Method of screening for colorectal cancer
10941449 ยท 2021-03-09
Assignee
Inventors
- Lawrence Charles Lapointe (New South Wales, AU)
- Susanne K. PEDERSEN (New South Wales, AU)
- Rohan Baker (New South Wales, AU)
- Snigdha GAUR (New South Wales, AU)
- Melissa THOMAS (New South Wales, AU)
Cpc classification
C12Q2600/112
CHEMISTRY; METALLURGY
G16H50/30
PHYSICS
International classification
Abstract
The present invention relates generally to a method of determining one or more probabilities of respective classifications of a neoplasm into one or more neoplastic categories. More particularly, the present invention relates to a method of determining the probability of classification of a large intestine neoplasm into one or more categories selected from adenoma, stage I, stage II, stage III or stage IV by screening for changes to the methylation levels of a panel of gene markers, including BCAT1, IKZF1, IRF4, GRASP and/or CAHM. The method of the present invention is useful in a range of applications including, but not limited to, those relating to the diagnosis and/or monitoring of colorectal neoplasms, such as colorectal adenocarcinosis.
Claims
1. A method comprising measuring a methylation level of a DNA region of a sample from an individual having or suspected of having a large intestine neoplasm, wherein said measuring of a methylation level of a DNA region of a sample from said individual comprises: selecting an individual from a patient population known or suspected to have a large intestine neoplasm staged as adenoma, stage I, stage II, stage III, or stage IV; obtaining or having obtained a blood-derived sample from said individual, the blood-derived sample comprising circulating cell-free DNA; extracting circulating cell-free DNA from the sample; bisulfite converting the circulating cell-free DNA; and detecting a level of methylation of a DNA region of the bisulfite converted DNA, wherein said detecting comprises hybridizing methylation-specific oligonucleotide primers to the DNA region of the bisulfite converted DNA, wherein the DNA region comprises: (i) the region, including 2kb upstream of the transcription start site, defined by chr12:24962958 . . . 25102393 and at least one of Hg19 coordinates: (1) chr7:50344378 . . . 50472798; (2) chr6:391739 . . . 411443; (3) chr12:52400748 . . . 52409671; or (4) chr6:163834097 . . . 163834982; or (ii) the gene region, including 2kb upstream of BCAT1 and at least one of: TABLE-US-00017 (1) IKZF1; (2) IRF4; (3) GRASP; or (4) CAHM; determining a probability whether said individual has a premalignant neoplasm, an early stage malignant neoplasm or a late stage malignant neoplasm from said measurement of said methylation level of said DNA region of said sample from said individual.
2. The method of claim 1, wherein said methylation level is measured in (1) BCAT1 subregions chr12:25101992-25102093 (SEQ ID NO:1 or corresponding minus strand) and chr12:25101909-25101995 (SEQ ID NO:2 or corresponding minus strand), and one or more chromosomal subregions selected from: (2) IKZF1 subregions: chr7:50343867-50343961 (SEQ ID NO:3 or corresponding minus strand) and chr7:50343804-5033895 (SEQ ID NO:4 or corresponding minus strand) (3) IRF4 subregions chr6:392036-392145 (SEQ ID NO:5 or corresponding minus strand) (4) GRASP subregions: chr12:52399672-52399922, chr12:52400821-52401051 (SEQ ID NO:6 or corresponding minus strand), chr12:52401407-52401664 (SEQ ID NO:7 or corresponding minus strand) chr12:52400866-52400973 and Chr2:52401107-52401664, or (5) CAHM subregions: chr6:163834295-163834500 (SEQ ID NO:8 or corresponding minus strand), chr6:163834621-163834906, chr6:163834393-163834455 and chr6:163834393-163834519.
3. The method of claim 2, wherein said subregion is selected from SEQ ID NO.1 or SEQ ID NO.2, and SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, or SEQ ID NO.8 or corresponding minus strands.
4. The method of claim 2, said method comprising measuring the methylation of one or more cytosine residues selected from: TABLE-US-00018 (BCAT1) chr12:25101998 chr12:25102003 chr12:25102006 chr12:25102009 chr12:25102017 chr12:25102022 chr12:25102039 chr12:25102048 chr12:25102050 chr12:25102053 chr12:25102061 chr12:25102063 chr12:25102071 chr112:25101921 chr12:25101934 chr12:25101943 chr12:25101951 chr12:25101962 chr12:25101964 chr12:25101970 (GRASP) chr12:52399713 chr12:52399731 chr12:52399749 chr12:52399783 chr12:52399796 chr12:52399808 chr12:52399823 chr12:52399835 chr12:52399891 chr12:52400847 chr12:52400850 chr12:52400859 chr12:52400866 chr12:52400869 chr12:52400873 chr12:52400881 chr12:52400886 chr12:52400893 chr12:52400895 chr12:52400899 chr12:52400902 chr12:52400907 chr12:52400913 chr12:52400919 chr12:52400932 chr12:52400938 chr12:52400958 chr12:52400962 chr12:52400971 chr12:52400973 chr12:52400976 chr12:52400998 chr12:52401008 chr12:52401010 chr12:52401012 chr12:52401016 chr12:52401019 chr12:52401025 chr12:52401041 chr12:52401044 chr12:52401053 chr12:52401060 chr12:52401064 chr12:52401092 chr12:52401118 chr12:52401438 chr12:52401448 chr12:52401460 chr12:52401465 chr12:52401474 chr12:52401477 chr12:52401479 chr12:52401483 chr12:52401504 chr12:52401514 chr12:52401523 chr12:52401540 chr12:52401553 chr12:52401576 chr12:52401588 chr12:52401595 chr12:52401599 chr12:52401604 chr12:52401606 chr12:52401634 chr12:52401640 chr12:52401644 chr12:52401659 chr12:52401160 chr12:52401165 chr12:52401174 chr12:52401177 chr12:52401179 chr12:52401183 chr12:52401204 chr12:52401215 chr12:52401223 chr12:52401240 chr12:52401253 chr12:52401288 chr12:52401295 chr12:52401299 chr12:52401304 chr12:52401334 chr12:52401340 chr12:52401344 chr12:52401359 (CAHM) chr6:163834330 chr6:163834332 chr6:163834357 chr6:163834373 chr6:163834384 chr6:163834390 chr6:163834392 chr6:163834406 chr6:163834412 chr6:163834419 chr6:163834443 chr6:163834448 chr6:163834452 chr6:163834464 chr6:163834483 chr6:163834653 chr6:163834660 chr6:163834672 chr6:163834675 chr6:163834678 chr6:163834681 chr6:163834815 chr6:163834824 chr6:163834835 chr6:163834840 chr6:163834853 chr6:163834855 chr6:163834858 chr6:163834863 chr6:163834869 chr6:163834872 (IKZF1) chr7:50343869 chr7:50343872 chr7:50343883 chr7:50343889 chr7:50343890 chr7:50343897 chr7:50343907 chr7:50343909 chr7:50343914 chr7:50343934 chr7:50343939 chr7:50343950 chr7:50343959 chr7:50343805 chr7:50343822 chr7:50343824 chr7:50343826 chr7:50343829 chr7:50343831 chr7:50343833 chr7:50343838 chr7:50343847 chr7:50343850 chr7:50343858 chr7:50343864 chr7:50343869 chr7:50343872 chr7:50343890 (IRF4) chr6:392036 chr6:392047 chr6:392049 chr6:392057 chr6:392060 chr6:392066 chr6:392080 chr6:392094 chr6:392102 chr6:392131 or a corresponding cytosine at position n+1 on the opposite DNA strand.
5. The method of claim 1, wherein any one of said DNA regions exhibit a higher level of methylation relative to a control sample.
6. The method of claim 1, wherein any two or more of said DNA regions exhibits a higher level of methylation relative to a control sample.
7. The method of claim 1, wherein said neoplasm is an adenoma or an adenocarcinoma.
8. The method of claim 1, wherein said neoplasm is a colorectal neoplasm.
9. The method of claim 1, wherein said level of methylation is used to determine one or more probabilities of respective classifications of said large intestine neoplasm of said individual into one or more neoplastic categories selected from adenoma, stage I, stage II, stage III, or stage IV categories.
10. The method of claim 9, wherein said level of methylation is used to determine one or more probabilities of respective classifications of said large intestine neoplasm of said individual into one or more aggregates of fewer than five of said neoplastic categories.
11. The method of claim 1, wherein said level of methylation is used to determine a probability that said large intestine of said individual would be classified as non-neoplastic, based on comparison of said level of methylation relative to said corresponding measured levels of methylation and to corresponding measured levels of methylation from a population of individuals whose large intestines were classified as non-neoplastic.
12. The method of claim 10, wherein said aggregates include one or more of: (i) one or more aggregates of fewer than five of said neoplastic categories and an aggregate of the non-neoplastic category with at least the adenoma category; (ii) a pre-malignant neoplasm category consisting of an aggregate of the non-neoplastic and adenoma categories; (iii) an early stage malignant neoplasm category consisting of an aggregate of the stage I and stage II categories; (iv) a late stage malignant neoplasm category consisting of an aggregate of the stage III and stage IV categories; or (v) the pre-malignant neoplasm category, the early stage malignant neoplasm category, and the late stage malignant neoplasm category.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
(2)
(3) A: The levels of methylated CAHM in colorectal tissue specimens including normals (n=26, solid circles), adenomas (n=17, solid squares), Stage I (n=20, open squares), Stage II (n=21, open circles), Stage III (n=30, open diamonds) and Stage IV (n=8, crosses) were measured using the methylation specific CAHM assay described in M&M on 15 ng of bisulfite converted DNA extracted from 122 tissue specimens (Left figure). The signal output was converted to a mass/well using a calibration curve. Data is given as the % methylated CAHM measured in 15 ng of total bisulfite converted tissue DNA per reaction. Data are mean values of triplicate. B: The levels of methylated CAHM was measured in the equivalent of triplicate analysis of 0.5 mL plasma from colonoscopy-confirmed patients including normals (n=74, solid circles), adenomas (n=73, solid squares), Stage 1 (n=12, open squares), Stage R (n=21, open circles), Stage III (n=23, open diamonds) and Stage IV (n=12, black crosses). The signal output was converted to a mass using a calibration curve. Data is given as pg methylated CAHM per mL plasma. Data are mean values of triplicate. Increased masses of methylated CAHM was observed in blood plasma from patients as a function of disease progression (i.e. pg/mL CAHM was calculated to be higher in Stage II-IV compared Stage I-H). In contrast, high and similar levels of pg methylated CAHM was measured in colorectal tissue from the earliest onset of disease (precancerous) to late stage cancer. C: The levels of methylated CAHM was measured and plotted in a scatter graph of pg methylated CAHM/ml plasma (log 10) vs. wt DNA ng/mL plasma from colonoscopy-confirmed patients including normals (n=74, solid circles), adenomas (n=73, solid squares), Stage I (n=12, open squares), Stage II (n=21, open circles, Stage I (n=23, open diamonds) and Stage IV (n=12, black crosses).
(4)
(5)
DETAILED DESCRIPTION OF THE INVENTION
(6) The present invention is predicated, in part, on the determination that several genes which are known to exhibit increased levels of methylation in individuals exhibiting large intestine neoplasms are also an indicator of the classification of the neoplasm. Specifically, it has been surprisingly determined that although the relative increase in DNA methylation levels of a given gene marker is relatively consistent in a tissue biopsy irrespective of the stage or grade of the neoplasm in issue, the same is not true if a blood-derived sample, such as plasma, is analysed. In particular, whereas a blood-derived sample will also show increased levels of DNA methylation in the context of the presence of a large intestine malignancy, these increased methylation levels become progressively more increased as the malignancy becomes more advanced. This is not observed in tissue specimens. Accordingly, by assessing DNA methylation levels in accordance with the method of the present invention, one can determine not only whether or not malignant transformation has occurred, but further the likely probability that the malignancy would be classified as early stage or late stage.
(7) Accordingly, one aspect of the present invention is directed to a method of determining one or more probabilities of respective classifications of a large intestine neoplasm in an individual, said method comprising assessing the methylation status of a DNA region selected from: (i) the region, including 2 kb upstream of the transcription start site, defined by at least one of Hg19 coordinates:
(8) (1) chr12:24962958 . . . 25102393
(9) (2) chr7:50344378 . . . 50472798
(10) (3) chr6:391739 . . . 411443;
(11) (4) chr12:52400748 . . . 52409671; and
(12) (5) chr6:163834097 . . . 163834982; or (ii) the gene region, including 2 kb upstream of at least one of:
(13) TABLE-US-00007 (1) BCAT1 (2) IKZF1 (3) IRF4 (4) GRASP and (5) CAHM
in a blood-derived sample from said individual, wherein a level of methylation of at least one of the DNA regions of group (i) and/or (ii) relative to corresponding measured levels of methylation from a population of individuals with known neoplastic categories of corresponding large intestine neoplasms is used to determine one or more probabilities of respective classifications of said large intestine neoplasm of said individual into one or more neoplastic categories selected from adenoma, stage I, stage II, stage III, and stage IV categories or into one or more aggregates of fewer than five of said neoplastic categories.
(14) In one embodiment, the method is directed to determining one or more probabilities of respective classifications of said large intestine neoplasms of said individual into one or more aggregates of fewer than five of said neoplastic categories.
(15) The method may further include using said level of methylation for said individual to determine a probability that said large intestine of said individual would be classified as non-neoplastic, based on comparison of said level of methylation relative to said corresponding measured levels of methylation and to further corresponding measured levels of methylation from a further population of individuals whose large intestines were classified as non-neoplastic.
(16) The aggregate categories may include one or more aggregates of fewer than five of said neoplastic categories and an aggregate of the non-neoplastic category with at least the adenoma category.
(17) The aggregate categories may include a pre-malignant neoplasm category consisting of an aggregate of the non-neoplastic and adenoma categories.
(18) The aggregate categories may include an early stage malignant neoplasm category consisting of an aggregate of the stage I and stage II categories.
(19) The aggregate categories may include a late stage malignant neoplasm category consisting of an aggregate of the stage III and stage IV categories.
(20) The aggregate categories may include the pre-malignant neoplasm category, early stage malignant neoplasm category, and late stage malignant neoplasm categories.
(21) Given measured levels of methylation in a population of individuals with known classifications of large intestine neoplasms into neoplastic categories selected from adenoma, stage I, stage II, stage III, and stage IV categories or aggregates of fewer than five of said neoplastic categories, and further measured levels of methylation in a further population of individuals whose large intestines were classified as non-neoplastic, the prior statistical relationships between the measured methylation levels and the corresponding known categories for the populations of individuals can be used to determine one or more probabilities that a further measured methylation level of an individual corresponds to respective ones of the same categories of the large intestine neoplasm or non-neoplastic large intestine of said individual. As will be apparent to those skilled in the art, the determination can be made using any one of a variety of standard statistical methods, including Bayesian statistics and machine learning.
