaatttagcttcgatagagaattctaatgaggaggattatgtcaccgaaaaattatccagtctctggtagct ggatcagtccctgtggtgattggtgctccaaacatcctagactagctccactcctaattgacttttacacattaaagagctgaaagacgctgcatcagagcc gagactatgaagtaccagcagaaaatcctagtgcatataatgagtcattaaggtggaagatgacggtccatctgactaacaaagccctggagacatggcagc agttcactatatgtcgtagtgtatatatagcaactagtattagggagaaagaagagaagagtccagaataacaaaacgtccctgcaaatgtaccagaggaca gaaactgtctatcatatatatgtacgtgaaagagggaggtttgacatggagtccattttcctaaggtcatctaatagtcattggaggcttagaatgtgcagt actgtcgaagttcaaatgtttaaagcatgttcccatttggaaagaagaaagacctcaaatactacgcggaggggatgaactaaagctctacagggtatatcc tctcggcatgacacaacgacaggcattgtacacctccagattcaaaggagacgccgattttaggaatcacatcgaaagccacccatgtgcaaattttgaagc catatngtatagatcaagtccaaacctgagagtctcgacagcagatgagtaggccatagcgta{circumflex over ()}tgctcagtgtactctatgccccactgtctaacatcatt ctggttatgaattcgtcgtgtagagtaaggatttgattattacatggggccaacctaattagggtggaaagtactgatataacataacaagtaagaaggaac aaactctgaaccttgaatggacatgcctaacctcccaaagagtgcagagggaaattgcgcgtgatatacaaacttggacttggttagctagcagaaaattct agctgatcaatagtaatcta{circumflex over ()}ttcagaggacatctccatcgtg1acaagtaatgacaagtgcagaaactaattaaaggttcttttcggaaaaaaaaaaaaaa
Other Embodiments
[0080] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.