ISOLATION AND DETECTION OF DNA FROM PLASMA
20210079451 ยท 2021-03-18
Inventors
- Hatim Allawi (Middleton, WI, US)
- Graham P. Lidgard (Middleton, WI, US)
- Brian Aizenstein (Madison, WI, US)
- Tamara J. Sander (Mazomanie, WI, US)
- Maria Giakoumopoulos (Middleton, WI, US)
- Michael W. Kaiser (Stoughton, WI, US)
- Melissa M. Gray (Madison, WI, US)
- Abram Michael Vaccaro (Rio, WI, US)
Cpc classification
C12Q2563/159
CHEMISTRY; METALLURGY
C12Q2527/125
CHEMISTRY; METALLURGY
C12Q2600/166
CHEMISTRY; METALLURGY
C12N15/1006
CHEMISTRY; METALLURGY
C12Q2537/143
CHEMISTRY; METALLURGY
C12Q2527/125
CHEMISTRY; METALLURGY
C12Q2537/143
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
C12Q2563/159
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
International classification
C12Q1/6806
CHEMISTRY; METALLURGY
C12N15/10
CHEMISTRY; METALLURGY
Abstract
Provided herein is technology relating to the amplification-based detection of bisulfite-treated DNAs and particularly, but not exclusively, to methods and compositions for multiplex amplification of low-level sample DNA prior to further characterization of the sample DNA. The technology further provides methods for isolating DNA from blood or blood product samples, e.g., plasma samples.
Claims
1. A method of processing a plasma sample, the method comprising: a) combining a plasma sample with i) protease; ii) a first portion of guanidine thiocyanate; and iii) a first portion of non-ionic detergent, to form a first mixture wherein proteins are digested by said protease; b) to the first mixture of step a) adding iv) silica particles; v) isopropyl alcohol; vi) a second portion of guanidine thiocyanate; and vii a second portion of non-ionic detergent, to form a second mixture under conditions wherein DNA is bound to said silica particles; c) separating silica particles with bound DNA from the second mixture; d) to the separated silica particles with bound DNA adding a first wash solution, said first wash solution comprising guanidine hydrochloride or guanidine thiocyanate, and ethyl alcohol; e) separating the silica particles with bound DNA from said first wash solution; f) to the separated silica particles with bound DNA adding a second wash solution, said second wash solution comprising a buffer and ethyl alcohol; g) separating the washed silica particles with bound DNA from said second wash solution; h) eluting DNA from said washed silica particles with bound DNA to produce an isolated DNA sample.
2. The method of claim 1, wherein steps f)-g) are repeated 1 to 3 additional times prior to step h).
3. The method of claim 1, wherein the first portion and the second portion of non-ionic detergent are the same or different, and are selected from the group consisting of polyethylene glycol sorbitan monolaurate (Tween-20), octylphenoxypolyethoxyethanol (Nonidet P-40), and octylphenoxy poly(ethyleneoxy) ethanol, branched (IGEPAL CA-630).
4. The method of claim 1, wherein said protease is Proteinase K protease.
5. The method of claim 1, further comprising a step after step g) and prior to step h) of drying the washed silica particles with bound DNA.
6. The method of claim 1, wherein the mixture of step a) further comprises a DNA process control.
7. The method of claim 6, wherein said DNA process control comprises a zebrafish RASSF1 sequence.
8. The method of claim 7, wherein said DNA process control comprising a zebrafish RASSF1 sequence is synthetic DNA.
9. The method of claim 1, wherein the first mixture further comprises bulk fish DNA.
10. The method of claim 1, wherein said plasma sample has a volume of at least 2 mL.
11. The method of claim 1, wherein said first portion of guanidine thiocyanate and said first portion of non-ionic detergent are added to the plasma sample together as a first lysis reagent comprising about 4.3 M guanidine thiocyanate and 10% w:v IGEPAL CA-630 and/or wherein said second portion of guanidine thiocyanate and said second portion of non-ionic detergent are added to the first mixture together as a second lysis reagent comprising 4.3 M guanidine thiocyanate and 10% w:v IGEPAL CA-630 combined with isopropyl alcohol.
12. The method of claim 1, wherein said first wash solution comprises about 3 M guanidine hydrochloride or 3 M guanidine thiocyanate and about 57% ethyl alcohol and/or said second wash solution comprises about 80% ethyl alcohol and about 20% 10 mM Tris pH 8.0 buffer.
13. The method of claim 1, further comprising analyzing said isolated DNA sample for multiple target nucleic acids, comprising: a) treating said isolated DNA sample with bisulfite to produce a bisulfite treated DNA sample; b) treating said bisulfite-treated DNA sample to an amplification reaction under conditions wherein at least five different target regions, if present in said sample, are amplified to form a pre-amplified mixture; c) partitioning said pre-amplified mixture into a plurality of different detection assay reaction mixtures; and d) conducting a plurality of detection assays with said detection assay reaction mixtures, wherein said at least five different target regions, if present in said sample at step a), are detected in one or more of said plurality of different detection assay reaction mixtures.
14. A kit for isolating DNA from plasma, the kit comprising: a) a first lysis reagent comprising guanidine thiocyanate and non-ionic detergent, or components for preparing said first lysis reagent; b) a second lysis reagent comprising guanidine thiocyanate, non-ionic detergent, and isopropanol, or components for preparing said second lysis reagent; c) a first wash solution comprising guanidine hydrochloride or guanidine thiocyanate and ethyl alcohol, or components for preparing said first wash solution; d) a second wash solution comprising Tris buffer and ethyl alcohol, or components for preparing said second wash solution; and e) silica particles.
15. The kit of claim 14, wherein the non-ionic detergents in the first lysis reagent and the second lysis reagent are the same or different, and are selected from the group consisting of polyethylene glycol sorbitan monolaurate (Tween-20), octylphenoxypolyethoxyethanol (Nonidet P-40), and octylphenoxy poly(ethyleneoxy) ethanol, branched (IGEPAL CA-630).
16. The kit of claim 14, further comprising one or more of: i) an elution buffer or components for preparing said elution buffer; ii) a DNA process control; and/or iii) a preparation of bulk fish DNA.
17. The kit of claim 16, wherein said DNA process control comprises a zebrafish RASSF1 sequence.
18. A system for processing a plasma sample, the system comprising: a) a first lysis reagent comprising guanidine thiocyanate and non-ionic detergent, or components for preparing said first lysis reagent; b) a second lysis reagent comprising guanidine thiocyanate, non-ionic detergent, and isopropanol, or components for preparing said second lysis reagent; c) a first wash solution comprising guanidine hydrochloride or guanidine thiocyanate and ethyl alcohol, or components for preparing said first wash solution; d) a second wash solution comprising Tris buffer and ethyl alcohol, or components for preparing said second wash solution; and e) silica particles.
19. The system of claim 18, wherein the non-ionic detergents in the first lysis reagent and the second lysis reagent are the same or different, and are selected from the group consisting of polyethylene glycol sorbitan monolaurate (Tween-20), octylphenoxypolyethoxyethanol (Nonidet P-40), and octylphenoxy poly(ethyleneoxy) ethanol, branched (IGEPAL CA-630).
20. The system of claim 18, further comprising one or more of: i) a protease; ii) an elution buffer or components for preparing said elution buffer; iii) a DNA process control; iv) a preparation of bulk fish DNA; v) reagents for treating DNA to produce bisulfite-treated DNA.
21. The system of claim 18, further comprising PCR amplification reagents and/or PCR flap assay reagents, wherein said PCR amplification reagents comprise: i) a plurality of different primer pairs for amplifying a plurality of different target regions, if present in said plasma; ii) thermostable DNA polymerase; iii) dNTPs; and iv) a buffer comprising Mg.sup.++; and wherein said PCR flap assay reagents comprise: i) a plurality of different primer pairs for amplifying a plurality of different target regions, if present in said plasma; ii) thermostable DNA polymerase; iii) dNTPs; iv) a buffer comprising Mg.sup.++ v) a flap endonuclease; vi) a flap oligonucleotide, and vii) a hairpin oligonucleotide comprising a region that is complimentary to a portion of said flap oligonucleotide.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0112] These and other features, aspects, and advantages of the present technology will become better understood with regard to the following drawings:
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126] It is to be understood that the figures are not necessarily drawn to scale, nor are the objects in the figures necessarily drawn to scale in relationship to one another. The figures are depictions that are intended to bring clarity and understanding to various embodiments of apparatuses, systems, and methods disclosed herein. Wherever possible, the same reference numbers will be used throughout the drawings to refer to the same or like parts. Moreover, it should be appreciated that the drawings are not intended to limit the scope of the present teachings in any way.
Definitions
[0127] To facilitate an understanding of the present technology, a number of terms and phrases are defined below. Additional definitions are set forth throughout the detailed description.
[0128] Throughout the specification and claims, the following terms take the meanings explicitly associated herein, unless the context clearly dictates otherwise. The phrase in one embodiment as used herein does not necessarily refer to the same embodiment, though it may. Furthermore, the phrase in another embodiment as used herein does not necessarily refer to a different embodiment, although it may. Thus, as described below, various embodiments of the technology may be readily combined, without departing from the scope or spirit of the technology.
[0129] In addition, as used herein, the term or is an inclusive or operator and is equivalent to the term and/or unless the context clearly dictates otherwise. The term based on is not exclusive and allows for being based on additional factors not described, unless the context clearly dictates otherwise. In addition, throughout the specification, the meaning of a, an, and the include plural references. The meaning of in includes in and on.
[0130] The transitional phrase consisting essentially of as used in claims in the present application limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed invention, as discussed in In re Herz, 537 F.2d 549, 551-52, 190 USPQ 461, 463 (CCPA 1976). For example, a composition consisting essentially of recited elements may contain an unrecited contaminant at a level such that, though present, the contaminant does not alter the function of the recited composition as compared to a pure composition, i.e., a composition consisting of the recited components.
[0131] As used herein in reference to non-target DNA, the term exogenous refers to non-target DNA that is isolated and purified from a source other than the source or sample containing the target DNA. For example, purified fish DNA is exogenous DNA with respect to a sample comprising human target DNA, e.g., as described in U.S. Pat. No. 9,212,392, which is incorporated herein by reference. Exogenous DNA need not be from a different organism than the target DNA. For example, purified fish DNA obtained commercially would be exogenous if added to a reaction configured to detect a target nucleic acid in a sample from a particular fish. In preferred embodiments, exogenous DNA is selected to be undetected by an assay configured to detect and/or quantify the target nucleic acid in the reaction in to which the exogenous DNA is added.
[0132] As used herein, a DNA fragment or small DNA or short DNA means a DNA that consists of no more than approximately 200 base pairs or nucleotides in length.
[0133] The term primer refers to an oligonucleotide that is capable of acting as a point of initiation of synthesis when placed under conditions in which primer extension is initiated. An oligonucleotide primer may occur naturally, as in a purified restriction digest or may be produced synthetically. In some embodiments, an oligonucleotide primer is used with a template nucleic acid and extension of the primer is template dependent, such that a complement of the template is formed.