(22) In some embodiments, the statistical method includes generating histograms wherein the measured levels of methylation corresponding to known categories are allocated into bins of respective ranges of methylation levels and using these histograms to estimate at least one probability that a further measured methylation level corresponds to at least one of the known categories. As will be apparent to those skilled in the art, there are many methods to estimate classification probabilities. For example, by adding the total sizes of the bins corresponding to methylation levels of equal or lesser levels to the methylation level in question and dividing this sum by the total across all bins, one can estimate the proportion of methylation levels at or below a given level which are of a known category and thus the probability that a measured methylation level is of said category.
(23) In some embodiments, the statistical distributions of said measured levels of methylation are modelled by standard statistical distributions such as a Gaussian distribution, for example, and a standard fitting or regression procedure such as maximum likelihood is used to determine the parameters of the distributions, which can then be applied to a further measured level of methylation from an individual to determine one or more probabilities that the large intestine of that individual would be classified as respective ones of the neoplastic categories and the non-neoplastic category.
(24) In some embodiments, the method may include using the determined probabilities to automatically classify the large intestine neoplasm of the individual into one of the prior known classifications, whether neoplastic or non-neoplastic. However, given the overlap between measured levels of methylation for the different categories, the probabilities are generally more useful for the selection of possible further medical treatment options.
(25) In other embodiments, the statistical associations between the measured methylation levels on the one hand and the corresponding categories observed by colonoscopy or surgery on the other are used as a training set for supervised learning. The resulting weights are then applied to at least one further measured methylation level for at least one further individual in order to determine corresponding probabilities for membership of those categories for that at least one individual. As will be apparent to those skilled in the art, any one of a number of standard supervised training methods can be used.
(26) The categories used for supervised learning may include all five neoplastic categories and the non-neoplastic category, or aggregates of those six categories, such as the aggregate categories described above. The selection of which categories to use for supervised training may be based on diagnostic/treatment requirements and/or the available number and/or classification confidence of the observed categories (e.g., in order to improve sensitivity and specificity of classification). In any case, the weights generated by supervised learning can also be provided as inputs to a standard classifier in order to classify the large intestine of the individual into a neoplastic or non-neoplastic class or category based on the corresponding measured methylation level.
(27) Reference to neoplasm should be understood as a reference to a lesion, tumour or other encapsulated or unencapsulated mass or other form of growth which comprises neoplastic cells. A neoplastic cell should be understood as a reference to a cell exhibiting abnormal growth. The term growth should be understood in its broadest sense and includes reference to proliferation. In this regard, an example of abnormal cell growth is the uncontrolled proliferation of a cell. Another example is failed apoptosis in a cell, thus prolonging its usual life span. The neoplastic cell may be a benign cell or a malignant cell. In a preferred embodiment, the subject neoplasm is an adenoma or an adenocarcinoma. Without limiting the present invention to any one theory or mode of action, an adenoma is generally a benign tumour of epithelial origin which is either derived from epithelial tissue or exhibits clearly defined epithelial structures. These structures may take on a glandular appearance. It can comprise a malignant cell population within the adenoma, such as occurs with the progression of a benign adenoma or benign neoplastic legion to a malignant adenocarcinoma.
(28) Reference to large intestine should be understood as a reference to a cell derived from one of the eight anatomical regions of the large intestine, which regions commence after the terminal region of the ileum, these being:
(29) (i) the cecum;
(30) (ii) the ascending colon;
(31) (iii) the transverse colon;
(32) (iv) the descending colon;
(33) (v) the sigmoid colon;
(34) (vi) the rectum;
(35) (vii) the splenic flexure; and
(36) (viii) the hepatic flexure.
(37) Preferably, said neoplastic cell is an adenoma or adenocarcinoma and even more preferably a colorectal adenoma or adenocarcinoma.
(38) Reference to DNA region should be understood as a reference to a specific section of genomic DNA. These DNA regions are specified either by reference to a gene name or a set of chromosomal coordinates. Both the gene names and the chromosomal coordinates would be well known to, and understood by, the person of skill in the art. As detailed hereinbefore, the chromosomal coordinates correspond to the Hg19 version of the genome. In general, a gene can be routinely identified by reference to its name, via which both its sequences and chromosomal location can be routinely obtained, or by reference to its chromosomal coordinates, via which both the gene name and its sequence can also be routinely obtained.
(39) Reference to each of the genes/DNA regions detailed above should be understood as a reference to all forms of these molecules and to fragments or variants thereof. As would be appreciated by the person of skill in the art, some genes are known to exhibit allelic variation between individuals or single nucleotide polymorphisms. SNPs encompass insertions and deletions of varying size and simple sequence repeats, such as dinucleotide and trinucleotide repeats. Variants include nucleic acid sequences from the same region sharing at least 90%, 95%, 98%, 99% sequence identity i.e. having one or more deletions, additions, substitutions, inverted sequences etc. relative to the DNA regions described herein. Accordingly, the present invention should be understood to extend to such variants which, in terms of the present diagnostic applications, achieve the same outcome despite the fact that minor genetic variations between the actual nucleic acid sequences may exist between individuals. The present invention should therefore be understood to extend to all forms of DNA which arise from any other mutation, polymorphic or allelic variation.
(40) It should be understood that the individual who is the subject of testing may be any human or non-human mammal. Examples of non-human mammals includes primates, livestock animals (e.g. horses, cattle, sheep, pigs, donkeys), laboratory test animals (e.g. mice, rats, rabbits, guinea pigs), companion animals (e.g. dogs, cats) and captive wild animals (e.g. deer, foxes).
(41) Preferably, said mammal is a human.
(42) As detailed hereinbefore, the method of the present invention enables one to assess the probability that a neoplasm is a premalignant neoplasm, early stage malignancy or late stage malignancy. Although the staging and grading systems which are commonly used by pathologists in the context of large intestine neoplasms (such as colorectal cancers) can purportedly stage such cancers quite precisely, the fact is that they require a biopsy specimen to be harvested, this being a procedure which is invasive. Since the assessment required to be performed is the preparation and histological analysis of a tissue section, it can also take some time to obtain results. In terms of accurately assessing histological specimens, the interpretation of the sections is subjective and can be extremely difficult and unreliable, particularly in the context of moderate grade cancers, as opposed to very early stage cancers or metastatic cancers. Accordingly, the identification of a molecular basis upon which to classify a neoplasm is a significant advance due to the fact that such analyses are not subjective. Still further, since the DNA methylation levels of the genes at issue are assessed in a blood sample, this is the first available non-invasive means of classifying a large intestine neoplasm.
(43) Without limiting the present invention to any one theory or mode of action, the most commonly used staging system for colorectal cancer is that of the American Joint Committee on Cancer (AJCC), sometimes also known as the TNM system. The TNM system describes 3 key pieces of information: T describes how, far the main (primary) tumour has grown into the wall of the intestine and whether it has grown into nearby areas. N describes the extent of spread to nearby (regional) lymph nodes. M indicates whether the cancer has metastasized.
(44) Numbers or letters appear after T, N, and M to provide more details about each of these factors. The numbers 0 through 4 indicate increasing severity.
(45) A detailed description in relation to how the TNM system is applied has been detailed earlier.
(46) Once a person's T, N, and M categories have been determined, usually after surgery, this information is combined in a process called stage grouping. The stage is expressed in Roman numerals from stage I (the least advanced) to stage IV (the most advanced). Nevertheless, despite the apparent theoretical precision with which staging parameters are classified, the reality in terms of assessing these parameters is far less precise. The present method has enabled a simpler and more reliable staging system to be made available. Specifically, a patient is assessed to determine the probability that a neoplasm is a premalignant neoplasm, early stage malignant neoplasm or late stage malignant neoplasm. Based on these results, one may elect to also have a biopsy or some other diagnostic procedure performed. Alternatively one may use these results to inform what therapeutic or palliative care regime should be designed and implemented. Of particular advantage is the fact that this method enables ongoing testing to be performed. This may be particularly relevant where a premalignant neoplasm has been identified and a decision has been made not to surgically remove the neoplasm in the first instance but to attempt to treat it.
(47) In the context of the present invention, reference to premalignant neoplasm should be understood as a reference to a neoplasm which is not malignant. An example of a non-malignant neoplasm is an adenoma. Without limiting the present invention in any way, the histological and functional characteristics of a premalignant large intestine neoplasm are evidence of new, abnormal tissue growth without evidence of invasion.
(48) Reference to an early stage malignant neoplasm is a reference to a large intestine neoplasm which has become malignant but which is unlikely to extend beyond the bowel wall.
(49) Reference to a late stage malignant neoplasm should be understood as a reference to a large intestine neoplasm which is malignant and which has spread to lymph nodes or distant organs. Reference to late stage malignant neoplasms includes, for example, neoplasms which have become metastatic.
(50) In terms of screening for the methylation of these gene regions, it should be understood that the assays can be designed to screen either the specific regions listed herein (which correspond to the plus strand of the gene) or the complementary minus strand. It is well within the skill of the person in the art to choose which strand to analyse and to target that strand based on the chromosomal coordinates provided herein. In some circumstances, assays may be established to screen both strands.
(51) Without limiting the present invention to any one theory or mode of action, although measuring the methylation levels across these DNA regions is diagnostic of the classification of a large intestine neoplastic condition, it has been determined that discrete subregions are particularly useful in this regard since these subregions contain a high density of CpG dinucleotides which are frequently hypermethylated in large intestine neoplasias, such as colorectal cancers. This finding renders these subregions a particularly useful target for analysis since it both simplifies the screening process due to a shorter more clearly defined region of DNA requiring analysis and, further, the fact that the results from these regions will provide a significantly more definitive result in relation to the presence, or not, of hypermethylation than would be obtained if analysis was performed across the DNA region as a whole. This finding therefore both simplifies the screening process and increases the sensitivity of large intestine neoplasia diagnosis.
(52) The subregions which have been determined to exhibit particular utility are listed below with reference to the gene and chromosomal region within which they are found: (1) BCAT1 subregions chr12:25101992-25102093 (SEQ ID NO:1 or the corresponding minus strand) and chr12:25101909-25101995 (SEQ ID NO:2 or the corresponding minus strand) (2) IKZF1 subregions: chr7:50343867-50343961 (SEQ ID NO:3 or the corresponding minus strand) and chr7:50343804-5033895 (SEQ ID NO:4 or the corresponding minus strand) (3) IRF4 subregions chr6:392036-392145 (SEQ ID NO:5 or the corresponding minus strand) (4) GRASP subregions: chr12:52399672-52399922, chr12:52400821-52401051 (SEQ ID NO:6 or the corresponding minus strand), chr12:52401407-52401664 (SEQ ID NO:7 or the corresponding minus strand) chr12:52400866-52400973 and Chr12:52401107-52401664. (5) CAHM subregions: chr6:163834295-163834500 (SEQ ID NO:8), chr6:163834621-163834906, chr6:163834393-163834455 and chr6:163834393-163834519.
(53) Without limiting the present invention to any one theory or mode of action, the skilled person may screen one or more subregions for each gene marker.
(54) Without limiting the present invention to any one theory or mode of action, DNA methylation is universal in bacteria, plants, and animals. DNA methylation is a type of chemical modification of DNA that is stable over rounds of cell division but does not involve changes in the underlying DNA sequence of the organism. Chromatin and DNA modifications are two important features of epigenetics and play a role in the process of cellular differentiation; allowing cells to stably maintain different characteristics despite containing the same genomic material. In eukaryotic organisms DNA methylation occurs only at the number 5 carbon of the cytosine pyrimidine ring. In mammals, DNA methylation occurs mostly at the number 5 carbon of the cytosine of a CpG dinucleotide. CpG dinucleotides comprise approximately 1% human genome.
(55) 70-80% of all CpGs are methylated. CpGs may be grouped in clusters called CpG islands that are present in the 5 regulatory regions of many genes and are frequently unmethylated. In many disease processes such as cancer, gene promoters and/or CpG islands acquire abnormal hypermethylation, which is associated with heritable transcriptional silencing. DNA methylation may impact the transcription of genes in two ways. First, the methylation of DNA may itself physically impede the binding of transcriptional proteins to the gene, thus blocking transcription. Second, methylated DNA may be bound by proteins known as Methyl-CpG-binding domain proteins (MBDs). MBD proteins then recruit additional proteins to the locus, such as histone deacetylases and other chromatin remodelling proteins that can modify histones, thereby forming compact, inactive chromatin termed silent chromatin. This link between DNA methylation and chromatin structure is very important. In particular, loss of Methyl-CpG-binding Protein 2 (MeCP2) has been implicated in Rett syndrome and Methyl-CpG binding domain protein 2 (MBD2) mediates the transcriptional silencing of hypermethylated genes in cancer.
(56) In humans, the process of DNA methylation is carried out by three enzymes, DNA methyltransferase 1, 3a and 3b (DNMT1, DNMT3a, DNMT3b). It is thought that DNMT3a and DNMT3b are the de novo methyltransferases that set up DNA methylation patterns early in development. DNMT1 is the proposed maintenance methyltransferase that is responsible for copying. DNA methylation patterns to the daughter strands during DNA replication. DNMT3L is a protein that is homologous to the other DNMT3s but has no catalytic activity. Instead, DNMT3L assists the de novo methyltransferases by increasing their ability to bind to DNA and stimulating their activity. Finally, DNMT2 has been identified as an enigmatic DNA methylstransferase homolog, containing all 10 sequence motifs common to all DNA methyltransferases; however, DNMT2 may not methylate DNA but instead has been shown to methylate a small RNA.
(57) Methylation status should therefore be understood as a reference to the presence, absence and/or quantity of methylation at a particular nucleotide, or nucleotides, within a DNA region. The methylation status of a particular DNA sequence (e.g. DNA region as described herein) can indicate the methylation state of every base in the sequence or can indicate the methylation state of a subset of the base pairs (e.g., of cytosines or the methylation state of one or more specific restriction enzyme recognition sequences) within the sequence, or can indicate information regarding regional methylation density within the sequence without providing precise information of where in the sequence the methylation occurs. The methylation status can optionally be represented or indicated by a methylation value. A methylation value can be generated, for example, by quantifying the amount of intact DNA present following restriction digestion with a methylation dependent restriction enzyme. In this example, if a particular sequence in the DNA is quantified using quantitative PCR, an amount of template DNA approximately equal to a mock treated control indicates the sequence is not highly methylated whereas an amount of template substantially less than occurs in the mock treated sample indicates the presence of methylated DNA at the sequence. Accordingly, a value, i.e., a methylation value, for example from the above described example, represents the methylation status and can thus be used as a quantitative indicator of the methylation status. This is of particular use when it is desirable to compare the methylation status of a sequence in a sample to a threshold value.
(58) The term methylation shall be taken to mean the presence of a methyl group added by the action of a DNA methyl transferase enzyme to a cytosine base or bases in a region of nucleic acid, e.g. genomic DNA. As described herein, there are several methods known to those skilled in the art for determining the level or degree of methylation of nucleic acid.