[0134] The term amplifying or amplification in the context of nucleic acids refers to the production of multiple copies of a polynucleotide, or a portion of the polynucleotide, typically starting from a small amount of the polynucleotide (e.g., a single polynucleotide molecule), where the amplification products or amplicons are generally detectable. Amplification of polynucleotides encompasses a variety of chemical and enzymatic processes. The generation of multiple DNA copies from one or a few copies of a target or template DNA molecule during a polymerase chain reaction (PCR) or a ligase chain reaction (LCR; see, e.g., U.S. Pat. No. 5,494,810; herein incorporated by reference in its entirety) are forms of amplification. Additional types of amplification include, but are not limited to, allele-specific PCR (see, e.g., U.S. Pat. No. 5,639,611; herein incorporated by reference in its entirety), assembly PCR (see, e.g., U.S. Pat. No. 5,965,408; herein incorporated by reference in its entirety), helicase-dependent amplification (see, e.g., U.S. Pat. No. 7,662,594; herein incorporated by reference in its entirety), hot-start PCR (see, e.g., U.S. Pat. Nos. 5,773,258 and 5,338,671; each herein incorporated by reference in their entireties), intersequence-specific PCR, inverse PCR (see, e.g., Triglia, et al., (1988) Nucleic Acids Res., 16:8186; herein incorporated by reference in its entirety), ligation-mediated PCR (see, e.g., Guilfoyle, R. et al., Nucleic Acids Research, 25:1854-1858 (1997); U.S. Pat. No. 5,508,169; each of which are herein incorporated by reference in their entireties), methylation-specific PCR (see, e.g., Herman, et al., (1996) PNAS 93(13) 9821-9826; herein incorporated by reference in its entirety), miniprimer PCR, multiplex ligation-dependent probe amplification (see, e.g., Schouten, et al., (2002) Nucleic Acids Research 30(12): e57; herein incorporated by reference in its entirety), multiplex PCR (see, e.g., Chamberlain, et al., (1988) Nucleic Acids Research 16(23) 11141-11156; Ballabio, et al., (1990) Human Genetics 84(6) 571-573; Hayden, et al., (2008) BMC Genetics 9:80; each of which are herein incorporated by reference in their entireties), nested PCR, overlap-extension PCR (see, e.g., Higuchi, et al., (1988) Nucleic Acids Research 16(15) 7351-7367; herein incorporated by reference in its entirety), real time PCR (see, e.g., Higuchi, et al., (1992) Biotechnology 10:413-417; Higuchi, et al., (1993) Biotechnology 11:1026-1030; each of which are herein incorporated by reference in their entireties), reverse transcription PCR (see, e.g., Bustin, S. A. (2000) J. Molecular Endocrinology 25:169-193; herein incorporated by reference in its entirety), solid phase PCR, thermal asymmetric interlaced PCR, and Touchdown PCR (see, e.g., Don, et al., Nucleic Acids Research (1991) 19(14) 4008; Roux, K. (1994) Biotechniques 16(5) 812-814; Hecker, et al., (1996) Biotechniques 20(3) 478-485; each of which are herein incorporated by reference in their entireties). Polynucleotide amplification also can be accomplished using digital PCR (see, e.g., Kalinina, et al., Nucleic Acids Research. 25; 1999-2004, (1997); Vogelstein and Kinzler, Proc Natl Acad Sci USA. 96; 9236-41, (1999); International Patent Publication No. WO05023091A2; US Patent Application Publication No. 20070202525; each of which are incorporated herein by reference in their entireties).
[0135] The term polymerase chain reaction (PCR) refers to the method of K. B. Mullis U.S. Pat. Nos. 4,683,195, 4,683,202, and 4,965,188, that describe a method for increasing the concentration of a segment of a target sequence in a mixture of genomic or other DNA or RNA, without cloning or purification. This process for amplifying the target sequence consists of introducing a large excess of two oligonucleotide primers to the DNA mixture containing the desired target sequence, followed by a precise sequence of thermal cycling in the presence of a DNA polymerase. The two primers are complementary to their respective strands of the double stranded target sequence. To effect amplification, the mixture is denatured and the primers then annealed to their complementary sequences within the target molecule. Following annealing, the primers are extended with a polymerase so as to form a new pair of complementary strands. The steps of denaturation, primer annealing, and polymerase extension can be repeated many times (i.e., denaturation, annealing and extension constitute one cycle; there can be numerous cycles) to obtain a high concentration of an amplified segment of the desired target sequence. The length of the amplified segment of the desired target sequence is determined by the relative positions of the primers with respect to each other, and therefore, this length is a controllable parameter. By virtue of the repeating aspect of the process, the method is referred to as the polymerase chain reaction (PCR). Because the desired amplified segments of the target sequence become the predominant sequences (in terms of concentration) in the mixture, they are said to be PCR amplified and are PCR products or amplicons. Those of skill in the art will understand the term PCR encompasses many variants of the originally described method using, e.g., real time PCR, nested PCR, reverse transcription PCR (RT-PCR), single primer and arbitrarily primed PCR, etc.
[0136] As used herein, the term nucleic acid detection assay refers to any method of determining the nucleotide composition of a nucleic acid of interest. Nucleic acid detection assay include but are not limited to, DNA sequencing methods, probe hybridization methods, structure specific cleavage assays (e.g., the INVADER flap assay, or invasive cleavage assay, (Hologic, Inc.) described, e.g., in U.S. Pat. Nos. 5,846,717, 5,985,557, 5,994,069, 6,001,567, 6,090,543, and 6,872,816; Lyamichev et al., Nat. Biotech., 17:292 (1999), Hall et al., PNAS, USA, 97:8272 (2000), and in combined PCR/invasive cleavage assays (Hologic, Inc., e.g., in U.S. Patent Publications 2006/0147955 and 2009/0253142), each of which is herein incorporated by reference in its entirety for all purposes); enzyme mismatch cleavage methods (e.g., Variagenics, U.S. Pat. Nos. 6,110,684, 5,958,692, 5,851,770, herein incorporated by reference in their entireties); polymerase chain reaction (PCR), described above; branched hybridization methods (e.g., Chiron, U.S. Pat. Nos. 5,849,481, 5,710,264, 5,124,246, and 5,624,802, herein incorporated by reference in their entireties); rolling circle replication (e.g., U.S. Pat. Nos. 6,210,884, 6,183,960 and 6,235,502, herein incorporated by reference in their entireties); NASBA (e.g., U.S. Pat. No. 5,409,818, herein incorporated by reference in its entirety); molecular beacon technology (e.g., U.S. Pat. No. 6,150,097, herein incorporated by reference in its entirety); E-sensor technology (U.S. Pat. Nos. 6,248,229, 6,221,583, 6,013,170, and 6,063,573, herein incorporated by reference in their entireties); cycling probe technology (e.g., U.S. Pat. Nos. 5,403,711, 5,011,769, and 5,660,988, herein incorporated by reference in their entireties); Dade Behring signal amplification methods (e.g., U.S. Pat. Nos. 6,121,001, 6,110,677, 5,914,230, 5,882,867, and 5,792,614, herein incorporated by reference in their entireties); ligase chain reaction (e.g., Barany Proc. Natl. Acad. Sci USA 88, 189-93 (1991)); and sandwich hybridization methods (e.g., U.S. Pat. No. 5,288,609, herein incorporated by reference in its entirety).
[0137] In some embodiments, target nucleic acid is amplified (e.g., by PCR) and amplified nucleic acid is detected simultaneously using an invasive cleavage assay. Assays configured for performing a detection assay (e.g., invasive cleavage assay) in combination with an amplification assay are described in US Patent Publication 20090253142 A1 (application Ser. No. 12/404,240), incorporated herein by reference in its entirety for all purposes, and as diagrammed in
[0138] As used herein, the term PCR-flap assay is used interchangeably with the term PCR-invasive cleavage assay and refers to an assay configuration combining PCR target amplification and detection of the amplified DNA by formation of a first overlap cleavage structure comprising amplified target DNA, and a second overlap cleavage structure comprising a cleaved 5 flap from the first overlap cleavage structure and a labeled hairpin detection oligonucleotide called a FRET cassette. In the PCR-flap assay as used herein, the assay reagents comprise a mixture containing DNA polymerase, FEN-1 endonuclease, a primary probe comprising a portion complementary to a target nucleic acid, and a hairpin FRET cassette, and the target nucleic acid is amplified by PCR and the amplified nucleic acid is detected simultaneously (i.e., detection occurs during the course of target amplification). PCR-flap assays include the QuARTS assays described in U.S. Pat. Nos. 8,361,720; 8,715,937; and 8,916,344, and the amplification assays of U.S. Pat. No. 9,096,893 (for example, as diagrammed in
[0139] As used herein, the term PCR-flap assay reagents refers to one or more reagents for detecting target sequences in a PCR-flap assay, the reagents comprising nucleic acid molecules capable of participating in amplification of a target nucleic acid and in formation of a flap cleavage structure in the presence of the target sequence, in a mixture containing DNA polymerase, FEN-1 endonuclease and a FRET cassette.
[0140] As used herein, the term flap assay reagents or invasive cleavage assay reagents refers to all reagents that are required for performing a flap assay or invasive cleavage assay on a substrate. As is known in the art, flap assays generally include an invasive oligonucleotide, a flap oligonucleotide, a flap endonuclease and, optionally, a FRET cassette, as described above. Flap assay reagents may optionally contain a target to which the invasive oligonucleotide and flap oligonucleotide bind.
[0141] As used herein, the term flap oligonucleotide refers to an oligonucleotide cleavable in a detection assay, such as an invasive cleavage assay, by a flap endonuclease. In preferred embodiments, a flap oligonucleotide forms an invasive cleavage structure with other nucleic acids, e.g., a target nucleic acid and an invasive oligonucleotide.
[0142] As used herein, the term FRET cassette refers to a hairpin oligonucleotide that contains a fluorophore moiety and a nearby quencher moiety that quenches the fluorophore. Hybridization of a cleaved flap (e.g., from cleavage of a target-specific probe in a PCR-flap assay assay) with a FRET cassette produces a secondary substrate for the flap endonuclease, e.g., a FEN-1 enzyme. Once this substrate is formed, the 5 fluorophore-containing base is cleaved from the cassette, thereby generating a fluorescence signal. In preferred embodiments, a FRET cassette comprises an unpaired 3 portion to which a cleavage product, e.g., a portion of a cleaved flap oligonucleotide, can hybridize to from an invasive cleavage structure cleavable by a FEN-1 endonuclease.
[0143] A nucleic acid hairpin as used herein refers to a region of a single-stranded nucleic acid that contains a duplex (i.e., base-paired) stem and a loop, formed when the nucleic acid comprises two portions that are sufficiently complementary to each other to form a plurality of consecutive base pairs.
[0144] As used herein, the term FRET refers to fluorescence resonance energy transfer, a process in which moieties (e.g., fluorophores) transfer energy e.g., among themselves, or, from a fluorophore to a non-fluorophore (e.g., a quencher molecule). In some circumstances, FRET involves an excited donor fluorophore transferring energy to a lower-energy acceptor fluorophore via a short-range (e.g., about 10 nm or less) dipole-dipole interaction. In other circumstances, FRET involves a loss of fluorescence energy from a donor and an increase in fluorescence in an acceptor fluorophore. In still other forms of FRET, energy can be exchanged from an excited donor flurophore to a non-fluorescing molecule (e.g., a quenching molecule). FRET is known to those of skill in the art and has been described (See, e.g., Stryer et al., 1978, Ann. Rev. Biochem., 47:819; Selvin, 1995, Methods Enzymol., 246:300; Orpana, 2004 Biomol Eng 21, 45-50; Olivier, 2005 Mutant Res 573, 103-110, each of which is incorporated herein by reference in its entirety).