(59) By higher level is meant that there are a higher number of methylated CpG dinucleotides in the subject diagnosed than in a control sample, that is, either the proportion of DNA molecules methylated at a particular CpG site is higher or there are a higher number of separate CpG sites methylated in the subject. It should be understood that the terms enhanced and increased are used interchangeably with the term higher.
(60) The present invention is not to be limited by a precise number of methylated residues that are considered to be diagnostic of neoplasia in a subject, because some variation between patient samples will occur. The present invention is also not limited by positioning of the methylated residue.
(61) Nevertheless, a number of specific cytosine residues which undergo hypermethylation within these subregions have also been identified. In another embodiment, therefore, a screening method can be employed which is specifically directed to assessing the methylation status of one or more of either these residues or the corresponding cytosine at position n+1 on the opposite DNA strand.
(62) To this end, detailed in Table 2 are the cytosine residues which have been identified in this regard. It should be appreciated by the person of skill in the art that these individual residues are numbered by reference to Hg19, which also corresponds to the numbering of the specific subregions listed hereinbefore and which can be further identified when the coordinate numbering for each subregion is applied to the corresponding subregion sequences which are provided in the sequence listing. It should be understood that these residues have been identified in the context of the subregion DNA. However, there are other residues which are hypermethylated outside the subregions themselves but within the larger DNA region from which the subregions derive. Accordingly, these specified residues represent a particularly useful subset of individual cytosine residues which undergo hypermethylation within the context of the DNA regions and subregions herein disclosed. These individual residues are grouped below according to the DNA region within which they occur. These DNA regions are identified by reference to both the Hg19 chromosomal coordinates and the gene region name.
(63) To the extent that the method of the present invention includes analysing the methylation of BCAT1, the subject residues:
(64) TABLE-US-00008 chr12:25101998 chr12:25102003 chr12:25102006 chr12:25102009 chr12:25102017 chr12:25102022 chr12:25102039 chr12:25102048 chr12:25102050 chr12:25102053 chr12:25102061 chr12:25102063 chr12:25102071 chrl12:25101921 chr12:25101934 chr12:25101943 chr12:25101951 chr12:25101962 chr12:25101964 chr12:25101970
or a corresponding cytosine at position n+1 on the opposite DNA strand.
(65) To the extent that the method of the present invention includes analysing the methylation of GRASP, the subject residues are:
(66) TABLE-US-00009 chr12:52399713 chr12:52399731 chr12:52399749 chr12:52399783 chr12:52399796 chr12:52399808 chr12:52399823 chr12:52399835 chr12:52399891 chr12:52400847 chr12:52400850 chr12:52400859 chr12:52400866 chr12:52400869 chr12:52400873 chr12:52400881 chr12:52400886 chr12:52400893 chr12:52400895 chr12:52400899 chr12:52400902 chr12:52400907 chr12:52400913 chr12:52400919 chr12:52400932 chr12:52400938 chr12:52400958 chr12:52400962 chr12:52400971 chr12:52400973 chr12:52400976 chr12:52400998 chr12:52401008 chr12:52401010 chr12:52401012 chr12:52401016 chr12:52401019 chr12:52401025 chr12:52401041 chr12:52401044 chr12:52401053 chr12:52401060 chr12:52401064 chr12:52401092 chr12:52401118 chr12:52401438 chr12:52401448 chr12:52401460 chr12:52401465 chr12:52401474 chr12:52401477 chr12:52401479 chr12:52401483 chr12:52401504 chr12:52401514 chr12:52401523 chr12:52401540 chr12:52401553 chr12:52401576 chr12:52401588 chr12:52401595 chr12:52401599 chr12:52401604 chr12:52401606 chr12:52401634 chr12:52401640 chr12:52401644 chr12:52401659 chr12:52401160 chr12:52401165 chr12:52401174 chr12:52401177 chr12:52401179 chr12:52401183 chr12:52401204 chr12:52401215 chr12:52401223 chr12:52401240 chr12:52401253 chr12:52401288 chr12:52401295 chr12:52401299 chr12:52401304 chr12:52401334 chr12:52401340 chr12:52401344 chr12:52401359
or a corresponding cytosine at position n+1 on the opposite DNA strand.
(67) To the extent that the method of the present invention includes analysing the methylation of CAHM, the subject residues are:
(68) TABLE-US-00010 chr6:163834330 chr6:163834332 chr6:163834357 chr6:163834373 chr6:163834384 chr6:163834390 chr6:163834392 chr6:163834406 chr6:163834412 chr6:163834419 chr6:163834443 chr6:163834448 chr6:163834452 chr6:163834464 chr6:163834483 chr6:163834653 chr6:163834660 chr6:163834672 chr6:163834675 chr6:163834678 chr6:163834681 chr6:163834815 chr6:163834824 chr6:163834835 chr6:163834840 chr6:163834853 chr6:163834855 chr6:163834858 chr6:163834863 chr6:163834869 chr6:163834872
or a corresponding cytosine at position n+1 on the opposite DNA strand.
(69) To the extent that the method of the present invention includes analysing the methylation of IKZF1, the subject residues are:
(70) TABLE-US-00011 chr7:50343869 chr7:50343872 chr7:50343883 chr7:50343889 chr7:50343890 chr7:50343897 chr7:50343907 chr7:50343909 chr7:50343914 chr7:50343934 chr7:50343939 chr7:50343950 chr7:50343959 chr7:50343805 chr7:50343822 chr7:50343824 chr7:50343826 chr7:50343829 chr7:50343831 chr7:50343833 chr7:50343838 chr7:50343847 chr7:50343850 chr7:50343858 chr7:50343864 chr7:50343869 chr7:50343872 chr7:50343890
or a corresponding cytosine at position n+1 on the opposite DNA strand.
(71) To the extent that the method of the present invention includes analysing the methylation of IRF4, the subject residues are:
(72) TABLE-US-00012 chr6:392036 chr6:392047 chr6:392049 chr6:392057 chr6:392060 chr6:392066 chr6:392080 chr6:392094 chr6:392102 chr6:392131
or a corresponding cytosine at position n+1 on the opposite DNA strand.
(73) The detection method of the present invention can be performed on any suitable blood sample. To this end, reference to a blood sample should be understood as a reference to any sample deriving from blood such as, but not limited to, whole blood, serum or plasma. The blood sample which is tested according to the method of the present invention may be tested directly or may require some form of treatment prior to testing. For example, it may require permeabilisation prior to testing. In one embodiment, the blood sample is a plasma sample.
(74) To the extent that the DNA region of interest is present in a biological sample, the biological sample may be directly tested or else all or some of the nucleic acid present in the biological sample may be isolated prior to testing. In yet another example, the sample may be partially purified or otherwise enriched prior to analysis. For example, to the extent that a biological sample comprises a very diverse cell population, it may be desirable to enrich for a sub-population of particular interest. It is within the scope of the present invention for the target cell population or molecules derived therefrom to be treated prior to testing, for example, inactivation of live virus. It should also be understood that the biological sample may be freshly harvested or it may have been stored (for example by freezing) prior to testing or otherwise treated prior to testing (such as by undergoing culturing).
(75) The choice of what type of sample is most suitable for testing in accordance with the method disclosed herein will be dependent on the nature of the situation.
(76) Although the present method is directed to classifying a large intestine neoplasm, the method of the invention is also useful as a means to monitor disease progression. This can be important in situations such as where a decision has been made not to excise an early stage tumour or, even where surgery has been performed on the primary tumour, to monitor for the development of metastases which may not have been visually detectable at the time that the primary tumor was identified. One may also seek to monitor a patient during a treatment regime for a premalignant or early stage malignancy in order to detect likely transition to a higher stage malignancy.
(77) The method of the invention can be used to evaluate individuals known or suspected to have a neoplasia or as a routine clinical test, i.e., in an individual not necessarily suspected to have a neoplasia.
(78) Further, the present methods may be used to assess the efficacy of a course of treatment. For example, the efficacy of an anti-cancer treatment can be assessed by monitoring DNA methylation of the sequences described herein over time in a mammal having cancer.
(79) The method of the present invention is therefore useful as a one-time test or as an ongoing monitor of those individuals thought to be at risk of neoplasia development or as a monitor of the effectiveness of therapeutic or prophylactic treatment regimes directed to inhibiting or otherwise slowing neoplasia development. In these situations, mapping the modulation of methylation levels in any one or more classes of biological samples is a valuable indicator of the status of an individual or the effectiveness of a therapeutic or prophylactic regime which is currently in use.
(80) Any method for detecting DNA methylation can be used in the methods of the present invention. A number of methods are available for detection of differentially methylated DNA at specific loci in either primary tissue samples or in patient samples such as blood, urine, stool or saliva (reviewed in Kristensen and Hansen Clin Chem. 55:1471-83, 2009; Ammerpohl et al. Biochim Biophys Acta. 1790:847-62, 2009; Shames et al. Cancer Lett. 251:187-98, 2007; Clark et al. Nat Protoc. 1:2353-64, 2006). For analysis of the proportion or extent of DNA methylation in a target gene, DNA is normally treated with sodium bisulfite and regions of interest amplified using primers and PCR conditions that will amplify independently of the methylation status of the DNA. The methylation of the overall amplicon or individual CpG sites can then be assessed by sequencing, including pyrosequencing, restriction enzyme digestion (COBRA) or by melting curve analysis. Alternatively ligation-based methods for analysis of methylation at specific CpG sites may be used. Detection of aberrantly methylated DNA released from tumours and into bodily fluids is being developed as a means of cancer diagnosis. Here, in the case of hypermethylated sequences, it is necessary to use sensitive methods that allow the selective amplification of the methylated DNA sequence from a background of normal cellular DNA that is unmethylated. Such methods based on bisulfite-treated DNA, for example; include methylation selective PCR (MSP), Heavymethyl PCR, Headloop PCR and Helper-dependent chain reaction (PCT/AU2008/001475).
(81) Briefly, in some embodiments, methods for detecting methylation include randomly shearing or randomly fragmenting the genomic DNA, cutting the DNA with a methylation-dependent or methylation-sensitive restriction enzyme and subsequently selectively identifying and/or analyzing the cut or uncut DNA. Selective identification can include, for example, separating cut and uncut DNA (e.g., by size) and quantifying a sequence of interest that was cut or, alternatively, that was not cut. See, e.g., U.S. Pat. No. 7,186,512. Alternatively, the method can encompass amplifying intact DNA after restriction enzyme digestion, thereby only amplifying DNA that was not cleaved by the restriction enzyme in the area amplified. See, e.g., U.S. patent application Ser. Nos. 10/971,986; 11/071,013; and 10/971,339. In some embodiments, amplification can be performed using primers that are gene specific. Alternatively, adaptors can be added to the ends of the randomly fragmented DNA, the DNA can be digested with a methylation-dependent or methylation-sensitive restriction enzyme, intact DNA can be amplified using primers that hybridize to the adaptor sequences. In this case, a second step can be performed to determine the presence, absence or quantity of a particular gene in an amplified pool of DNA. In some embodiments, the DNA is amplified using real-time, quantitative PCR.
(82) In some embodiments, the methods comprise quantifying the average methylation density in a target sequence within a population of genomic DNA. In some embodiments, the method comprises contacting genomic DNA with a methylation-dependent restriction enzyme or methylation-sensitive restriction enzyme under conditions that allow for at least some copies of potential restriction enzyme cleavage sites in the locus to remain uncleaved; quantifying intact copies of the locus; and comparing the quantity of amplified product to a control value representing the quantity of methylation of control DNA, thereby quantifying the average methylation density in the locus compared to the methylation density of the control DNA.
(83) The quantity of methylation of a locus of DNA can be determined by providing a sample of genomic DNA comprising the locus, cleaving the DNA with a restriction enzyme that is either methylation-sensitive or methylation-dependent, and then quantifying the amount of intact DNA or quantifying the amount of cut DNA at the DNA locus of interest. The amount of intact or cut DNA will depend on the initial amount of genomic DNA containing the locus, the amount of methylation in the locus, and the number (i.e., the fraction) of nucleotides in the locus that are methylated in the genomic DNA. The amount of methylation in a DNA locus can be determined by comparing the quantity of intact DNA or cut DNA to a control value representing the quantity of intact DNA or cut DNA in a similarly-treated DNA sample. The control value can represent a known or predicted number of methylated nucleotides. Alternatively, the control value can represent the quantity of intact or cut DNA from the same locus in another (e.g., normal, non-diseased) cell or a second locus.
(84) By using at least one methylation-sensitive or methylation-dependent restriction enzyme under conditions that allow for at least some copies of potential restriction enzyme cleavage sites in the locus to remain uncleaved and subsequently quantifying the remaining intact copieand comparing the quantity to a control, average methylation density of a locus can be determined. A methylation-sensitive enzyme is one which cuts DNA if its recognition sequence is unmethylated while a methylation-dependent enzyme cuts DNA if its recognition sequence is methylated. If the methylation-sensitive restriction enzyme is contacted to copies of a DNA locus under conditions that allow for at least some copies of potential restriction enzyme cleavage sites in the locus to remain uncleaved, then the remaining intact DNA will be directly proportional to the methylation density, and thus may be compared to a control to determine the relative methylation density of the locus in the sample. Similarly, if a methylation-dependent restriction enzyme is contacted to copies of a DNA locus under conditions that allow for at least some copies of potential restriction enzyme cleavage sites in the locus to remain uncleaved, then the remaining intact DNA will be inversely proportional to the methylation density, and thus may be compared to a control to determine the relative methylation density of the locus in the sample. Such assays are disclosed in, e.g., U.S. patent application Ser. No. 10/971,986.
(85) Kits for the above methods can include, e.g., one or more of methylation-dependent restriction enzymes, methylation-sensitive restriction enzymes, amplification (e.g., PCR) reagents, probes and/or primers.
(86) Quantitative amplification methods (e.g., quantitative PCR or quantitative linear amplification) can be used to quantify the amount of intact DNA within a locus flanked by amplification primers following restriction digestion. Methods of quantitative amplification are disclosed in, e.g., U.S. Pat. Nos. 6,180,349; 6,033,854; and 5,972,602, as well as in, e.g., Gibson et al., Genome Research 6:995-1001 (1996); DeGraves, et al., Biotechniques 34(1):106-10, 112-5 (2003); Deiman B, et al., Mol. Biotechnol. 20(2):163-79 (2002). Amplifications may be monitored in real time.
(87) Additional methods for detecting DNA methylation can involve genomic sequencing before and after treatment of the DNA with bisulfite. See, e.g., Frommer et al., Proc. Natl. Acad. Sci. USA 89:1827-1831 (1992). When sodium bisulfite is contacted to DNA, unmethylated cytosine is converted to uracil, while methylated cytosine is not modified.