[0145] As used herein, the term FEN-1 in reference to an enzyme refers to a non-polymerase flap endonuclease from a eukaryote or archaeal organism, as encoded by a FEN-1 gene. See, e.g., WO 02/070755, and Kaiser M. W., et al. (1999) J. Biol. Chem., 274:21387, which are incorporated by reference herein in their entireties for all purposes.
[0146] As used herein, the term FEN-1 activity refers to any enzymatic activity of a FEN-1 enzyme.
[0147] As used herein, the term primer annealing refers to conditions that permit oligonucleotide primers to hybridize to template nucleic acid strands. Conditions for primer annealing vary with the length and sequence of the primer and are generally based upon the T.sub.m that is determined or calculated for the primer. For example, an annealing step in an amplification method that involves thermocycling involves reducing the temperature after a heat denaturation step to a temperature based on the T.sub.m of the primer sequence, for a time sufficient to permit such annealing.
[0148] As used herein, the term amplifiable nucleic acid is used in reference to nucleic acids that may be amplified by any amplification method. It is contemplated that amplifiable nucleic acid will usually comprise sample template.
[0149] The term real time as used herein in reference to detection of nucleic acid amplification or signal amplification refers to the detection or measurement of the accumulation of products or signal in the reaction while the reaction is in progress, e.g., during incubation or thermal cycling. Such detection or measurement may occur continuously, or it may occur at a plurality of discrete points during the progress of the amplification reaction, or it may be a combination. For example, in a polymerase chain reaction, detection (e.g., of fluorescence) may occur continuously during all or part of thermal cycling, or it may occur transiently, at one or more points during one or more cycles. In some embodiments, real time detection of PCR is accomplished by determining a level of fluorescence at the same point (e.g., a time point in the cycle, or temperature step in the cycle) in each of a plurality of cycles, or in every cycle. Real time detection of amplification may also be referred to as detection during the amplification reaction.
[0150] As used herein, the term abundance of nucleic acid refers to the amount of a particular target nucleic acid sequence present in a sample or aliquot. The amount is generally referred to in terms of mass (e.g., g), mass per unit of volume (e.g., g/L); copy number (e.g., 1000 copies, 1 attomole), or copy number per unit of volume (e.g., 1000 copies per mL, 1 attomole per L). Abundance of a nucleic acid can also be expressed as an amount relative to the amount of a standard of known concentration or copy number. Measurement of abundance of a nucleic acid may be on any basis understood by those of skill in the art as being a suitable quantitative representation of nucleic acid abundance, including physical density or the sample, optical density, refractive property, staining properties, or on the basis of the intensity of a detectable label, e.g. a fluorescent label.
[0151] The term amplicon or amplified product refers to a segment of nucleic acid, generally DNA, generated by an amplification process such as the PCR process. The terms are also used in reference to RNA segments produced by amplification methods that employ RNA polymerases, such as NASBA, TMA, etc.
[0152] The term amplification plot as used in reference to a thermal cycling amplification reaction refers to the plot of signal that is indicative of amplification, e.g., fluorescence signal, versus cycle number. When used in reference to a non-thermal cycling amplification method, an amplification plot generally refers to a plot of the accumulation of signal as a function of time.
[0153] The term baseline as used in reference to an amplification plot refers to the detected signal coming from assembled amplification reactions prior to incubation or, in the case of PCR, in the initial cycles, in which there is little change in signal.
[0154] The term C.sub.t or threshold cycle as used herein in reference to real time detection during an amplification reaction that is thermal cycled refers to the fractional cycle number at which the detected signal (e.g., fluorescence) passes the fixed threshold.
[0155] The term no template control and no target control (or NTC) as used herein in reference to a control reaction refers to a reaction or sample that does not contain template or target nucleic acid. It is used to verify amplification quality.
[0156] As used herein, the term sample template refers to nucleic acid originating from a sample that is analyzed for the presence of target. In contrast, background template is used in reference to nucleic acid other than sample template that may or may not be present in a sample. The presence of background template is most often inadvertent. It may be the result of carryover, or it may be due to the presence of nucleic acid contaminants sought to be purified away from the sample. For example, nucleic acids from organisms other than those to be detected may be present as background in a test sample.
[0157] A sample suspected of containing a nucleic acid may contain or not contain the target nucleic acid molecule.
[0158] As used herein, the term sample is used in its broadest sense. For example, in some embodiments, it is meant to include a specimen or culture (e.g., microbiological culture), whereas in other embodiments, it is meant to include both biological and environmental samples (e.g., suspected of comprising a target sequence, gene or template). In some embodiments, a sample may include a specimen of synthetic origin. Samples may be unpurifed or may be partially or completely purified or otherwise processed.
[0159] The present technology is not limited by the type of biological sample used or analyzed. The present technology is useful with a variety of biological samples including, but not limited to, tissue (e.g., organ (e.g., heart, liver, brain, lung, stomach, intestine, spleen, kidney, pancreas, and reproductive organs), glandular, skin, and muscle), cell (e.g., blood cell (e.g., lymphocyte or erythrocyte), muscle cell, tumor cell, and skin cell), gas, bodily fluid (e.g., blood or portion thereof, serum, plasma, urine, semen, saliva, etc.), or solid (e.g., stool) samples obtained from a human (e.g., adult, infant, or embryo) or animal (e.g., cattle, poultry, mouse, rat, dog, pig, cat, horse, and the like). In some embodiments, biological samples may be solid food and/or feed products and/or ingredients such as dairy items, vegetables, meat and meat by-products, and waste. Biological samples may be obtained from all of the various families of domestic animals, as well as feral or wild animals, including, but not limited to, such animals as ungulates, bear, fish, lagomorphs, rodents, pinnipeds, etc.
[0160] Biological samples also include biopsies and tissue sections (e.g., biopsy or section of tumor, growth, rash, infection, or paraffin-embedded sections), medical or hospital samples (e.g., including, but not limited to, blood samples, saliva, buccal swab, cerebrospinal fluid, pleural fluid, milk, colostrum, lymph, sputum, vomitus, bile, semen, oocytes, cervical cells, amniotic fluid, urine, stool, hair, and sweat), laboratory samples (e.g., subcellular fractions), and forensic samples (e.g., blood or tissue (e.g., spatter or residue), hair and skin cells containing nucleic acids), and archeological samples (e.g., fossilized organisms, tissue, or cells).
[0161] Environmental samples include, but are not limited to, environmental material such as surface matter, soil, water (e.g., freshwater or seawater), algae, lichens, geological samples, air containing materials containing nucleic acids, crystals, and industrial samples, as well as samples obtained from food and dairy processing instruments, apparatus, equipment, utensils, disposable and non-disposable items.
[0162] Samples may be prepared by any desired or suitable method. In some embodiments, nucleic acids are analyzed directly from bodily fluids, stool, or other samples using the methods described in U.S. Pat. No. 9,000,146, which is herein incorporated by reference in its entirety for all purposes.
[0163] The above described examples are not, however, to be construed as limiting the sample (e.g., suspected of comprising a target sequence, gene or template (e.g., the presence or absence of which can be determined using the compositions and methods of the present technology)) types applicable to the present technology.
[0164] The terms nucleic acid sequence and nucleic acid molecule as used herein refer to an oligonucleotide, nucleotide or polynucleotide, and fragments or portions thereof. The terms encompass sequences that include analogs of DNA and RNA nucleotides, including those listed above, and also including, but not limited to, 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxyl-methyl)uracil, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethyl-aminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudo-uracil, 1-methylguanine, 1-methylinosine, 2,2-dimethyl-guanine, 2-methyladenine, 2-methylguanine, 3-methyl-cytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxy-amino-methyl-2-thiouracil, beta-D-mannosylqueosine, 5-methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, oxybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, N-uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, pseudouracil, queosine, 2-thiocytosine, 2,6-diaminopurine, and pyrazolo[3,4-d]pyrimidines such as guanine analogue 6 amino 1H-pyrazolo[3,4d]pyrimidin 4(5H) one (ppG or PPG, also Super G) and the adenine analogue 4 amino 1H-pyrazolo[3,4d]pyrimidine (ppA or PPA). The xanthine analogue 1H-pyrazolo[5,4d]pyrimidin 4(5H)-6(7H)-dione (ppX) can also be used. These base analogues, when present in an oligonucleotide, strengthen hybridization and improve mismatch discrimination. All tautomeric forms of naturally-occurring bases, modified bases and base analogues may be included in the oligonucleotide conjugates of the technology. Other modified bases useful in the present technology include 6-amino-3-prop-1-ynyl-5-hydropyrazolo[3,4-d]pyrimidine-4-one, PPPG; 6-amino-3-(3-hydroxyprop-1-yny)l-5-hydropyrazolo[3,4-d]pyrimidine-4-one, HOPPPG; 6-amino-3-(3-aminoprop-1-ynyl)-5-hydropyrazolo[3,4-d]pyrimidine-4-one, NH2PPPG; 4-amino-3-(prop-1-ynyl)pyrazolo[3,4-d]pyrimidine, PPPA; 4-amino-3-(3-hydroxyprop-1-ynyl)pyrazolo[3,4-d]pyrimidine, HOPPPA; 4-amino-3-(3-aminoprop-1-ynyl)pyrazolo[3,4-d]pyrimidine, NH2 PPPA; 3-prop-1-ynylpyrazolo[3,4-d]pyrimidine-4,6-diamino, (NH.sub.2).sub.2 PPPA; 2-(4,6-diaminopyrazolo[3,4-d]pyrimidin-3-yl)ethyn-1-ol, (NH.sub.2).sub.2 PPPAOH; 3-(2-aminoethynyl)pyrazolo[3,4-d]pyrimidine-4,6-diamine, (NH.sub.2).sub.2 PPPANH2; 5-prop-1-ynyl-1,3-dihydropyrimidine-2,4-dione, PU; 5-(3-hydroxyprop-1-ynyl)-1,3-dihydropyrimidine-2,4-dione, HOPU; 6-amino-5-prop-1-ynyl-3-dihydropyrimidine-2-one, PC; 6-amino-5-(3-hydroxyprop-1-yny)-1,3-dihydropyrimidine-2-one, HOPC; and 6-amino-5-(3-aminoprop-1-yny)-1,3-dihydropyrimidine-2-one, NH.sub.2PC; 5-[4-amino-3-(3-methoxyprop-1-ynyl)pyrazol[3,4-d]pyrimidinyl]-2-(hydroxymethyl)oxolan-3-ol, CH.sub.3 OPPPA; 6-amino-1-[4-hydroxy-5-(hydroxymethyl)oxolan-2-yl]-3-(3-methoxyprop-1-ynyl)-5-hydropyrazolo[3,4-d]pyrimidin-4-one, CH.sub.3 OPPPG; 4, (4,6-Diamino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)-but-3-yn-1-ol, Super A; 6-Amino-3-(4-hydroxy-but-1-ynyl)-1,5-dihydro-pyrazolo[3,4-d]pyrimidin-4-one; 5-(4-hydroxy-but-1-ynyl)-1H-pyrimidine-2,4-dione, Super T; 3-iodo-1H-pyrazolo[3,4-d]pyrimidine-4,6-diamine ((NH.sub.2).sub.2PPAI); 3-bromo-1H-pyrazolo[3,4-d]pyrimidine-4,6-diamine ((NH.sub.2).sub.2PPABr); 3-chloro-1H-pyrazolo[3,4-d]pyrimidine-4,6-diamine ((NH.sub.2).sub.2PPACl); 3-Iodo-1H-pyrazolo[3,4-d]pyrimidin-4-ylamine (PPAI); 3-Bromo-1H-pyrazolo[3,4-d]pyrimidin-4-ylamine (PPABr); and 3-chloro-1H-pyrazolo[3,4-d]pyrimidin-4-ylamine (PPACl).
[0165] A nucleic acid sequence or molecule may be DNA or RNA, of either genomic or synthetic origin, that may be single or double stranded, and represent the sense or antisense strand. Thus, nucleic acid sequence may be dsDNA, ssDNA, mixed ssDNA, mixed dsDNA, dsDNA made into ssDNA (e.g., through melting, denaturing, helicases, etc.), A-, B-, or Z-DNA, triple-stranded DNA, RNA, ssRNA, dsRNA, mixed ss and dsRNA, dsRNA made into ssRNA (e.g., via melting, denaturing, helicases, etc.), messenger RNA (mRNA), ribosomal RNA (rRNA), transfer RNA (tRNA), catalytic RNA, snRNA, microRNA, or protein nucleic acid (PNA).
[0166] The present technology is not limited by the type or source of nucleic acid (e.g., sequence or molecule (e.g. target sequence and/or oligonucleotide)) utilized. For example, the nucleic acid sequence may be amplified or created sequence (e.g., amplification or creation of nucleic acid sequence via synthesis (e.g., polymerization (e.g., primer extension (e.g., RNA-DNA hybrid primer technology)) and reverse transcription (e.g., of RNA into DNA)) and/or amplification (e.g., polymerase chain reaction (PCR), rolling circle amplification (RCA), nucleic acid sequence based amplification (NASBA), transcription mediated amplification (TMA), ligase chain reaction (LCR), cycling probe technology, Q-beta replicase, strand displacement amplification (SDA), branched-DNA signal amplification (bDNA), hybrid capture, and helicase dependent amplification).
[0167] The terms nucleotide and base are used interchangeably when used in reference to a nucleic acid sequence, unless indicated otherwise herein. A nucleobase is a heterocyclic base such as adenine, guanine, cytosine, thymine, uracil, inosine, xanthine, hypoxanthine, or a heterocyclic derivative, analog, or tautomer thereof. A nucleobase can be naturally occurring or synthetic. Non-limiting examples of nucleobases are adenine, guanine, thymine, cytosine, uracil, xanthine, hypoxanthine, 8-azapurine, purines substituted at the 8 position with methyl or bromine, 9-oxo-N6-methyladenine, 2-aminoadenine, 7-deazaxanthine, 7-deazaguanine, 7-deaza-adenine, N4-ethanocytosine, 2,6-diaminopurine, N6-ethano-2,6-diaminopurine, 5-methylcytosine, 5-(C3-C6)-alkynylcytosine, 5-fluorouracil, 5-bromouracil, thiouracil, pseudoisocytosine, 2-hydroxy-5-methyl-4-triazolopyridine, isocytosine, isoguanine, inosine, 7,8-dimethylalloxazine, 6-dihydrothymine, 5,6-dihydrouracil, 4-methyl-indole, ethenoadenine and the non-naturally occurring nucleobases described in U.S. Pat. Nos. 5,432,272 and 6,150,510 and PCT applications WO 92/002258, WO 93/10820, WO 94/22892, and WO 94/24144, and Fasman (Practical Handbook of Biochemistry and Molecular Biology, pp. 385-394, 1989, CRC Press, Boca Raton, La.), all herein incorporated by reference in their entireties.
[0168] The term oligonucleotide as used herein is defined as a molecule comprising two or more nucleotides (e.g., deoxyribonucleotides or ribonucleotides), preferably at least 5 nucleotides, more preferably at least about 10-15 nucleotides and more preferably at least about 15 to 30 nucleotides, or longer (e.g., oligonucleotides are typically less than 200 residues long (e.g., between 15 and 100 nucleotides), however, as used herein, the term is also intended to encompass longer polynucleotide chains). The exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. Oligonucleotides are often referred to by their length. For example a 24 residue oligonucleotide is referred to as a 24-mer. Oligonucleotides can form secondary and tertiary structures by self-hybridizing or by hybridizing to other polynucleotides. Such structures can include, but are not limited to, duplexes, hairpins, cruciforms, bends, and triplexes. Oligonucleotides may be generated in any manner, including chemical synthesis, DNA replication, reverse transcription, PCR, or a combination thereof. In some embodiments, oligonucleotides that form invasive cleavage structures are generated in a reaction (e.g., by extension of a primer in an enzymatic extension reaction).
[0169] Because mononucleotides are reacted to make oligonucleotides in a manner such that the 5 phosphate of one mononucleotide pentose ring is attached to the 3 oxygen of its neighbor in one direction via a phosphodiester linkage, an end of an oligonucleotide is referred to as the 5 end if its 5 phosphate is not linked to the 3 oxygen of a mononucleotide pentose ring and as the 3 end if its 3 oxygen is not linked to a 5 phosphate of a subsequent mononucleotide pentose ring. As used herein, a nucleic acid sequence, even if internal to a larger oligonucleotide, also may be said to have 5 and 3 ends. A first region along a nucleic acid strand is said to be upstream of another region if the 3 end of the first region is before the 5 end of the second region when moving along a strand of nucleic acid in a 5 to 3 direction.
[0170] As used herein, the terms complementary or complementarity are used in reference to polynucleotides (e.g., a sequence of two or more nucleotides (e.g., an oligonucleotide or a target nucleic acid)) related by the base-pairing rules. For example, the sequence 5-A-G-T-3, is complementary to the sequence 3-T-C-A-5. Complementarity may be partial, in which only some of the nucleic acid bases are matched according to the base pairing rules. Or, there may be complete or total complementarity between the nucleic acid bases. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods that depend upon the association of two or more nucleic acid strands. Either term may also be used in reference to individual nucleotides, especially within the context of polynucleotides. For example, a particular nucleotide within an oligonucleotide may be noted for its complementarity, or lack thereof, to a nucleotide within another nucleic acid sequence (e.g., a target sequence), in contrast or comparison to the complementarity between the rest of the oligonucleotide and the nucleic acid sequence.
[0171] The complement of a nucleic acid sequence as used herein refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5 end of one sequence is paired with the 3 end of the other, is in antiparallel association. Nucleotide analogs, as discussed above, may be included in the nucleic acids of the present technology and include. Complementarity need not be perfect; stable duplexes may contain mismatched base pairs or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the oligonucleotide, ionic strength and incidence of mismatched base pairs.
[0172] As used herein, the term label refers to any moiety (e.g., chemical species) that can be detected or can lead to a detectable response. In some preferred embodiments, detection of a label provides quantifiable information. Labels can be any known detectable moiety, such as, for example, a radioactive label (e.g., radionuclides), a ligand (e.g., biotin or avidin), a chromophore (e.g., a dye or particle that imparts a detectable color), a hapten (e.g., digoxygenin), a mass label, latex beads, metal particles, a paramagnetic label, a luminescent compound (e.g., bioluminescent, phosphorescent or chemiluminescent labels) or a fluorescent compound.
[0173] A label may be joined, directly or indirectly, to an oligonucleotide or other biological molecule. Direct labeling can occur through bonds or interactions that link the label to the oligonucleotide, including covalent bonds or non-covalent interactions such as hydrogen bonding, hydrophobic and ionic interactions, or through formation of chelates or coordination complexes. Indirect labeling can occur through use of a bridging moiety or linker, such as an antibody or additional oligonucleotide(s), which is/are either directly or indirectly labeled.
[0174] Labels can be used alone or in combination with moieties that can suppress (e.g., quench), excite, or transfer (e.g., shift) emission spectra (e.g., fluorescence resonance energy transfer (FRET)) of a label (e.g., a luminescent label).
[0175] A polymerase is an enzyme generally for joining 3-OH 5-triphosphate nucleotides, oligomers, and their analogs. Polymerases include, but are not limited to, template-dependent DNA-dependent DNA polymerases, DNA-dependent RNA polymerases, RNA-dependent DNA polymerases, and RNA-dependent RNA polymerases. Polymerases include but are not limited to T7 DNA polymerase, T3 DNA polymerase, T4 DNA polymerase, T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, DNA polymerase 1, Klenow fragment, Thermophilus aquaticus DNA polymerase, Tth DNA polymerase, Vent DNA polymerase (New England Biolabs), Deep Vent DNA polymerase (New England Biolabs), Bst DNA Polymerase Large Fragment, Stoeffel Fragment, 9 N DNA Polymerase, Pfu DNA Polymerase, Tfl DNA Polymerase, RepliPHI Phi29 Polymerase, Tli DNA polymerase, eukaryotic DNA polymerase beta, telomerase, Therminator polymerase (New England Biolabs), KOD HiFi DNA polymerase (Novagen), KOD1 DNA polymerase, Q-beta replicase, terminal transferase, AMV reverse transcriptase, M-MLV reverse transcriptase, Phi6 reverse transcriptase, HIV-1 reverse transcriptase, novel polymerases discovered by bioprospecting, and polymerases cited in US 2007/0048748, U.S. Pat. Nos. 6,329,178; 6,602,695; and U.S. Pat. No. 6,395,524 (incorporated by reference). These polymerases include wild-type, mutant isoforms, and genetically engineered variants.
[0176] A DNA polymerase is a polymerase that produces DNA from deoxynucleotide monomers (dNTPs). Eubacterial DNA polymerase as used herein refers to the Pol A type DNA polymerases (repair polymerases) from Eubacteria, including but not limited to DNA Polymerase I from E. coli, Taq DNA polymerase from Thermus aquaticus and DNA Pol I enzymes from other members of genus Thermus, and other eubacterial species etc.
[0177] As used herein, the term target refers to a nucleic acid species or nucleic acid sequence or structure to be detected or characterized.
[0178] Accordingly, as used herein, non-target, e.g., as it is used to describe a nucleic acid such as a DNA, refers to nucleic acid that may be present in a reaction, but that is not the subject of detection or characterization by the reaction. In some embodiments, non-target nucleic acid may refer to nucleic acid present in a sample that does not, e.g., contain a target sequence, while in some embodiments, non-target may refer to exogenous nucleic acid, i.e., nucleic acid that does not originate from a sample containing or suspected of containing a target nucleic acid, and that is added to a reaction, e.g., to normalize the activity of an enzyme (e.g., polymerase) to reduce variability in the performance of the enzyme in the reaction.