(88) In some embodiments, restriction enzyme digestion of PCR products amplified from bisulfite-converted DNA is used to detect DNA methylation. See, e.g., Sadri & Hornsby, Nucl. Acids Res. 24:5058-5059 (1996); Xiong & Laird, Nucleic Acids Res. 25:2532-2534 (1997).
(89) In some embodiments, a methylation-specific PCR (MSP) reaction is used alone or in combination with other methods to detect DNA methylation. An MSP assay entails initial modification of DNA by sodium bisulfite, converting all unmethylated, but not methylated, cytosines to uracil, and subsequent amplification with primers specific for methylated verses unmethylated DNA. See, Herman et al. Proc. Natl. Acad. Sci. USA 93:9821-9826 (1996); U.S. Pat. No. 5,786,146.
(90) In some embodiments, a MethyLight assay is used alone or in combination with other methods to detect DNA methylation (see, Eads et al., Cancer Res. 59:2302-2306 (1999)). Briefly, in the MethyLight process genomic DNA is converted in a sodium bisulfite reaction (the bisulfite process converts unmethylated cytosine residues to uracil). Amplification of a DNA sequence of interest is then performed using PCR primers that hybridize to CpG dinucleotides. By using primers that hybridize only to sequences resulting from bisulfite conversion of methylated DNA, (or alternatively to unmethylated sequences) amplification can indicate methylation status of sequences where the primers hybridize. Furthermore, the amplification product can be detected with a probe that specifically binds to a sequence resulting from bisulfite treatment of an unmethylated DNA. If desired, both primers and probes can be used to detect methylation status. Thus, kits for use with MethyLight can include sodium bisulfite as well as primers or detectably-labelled probes (including but not limited to Taqman or molecular beacon probes) that distinguish between methylated and unmethylated DNA that have been treated with bisulfite. Other kit components can include, e.g., reagents necessary for amplification of DNA including but not limited to, PCR buffers, deoxynucleotides; and a thermostable polymerase.
(91) In some embodiments, a Ms-SNuPE (Methylation-sensitive Single Nucleotide Primer Extension) reaction is used alone or in combination with other methods to detect DNA methylation (see, Gonzalgo & Jones, Nucleic Acids Res. 25:2529-2531 (1997)). The Ms-SNuPE technique is a quantitative method for assessing methylation differences at specific CpG sites based on bisulfite treatment of DNA, followed by single-nucleotide primer extension (Gonzalgo & Jones, supra). Briefly, genomic DNA is reacted with sodium bisulfite to convert unmethylated cytosine to uracil while leaving 5-methylcytosine unchanged. Amplification of the desired target sequence is then performed using PCR primers specific for bisulfite-converted DNA, and the resulting product is isolated and used as a template for methylation analysis at the CpG site(s) of interest.
(92) Typical reagents (e.g., as might be found in a typical Ms-SNuPE-based kit) for Ms-SNuPE analysis can include, but are not limited to: PCR primers for specific gene (or methylation-altered DNA sequence or CpG island); optimized PCR buffers and deoxynucleotides; gel extraction kit; positive control primers; Ms-SNuPE primers for a specific gene; reaction buffer (for the Ms-SNuPE reaction); and detectably-labelled nucleotides. Additionally, bisulfite conversion reagents may include: DNA denaturation buffer; sulfonation buffer; DNA recovery regents or kit (e.g., precipitation, ultrafiltration, affinity column); desulfonation buffer; and DNA recovery components.
(93) Additional methylation detection methods include, but are not limited to, methylated CpG island amplification (see, Toyota et al.: Cancer Res. 59:2307-12 (1999)) and those described in, e.g., U.S. Patent Publication 2005/0069879; Rein, et al. Nucleic Acids Res. 26 (10): 2255-64 (1998); Olek, et al. Nat. Genet. 17(3): 275-6 (1997); and PCT Publication No. WO 00/70090.
(94) More detailed information in relation to several of these generally described methods is provided below:
(95) (a) Probe or Primer Design and/or Production
(96) Several methods described herein for the diagnosis of a neoplasia use one or more probes and/or primers. Methods for designing probes and/or primers for use in, for example, PCR or hybridization are known in the art and described, for example, in Dieffenbach and Dveksler (Eds) (In: PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratories, NY, 1995). Furthermore, several software packages are publicly available that design optimal probes and/or primers for a variety of assays, e.g. Primer 3 available from the Center for Genome Research, Cambridge, Mass., USA.
(97) Clearly, the potential use of the probe or primer should be considered during its design. For example, should the probe or primer be produced for use in a methylation specific PCR or ligase chain reaction (LCR) assay the nucleotide at the 3 end (or 5 end in the case of LCR) should preferably correspond to a methylated nucleotide in a nucleic acid.
(98) Probes and/or primers useful for detection of a sequence associated with a neoplasia are assessed, for example, to determine those that do not form hairpins, self-prime or form primer dimers (e.g. with another probe or primer used in a detection assay). Furthermore, a probe or primer (or the sequence thereof) is often assessed to determine the temperature at which it denatures from a target nucleic acid (i.e. the melting temperature of the probe or primer, or Tm). Methods for estimating Tm are known in the art and described, for example, in Santa Lucia, Proc. Natl. Acad. Sci. USA, 95: 1460-1465, 1995 or Bresslauer et al., Proc. Natl. Acad. Sci. USA, 83: 3746-3750, 1986.
(99) Methods for producing/synthesizing a probe or primer of the present invention are known in the art. For example, oligonucleotide synthesis is described, in Gait (Ed) (In: Oligonucleotide Synthesis: A Practical Approach, IRL Press, Oxford, 1984). For example, a probe or primer may be obtained by biological synthesis (e.g. by digestion of a nucleic acid with a restriction endonuclease) or by chemical synthesis. For short sequences (up to about 100 nucleotides) chemical synthesis is preferable.
(100) For longer sequences standard replication methods employed in molecular biology are useful, such as, for example, the use of M13 for single stranded DNA as described by Messing, Methods Enzymol, 101, 20-78, 1983. Other methods for oligonucleotide synthesis include, for example, phosphotriester and phosphodiester methods (Narang, et al. Meth. Enzymol 68: 90, 1979) and synthesis on a support (Beaucage, et al. Tetrahedron Letters 22:1859-1862, 1981) as well as phosphoramidate technique, Caruthers, M. H., et al., Methods in Enzymology, Vol. 154, pp. 287-314 (1988), and others described in Synthesis and Applications of DNA and RNA, S. A. Narang, editor, Academic Press, New York, 1987, and the references cited therein. Probes comprising locked nucleic acid (LNA) are synthesized as described, for example, in Nielsen et al. J. Chem. Soc. Perkin Trans., 1:3423, 1997; Singh and Wengel, Chem. Commun. 1247, 1998. While, probes comprising peptide-nucleic acid (PNA) are synthesized as described, for example, in Egholm et al., Am. Chem. Soc., 114:1895, 1992; Egholm et al., Nature, 365:566, 1993; and Orum et al., Nucl. Acids Res, 21:5332, 1993.
(101) (b) Methylation-Sensitive Endonuclease Digestion of DNA
(102) In one example, the increased methylation in a sample is determined using a process comprising treating the nucleic acid with an amount of a methylation-sensitive restriction endonuclease enzyme under conditions sufficient for nucleic acid to be digested and then detecting the fragments produced. Exemplary methylation-sensitive endonucleases include, for example, HhaI or HpaII. Preferably, assays include internal controls that are digested with a methylation-insensitive enzyme having the same specificity as the methylation-sensitive enzyme employed. For example, the methylation-insensitive enzyme MspI is an isoschizomer of the methylation-sensitive enzyme HpaII.
(103) Hybridization Assay Formats
(104) In one example, the digestion of nucleic acid is detected by selective hybridization of a probe or primer to the undigested nucleic acid. Alternatively, the probe selectively hybridizes to both digested and undigested nucleic acid but facilitates differentiation between both forms, e.g., by electrophoresis. Suitable detection methods for achieving selective hybridization to a hybridization probe include, for example, Southern or other nucleic acid hybridization (Kawai et al., Mol. Cell. Biol. 14:7421-7427, 1994; Gonzalgo et al., Cancer Res. 57:594-599, 1997).
(105) Suitable hybridization conditions are determined based on the melting temperature (Tm) of a nucleic acid duplex comprising the probe. The skilled artisan will be aware that optimum hybridization reaction conditions should be determined empirically for each probe, although some generalities can be applied. Preferably, hybridizations employing short oligonucleotide probes are performed at low to medium stringency. In the case of a GC rich probe or primer or a longer probe or primer a high stringency hybridization and/or wash is preferred. A high stringency is defined herein as being a hybridization and/or wash carried out in about 0.1SSC buffer and/or about 0.1% (w/v) SDS, or lower salt concentration, and/or at a temperature of at least 65 C., or equivalent conditions. Reference herein to a particular level of stringency encompasses equivalent conditions using wash/hybridization solutions other than SSC known to those skilled in the art.
(106) In accordance with the present example, a difference in the fragments produced for the test sample and a negative control sample is indicative of the subject having a neoplasia. Similarly, in cases where the control sample comprises data from a tumor, cancer tissue or a cancerous cell or pre-cancerous cell, similarity, albeit not necessarily absolute identity, between the test sample and the control sample is indicative of a positive diagnosis (i.e. cancer).
(107) Amplification Assay Formats
(108) In an alternative example, the fragments produced by the restriction enzyme are detected using an amplification system, such as, for example, polymerase chain reaction (PCR), rolling circle amplification (RCA), inverse polymerase chain reaction (iPCR), in situ PCR (Singer-Sam et al., Nucl. Acids Res. 18:687, 1990), strand displacement amplification (SDA) or cycling probe technology.
(109) Methods of PCR are known in the art and described, for example, by McPherson et al., PCR: A Practical Approach. (series eds, D. Rickwood and B. D. Hames), IRL Press Limited, Oxford. pp 1-253, 1991 and by Dieffenbach (ed) and Dveksler (ed) (In: PCR Primer: A Laboratory Manual, Cold Spring Harbour Laboratories, NY, 1995), the contents of which are each incorporated in their entirety by way of reference. Generally, for PCR two non-complementary nucleic acid primer molecules comprising at least about 18 nucleotides in length, and more preferably at least 20-30 nucleotides in length are hybridized to different strands of a nucleic acid template molecule at their respective annealing sites, and specific nucleic acid molecule copies of the template that intervene the annealing sites are amplified enzymatically. Amplification products may be detected, for example, using electrophoresis and detection with a detectable marker that binds nucleic acids. Alternatively, one or more of the oligonucleotides are labelled with a detectable marker (e.g. a fluorophore) and the amplification product detected using, for example, a lightcycler (Perkin Elmer, Wellesley, Mass., USA, Roche Applied Science, Indianapolis, Ind., USA).
(110) Strand displacement amplification (SDA) utilizes oligonucleotide primers, a DNA polymerase and a restriction endonuclease to amplify a target sequence. The oligonucleotides are hybridized to a target nucleic acid and the polymerase is used to produce a copy of the region intervening the primer annealing sites. The duplexes of copied nucleic acid and target nucleic acid are then nicked with an endonuclease that specifically recognizes a sequence at the beginning of the copied nucleic acid. The DNA polymerase recognizes the nicked DNA and produces another copy of the target region at the same time displacing the previously generated nucleic acid. The advantage of SDA is that it occurs in an isothermal format, thereby facilitating high-throughput automated analysis.
(111) Cycling Probe Technology uses a chimeric synthetic primer that comprises DNA-RNA-DNA that is capable of hybridizing to a target sequence. Upon hybridization to a target sequence the RNA-DNA duplex formed is a target for RNaseH thereby cleaving the primer. The cleaved primer is then detected, for example, using mass spectrometry or electrophoresis.
(112) For primers that flank or are adjacent to a methylation-sensitive endonuclease recognition site, it is preferred that such primers flank only those sites that are hypermethylated in neoplasia to ensure that a diagnostic amplification product is produced. In this regard, an amplification product will only be produced when the restriction site is not cleaved, i.e., when it is methylated. Accordingly, detection of an amplification product indicates that the CpG dinucleotide/s of interest is/are methylated.
(113) As will be known to the skilled artisan, the precise length of the amplified product will vary depending upon the distance between the primers. Clearly this form of analysis may be used to determine the methylation status of a plurality of CpG dinucleotides provided that each dinucleotide is within a methylation sensitive restriction endonuclease site. In these methods, one or more of the primers may be labelled with a detectable marker to facilitate rapid detection of amplified nucleic acid, for example, a fluorescent label (e.g. Cy5 or Cy3) or a radioisotope (e.g. .sup.32P).
(114) The amplified nucleic acids are generally analyzed using, for example, non-denaturing agarose gel electrophoresis, non-denaturing polyacrylamide gel electrophoresis, mass spectrometry, liquid chromatography (e.g. HPLC or dHPLC), or capillary electrophoresis. (e.g. MALDI-TOF). High throughput detection methods, such as, for example, matrix-assisted laser desorption/ionization time of flight (MALDI-TOF), electrospray ionization (ESI), mass spectrometry (including tandem mass spectrometry, e.g. LC MS/MS), biosensor technology, evanescent fiber-optics technology or DNA chip technology (e.g., WO98/49557; WO 96/17958; Fodor et al., Science 767-773, 1991; U.S. Pat. Nos. 5,143,854; and 5,837,832, the contents of which are all incorporated herein by reference), are especially preferred for all assay formats described herein. Alternatively, amplification of a nucleic acid may be continuously monitored using a melting curve analysis method as described herein and/or in, for example, U.S. Pat. No. 6,174,670, which is incorporated herein by reference.
(115) (c) Other Assay Formats
(116) In an alternative example, the increased methylation in a sample is determined by performing a process comprising treating chromatin containing the nucleic acid with an amount of DNaseI under conditions sufficient for nucleic acid to be digested and then detecting the fragments produced. This assay format is predicated on the understanding that chromatin containing methylated DNA, e.g., hyper methylated DNA, has a more tightly-closed conformation than non-hyper methylated DNA and, as a consequence, is less susceptible to endonuclease digestion by DNase I.
(117) In accordance with this method, DNA fragments of different lengths are produced by DNase I digestion of methylated compared to non-methylated DNA. Such different DNA fragments are detected, for example, using an assay described earlier. Alternatively, the DNA fragments are detected using PCR-SSCP essentially as described, for example, in Gregory and Feil, Nucleic Acids Res., 27, e32i-e32iv, 1999. In adapting PCR-SSCP to the present invention, amplification primers flanking or comprising one or more CpG dinucleotides in a nucleic acid that are resistant to DNase I digestion in a neoplasia sample but not resistant to DNase I digestion in a healthy/normal control or healthy/normal test sample are used to amplify the DNase I-generated fragments. In this case, the production of a specific nucleic acid fragment using DNase I is diagnostic of neoplasia, because the DNA is not efficiently degraded. In contrast, template DNA from a healthy/normal subject sample is degraded by the action of DNase I and, as a consequence, amplification fails to produce a discrete amplification product. Alternative methods to PCR-SSCP, such as for example, PCR-dHPLC are also known in the art and contemplated by the present invention.