[0179] As used herein, the term amplification reagents refers to those reagents (deoxyribonucleoside triphosphates, buffer, etc.), needed for amplification except for primers, nucleic acid template, and the amplification enzyme. Typically, amplification reagents along with other reaction components are placed and contained in a reaction vessel.
[0180] As used herein, the term control when used in reference to nucleic acid detection or analysis refers to a nucleic acid having known features (e.g., known sequence, known copy-number per cell), for use in comparison to an experimental target (e.g., a nucleic acid of unknown concentration). A control may be an endogenous, preferably invariant gene against which a test or target nucleic acid in an assay can be normalized. Such normalizing controls for sample-to-sample variations that may occur in, for example, sample processing, assay efficiency, etc., and allows accurate sample-to-sample data comparison. Genes that find use for normalizing nucleic acid detection assays on human samples include, e.g., -actin, ZDHHC1, and B3GALT6 (see, e.g., U.S. Pat. Appln. Ser. Nos 14/966,617 and 62/364,082, each incorporated herein by reference.
[0181] Controls may also be external. For example, in quantitative assays such as qPCR, QuARTS, etc., a calibrator or calibration control is a nucleic acid of known sequence, e.g., having the same sequence as a portion of an experimental target nucleic acid, and a known concentration or series of concentrations (e.g., a serially diluted control target for generation of calibration curved in quantitative PCR). Typically, calibration controls are analyzed using the same reagents and reaction conditions as are used on an experimental DNA. In certain embodiments, the measurement of the calibrators is done at the same time, e.g., in the same thermal cycler, as the experimental assay. In preferred embodiments, multiple calibrators may be included in a single plasmid, such that the different calibrator sequences are easily provided in equimolar amounts. In particularly preferred embodiments, plasmid calibrators are digested, e.g., with one or more restriction enzymes, to release calibrator portion from the plasmid vector. See, e.g., WO 2015/066695, which is included herein by reference.
[0182] As used herein ZDHHC1 refers to a gene encoding a protein characterized as a zinc finger, DHHC-type containing 1, located in human DNA on Chr 16 (16q22.1) and belonging to the DHHC palmitoyltransferase family.
[0183] As used herein, the term process control refers to an exogenous molecule, e.g., an exogenous nucleic acid added to a sample prior to extraction of target DNA that can be measured post-extraction to assess the efficiency of the process and be able to determine success or failure modes. The nature of the process control nucleic acid used is usually dependent on the assay type and the material that is being measured. For example, if the assay being used is for detection and/or quantification of double stranded DNA or mutations in it, then double stranded DNA process controls are typically spiked into the samples pre-extraction. Similarly, for assays that monitor mRNA or microRNAs, the process controls used are typically either RNA transcripts or synthetic RNA. See, e.g., U.S. Pat. Appl. Ser. No. 62/364,049, filed Jul. 19, 2016, which is incorporated herein by reference, and which describes use of zebrafish DNA as a process control for human samples.
[0184] As used herein, the term zebrafish DNA is distinct from bulk fish DNA) e.g., purified salmon DNA) and refers to DNA isolated from Danio rerio, or created in vitro (e.g., enzymatically, synthetically) to have a sequence of nucleotides found in DNA from Danio rerio. In preferred embodiments, the zebrafish DNA is a methylated DNA added as a detectable control DNA, e.g., a process control for verifying DNA recovery through sample processing steps. In particular, zebrafish DNA comprising at least a portion of the RASSF1 gene finds use as a process control, e.g., for human samples, as described in U.S. Pat. Appl. Ser. No. 62/364,049.
[0185] As used herein the term fish DNA is distinct from zebrafish DNA and refers to bulk (e.g., genomic) DNA isolated from fish, e.g., as described in U.S. Pat. No. 9,212,392. Bulk purified fish DNA is commercially available, e.g., provided in the form of cod and/or herring sperm DNA (Roche Applied Science, Mannheim, Germany) or salmon DNA (USB/Affymetrix).
[0186] As used herein, the terms particle and beads are used interchangeable, and the terms magnetic particles and magnetic beads are used interchangeably and refer to particles or beads that respond to a magnetic field. Typically, magnetic particles comprise materials that have no magnetic field but that form a magnetic dipole when exposed to a magnetic field, e.g., materials capable of being magnetized in the presence of a magnetic field but that are not themselves magnetic in the absence of such a field. The term magnetic as used in this context includes materials that are paramagnetic or superparamagnetic materials. The term magnetic, as used herein, also encompasses temporarily magnetic materials, such as ferromagnetic or ferrimagnetic materials with low Curie temperatures, provided that such temporarily magnetic materials are paramagnetic in the temperature range at which silica magnetic particles containing such materials are used according to the present methods to isolate biological materials.
[0187] As used herein, the term kit refers to any delivery system for delivering materials. In the context of nucleic acid purification systems and reaction assays, such delivery systems include systems that allow for the storage, transport, or delivery of reagents and devices (e.g., chaotropic salts, particles, buffers, denaturants, oligonucleotides, filters etc. in the appropriate containers) and/or supporting materials (e.g., sample processing or sample storage vessels, written instructions for performing a procedure, etc.) from one location to another. For example, kits include one or more enclosures (e.g., boxes) containing the relevant reaction reagents and/or supporting materials. As used herein, the term fragmented kit refers to a delivery system comprising two or more separate containers that each contains a subportion of the total kit components. The containers may be delivered to the intended recipient together or separately. For example, a first container may contain an materials for sample collection and a buffer, while a second container contains capture oligonucleotides and denaturant. The term fragmented kit is intended to encompass kits containing Analyte specific reagents (ASR's) regulated under section 520(e) of the Federal Food, Drug, and Cosmetic Act, but are not limited thereto. Indeed, any delivery system comprising two or more separate containers that each contains a subportion of the total kit components are included in the term fragmented kit. In contrast, a combined kit refers to a delivery system containing all of the components of a reaction assay in a single container (e.g., in a single box housing each of the desired components). The term kit includes both fragmented and combined kits.
[0188] The term system as used herein refers to a collection of articles for use for a particular purpose. In some embodiments, the articles comprise instructions for use, as information supplied on e.g., an article, on paper, on recordable media (e.g., diskette, CD, flash drive, etc.). In some embodiments, instructions direct a user to an online location, e.g., a website for viewing, hearing, and/or downloading instructions. In some embodiments, instructions or other information are provided as an application (app) for a mobile device.
DETAILED DESCRIPTION OF THE INVENTION
[0189] Provided herein is technology relating to the amplification-based detection of nucleic acids and particularly, but not exclusively, to methods for enriching low-DNA, bisulfite-converted samples for analysis.
[0190] Biological samples of interest may have vastly different amounts of DNA in them, and even if rich in bulk DNA, may have very low amounts of DNAs of interest, e.g., non-normal DNAs within a background of normal DNA, or human DNA in a background of microbial DNA (or vice versa). To compensate for a low concentration of target DNA, a large sample may sometimes be processed to collect sufficient DNA for a particular assay. However, when it is desirable to subject a sample with a low concentration of target DNA to a number of different assays in parallel, the necessary sample size may become prohibitively large. For example, circulating free DNA in plasma of a subject is typically very low, as it is continuously cleared from the bloodstream, mainly by the liver, and has a half-life of only 10 to 15 minutes. The typical levels of circulating DNA are thus very low, e.g., for healthy individuals, a particular segment of DNA, e.g., from a gene of interest, may be present at about 1,500-2000 copies/mL, while a segment of DNA associated with a tumor may be present at about 5000 copies/mL in a subject with a late stage cancer. Further, tumor-derived cfDNA in plasma is typically fragmented into short strands, e.g., of 200 or fewer base pairs (see, e.g., P. Jiang, et al., Proc. Natl Acad Sci. 112(11): E1317-E1325 (2015), incorporated herein by reference in its entirety). Such small DNAs are especially hard to purify because they can be lost during typical purification steps, e.g., through inefficiencies in precipitation and/or DNA binding purification steps.
[0191] Recovery of the DNA from such blood fraction samples may capture 75%, but often much less is recovered. Thus, depending on the sensitivity of the particular assay for these targets, analysis of multiple DNA markers from plasma can require large amounts of plasma from a subject. Enrichment by targeted pre-amplification of specific target regions can increase the number of markers that can be analyzed using the same starting sample, i.e., without the need to collect correspondingly larger samples (e.g., plasma or blood) from the subject.
[0192] Provided herein are embodiments of technologies for extraction of DNA, e.g., cell-free circulating DNA, from plasma samples. In preferred embodiments, the methods provided herein do not comprise organic extraction (e.g., phenol-chloroform extraction), alcohol precipitation, or use of columns, making the methods readily scalable and automatable. In particularly preferred embodiments, essentially the entire isolation procedurefrom plasma sample to bead-bound purified DNA ready for elution- is performed at room temperature.
[0193] Provided herein are embodiments of technologies for multiplexed pre-amplification particularly suited for analysis of target DNAs that are in low abundance and/or that are fragmented in the samples in which they are found, and that have been treated with bisulfite reagent, e.g., as described in Leontiou, et al., PLoS ONE 10(8): e0135058. doi:10.1371/journal.pone.0135058 (2015). In certain preferred embodiments, the bisulfite treatment comprises use of ammonium hydrogen sulfite, with desulfonation preferably performed on support-bound DNA, as described in U.S. Pat. No. 9,315,853.
Embodiments of the Technology
[0194] 1. Isolation of Circulating Cell-Free DNA from Plasma
[0195] Provided herein is technology related to isolation of fragmented DNA from samples, e.g., blood or plasma samples. In particular, provided herein is technology related to extraction of low-copy, small DNAs, e.g., less than about 200 base pairs in length, from plasma samples, using mixable particles, e.g., silica particles, to bind DNA. Methods are provided herein using two different lysis reagents, added at different times during the lysis treatment of the plasma sample, and using a combination of two different wash buffers in the processing of DNA bound to the particles. In preferred embodiments, the technology provided herein comprises addition of a bulk exogenous non-target DNA, e.g., bulk fish DNA, to the DNA to be isolated for further analysis, preferably added to the plasma prior to or at the first particle-binding step.
[0196] 2. Pre-Amplification of Target Regions for PCR-Flap Assay Analysis
[0197] Provided herein is technology related to providing an increased amount of DNA for analysis in a PCR-flap assay, e.g., a QuARTS assay as diagramed in
[0198] Re-amplifying DNA segments previously amplified in a targeted manner, e.g., amplification of an aliquot or dilution of the amplicon product of a target-specific PCR, is known to be prone to undesirable artifacts, e.g., high background of undesired DNA products. Thus, analysis of target nucleic acids using sequential rounds of specific PCR is typically conducted under special conditions, e.g., using different primers pairs in the sequential reactions. For example, in nested PCR the first round of amplification is conducted to produce a first amplicon, and the second round of amplification is conducted using a primer pair in which one or both of the primers anneal to sites inside the regions defined by the initial primer pair, i.e., the second primer pair is considered to be nested within the first primer pair. In this way, background amplification products from the first PCR that do not contain the correct inner sequence are not further amplified in the second reaction. Other strategies to reduce undesirable effects include using very low concentrations of primers in the first amplification.