(118) (d) Selective Mutagenesis of Non-Methylated DNA
(119) In an alternative method the increased methylation in a sample is determined using a process comprising treating the nucleic acid with an amount of a compound that selectively mutates a non-methylated cytosine residue within a CpG dinucleotide under conditions sufficient to induce mutagenesis.
(120) Preferred compounds mutate cytosine to uracil or thymidine, such as, for example, a salt of bisulfite, e.g., sodium bisulfite or potassium bisulfite (Frommer et al., 1992, supra). Bisulfite treatment of DNA is known to distinguish methylated from non-methylated cytosine residues, by mutating cytosine residues that are not protected by methylation, including cytosine residues that are not within a CpG dinucleotide or that are positioned within a CpG dinucleotide that is not subject to methylation.
(121) Sequence Based Detection
(122) In one example, the presence of one or more mutated nucleotides or the number of mutated sequences is determined by sequencing mutated DNA. One form of analysis comprises amplifying mutated nucleic acid using an amplification reaction described herein, for example, PCR. The amplified product is then directly sequenced or cloned and the cloned product sequenced. Methods for sequencing DNA are known in the art and include for example, the dideoxy chain termination method or the Maxam-Gilbert method (see Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd Ed., CSHP, New York 1989) or Zyskind et al., Recombinant DNA Laboratory Manual, (Acad. Press, 1988)).
(123) As the treatment of nucleic acid with a compound, such as, for example, bisulfite results in non-methylated cytosines being mutated to uracil (and hence thymidine after an amplification process), analysis of the sequence determines the presence or absence of a methylated nucleotide. For example, by comparing the sequence obtained using a control sample or a sample that has not been treated with bisulfite, or the known nucleotide sequence of the region of interest with a treated sample facilitates the detection of differences in the nucleotide sequence. Any thymine residue detected at the site of a cytosine in the treated sample compared to a control or untreated sample may be considered to be caused by mutation as a result of bisulfite treatment. Suitable methods for the detection of methylation using sequencing of bisulfite treated nucleic acid are described, for example, in Frommer et al., 1992, supra or Clark et al., Nucl. Acids Res. 22:2990-2997, 1994.
(124) In another method, the presence of a mutated or non-mutated nucleotide in a bisulfite treated sample is detected using pyrosequencing, such as, for example, as described in Uhlmann et al., Electrophoresis, 23: 4072-4079, 2002. Essentially this method is a form of real-time sequencing that uses a primer that hybridizes to a site adjacent or close to the site of a cytosine that is methylated. Following hybridization of the primer and template in the presence of a DNA polymerase each of four modified deoxynucleotide triphosphates are added separately according to a predetermined dispensation order. Only an added nucleotide that is complementary to the bisulfite treated sample is incorporated and inorganic pyrophosphate (PPi) is liberated. The PPi then drives a reaction resulting in production of detectable levels of light. Such a method allows determination of the identity of a specific nucleotide adjacent to the site of hybridization of the primer.
(125) Methods of solid phase pyrosequencing are known in the art and reviewed in, for example, Landegren et al., Genome Res., 8(8): 769-776, 1998. Such methods enable the high-throughput detection of methylation of a number of CpG dinucleotides.
(126) A related method for determining the sequence of a bisulfite treated nucleotide is methylation-sensitive single nucleotide primer extension (Me-SnuPE) or SNaPmeth. Suitable methods are described, for example, in Gonzalgo and Jones, 1997, supra, or Uhlmann et al., Electrophoresis, 23:4072-4079, 2002. An oligonucleotide is used that hybridizes to the region of a nucleic acid adjacent to the site of a cytosine that is methylated. This oligonucleotide is then used in a primer extension protocol with a polymerase and a free nucleotide diphosphate or dideoxynucleotide triphosphate that corresponds to either or any of the possible bases that occur at this site following bisulfite treatment (i.e., thymine or cytosine). Preferably, the nucleotide-diphosphate is labelled with a detectable marker (e.g. a fluorophore). Following primer extension, unbound labelled nucleotide diphosphates are removed, e.g. using size exclusion chromatography or electrophoresis, or hydrolyzed, using for example, alkaline phosphatase, and the incorporation of the labelled nucleotide to the oligonucleotide is detected, indicating the base that is present at the site.
(127) Clearly other high throughput sequencing methods are encompassed by the present invention. Such methods include, for example, solid phase minisequencing (as described, for example, in Southern et al., Genomics, 13:1008-1017, 1992), or minisequencing with FRET (as described, for example, in Chen and Kwok, Nucleic Acids Res. 25:347-353, 1997).
(128) Restriction Endonuclease-Based Assay Format
(129) In one method, the presence of a non-mutated sequence is detected using combined bisulfite restriction analysis (COBRA) essentially as described in Xiong and Laird, 2001, supra. This method exploits the differences in restriction enzyme recognition sites between methylated and unmethylated nucleic acid after treatment with a compound that selectively mutates a non-methylated cytosine residue, e.g., bisulfite.
(130) Following bisulfite treatment a region of interest comprising one or more CpG dinucleotides that are methylated and are included in a restriction endonuclease recognition sequence is amplified using an amplification reaction described herein, e.g., PCR. The amplified product is then contacted with the restriction enzyme that cleaves at the site of the CpG dinucleotide for a time and under conditions sufficient for cleavage to occur. A restriction site may be selected to indicate the presence or absence of methylation. For example, the restriction endonuclease TaqI cleaves the sequence TCGA, following bisulfite treatment of a non-methylated nucleic acid the sequence will be TTGA and, as a consequence, will not be cleaved. The digested and/or non-digested nucleic acid is then detected using a detection means known in the art, such as, for example, electrophoresis and/or mass spectrometry. The cleavage or non-cleavage of the nucleic acid is indicative of cancer in a subject. Clearly, this method may be employed in either a positive read-out or negative read-out system for the diagnosis of a cancer.
(131) Positive Read-Out Assay Format
(132) In one embodiment, the assay format of the invention comprises a positive read-out system in which DNA from a sample that has been treated, for example, with bisulfate is detected as a positive signal. Preferably, the non-hypermethylated DNA from a healthy or normal control subject is not detected or only weakly detected.
(133) In a preferred embodiment, the increased methylation in a subject sample is determined using a process comprising:
(134) (i) treating the nucleic acid with an amount of a compound that selectively mutates a non-methylated cytosine residue under conditions sufficient to induce mutagenesis thereby producing a mutated nucleic acid;
(135) (ii) hybridizing a nucleic acid to a probe or primer comprising a nucleotide sequence that is complementary to a sequence comprising a methylated cytosine residue under conditions such that selective hybridization to the non-mutated nucleic acid occurs; and
(136) (iii) detecting the selective hybridization.
(137) In this context, the term selective hybridization means that hybridization of a probe or primer to the non-mutated nucleic acid occurs at a higher frequency or rate, or has a higher maximum reaction velocity, than hybridization of the same probe or primer to the corresponding mutated sequence. Preferably, the probe or primer does not hybridize to the non-methylated sequence carrying the mutation(s) under the reaction conditions used.
(138) Hybridization-Based Assay Format
(139) In one embodiment, the hybridization is detected using Southern, dot blot, slot blot or other nucleic acid hybridization means (Kawai et al., 1994, supra; Gonzalgo et al., 1997, supra). Subject to appropriate probe selection, such assay formats are generally described herein above and apply mutatis mutandis to the presently described selective mutagenesis approach.
(140) Preferably, a ligase chain reaction format is employed to distinguish between a mutated and non-mutated nucleic acid. Ligase chain reaction (described in EP 320,308 and U.S. Pat. No. 4,883,750) uses at least two oligonucleotide probes that anneal to a target nucleic acid in such a way that they are juxtaposed on the target nucleic acid. In a ligase chain reaction assay, the target nucleic acid is hybridized to a first probe that is complementary to a diagnostic portion of the target sequence (the diagnostic probe) e.g., a nucleic acid comprising one or more methylated CpG dinucleotide(s), and with a second probe that is complementary to a nucleotide sequence contiguous with the diagnostic portion (the contiguous probe), under conditions wherein the diagnostic probe remains bound substantially only to the target nucleic acid. The diagnostic and contiguous probes can be of different lengths and/or have different melting temperatures such that the stringency of the hybridization can be adjusted to permit their selective hybridization to the target, wherein the probe having the higher melting temperature is hybridized at higher stringency and, following washing to remove unbound and/or non-selectively bound probe, the other probe having the lower melting temperature is hybridized at lower stringency. The diagnostic probe and contiguous probe are then covalently ligated such as, for example, using T4 DNA ligase, to thereby produce a larger target probe that is complementary to the target sequence, and the probes that are not ligated are removed by modifying the hybridization stringency. In this respect, probes that have not been ligated will selectively hybridize under lower stringency hybridization conditions than probes that have been ligated. Accordingly, the stringency of the hybridization can be increased to a stringency that is at least as high as the stringency used to hybridize the longer probe, and preferably at a higher stringency due to the increased length contributed by the shorter probe following ligation.
(141) In another example, one or both of the probes is labelled such that the presence or absence of the target sequence can be tested by melting the target-probe duplex, eluting the dissociated probe, and testing for the label(s). Where both probes are labelled, different ligands are used to permit distinction between the ligated and unligated probes, in which case the presence of both labels in the same eluate fraction confirms the ligation event. If the target nucleic acid is bound to a solid matrix e.g., in a Southern hybridization, slot blot, dot blot, or microchip assay format, the presence of both the diagnostic and contiguous probes can be determined directly.
(142) Methylation specific microarrays (MSO) are also useful for differentiating between a mutated and non-mutated sequence. A suitable method is described, for example, in Adorjan et al. Nucl. Acids Res., 30: e21, 2002. MSO uses nucleic acid that has been treated with a compound that selectively mutates a non-methylated cytosine residue (e.g., bisulfite) as template for an amplification reaction that amplifies both mutant and non-mutated nucleic acid. The amplification is performed with at least one primer that comprises a detectable label, such as, for example, a fluorophore, e.g., Cy3 or Cy5.
(143) To produce a microarray for detection of mutated nucleic acid oligonucleotides are spotted onto, for example, a glass slide, preferably, with a degree of redundancy (for example, as described in Golub et al., Science, 286:531-537, 1999). Preferably, for each CpG dinucleotide analyzed two different oligonucleotides are used. Each oligonucleotide comprises a sequence N.sub.2-16CGN.sub.2-16 or N.sub.2-16TGN.sub.2-16 (wherein N is a number of nucleotides adjacent or juxtaposed to the CpG dinucleotide of interest) reflecting the methylated or non-methylated status of the CpG dinucleotides.
(144) The labelled amplification products are then hybridized to the oligonucleotides on the microarray under conditions that enable detection of single nucleotide differences. Following washing to remove unbound amplification product, hybridization is detected using, for example, a microarray scanner. Not only does this method allow for determination of the methylation status of a large number of CpG dinucleotides, it is also semi-quantitative, enabling determination of the degree of methylation at each CpG dinucleotide analyzed. As there may be some degree of heterogeneity of methylation in a single sample, such quantification may assist in the diagnosis of cancer.
(145) Amplification-Based Assay Format
(146) In an alternative example, the hybridization is detected using an amplification system. In methylation-specific PCR formats (MSP; Herman et al. Proc. Natl. Acad. Sci. USA 93:9821-9826, 1992), the hybridization is detected using a process comprising amplifying the bisulfite-treated DNA. Accordingly, by using one or more probe or primer that anneals specifically to the unmutated sequence under moderate and/or high stringency conditions an amplification product is only produced using a sample comprising a methylated nucleotide. Alternate assays that provide for selective amplification of either the methylated or the unmethylated component from a mixture of bisulfite-treated DNA are provided by Cottrell et al., Nucl. Acids Res. 32: e10, 2003 (HeavyMethyl PCR), Rand et al. Nucl. Acids Res. 33:e127, 2005 (Headloop PCR), Rand et al. Epigenetics 1:94-100, 2006 (Bisulfite Differential Denaturation PCR) and PCT/AU07/000389 (End-specific PCR).
(147) Any amplification assay format described herein can be used, such as, for example, polymerase chain reaction (PCR), rolling circle amplification (RCA), inverse polymerase chain reaction (iPCR), in situ PCR (Singer-Sam et al., 1990, supra), strand displacement amplification, or cycling probe technology. PCR techniques have been developed for detection of gene mutations (Kuppuswamy et al., Proc. Natl. Acad. Sci. USA 88:1143-1147, 1991) and quantitation of allelic-specific expression (Szabo and Mann, Genes Dev. 9: 3097-3108, 1995; and Singer-Sam et al., PCR Methods Appl. 1: 160-163, 1992). Such techniques use internal primers, which anneal to a PCR-generated template and terminate immediately 5 of the single nucleotide to be assayed. Such as format is readily combined with ligase chain reaction as described herein above. The use of a real-time quantitative assay format is also useful. Subject to the selection of appropriate primers, such assay formats are generally described herein above and apply mutatis mutandis to the presently described selective mutagenesis approach.
(148) Methylation-specific melting-curve analysis (essentially as described in Worm et al., Clin. Chem., 47:1183-1189, 2001) is also contemplated by the present invention. This process exploits the difference in melting temperature in amplification products produced using bisulfite treated methylated or unmethylated nucleic acid. In essence, non-discriminatory amplification of a bisulfite treated sample is performed in the presence of a fluorescent dye that specifically binds to double stranded DNA (e.g., SYBR Green I). By increasing the temperature of the amplification product while monitoring fluorescence the melting properties and thus the sequence of the amplification product is determined. A decrease in the fluorescence reflects melting of at least a domain in the amplification product. The temperature at which the fluorescence decreases is indicative of the nucleotide sequence of the amplified nucleic acid, thereby permitting the nucleotide at the site of one or more CpG dinucleotides to be determined. As the sequence of the nucleic acids amplified using the present invention
(149) The present invention also encompasses the use of real-time quantitative forms of PCR, such as, for example, TaqMan (Holland et al., Proc. Natl. Acad. Sci. USA, 88:7276-7280, 1991; Lee et al., Nucleic Acid Res. 21:3761-3766, 1993) to perform this embodiment. For example, the MethylLight method of Eads et al., Nucl. Acids Res. 28: E32, 2000 uses a modified TaqMan assay to detect methylation of a CpG dinucleotide. Essentially, this method comprises treating a nucleic acid sample with bisulfite and amplifying nucleic acid comprising one or more CpG dinucleotides that are methylated in a neoplastic cell and not in a control sample using an amplification reaction, e.g., PCR. The amplification reaction is performed in the presence of three oligonucleotides, a forward and reverse primer that flank the region of interest and a probe that hybridizes between the two primers to the site of the one or more methylated CpG dinucleotides. The probe is dual labelled with a 5 fluorescent reporter and a 3 quencher (or vice versa). When the probe is intact, the quencher dye absorbs the fluorescence of the reporter due to their proximity. Following annealing of to the PCR product the probe is cleaved by 5 to 3 exonuclease activity of, for example, Taq DNA polymerase. This cleavage releases the reporter from the quencher thereby resulting in an increased fluorescence signal that can be used to estimate the initial template methylation level. By using a probe or primer that selectively hybridizes to unmutated nucleic acid (i.e. methylated nucleic acid) the level of methylation is determined, e.g., using a standard curve.
(150) Alternatively, rather than using a labelled probe that requires cleavage, a probe, such as, for example, a Molecular Beacon is used (see, for example, Mhlanga and Malmberg, Methods 25:463-471, 2001). Molecular beacons are single stranded nucleic acid molecules with a stem-and-loop structure. The loop structure is complementary to the region surrounding the one or more CpG dinucleotides that are methylated in a neoplastic sample and not in a control sample. The stem structure is formed by annealing two arms complementary to each other, which are on either side of the probe (loop). A fluorescent moiety is bound to one arm and a quenching moiety that suppresses any detectable fluorescence when the molecular beacon is not bound to a target sequence is bound to the other arm. Upon binding of the loop region to its target nucleic acid the arms are separated and fluorescence is detectable. However, even a single base mismatch significantly alters the level of fluorescence detected in a sample. Accordingly, the presence or absence of a particular base is determined by the level of fluorescence detected. Such an assay facilitates detection of one or more unmutated sites (i.e. methylated nucleotides) in a nucleic acid.
(151) Fluorescently labelled locked nucleic acid (LNA) molecules or fluorescently labelled protein-nucleic acid (PNA) molecules are useful for the detection of nucleotide differences (e.g., as described in Simeonov and Nikiforov, Nucleic Acids Research, 30(17):1-5, 2002). LNA and PNA molecules bind, with high affinity, to nucleic acid, in particular, DNA. Fluorophores (in particular, rhodomine or hexachlorofluorescein) conjugated to the LNA or PNA probe fluoresce at a significantly greater level upon hybridization of the probe to target nucleic acid. However, the level of increase of fluorescence is not enhanced to the same level when even a single nucleotide mismatch occurs. Accordingly, the degree of fluorescence detected in a sample is indicative of the presence of a mismatch between the LNA or PNA probe and the target nucleic acid, such as, in the presence of a mutated cytosine in a methylated CpG dinucleotide. Preferably, fluorescently labelled LNA or PNA technology is used to detect at least a single base change in a nucleic acid that has been previously amplified using, for example, an amplification method known in the art and/or described herein.
(152) As will be apparent to the skilled artisan, LNA or PNA detection technology is amenable to a high-throughput detection of one or more markers by immobilizing an LNA or PNA probe to a solid support, as described in Orum et al., Clin. Chem. 45:1898-1905, 1999.
(153) Alternatively, a real-time assay, such as, for example, the so-called HeavyMethyl assay (Cottrell et al., 2003, supra) is used to determine the presence or level of methylation of nucleic acid in a test sample. Essentially, this method uses one or more non-extendible nucleic acid (e.g., oligonucleotide) blockers that bind to bisulfate-treated nucleic acid in a methylation specific manner (i.e., the blocker/s bind specifically to unmutated DNA under moderate to high stringency conditions). An amplification reaction is performed using one or more primers that may optionally be methylation specific but that flank the one or more blockers. In the presence of unmethylated nucleic acid (i.e., non-mutated DNA) the blocker/s bind and no PCR product is produced. Using a TaqMan assay essentially as described supra the level of methylation of nucleic acid in a sample is determined.
(154) Other amplification based methods for detecting methylated nucleic acid following treatment with a compound that selectively mutates a non-methylated cytosine residue include, for example, methylation-specific single stranded conformation analysis (MS-SSCA) (Bianco et al., Hum. Mutat., 14:289-293, 1999), methylation-specific denaturing gradient gel electrophoresis (MS-DGGE) (Abrams and Stanton, Methods Enzymol., 212:71-74, 1992) and methylation-specific denaturing high-performance liquid chromatography (MS-DHPLC) (Deng et al. Chin. J. Cancer Res., 12:171-191, 2000). Each of these methods use different techniques for detecting nucleic acid differences in an amplification product based on differences in nucleotide sequence and/or secondary structure. Such methods are clearly contemplated by the present invention.
(155) As with other amplification-based assay formats, the amplification product is analyzed using a range of procedures, including gel electrophoresis, gel filtration, mass spectrometry, and in the case of labelled primers, by identifying the label in the amplification product. In an alternative embodiment, restriction enzyme digestion of PCR products amplified from bisulfate-converted DNA is performed essentially as described by Sadri and Hornsby, Nucl. Acids Res. 24:5058-5059, 1996; and Xiong and Laird, Nucl. Acids Res. 25:2532-2534, 1997), to analyze the product formed.
(156) High throughput detection methods, such as, for example, matrix-assisted laser desorption/ionization time of flight (MALDI-TOF), electrospray ionization (ESI), Mass spectrometry (including tandem mass spectrometry, e.g. LC MS/MS), biosensor technology, evanescent fiber-optics technology or DNA chip technology, can also be employed.
(157) As with the other assay formats described herein that utilize hybridization and/or amplification detection systems, combinations of such processes as described herein above are particularly contemplated by the selective mutagenesis-based assay formats of the present invention. In one example, the increased methylation is detected by performing a process comprising: (i) treating the nucleic acid with an amount of a compound that selectively mutates a non-methylated cytosine residue within a CpG dinucleotide under conditions sufficient to induce mutagenesis thereby producing a mutated nucleic acid; (ii) hybridizing the nucleic acid to two non-overlapping and non-complementary primers each of which comprises a nucleotide sequence that is complementary to a sequence in the DNA comprising a methylated cytosine residue under conditions such that hybridization to the non-mutated nucleic acid occurs; (iii) amplifying nucleic acid intervening the hybridized primers thereby producing a DNA fragment consisting of a sequence that comprises a primer sequence; (iv) hybridizing the amplified DNA fragment to a probe comprising a nucleotide sequence that corresponds or is complementary to a sequence comprising a methylated cytosine residue under conditions such that hybridization to the non-mutated nucleic acid occurs; and detecting the hybridization.
Negative Read-Out Assays
(158) In another example, the assay format comprises a negative read-out system in which reduced methylation of DNA from a healthy/normal control sample is detected as a positive signal and preferably, methylated DNA from a neoplastic sample is not detected or is only weakly detected.
(159) In a preferred embodiment, the reduced methylation is determined using a process comprising: (i) treating the nucleic acid with an amount of a compound that selectively mutates a non-methylated cytosine residue within a CpG island under conditions sufficient to induce mutagenesis thereby producing a mutated nucleic acid; (ii) hybridizing the nucleic acid to a probe or primer comprising a nucleotide sequence that is complementary to a sequence comprising the mutated cytosine residue under conditions such that selective hybridization to the mutated nucleic acid occurs; and (iii) detecting the selective hybridization.
(160) In this context, the term selective hybridization means that hybridization of a probe or primer to the mutated nucleic acid occurs at a higher frequency or rate, or has a higher maximum reaction velocity, than hybridization of the same probe or primer to the corresponding non-mutated sequence. Preferably, the probe or primer does not hybridize to the methylated sequence (or non-mutated sequence) under the reaction conditions used.
(161) Hybridization-Based Assay Format
(162) In one embodiment the hybridization is detected using Southern, dot blot, slot blot or other nucleic acid hybridization means (Kawai et al., 1994, supra; Gonzalgo et al., 1997, supra). Subject to appropriate probe selection, such assay formats are generally described herein above and apply mutatis mutandis to the presently described selective mutagenesis approach. Preferably, a ligase chain reaction format is employed to distinguish between a non-mutated and mutated nucleic acid. In this respect, the assay requirements and conditions are as described herein above for positive read-out assays and apply mutatis mutandis to the present format. However the selection of probes will differ. For negative read-out assays, one or more probes are selected that selectively hybridize to the mutated sequence rather than the non-mutated sequence.
(163) Preferably, the ligase chain reaction probe(s) have 3-terminal and/or 5-terminal sequences that comprise a CpG dinucleotide that is not methylated in a healthy control sample, but is hypermethylated in cancer, such that the diagnostic probe and contiguous probe are capable of being ligated only when the cytosine of the CpG dinucleotide is mutated to thymidine e.g., in the case of a non-methylated cytosine residue.
(164) As will be apparent to the skilled artisan the MSO method described supra is amenable to either or both positive and/or negative readout assays. This is because the assay described detects both mutated and non-mutated sequences thereby facilitating determining the level of methylation. However, an assay detecting only methylated or non-methylated sequences is contemplated by the invention.
(165) Amplification-Based Assay Format
(166) In an alternative example, the hybridization is detected using an amplification system using any amplification assay format as described herein above for positive read-out assay albeit using primers (and probes where applicable) selectively hybridize to a mutated nucleic acid.
(167) In adapting the HeavyMethyl assay described supra to a negative read-out format, the blockers that bind to bisulfate-treated nucleic acid in a methylation specific manner bind specifically to mutated DNA under moderate to high stringency conditions. An amplification reaction is performed using one or more primers that may optionally be methylation specific (i.e. only bind to mutated nucleic acid) but that flank the one or more blockers. In the presence of methylated nucleic acid (i.e., mutated DNA) the blocker/s bind and no PCR product is produced.
(168) In one example, the reduced methylation in the normal/healthy control subject is detected by performing a process comprising: (i) treating the nucleic acid with an amount of a compound that selectively mutates non-methylated cytosine residues under conditions sufficient to induce mutagenesis thereby producing a mutated nucleic acid; (ii) hybridizing the nucleic acid to two non-overlapping and non-complementary primers each of which comprises a nucleotide sequence that is complementary to a sequence in the DNA comprising a mutated cytosine residue under conditions such that hybridization to the mutated nucleic acid occurs; (iii) amplifying nucleic acid intervening the hybridized primers thereby producing a DNA fragment consisting of a sequence that comprises a primer sequence; (iv) hybridizing the amplified DNA fragment to a probe comprising a nucleotide sequence that corresponds or is complementary to a sequence comprising a mutated cytosine residue under conditions such that hybridization to the mutated nucleic acid occurs; and
(v) detecting the hybridization.
(169) As will be apparent to the skilled artisan, a negative read-out assay preferably includes a suitable control sample to ensure that the negative result is caused by methylated nucleic acid rather than a reaction failing.
(170) This invention also provides kits for the detection and/or quantification of the diagnostic sequences of the invention, or expression or methylation thereof using the methods described herein.
(171) For kits for detection of methylation, the kits of the invention can comprise at least one polynucleotide that hybridizes to at least one of the diagnostic sequences of the invention and at least one reagent for detection of gene methylation. Reagents for detection of methylation include, e.g., sodium bisulfite, polynucleotides designed to hybridize to sequence that is the product of a biomarker sequence of the invention if the biomarker sequence is not methylated (e.g., containing at least one C.fwdarw.U conversion), and/or a methylation-sensitive or methylation-dependent restriction enzyme. The kits may also include control natural or synthetic DNA sequences representing methylated or unmethylated forms of the sequence. The kits can provide solid supports in the form of an assay apparatus that is adapted to use in the assay. The kits may further comprise detectable labels, optionally linked to a polynucleotide, e.g., a probe, in the kit. Other materials useful in the performance of the assays can also be included in the kits, including test tubes, transfer pipettes, and the like. The kits can also include written instructions for the use of one or more of these reagents in any of the assays described herein.
(172) The present invention is further described by reference to the following non-limiting examples.
EXAMPLES
Materials and Methods
(173) Specimen Collection
(174) Tissue DNA samples were acquired through a commercial specimen bank (BioServe, @, US) and a tertiary referral hospital tissue bank in Adelaide, Australia. Blood plasma specimens were acquired from a commercial specimen bank (Proteogenex, Culver City, Calif.) and a tertiary referral hospital in Adelaide, Australia. Blood specimens were classified as normal, adenoma or cancer based on colonoscopy results verified (where appropriate) by histopathology. This also identified the stage of the cancer. Peripheral blood was drawn into K.sub.3EDTA VACUETTE blood tubes (Greiner-One, Monroe, N.C.) and transported to the processing laboratory on wet ice. Whole blood was centrifuged at 1,500 g (4 C.) for 10 minutes within 4 hours of blood draw and plasma was collected. The plasma was centrifuged for a second time at 1,500 g (4 C.) for 10 minutes, where after the plasma was collected and stored at 80 C. until further use.
(175) Tissue DNA Extraction & Bisulfite Conversion
(176) Tissue specimens were homogenised using a bead homogeniser and genomic DNA extracted using a Wizard Genomic DNA Purification Kit (Promega, Sydney, Australia).
(177) Commercially acquired DNA was extracted by BioServe (MD, USA). DNA concentration was determined by Nanodrop ND 1000 20 spectrophometor (Nanodrop Technologies, Wilmington, Del.). The EZ DNA Methylation-Gold Kit (Zymo Research Corporation, Orange, Calif. USA) was used for bisulfite conversion of 1 mg of tissue-extracted DNA in accordance with the manufacturers instructions with the following modification to the bisulfite reaction cycling conditions: 99 C. for 5 minutes, 60 C. for 25 minutes, 99 C. for 5 minutes, 60 C. for 85 minutes, 99 C. for 5 minutes and 60 C. for 17.5 minutes. The concentration of purified bisulfite converted DNA was determined by qPCR using bisulfite conversion specific primers to beta-Actin [ACTB1], as described in Table 1 and previously by Devos et al. (Clin. Chem., 2009; 55(7):1337-1346). The bisulfite converted DNA samples were stored at 80 C. until further use.