[0199] Multiplex amplification of a plurality of different specific target sequences is typically conducted using relatively standard PCR reagent mixtures, e.g., for Amplitaq DNA polymerase, mixtures comprising 50 mM KCl, 1.5 to 2.5 mM MgCl.sub.2, and Tris-HCl buffer at about pH 8.5 are used. As discussed above, if a second amplification is to be performed, the primers are typically present in limited amounts (Andersson, supra). For a subsequent assay, the amplified DNA is diluted or purified, and a small aliquot is then added to a detection assay, e.g., a PCR-flap assay, which uses different buffer and salt conditions than standard PCR (e.g., a buffer comprising MOPS, Tris-HCl pH 8.0, and 7.5 mM MgCl.sub.2, and little or no added KCl or other monovalent salt, conditions typically considered unfavorable for PCR due to the low monovalent salt and the relatively high concentration of Mg.sup.++ (see, e.g., Guidelines for PCR Optimization with Taq DNA Polymerase https://www.neb.com/tools-and-resources/usage-guidelines/guidelines-for-per-optimization-with-taq-dna-polymerase, which discloses 1.5 mM to 2.0 mM as the optimal Mg range for Taq DNA polymerase, with optimization to be conducted by supplementing the magnesium concentration in 0.5 increments up to 4 mM. See also Multiplex PCR: Critical Parameters and Step-by-Step Protocol O. Henegariu, et al., BioTechniques 23:504-511 (September 1997). A change in reaction conditions between a first amplification and a second amplification (or other detection assay) is often effected by either purifying the DNA from the first amplification reaction or by using sufficient dilution such that the amounts of reaction components carried into the follow-on reaction is negligible.
[0200] Embodiments of the present technology are directed to combining bisulfite modification, multiplex PCR amplification, and PCR-flap assay detection for the detection of low-copy number DNAs. During development of embodiments of the technology provided herein, it was discovered that use of a PCR-flap assay buffer with very low KCl and comprising elevated Mg.sup.++ (e.g., >6 mM, preferably >7 mM, more preferably 7.5 mM), for both the multiplex pre-amplification in the absence of the flap assay reagents (e.g., in the absence of the hairpin oligonucleotide and FEN-1 endonuclease) and for the following PCR-flap assay produced substantially better signal. Further, it was unexpectedly determined that using the same primer pair to amplify a target region in both the pre-amplification and in the subsequent PCR-flap assay reaction produced better results than using a nested arrangement of primers. Use of the PCR-flap assay primers pairs in the initial amplification and in the PCR-flap assay has the advantage of producing signal from very small fragments of target DNA, such as would be expected in remote DNA samples. For example, amplicons of about 50 to 85 base pairs are produced and detected in examples hereinbelow).
[0201] In some embodiments, the one or both of the pre-amplification and the PCR-flap assay comprise exogenous, non-target DNA in the reaction mixture, as described, e.g., in U.S. patent application Ser. No. 14/036,649, filed Sep. 25, 2013, which is incorporated herein by reference in its entirety. In certain preferred embodiments, the exogenous non-target DNA comprises fish DNA. While not limiting the invention to any particular mechanism of action, it has been observed that the presence of hairpin oligonucleotides (e.g., hairpin FRET cassettes as used, for example, in some embodiments of invasive cleavage detection assays) may have an inhibiting effect on DNA polymerase present in the same vessel, as assessed by sample and signal amplification. See, e.g., U.S. Patent Publication 2006/0147955 to Allawi, which is incorporated herein by reference for all purposes. Allawi et al. observed that when PCR and invasive cleavage assay components were combined, the hairpin FRET oligonucleotides affected polymerase performance, and the use of purified exogenous non-target DNA, especially genomic DNA, improves the consistency of signal produced in such assays. Thus, in preferred embodiments, purified exogenous non-target DNA is added to samples before and/or while contacting the samples with an enzyme such as a polymerase. The non-target DNA is typically added to the sample or reaction mixture, for example, at a concentration of approximately 2 to 20 ng per l of reaction mixture, preferably approximately 6 to approximately 7 ng per l of reaction mixture, when approximately 0.01 to 1.0 U/L of enzyme, e.g., 0.05 U/L of enzyme (e.g., a polymerase such as, e.g., Taq polymerase) is used in the assay.
[0202] Embodiments of the multiplex pre-amplification as disclosed herein find use with PCR-flap assays such as the QuARTS assay. As diagrammed in
[0203] In some configurations, each assay is designed to detect multiple genes, e.g., 3 genes reporting to 3 distinct fluorescent dyes. See, e.g., Zou, et al., (2012) Quantification of Methylated Markers with a Multiplex Methylation-Specific Technology, Clinical Chemistry 58: 2, incorporated herein by reference for all purposes.
[0204] These embodiments are further understood by the illustrative examples provided below.
EXPERIMENTAL EXAMPLES
Example 1
DNA Isolation from Cells and Plasma and Bisulfite Conversion
DNA Isolation
[0205] For cell lines, genomic DNA was isolated from cell-conditioned media using the Maxwell RSC ccfDNA Plasma Kit (Promega Corp., Madison, Wis.). Following the kit protocol, 1 mL of cell-conditioned media (CCM) is used in place of plasma, and processed according to the kit procedure. The elution volume is 100 L, of which 70 L are used for bisulfite conversion.
[0206] An exemplary procedure for isolating DNA from a 4 mL sample of plasma would be conducted as follows: [0207] To a 4 mL sample of plasma, 300 L of proteinase K (20 mg/mL) is added and mixed. [0208] Add 3 L of 1 g/L of Fish DNA to the plasma-proteinase K mixture. [0209] Add 2 mL of plasma lysis buffer to plasma. [0210] Plasma lysis buffer is: [0211] 4.3M guanidine thiocyanate [0212] 10% IGEPAL CA-630 (Octylphenoxy poly(ethyleneoxy)ethanol, branched) (5.3 g of IGEPAL CA-630 combined with 45 mL of 4.8 M guanidine thiocyanate) [0213] Incubate mixtures at 55 C. for 1 hour with shaking at 500 rpm. [0214] Add 3 mL of plasma lysis buffer and mix. [0215] Add 200 L magnetic silica binding beads [16 g of beads/L] and mix again. [0216] Add 2 mL of 100% isopropanol and mix. [0217] Incubate at 30 C. for 30 minutes with shaking at 500 rpm. [0218] Place tube(s) on magnet and let the beads collect. Aspirate and discard the supernatant. [0219] Add 750 L guanidine hydrochloride-ethyl alcohol (GuHCl-EtOH) wash solution to vessel containing the binding beads and mix. [0220] GuHCl-EtOH wash solution is: [0221] 3M GuHCl [0222] 57% EtOH. [0223] Shake at 400 rpm for 1 minute. [0224] Transfer samples to a deep well plate or 2 mL microfuge tubes. [0225] Place tubes on magnet and let the beads collect for 10 minutes. Aspirate and discard the supernatant. [0226] Add 1000 L wash buffer (10 mM Tris HCl, 80% EtOH) to the beads, and incubate at 30 C. for 3 minutes with shaking. [0227] Place tubes on magnet and let the beads collect. Aspirate and discard the supernatant. [0228] Add 500 L wash buffer to the beads and incubate at 30 C. for 3 minutes with shaking. [0229] Place tubes on magnet and let the beads collect. Aspirate and discard the supernatant. [0230] Add 250 L wash buffer and incubate at 30 C. for 3 minutes with shaking. [0231] Place tubes on magnet and let the beads collect. Aspirate and discard the remaining buffer. [0232] Add 250 L buffer and incubate at 30 C. for 3 minutes with shaking. [0233] Place tubes on magnet and let the beads collect. Aspirate and discard the remaining buffer. [0234] Dry the beads at 70C for 15 minutes, with shaking. [0235] Add 125 L elution buffer (10 mM Tris HCl, pH 8.0, 0.1 mM EDTA) to the beads and incubate at 65 C. for 25 minutes with shaking. [0236] Place tubes on magnet and let the beads collect for 10 minutes. [0237] Aspirate and transfer the supernatant containing the DNA to a new vessel or tube.
Bisulfite Conversion
I. Sulfonation of DNA Using Ammonium Hydrogen Sulfite
[0238] 1. In each tube, combine 64 L DNA, 7 L 1 N NaOH, and 9 L of carrier solution containing 0.2 mg/mL BSA and 0.25 mg/mL of fish DNA. [0239] 2. Incubate at 42 C. for 20 minutes. [0240] 3. Add 120 L of 45% ammonium hydrogen sulfite and incubate at 66 for 75 minutes. [0241] 4. Incubate at 4 C. for 10 minutes.
II. Desulfonation Using Magnetic Beads
Materials
[0242] Magnetic beads (Promega MagneSil Paramagnetic Particles, Promega catalogue number AS1050, 16 g/L).
[0243] Binding buffer: 6.5-7 M guanidine hydrochoride.
[0244] Post-conversion Wash buffer: 80% ethanol with 10 mM Tris HCl (pH 8.0).
[0245] Desulfonation buffer: 70% isopropyl alcohol, 0.1 N NaOH was selected for the desulfonation buffer.
[0246] Samples are mixed using any appropriate device or technology to mix or incubate samples at the temperatures and mixing speeds essentially as described below. For example, a Thermomixer (Eppendorf) can be used for the mixing or incubation of samples. An exemplary desulfonation is as follows: [0247] 1. Mix bead stock thoroughly by vortexing bottle for 1 minute. [0248] 2. Aliquot 50 L of beads into a 2.0 mL tube (e.g., from USA Scientific). [0249] 3. Add 750 L of binding buffer to the beads. [0250] 4. Add 150 L of sulfonated DNA from step I. [0251] 5. Mix (e.g., 1000 RPM at 30 C. for 30 minutes). [0252] 6. Place tube on the magnet stand and leave in place for 5 minutes. With the tubes on the stand, remove and discard the supernatant. [0253] 7. Add 1,000 L of wash buffer. Mix (e.g., 1000 RPM at 30 C. for 3 minutes). [0254] 8. Place tube on the magnet stand and leave in place for 5 minutes. With the tubes on the stand, remove and discard the supernatant. [0255] 9. Add 250 L of wash buffer. Mix (e.g., 1000 RPM at 30 C. for 3 minutes). [0256] 10. Place tube on magnetic rack; remove and discard supernatant after 1 minute. [0257] 11. Add 200 L of desulfonation buffer. Mix (e.g., 1000 RPM at 30 C. for 5 minutes). [0258] 12. Place tube on magnetic rack; remove and discard supernatant after 1 minute. [0259] 13. Add 250 L of wash buffer. Mix (e.g., 1000 RPM at 30 C. for 3 minutes). [0260] 14. Place tube on magnetic rack; remove and discard supernatant after 1 minute. [0261] 15. Add 250 L of wash buffer to the tube. Mix (e.g., 1000 RPM at 30 C. for 3 minutes). [0262] 16. Place tube on magnetic rack; remove and discard supernatant after 1 minute. [0263] 17. Incubate all tubes at 30 C. with the lid open for 15 minutes. [0264] 18. Remove tube from magnetic rack and add 70 L of elution buffer directly to the beads. [0265] 19. Incubate the beads with elution-buffer (e.g., 1000 RPM at 40 C. for 45 minutes). [0266] 20. Place tubes on magnetic rack for about one minute; remove and save the supernatant.
[0267] The converted DNA is then used in pre-amplification and/or flap endonuclease assays, as described below.
Example 2
Multiplex Pre-AmplificationCycles of Pre-Amplification
[0268] Using a nested approach, the effect of the number of PCR cycles was examined by conducting 5, 7 or 10 cycles using the outer primer pairs for each target sample. The PCR-flap assays using inner primers were used to further amplify and to analyze the pre-amplified products. [0269] Experimental conditions: [0270] 1. Sample source: DNA extracted from HCT116 cell lines and bisulfite treated as described above; [0271] 2. 50 L pre-amplification PCR reactions. [0272] 3. Targets regions tested: NDRG4, BMP3, SFMBT2, VAV3, ZDHHC1, and -actin (see
[0284] 10 L of prepared bisulfite-treated target DNA are used in each 50 L PCR reaction. Pre-amplification cycling was as shown below:
TABLE-US-00001 Pre-Amplification Reaction Cycles: Stage Temp/Time #of Cycles Pre-incubation 95 C./5 1 Amplification 1 95 C./30 varying 68 C./30 72 C./30 Cooling 40 C./30 1.
[0285] After PCR, 10 L of the amplification reaction was diluted to 100 L in 10 mM Tris, 0.1 mM EDTA, and 10 L of the diluted amplification product are used in a standard PCR-flap assay, as described below. Comparative assays used a QuARTS PCR-flap assay directly on the bisulfate-treated DNA, without pre-amplification.
[0286] An exemplary QuARTS reaction typically comprises approximately 400-600 nM (e.g., 500 nM) of each primer and detection probe, approximately 100 nM of the invasive oligonucleotide, approximately 600-700 nM of each FAM (e.g., as supplied commercially by Hologic), HEX (e.g., as supplied commercially by BioSearch Technologies, IDT), and Quasar 670 (e.g., as supplied commercially by BioSearch Technologies) FRET cassettes, 6.675 ng/L FEN-1 endonuclease (e.g., Cleavase 2.0, Hologic, Inc.), 1 unit Taq DNA polymerase in a 30 l reaction volume (e.g., GoTaq DNA polymerase, Promega Corp., Madison, Wis.), 10 mM 3-(n-morpholino) propanesulfonic acid (MOPS), 7.5 mM MgCl.sub.2, and 250 M of each dNTP.
[0287] Exemplary QuARTS cycling conditions are as shown below:
TABLE-US-00002 QuARTS Reaction Cycle: Number of Stage Temp/Time Cycles Acquisition Pre-incubation 95 C./3 1 none Amplification 1 95 C./20 10 none 63 C./30 none 70 C./30 none Amplification 2 95 C./20 35 none 53 C./1 single 70 C./30 none Cooling 40 C./30 1 none
[0288] The data are shown in
Example 3
Nested Primers Vs. Non-Nested Primers; PCR Buffer Vs. PCR-Flap Assay Buffer
[0289] Assays were conducted to compare using a nested primer arrangement to the use of the same PCR flap assay primers in both the pre-amplification and the PCR-flap assay steps, and to compare the use of a typical PCR buffer vs. a PCR-flap assay buffer during the pre-amplification step. The PCR-flap assay buffer was used. The typical PCR buffer was 1.5 mM MgCl.sub.2, 20 mM Tris-HCl, pH 8, 50 mM KCl, 250 M each dNTP; and the PCR-flap assay buffer was 7.5 mM MgCl.sub.2, 10 mM MOPS, 0.3 mM Tris-HCl, pH 8.0, 0.8 mM KCl, 0.1m/L BSA, 0.0001% Tween-20, 0.0001% IGEPAL CA-630, 250 M each dNTP. Primer concentrations of 20 nM, 100 nM and 500 nM each primer were also compared. [0290] Experimental conditions: [0291] 1. Sample source: DNA extracted from HCT116 cell lines and bisulfite treated; [0292] 2. 50 L PCR reactions. [0293] 3. Targets regions tested: NDRG4, BMP3, SFMBT2, VAV3, ZDHHC1, and -actin [0294] 4. GoTaq polymerase at 0.025 U/L. [0295] 5. PCR or PCR-flap assay buffer, as described above, [0296] 6. Primer pairs for bisulfite-converted NDRG4, BMP3, SFMBT2, VAV3, ZDHHC1, and -actin, as shown in
[0297] Pre-amplification cycling was as shown below:
TABLE-US-00003 Pre-Amplification Reaction Cycle: Stage Temp/Time #of Cycles Pre-incubation 95 C. /5 1 Amplification 1 95 C./30 11 68 C./30 72 C./30 Cooling 40 C./30 1
[0298] 10 L of prepared bisulfite-treated target DNA were used in each 50 L PCR reaction. After PCR, 10 L of the pre-amplification reaction was diluted to 100 L in 10 mM Tris, 0.1 mM EDTA, and 10 L of the diluted amplification product are used in a standard PCR-flap assay, as described in Example 2.
[0299] The data are shown in
Example 4
Testing Cycles of Pre-Amplification in Flap Assay Buffer
[0300] Assays were conducted to determine effect of increasing the number of pre-amplification PCR cycles on background in both no target control samples and on samples containing target DNA.
[0301] Experimental Conditions: [0302] 1. Sample source: [0303] i) No target control=20 ng/L fish DNA and/or 10 mM Tris, 0.1 mM EDTA; [0304] ii) Bisulfite-converted DNA isolated from plasma from a normal patient [0305] iii) Bisulfite-converted DNA isolated from plasma from a normal patient combined with DNA extracted from HCT116 cell lines and bisulfite treated [0306] 2. 50 L PCR reactions, [0307] 3. Targets regions tested: NDRG4, BMP3, SFMBT2, VAV3, ZDHHC1, and -actin, [0308] 4. Reaction conditions used for both pre-amplification and PCR-flap assay: [0309] 7.5 mM MgCl.sub.2, [0310] 10 mM MOPS, [0311] 0.3 mM Tris-HCl, pH 8.0, [0312] 0.8 mM KCl, [0313] 0.1 g/L BSA, [0314] 0.0001% Tween-20, [0315] 0.0001% IGEPAL CA-630, [0316] 250 M dNTP) [0317] GoTaq polymerase at 0.025 U/l, [0318] Primer pairs for bisulfite-converted NDRG4, BMP3, SFMBT2, VAV3, ZDHHC1, and -actin, as shown in
[0319] Pre-amplification cycling was as shown below:
TABLE-US-00004 Pre-Amplification Reaction Cycle: Stage Temp/Time #of Cycles Pre-incubation 95 C./5 1 Amplification 1 95 C./30 5, 10, 20, or 25 68 C./30 72 C./30 Cooling 40 C./30 1
[0320] After PCR, 10 L of the amplification reaction was diluted to 100 L in 10 mM Tris, 0.1 mM EDTA, and 10 L of the diluted amplification product are used in a standard PCR-flap assay, as described in Example 1.
[0321] The data are shown in
Example 5
Multiplex Targeted Pre-Amplification of Large-Volume Bisulfite-Converted DNA
[0322] To pre-amplify most or all of the bisulfite treated DNA from an input sample, a large volume of the treated DNA may be used in a single, large-volume multiplex amplification reaction. For example, DNA is extracted from a cell lines (e.g., DFCI032 cell line (adenocarcinoma); H1755 cell line (neuroendocrine), using, for example, the Maxwell Promega blood kit # AS1400, as described above. The DNA is bisulfite converted, e.g., as described in Example 1.
[0323] A pre-amplification is conducted in a reaction mixture containing 7.5 mM MgCl.sub.2, 10 mM MOPS, 0.3 mM Tris-HCl, pH 8.0, 0.8 mM KCl, 0.1 g/L BSA, 0.0001% Tween-20, 0. 0001% IGEPAL CA-630, 250 M dNTP, (e.g., 12 primer pairs/24 primers, in equimolar amounts, or with individual primer concentrations adjusted to balance amplification efficiencies of the different target regions), 0.025 units/L HotStart GoTaq concentration, and 20 to 50% by volume of bisulfite-treated target DNA (e.g., 10 L of target DNA into a 50 L reaction mixture, or 50 L of target DNA into a 125 L reaction mixture). Thermal cycling times and temperatures are selected to be appropriate for the volume of the reaction and the amplification vessel. For example, the reactions may be cycled as follows
TABLE-US-00005 Stage Temp/Time #of Cycles Pre-incubation 95 C./5 1 Amplification 1 95 C./30 10 64 C./30 72 C./30 Cooling 4 C./Hold 1
[0324] After thermal cycling, aliquots of the pre-amplification reaction (e.g., 10 L) are diluted to 500 L in 10 mM Tris, 0.1 mM EDTA. Aliquots of the diluted pre-amplified DNA (e.g., 10 L) are used in a QuARTS PCR-flap assay, e.g., as described in Example 2.
Example 6
Multiplex Targeted Pre-amplification of Bisulfite-Converted DNA from Stool Samples
[0325] The multiplex pre-amplification methods described above were tested on DNA isolated from human stool samples. [0326] Sample source: [0327] i) 4 DNA samples captured from stool samples (see, e.g., U.S. Pat. No. 9,000,146) and bisulfite-treated according to Example 1, above, the samples having the following pathologies:
TABLE-US-00006 500237 Adenoma (AA) 500621 Adenocarcinoma (ACA) 780116 Normal 780687 Normal [0328] ii) No target control=20 ng/L bulk fish DNA and/or 10 mM Tris, 0.1 mM EDTA; [0329] 2. 50 L PCR reactions, [0330] 3. Targets regions tested: NDRG4, BMP3, SFMBT2, VAV3, ZDHHC1, and -actin, [0331] 4. Reaction conditions used for both pre-amplification and PCR-flap assay: [0332] 7.5 mM MgCl2, [0333] 10 mM MOPS, [0334] 0.3 mM Tris-HCl, pH 8.0, [0335] 0.8 mM KCl, [0336] 0.1 g/L BSA, [0337] 0.0001% Tween-20, [0338] 0.0001% IGEPAL CA-630, [0339] 250 M dNTP) [0340] GoTaq polymerase at 0.025 U/l, [0341] Primer pairs for bisulfite-converted NDRG4, BMP3, SFMBT2, VAV3, ZDHHC1, and -actin, as shown in
[0342] Pre-amplification cycling was as shown below:
TABLE-US-00007 Pre-Amplification Reaction Cycle: Stage Temp/Time #of Cycles Pre-incubation 95 C./5 1 Amplification 1 95 C./30 10 68 C./30 72 C./30 Cooling 40 C./30 1
[0343] After PCR, 10 L of the amplification reaction was diluted to 100 L in 10 mM Tris, 0.1 mM EDTA, and 10 L of the diluted amplification product are used in a standard PCR-flap assay, as described in Example 2.
[0344] The data are shown in
Example 6
Multiplex Targeted Pre-Amplification of Bisulfite-Converted DNA from Plasma Samples
[0345] The multiplex pre-amplification methods described above were tested on DNA isolated from human plasma samples and treated with bisulfite, as described in Example 1.