(178) Plasma DNA Extraction & Bisulfite Conversion:
(179) DNA was prepared from 4 mL of plasma using the QIAamp Circulating Nucleic Acid Kit (QIAGEN, Dusseldorf, Germany) according to the manufacturer's specifications with the following modifications: The column was washed twice with 750 ul of ACW2 and twice with 750 ul of absolute ethanol (200 proof). The resulting DNA was eluted in 35 ul of buffer AVE and this eluate was then reapplied to the column and eluted again to increase the concentration of the DNA. The optimised protocol resulted in a 20% improvement in DNA yield compared to the recommended manufacturer protocol (data not shown). The final volume of plasma DNA was 32 L per 4 mL of patient plasma. Real-time PCR was used to measure the total DNA recovery: 21 L aliquots of the resulting plasma DNA was used in a previously described CFFI assay (Devon et al. 2009. Clin Chem) (Table 1)
(180) All PCRs were performed on the LightCycler 480 Real-Time PCR System, model H (Roche). A 4-fold serial dilution of sonicated genomic blood DNA (Roche, Mannheim, Germany) was used as a standard to determine the amount (ng) of DNA extracted per mL of plasma 30 L of DNA extracted from 4 mL plasma was stripped of DNA-binding proteins by incubation at 37 C. for 1 hour after adding 3 uL of a Lysis Buffer consisting of 1 mg/mL tRNA, 2 mg/mL Proteinase K and 10% SDS. The samples were subsequently bisulphite converted using either the EZ DNA Methylation-Gold Kit as recommended by the manufacturer (Zymo Research Corp. Orange, Calif. USA), with the same modification to thermal cycling conditions described above, or the Epitect Plus DNA Bisulfite Kit using Epitect Fast bisulfite reagent (QIAGEN, Dusseldorf, Germany) using conditions recommended by the manufacturer. In both cases, the purified DNA was eluted with 40 uL nuclease-free water. The resulting bisulphite DNA concentration was calculated by analysing 2 L in the ACTB PCR assay as described above. Triplicate 5 uL aliquots of the resulting 36 uL bisulphite converted DNA extracted from 4 mL plasma (the equivalent of 555 L plasma per aliquot) were analysed in methylation-specific qPCR assays as described below.
(181) Measurement of Methylation
(182) Methylation specific oligonucleotide-primers and probes were designed to interrogate the methylation status of sites within CAHM, GRASP, IRF4, BCAT1 and IKZF1. PCR was performed in triplicate on bisulfite-converted tissue DNA (5 ng) or 5 L plasma DNA in a total volume of 15 L (see Table 1 for primer/probe sequences and reaction conditions). Melt peaks of 78.4+/0.9 C. (CAHM) and 82.9.4+/0.3 C. (IKZF1) were characteristic for the amplicons which ran without a probe. Methylation levels were quantified against an in house made standard curve consisting of a serial dilution of bisulfite-converted sheared methylated DNA (CpGenome Universal Methylated DNA, Chemicon, Temecula, Calif., USA) in a background of sheared bisulfite-converted white blood cell DNA (Roche, Mannheim, Germany). The standard curve contained the following dilution points: 5000-, 1250-, 312.5-, 78.125, 19.53-, 4.88-, 1.22- and 0 pg mCpG in a background of WBC DNA (5 ng total DNA per reaction).
(183) Estimation of Class Probabilities
(184) The R open source programming language and environment for statistical computing and graphics (http://www.r-project.org) was installed on a standard Intel IA-32 personal computer system and used to access and process input data representing the measured methylation levels and corresponding observed non-neoplastic and neoplastic categories, as described below.
(185) Specifically, the observed methylated CAHM mass by phenotype classification (
(186) Using only positive (i.e., greater than zero) methylation levels determined for plasma specimens of known phenotype (and shown in
(187) TABLE-US-00013 RELATIVE Probability (normalised to premalignant) Log Pre- Early-Stage Late-Stage (methyl CAHM pg) malignant Cancer Cancer 1.0 (2.8 pg) 1.0 1.0 0.175 5.0 (148 pg) 1.0 3.2 4.95 10.0 (22,000 pg) 1.0 8.3 627
(188) These data were also used to estimate the probability that a plasma specimen from a known classification would yield an observed methylation level equal to or greater than the hypothetical CAHM methylation levels. Using the probability density functions shown in
(189) TABLE-US-00014 Cumulative probability methylated CAHM is greater than or equal to (ratio to premalignant) Log Pre- Early-Stage Late-Stage (methyl CAHM pg) malignant Cancer Cancer 1.0 36% (1.0) 68% (1.8) 96% (2.6) 5.0 3% (1.0) 12% (4.1) 66% (23.2) 10.0 0.0058% (1.0) 0.052% (8) 9% (1600)
(190) Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.
(191) TABLE-US-00015 TABLE1 OligonucleotidesequencesandreactionconditionsforPCR,MethylationSpecific PCRandMethylightassays. PCR Primer/ProbeSequence Mastermix CyclingConditions CAHM Foward:GAAGGAAGTATTTCGAGTACG Each15Lreaction Activation-95C. ATTGAC(SEQIDNO:9) contained:0.1L 2min. Reverse:CCCGAACGCAACGACTTAA 5U/LPlatinumTaq 3Cycles:92C.15 (SEQIDNO:10) DNApolymerase sec(4.4C./sec), (Invitrogen),1.5L 62C.15sec 10PlatinumBuffer (2.2C./sec),72C. (Invitrogen),0.9L 20sec 50mMMgCl.sub.2(f3mM 50Cycles:82C.15 Final,Invitrogen), sec(4.4C./sec), 0.3L10mMdNTPs 63C.15sec (200uMFinal, (2.2C./sec) Promega),0.1Lofthe 72C.20sec fowardandreverse Cooling-40C. primers(50uM/200nM 5sec(2.2C./sec) Final)and0.125L followedbyaMelt 1/1000SYBRGreen analysistoconfirm andNucleaseFree correctproduct Water GRASP Foward:CGGAAGTCGCGTTCGTC Each15Lreaction Activation-95C. (SEQIDNO:11) Reverse:GCGTACAACTCGTCCGCTAA contained:0.1L 2min. (SEQIDNO:12) Probe:[HEX] 5U/LPlatinumTaq 3Cycles:92C.15 TTCGATTTCGGGATTTTTTGTCGTAGTC DNApolymerse sec(4.4C./sec), [BHQ1](SEQIDNo:13) (Invitrogen),1.5L 64C.15sec 10PlatinumBuffer (2.2C./sec),72C. (Invitrogen),1.2L 20sec(4.4C./sec) 50mMMgCl.sub.2(4mM 47Cycles:85C.15 Final,Invitrogen), sec(4.4C./sec), 0.3L10mMdNTPs 64C.15sec (0.2mMFinal, (2.2C./sec),72C. Promega),0.06Lof 20sec(4.4C./sec) thefowardandreverse cooling-40C. primers(50uM/200nM 10sec(2.2C./sec). Final)and0.03uLof probe(50uM stock/100nMFinal) IRF4 Foward:TGGGTGTTTTGGACGGTTTC Each15Lreaction Activation-95C. (SEQIDNo:14) Reverse:CGCCTACCCTCCGCG contained:0.1L 2min. (SEQIDNo:15 Probe:[HEX]) 5U/LPlatinumTaq 3Cycles:92C.15 TCGTTTAGTTTGTGGCGATTTCGTCG DNApolymerse sec(4.4C./sec), {BHQ1](SEQIDNo:16) (Invitrogen),1.5L 64C.15sec 10PlatinumBuffer (2.2C./sec),72C. (Invitrogen),1.2L 30sec(4.4C./sec) 50mMMgCl.sub.2(4mM 50Cycles:86C.15 Final,Invitrogen), sec(4.4C./sec), 0.3L10mMdNTPs 62C.30sec (0.2mMFinal, (2.2C./sec),72C. Promega),0.12Lof 30sec(4.4C./sec) thefowardandreverse cooling-40C. primers(50uM/200nM 10sec(2.2C./sec). Final)and0.03uLof probe(10uM stock/200nMFinal) BCAT1 Foward:GTTTTTTTGTTGATGTAATTCGTTAGGTC Each15Lreaction Activation-95C. (SEQIDNo:17) Reverse:CAATACCCGAAACGACGACG contained:0.1L 2min. (SEQIDNo:18) Probe:HEX-5 5U/LPlatinumTaq 50Cycles:95C.15 TTCGTCGCGAGAGGGTCGGTT-BHQ DNApolymerse sec(4.4C./sec), (SEQIDNo:19) (Invitrogen),1.5L 62C.30sec 10PlatinumBuffer (2.2C./sec),72C. (Invitrogen),1.2L 30sec(4.4C./sec) 50mMMgCl.sub.2(4mM cooling-40C. Final,Invitrogen), 5sec(2.2C./sec). 0.3L10mMdNTPs (0.2mMFinal, Promega),0.06Lof thefowardandreverse primers(50uM/200nM Final)and0.15uLof probe(10uM stock/100nMFinal) IKZF1 Foward:GACGACGTATTTTTTTCGTGTTTC Each15Lreaction Activation-95C. (SEQIDNo:20) Reverse:GCGCACCTCTCGACCG contained:7.5Lof2 2min. (SEQIDNo:21) GoTaqHotStartbuffer 50Cycles:95C.15 w/MgCL2,0.3L sec(4.4C./sec), 50mMMgCl.sub.2(4mM 62C.30sec Final,Invitrogen), (2.2C./sec),72C. 0.06Lofthefoward 30sec(4.4C./sec) andreverseprimers cooling-40C. (50uM/200nMFinal) 5sec(2.2C./sec). and0/15ulofSYBR (1:1000stock/1: 100,000Final) CFF1 Foward:TAAGAGTAATAATGGATGGAT Each15Lreaction Activation-95C. (SEQIDNo:22) GATGReverse:CCTCCCATCTCCCTTCC contained:0.15L 2min. (SEQIDNo:23) Probe:6FAM- 5U/LPlatinumTaq 50Cycles:95C.10 ATGGATGAAGAAAGAAAGGATGAGT-BHQ-1 DNApolymerse sec(4.4C./sec), (SEQIDNo:24) (Invitrogen),1.5L 58C.60sec 10PlatinumBuffer (2.2C./sec) (Invitrogen),0.9L cooling-40C. 50mMMgCl.sub.2(3mM 5sec(2.2C./sec). Final,Invitrogen), 0.3L10mMdNTPs (0.2mMFinal, Promega),0.189Lof thefowardandreverse primers(50uM/200nM Final)and0.3uLof probe(10uM stock/200nMFinal) -actin Foward:GTGATGGAGGAGGTTTAGTAAGTT Each15Lreaction Activation-95C. (SEQIDNo:25) Reverse:CCAATAAAACCTACTCCTCCCTTAA contained:0.15L 2min. (SEQIDNo:26) Probe:FAM-ACCACCACCCAACACACAATAAC 5U/LPlatinumTaq 60Cycles:95C.10 AAACACA-BHQ1(SEQIDNo:27) DNApolymerse sec(4.4C./sec), (Invitrogen),1.5L 57C.40sec 10PlatinumBuffer (2.2C./sec) (Invitrogen),0.6L 10sec(4.4C./sec) 50mMMgCl.sub.2(2mM cooling-40C. Final,Invitrogen), 5sec(2.2C./sec). 0.3L10mMdNTPs (0.2mMFinal, Promega),0.27Lof thefowardandreverse primers(50uM/900nM Final)and0.15uLof probe(10uM stock/100nMFinal)
(192) TABLE-US-00016 TABLE 2 Genomic Current sub-region(s) of interest Coordinates of Resulting bisulphite converted sequence Oligonucleotide sequences for Gene Strand (genomic sequence) sub region(s) (strands no longer complementary) measurement of methylation levels BCAT1 top strand 5-cagtgccCGaggCGgCGgCGagtacaCG 25,101,992- 5-tagtgttCGaggCGgCGgCGagtataCGtggCGg tggCGggctggattgcagacCGgccctctC 25,102,093 gttggattgtagatCGgttttttCGCGgCGgagattCG GCGgCGgagactCGCGacctagCGgattgc CGatttagCGgattgtattagtaggaagat atcagcaggaagac (SEQ ID No: 1) (SEQ ID No: 28) minus 3-gtcacggGCtccGCcGCcGCtcatgtG 3-gttatggGCtttGCtGCtGCttatgtGCattGCtt 5-gtttttttgttgtttgtaattcgttaggtc strand CaccGCccgacctaacgtctgGCcgggaga gatttaatgtttgGCtgggagaGCGCtGCttttgaGCGC (SEQ ID No: 31) GCGCcGCctctgaGCGCtggatcGCctaac tggattGCttaatgtagttgtttttttg 5-caatacccgaaacgacgacg gtagtcgtccttctg (SEQ ID No: 29) (SEQ ID No: 30) (SEQ ID No: 32) 5-ttcgtcgcgagagggtcggtt (SEQ ID No: 33) 5-tttttgttgatgtaattcgttaggtc (SEQ ID No: 34) 5-attacaaaccgaccctctcg (SEQ ID No: 35) top strand 5-agatcccaagggtCGtagcccctggcC 25,101,909- This sequence is for measuring CpG 5-agatcccaagggtcgtagc GtgtggacCGggtctgCGgctgcagagCGC 25,101,995 methylation levels using methylation (SEQ ID No: 36) GgtccCGgctgcagcaagacctggggcagt sensitive restriction enzymes (e.g. 5-actgccccaggtcttgct ((SEQ ID No: 2) HbaIl, Hhal (underlined) (SEQ ID No: 37) minus 3-tctagggttcccaGCatcggggaccgGC strand acacctgGCccagacGCcgacgtctcGCGC caggGCcgacgtcgttctggaaccccgtca (SEQ ID No: 38) IKZF1 top strand 5-gaCGaCGcaccctctcCGtgtccCGct 50,343,867- 5-gaCGaCGtatttttttCGtgtttCGttttgCGttttt 5-gacgacgtatttttttcgtgtttc ctgCGcccttctgCGCGcccCGctccctgt 50,343,961 ttgCGCGtttCGttttttgtatCGgagtagCGattC (SEQ ID No: 40) acCGgagcagCGatcCGggaggCGgcCGag GggaggCGgtCGagaggtgCGt 5-gcgcacctctcgaccg aggtgCGc (SEQ ID No: 3) (SEQ ID No: 39) (SEQ ID No: 41) 5-tttgtatcggagtagcgattccgggag (SEQ ID No: 42) minus 3-ctGCtGCgtgggagagGCacaggGCga 3-ttGCtGCgtgggagagGCataggGCgagatGCgg strand gacGCgggaagacGCGCgggGCgagggaca gaagatGCGCgggGCgagggatatgGCtttgttGCta tgGCctcgtcGCtagGCcctccGCcgGCtc gGCtttttGCtgGCtttttatGCg tccacGCg (SEQ ID No: 43) (SEQ ID No: 44) top strand 5-cCGgagttgCGgctgagaCGCGCGcCGC 50,343,804- This sequence is for measuring CpG 5-ggagttgcggctgagac GCGagcCGggggactCGgCGaCGgggCGgg 50,343,895 methylation levels using methylation (SEQ ID No: 45) gaCGggaCGaCGcaccctctcCGtgtccCG sensitive restriction enzymes (e.g. 5-agagcgggacacggaga ctct (SEQ ID No: 4) HbaIl, Hhal (underlined) (SEQ ID No: 46) minus 3-gGCctcaacGCcgactctGCGCGCgGC strand GCGCtcgGCcccctgaGCcGCtGCcccGCc cctGCcctGCtGCgtgggagagGCacaggG Cgaga (SEQ ID No: 47) IRF4 top strand 5-CGcctgccctcCGCGctcctgCGaCGg 392,036- 5-CGtttgtttttCGCGtttttgCGaCGgggtCGtt 5-gtttttgcgacggggtc ggtCGccacaagctggaCGggatgagctaa 392,145 ataagttggaCGggatgagttatCGgattgtCGgggt (SEQ ID No: 49) cCGgactgtCGgggccccaggagtggctga tttaggagtggttgaggCGgggtCGtttaaggtattta 5-taaaaccccgacaatccg ggCGgggcCGtccaaggcaccca (SEQ ID No: 48) (SEQ ID No: 50) (SEQ ID No: 5) minus 3-GCggacgggagGCGCgaggacGCtGC 3-GCggatgggagGCGCgaggatGCtGCtttaGCgg 5-tgggtgttttggacggtttc strand cccaGCggtgttcgacctGCcctactcgat tgtttgatttGCtttatttgattgGCttgataGCtttg (SEQ ID No: 53) tgGCctgacaGCcccggggtcctcaccgac gggtttttattgattttGCtttgGCaggttttgtgggt 5-tagttatttttggggtttcgatagttc tccGCcccgGCaggttccgtgggt (SEQ ID No: 52) (SEQ ID No: 54) (SEQ ID No: 51) 5-cgcctaccctccgcg (SEQ ID No: 55) 5-tcgtttagtttgtggcgatttcgtcg (SEQ ID No: 56) GRASP top strand 5-caggaagctgcagcagaaggaggaggC 52,400,821- 5-taggaagttgtagtagaaggaggaggCGgCGgttat 5-cggaagtcgcgttcgtc GgCGgccacccCGgacccCGcCGccCGgac 52,401,051 ttCGgatttCGtCGttCGgattttCGattCGgaagtC (SEQ ID No: 58) tccCGactCGgaagtCGCGccCGcCGctcC GCGttCGtCGtttCGgtttCGatttCGggattttttg 5-gcgtacaactcgtccgctaa GgtccCGacccCGggaccccctgcGCcagc tCGtagtCGttatttttgggtttttagCGgaCGagt (SEQ ID No: 59) CGccacccctgggcccccagCGgaCGagct tgtaCGCGgCGttggaggattattattttgtCGagtt 5-ttcgatttcgggattttttgtcgtagtc gtaCGCGgCGctggaggactatcaccctgc gtatCGCGCGttCGtCGtgttCGggggtattttgttt (SEQ ID No: 60) CGagctgtacCGCGCGctCGcCGtgtcCGg CGtCGaaaggtgCGtttttCGttCGtttttaggattt 5-cggattttcgattcggaagt gggcaccctgcccCGcCGaaaggtgCGtcc gtttagttttttttCGattttttatagggtttgttga (SEQ ID No: 61) ccCGccCGccttcaggatctgctcagcccc tttCG (SEQ ID No: 57) tctcCGactccctacagggcctgctgactc CG (SEQ ID No: 6) minus 3-gtccttcgacgtcgtcttcctcctccG 3-gttttttgatgttgtatttttttttGCtGCtgg 5-ggtagggtgttttcggatac strand CcGCcggtgggGCctgggGCgGCggGCctg tgggGCttgggGCgGggGCttgaggGCtgaGCtttaGC (SEQ ID No: 64) aggGCtgaGCctcaGCGCggGCgGCgagGC GCggGCgGCgagGCtaggGCtgggGCtttgggggatgG 5-aacgaacgaactatacgcgac caggGCtgggGCcctgggggacgGCgtcgG CgttgGCggtggggatttgggggttGCttGCttgatat (SEQ ID No: 65) CggtggggacccgggggtcGCctGCtcgac GCGCtGCgatttatgatagtgggatgGCttgatatgGC atGCGCcGCgacctcctgatagtgggacgG GCGCgaGCgGCatagGCttttgtgggatgggGCgGCttt CtcgacatgGCGCGCgaGCgGCacagGCcc ttatGCaggggGCggGCggaagttttagatgagttggg ccgtgggacgggGCgGCtttccacGCaggg gagagGCtgagggatgttttggatgattgagGC gGCggGCggaagtcctagacgagtcgggga (SEQ ID No: 63) gagGCtgagggatgtcccggacgactgagGC (SEQ ID No: 62) top strand 5-gacagagacagccccaggcaagttgaa 52,401,407- 5-gatagagatagttttaggtaagttgaaggttCGa ggtcCGagagccccCGgtgggagaagCGgg 52,401,664 gagttttCGgtgggagaagCGggtCGgtggttgCGtC cCGgtggctgCGcCGCGtgCGttctcactct GCGtgCGtttttattttgaggaagtgCGtggggagtCGt gaggaagtgCGtggggagcCGctgactcCG tgatttCGgatagtatattttttCGaggggatttttC gatagcacacccttcCGaggggactcccCG GatttttgggttgggggtttgtCGtttggttttaCGt attcctgggctgggggcctgcCGcctggcc ttgaCGtaCGgggCGCGagggttattgttttttggattt ccaCGtctgaCGtaCGgggCGCGagggccac ttgtCGgaatCGgaCGtagtgggaggggtCGtagg tgtccctggacttctgtCGgaacCGgaCGc (SEQ ID No: 66) agtgggaggggtCGcagg (SEQ ID No: 7) minus 3-ctgtctctgtcggggtccgttcaacttc 3-ttgtttttgttggggtttgtttaatttttagGCtt 5-cggagttagcggttttttacg strand cagGCtctcggggGCcaccctcttcGCccg ttggggGCtattttttttGCttgGCtattgatGCgGCG (SEQ ID No: 69) GCcaccgacGCgGCGCacGCaagagtgaga CatGCaagagtgagatttttttatGCattttttgG 5-cgataaaaaaaacgaaccga ctccttcacGCacccctcgGCgactgagGC CgattgagGCttattgtgtgggaagGCttttttgag (SEQ ID No: 70) ctatcgtgtgggaagGCtcccctgagggG ggGCtaaggatttgatttttggatgGCggattggggt 5-agagtgagaacgtacgcggc CtaaggacccgacccccggacgGCggaccg GCagattGCatGCtttGCGCttttggtgatgagggat (SEQ ID No: 71) gggtGCagactGCatGCcccGCGCtcccgg ttgaagataGCtttgGCttGCgttattttttttaGCg tgacgagggacctgaagacaGCcttgGCct ttt (SEQ ID No: 68) GCgtcaccctccccaGCgtcc (SEQ ID No: 67) top strand 5-gacagagacagccccaggcaagttgaa This sequence is for measuring CpG 5-caagttgaaggtccgagagc ggtcCGagagccccCGgtgggagaagCGggc methylation levels using methylation (SEQ ID No: 73) CGgtggctgCGcCGCGtgCGttctcactct sensitive restriction enzymes (e.g. 5-cgcacttcctcagagtgaga gaggaagtgCGtggggagcCGctgactcCG HbalI, HhaI (underlined) (SEQ ID No: 74) gatagcacacccttcCGaggggactcccCG attcctgggctgggggcctgcCGcctggcc ccaCGtctgaCGtaCGgggCGCGagggcca ctgctccctggacttctgtCGgaacCGgaC GcagtgggaggggtCGcagg (SEQ ID No: 72) minus 3-ctgtctctgtcggggtccgttcaactt strand ccagGCtctcggggGCcaccctcttcGCcc gGCcaccgacGCgGCGCacGCaagagtgag actccttcacGCacccctcgGCgactgagG CctatcgtgtgggaagGCtcccctgagggG CtaaggacccgacccccggacgGCggaccg gggtGCagactGCatGCcccGCGCtcccgg tgacgagggacctgaagacaGCcttgGCct GCgtcaccctccccaGCgtcc (SEQ ID No: 75) CAHM top strand 5-atctgtaaaaatgttgacttctgcttt 163,834,295 5-atttgtaaaaatgttgatttttgttttttagatt 5-gaaggaagtatttcgagtacgattgacc tcagactaCGCGcacagcctctttatttcc 163,834,500 aCGCGtatagtttttttattttttattgCGgttttat (SEQ ID No: 77) tactCGgcttcattccctcaCGgaacactg ttttttaCGgaatattgaCGttatCGCGaaggaagta 5-cccgaacgcaacgacttaa aCGccatCGCGaaggaagcatttCGagcaC tttCGagtaCGattgaCGttttttttattatttgtta (SEQ ID No: 78) GactgaCGctccccttattatttgctaagc agtCGttgCGttCGggtttggttaCGatttgttttta 5-gcctctaaaaaaacgatcttattacacc CGctgCGctCGggtctggctaCGatttgct gaataaCGggaaggtgtaataaga (SEQ ID No: 79) ttcagaataaCGggaaggtgcaacaaga (SEQ ID No: 76) (SEQ ID No: 8) minus 3-tagacatttttacaactgaagacgaaa 3-tagatatttttataattgaagatgaaaagtttga 5-gaaacactaacgccatcg strand agtctgatGCGCgtgtcggagaaataaagga tGCGCgtgttggagaaataaaggatgatGCtgaagta (SEQ ID No: 82) tgacGCcgaagtaagggagtGCcttgtgac agggagtGCtttgtgattGCggtaGCGCtttttttgtaa 5-cgtagttagattcgagcgtag tGCggtaGCGCttccttcgtaaaGCtcgtG aGCttgtGCtgattGCgaggggaataataaatgattt (SEQ ID No: 83) CtgactGCgaggggaataataaacgattcg gGCgatGCgaGCttagattgatGCtaaatgaaagttt 5-aggggagcgttagtcgtgttcgaaa GCgacGCgaGCccagaccgatGCtaaacga tattGCttttttatgttgtttt (SEQ ID No: 84) aagtcttattGCccttccacgttgttct (SEQ ID No: 81) (SEQ ID No: 80) minus 3-cgGCacgacgaaaggtcggagagtcgt 163,834,621 tgGCatgatgaaaggttggagagttgtttagtGCttg 5-gtttttttcggcgataaagc strand ttagtGCttgtgGCtttcttcggtGCcGCc 163,834,906 tgGCtttttttggtGCtGCtGCtGCtttttttGCaGC (SEQ ID No: 87) GCtGCcctccccGCaGCGCGCacgaaggga GCGCatgaagggaGCtGCtgttttGCttttgGCttGCG 5-cgcctctacgaaactctacg GCcGCtgtttcGCcctcgGCccGCGCgGCc CgGCtgGCttttGCggGCtGCgttttaggGCgttttt (SEQ ID No: 88) gGCtcccGCggGCcGCgtctcaggGCgtct GCttGCgGCGCtgtGCGCggaGCtttttggagtttga 5-cgtcggtcgagggcgttc ccGCctGCgGCGCcgtGCGCggaGCttttc gaataggaGCtgagaggGCggggtggagGCgggGCgt (SEQ ID No: 89) ggagtttgagaataggaGCcgagaggGCgg tggttttggGCGCgGCattGCttggGCtGCtggtttt ggtggagGCgggGCgtcggttctggGCGCg ttttgggtggttgggagGC tgGCat GCaccGCccggGCtGCcggttcctttcggg (SEQ ID No: 86) tggtcgggagGCtgGCac (SEQ ID No: 85)
BIBLIOGRAPHY
(193) Adorjan et al. Nucl. Acids. Res., 30: e21, 2002 Ammerpohl et al. Biochim Biophys Acta. 1790:847-62, 2009 Beaucage, et al. Tetrahedron Letters 22:1859-1862, 1981 Caruthers, M. H., et al., Methods in Enzymology, Vol. 154, pp. 287-314 (1988) Chen and Kwok, Nucleic Acids Res. 25:347-353, 1997 Clark et al. Nat Protoc. 1:2353-64, 2006 Cottrell et al., Nucl. Acids Res. 32: e10, 2003 DeGraves, et al., Biotechniques 34(1):106-10, 112-5 (2003) Deiman B, et al., Mol. Biotechnol. 20(2):163-79 (2002) Devos et al. (Clin. Chem., 2009; 55(7):1337-0.1346 Eads et al., Cancer Res. 59:2302-2306 (1999) Eads et al., Nucl. Acids Res. 28: E32, 2000 Egholm et al., Am. Chem. Soc., 114:1895, 1992 Egholm et al., Nature, 365:566, 1993 Fodor et al., Science 767-773, 1991 Frommer et al., Proc. Natl. Acad. Sci. USA 89:1827-1831 (1992) Gibson et al., Genome Research 6:995-1001 (1996) Golub et al., Science, 286:531-537, 1999 Gonzalgo & Jones, Nucleic Acids Res. 25:2529-2531 (1997) Gonzalgo et al., Cancer Res. 57:594-599, 1997 Gregory and Feil, Nucleic Acids Res., 27, e32i-e32iv, 1999 Herman et al. Proc. Natl. Acad. Sci. USA 93:9821-9826, 1992 Holland et al., Proc. Natl. Acad. Sci. USA, 88:7276-7280, 1991 Kawai et al., Mol. Cell. Biol. 14:7421-7427, 1994 Kristensen and Hansen Clin Chem. 55:1471-83, 2009 Kuppuswamy et al., Proc. Natl. Acad. Sci. USA 88:1143-1147, 1991 Landegren et al., Genome Res., 8(8): 769-776, 1998 Lee et al., Nucleic Acid Res. 21:3761-3766, 1993 Markowitz and Bertagnolli (2009). N. Engl. J. Med. 361(25):2449-60 Messing, Methods Enzymol, 101, 20-78, 1983 Mhlanga and Malmberg, Methods 25:463-471, 2001 Narang, et al. Meth. Enzymol 68: 90, 1979 Nielsen et al. J. Chem. Soc. Perkin Trans., 1:3423, 1997 Olek, et al. Nat. Genet. 17(3): 275-6 (1997) Orum et al., Clin. Chem. 45:1898-1905, 1999 Orum et al., Nucl. Acids Res., 21:5332, 1993 Rand et al. Epigenetics 1:94-100, 2006 Rand et al. Nucl. Acids Res. 33:e127, 2005 Rein, et al. Nucleic Acids Res. 26 (10): 2255-64 (1998) Sadri and Hornsby, Nucl. Acids Res. 24:5058-5059, 1996 Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd Ed., CSHP, New York 1989) Shames et al. Cancer Lett. 251:187-98, 2007 Simeonov and Nikiforov, Nucleic Acids Research, 30(17):1-5, 2002 Singer-Sam et al., Nucl. Acids Res. 18:687, 1990 Singer-Sam et al., PCR Methods Appl. 1: 160-163, 1992 Singh and Wengel, Chem. Commun. 1247, 1998 Southern et al., Genomics, 13:1008-1017, 1992 Szabo and Mann, Genes Dev. 9: 3097-3108, 1995 Toyota et al., Cancer Res. 59:2307-12 (1999) Uhlmann et al., Electrophoresis, 23: 4072-4079, 2002 Worm et al., Clin. Chem., 47:1183-1189, 2001 Xiong and Laird, Nucl. Acids Res. 25:2532-2534, 1997 Zyskind et al., Recombinant DNA Laboratory Manual, (Acad. Press, 1988)