[0346] Experimental conditions: [0347] 1. Sample source: [0348] Extracted and bisulfite-treated 75 plasma samples from patients with colorectal cancer or stomach cancer, or from normal patients2 mL each. [0349] 2. 50 L PCR reactions, [0350] 3. Targets regions tested: NDRG4, BMP3, SFMBT2, VAV3, ZDHHC1, and -actin, [0351] 4. Reaction conditions used for both pre-amplification and PCR-flap assay: [0352] 7.5 mM MgCl.sub.2, [0353] 10 mM MOPS, [0354] 0.3 mM Tris-HCl, pH 8.0, [0355] 0.8 mM KCl, [0356] 0.1 g/L BSA, [0357] 0.0001% Tween-20, [0358] 0.0001% IGEPAL CA-630, [0359] 250 M dNTP) [0360] GoTaq polymerase at 0.025 U/l, [0361] Primer pairs for bisulfite-converted NDRG4, BMP3, SFMBT2, VAV3, ZDHHC1, and -actin, as shown in
[0362] Pre-amplification cycling was as shown below:
TABLE-US-00008 Pre-Amplification Reaction Cycle: Stage Temp/Time # of Cycles Pre-incubation 95 C./5.sup. 1 Amplification 1 95 C./30 10 68 C./30 72 C./30 Cooling 40 C./30 1
[0363] After PCR, 10 L of the amplification reaction was diluted to 100 L in 10 mM Tris, 0.1 mM EDTA, and 10 L of the diluted amplification product are used in a standard PCR-flap assay, as described in Example 2.
[0364] The data are shown in
[0365] Embodiments of the technology disclosed herein offer at least 100-fold or greater sensitivity for detecting DNA from blood, e.g., 2.5 copies from 4 mL of plasma, compared to 250 copies using the QuARTS PCR flap assay without pre-amplification.
Example 7
An Exemplary Protocol for Complete Blood-to-Result Analysis of Plasma DNA
[0366] An example of a complete process for isolating DNA from a blood sample for use, e.g., in a detection assay, is provided in this example. Optional bisulfite conversion and detection methods are also described.
I. Blood Processing
[0367] Whole blood is collected in anticoagulant EDTA or Streck Cell-Free DNA BCT tubes. An exemplary procedure is as follows: [0368] 1. Draw 10 mL whole blood into vacutainers tube (anticoagulant EDTA or Streck BCT), collecting the full volume to ensure correct blood to anticoagulant ratio. [0369] 2. After collection, gently mix the blood by inverting the tube 8 to 10 times to mix blood and anticoagulant and keep at room temperature until centrifugation, which should happen within 4 hours of the time of blood collection. [0370] 3. Centrifuge blood samples in a horizontal rotor (swing-out head) for 10 minutes at 1500 g (100 g) at room temperature. Do not use brake to stop centrifuge. [0371] 4. Carefully aspirate the supernatant (plasma) at room temperature and pool in a centrifuge tube. Make sure not to disrupt the cell layer or transfer any cells. [0372] 5. Carefully transfer 4 mL aliquots of the supernatant into cryovial tubes. [0373] 6. Close the caps tightly and place on ice as soon as each aliquot is made. This process should be completed within 1 hour of centrifugation. [0374] 7. Ensure that the cryovials are adequately labeled with the relevant information, including details of additives present in the blood. [0375] 8. Specimens can be kept frozen at 20 C. for a maximum of 48 hours before transferring to a 80 C. freezer.
II. Preparation of a Synthetic Process Control DNA
[0376] Complementary strands of methylated zebrafish DNA are synthesized having the sequences as shown below using standard DNA synthesis methods such as phosphoramidite addition, incorporating 5-methyl C bases at the positions indicated. The synthetic strands are annealed to create a double-stranded DNA fragment for use as a process control.
A. Annealing and Preparation of Concentrated Zebra Fish (ZF-RASS F1 180 mer) Synthetic Process Control
TABLE-US-00009 OligoName OligoSequence ZebrafishRASSF1me 5-TCCAC/iMe-dC/GTGGTGCCCACTCTGGACAGGTGGAGCAGAGGGAAGGTGGT syntheticTarget G/iMe-dC/GCATGGTGGG/iMe-dC/GAG/iMe-dC/G/iMe-dC/GTG/iMe-dC/GC SenseStrand CTGGAGGACCC/iMe-dC/GATTGGCTGA/iMe-dC/GTGTAAACCAGGA/iMe-dC/GA GGACATGACTTTCAGCCCTGCAGCCAGACACAGCTGAGCTGGTGTGACCTGTGTGGA GAGTTCATCTGG-3 ZebrafishRASSF1me 5-CCAGATGAACTCTCCACACAGGTCACACCAGCTCAGCTGTGTCTGGCTGCAGGGCTG syntheticTarget AAAGTCATGTCCT/iMe-dC/GTCCTGGTTTACA/iMe-dC/GTCAGCCAAT/iMe- Anti-SenseStrand dC/GGGGTCCTCCAGG/iMe-dC/GCA/iMe-dC/G/iMe-dC/GCT/iMe-dC/GC CCACCATG/iMe-dC/GCACCACCTTCCCTCTGCTCCACCTGTCCAGAGTGG GCACCA/iMe-dC/GGTGGA-3 [0377] 1. Reconstitute the lyophilized, single stranded oligonucleotides in 10 mM Tris, pH 8.0, 0.1 mM EDTA, at a concentration of 1 M. [0378] 2. Make 10 Annealing Buffer of 500 mM NaCl, 200 mM Tris-HCl pH 8.0, and 20 mM MgCl.sub.2. [0379] 3. Anneal the synthetic strands
[0380] In a total volume of 100 combine equimolar amounts of each of the single-stranded oligonucleotides in 1 annealing buffer, e.g., as shown in the table below:
TABLE-US-00010 Final Conc. Volume Stock (copies/l in 1 ml added Component Conc. final volume) (L) Zebrafish RASSF1 me 1 M 1.0E+10 16.6 synthetic Target Sense Strand Zebrafish RASSF1 me 1 M 1.0E+10 16.6 synthetic Target Anti-Sense Strand Annealing Buffer 10X NA 10.0 Water NA NA 56.8 total vol. 100.0 L [0381] 4. Heat the annealing mixture to 98 C. for 11-15 minutes. [0382] 5. Remove the reaction tube from the heat and spin down briefly to collect condensation to bottom of tube. [0383] 6. Incubate the reaction tube at room temp for 10 to 25 minutes. [0384] 7. Add 0.9 mL fish DNA diluent (20 ng/mL bulk fish DNA in Te (10 mM Tris-HCl pH8.0, 0.1 mM EDTA)) to adjust to the concentration of zebrafish RASSF1 DNA fragment to 1.010.sup.10 copies/l of annealed, double-stranded synthetic zebrafish RASSF1 DNA in a carrier of genomic fish DNA. [0385] 8. Dilute the process control to a desired concentration with 10 mM Tris, pH 8.0, 0.1 mM EDTA, e.g., as described in the table below, and store at either 20 C. or 80 C.
TABLE-US-00011 Target Total Initial Concentration Addition Te Volume Final Concentration 1.00E+10 copies/L 10 L 990 L 1000 L 1.00E+08 copies/L 1.00E+08 copies/L 10 L 990 L 1000 L 1.00E+06 copies/L
B. Preparation of 100 Stock Process Control (12,000 Copies/L Zebra Fish RASSF1 DNA in 200 ng/L Bulk Fish DNA) [0386] 1. Thaw reagents [0387] 2. Vortex and spin down thawed reagents [0388] 3. Add the following reagents into a 50 mL conical tube
TABLE-US-00012 Initial Final Volume Reagent Concentration Concentration to add (mL) Stock carrier fish DNA 10 g/L 200 ng/L 0.40 Zebra fish 1.00E+06 1.20E+04 0.24 (ZF-RASS F1 180mer) copies/L copies/L 10 mM Tris, pH 8.0, NA NA 19.36 0.1 mM EDTA Total Volume 20.00 [0389] 4. Aliquot into labeled 0.5 mL tubes and store @ 20 C.
C. Preparation of Lx Stock of Process Control (120 Copies/L Zebra Fish RASSF1 DNA in 2 ng/L Fish DNA) [0390] 1. Thaw reagents [0391] 2. Vortex and spin down thawed reagents [0392] 3. Add the following reagents into a 50 mL conical tube:
TABLE-US-00013 Reagent 1 mL 5 mL 10 mL 100 Zebra Fish Process Control 10 L 50 L 100 L 10 mM Tris, pH 8.0, 0.1 mM EDTA 990 L 4950 L 9900 L [0393] 4. Aliquot 0.3 mL into labeled 0.5 mL tubes and store @ 20 C.
III. DNA Extraction from Plasma [0394] 1. Thaw plasma, prepare reagents, label tubes, and clean and setup biosafety cabinet for extraction [0395] 2. Add 300 L Proteinase K (20 mg/mL) to one 50 mL conical tube for each sample. [0396] 3. Add 2-4 mL of plasma sample to each 50 mL conical tube (do not vortex). [0397] 4. Swirl or pipet to mix and let sit at room temp for 5 min. [0398] 5. Add 4-6 mL of lysis buffer 1 (LB1) solution to bring the volume up to approximately 8 mL. [0399] LB1 formulation: [0400] 0.1 mL of 120 copies/L of zebrafish RASSF1 DNA process control, as described above; [0401] 0.9-2.9 mL of 10 mM Tris, pH 8.0, 0.1 mM EDTA (e.g., use 2.9 mL for 2 mL plasma samples) [0402] 3 mL of 4.3 M guanidine thiocyanate with 10% IGEPAL (from a stock of 5.3 g of IGEPAL CA-630 combined with 45 mL of 4.8 M guanidine thiocyanate) [0403] 6. Invert tubes 3 times. [0404] 7. Place tubes on bench top shaker (room temperature) at 500 rpm for 30 minutes at room temperature. [0405] 8. Add 200 L of silica binding beads [16 g of particles/L] and mix by swirling. [0406] 9. Add 7 mL of lysis buffer 2 (LB2) solution and mix by swirling. [0407] LB2 formulation: [0408] 4 mL 4.3 M guanidine thiocyanate mixed with 10% IGEPAL [0409] 3 mL 100% Isopropanol (Lysis buffer 2 may be added before, after, or concurrently with the silica binding beads) [0410] 10. Invert tubes 3 times. [0411] 11. Place tubes on bench top shaker at 500 rpm for 30 minutes at room temperature. [0412] 12. Place tubes on capture aspirator and run program with magnetic collection of the beads for 10 minutes, then aspiration. This will collect the beads for 10 minutes then remove all liquid from the tubes. [0413] 13. Add 0.9 mL of Wash Solution 1 (3 M guanidine hydrochloride or guanidine thiocyanate, 56.8% EtOH) to resuspend binding beads and mix by swirling. [0414] 14. Place tubes on bench top shaker at 400 rpm for 2 minute at room temperature. (All subsequent steps can be done on the STARlet automated platform.) [0415] 15. Mix by repeated pipetting then transfer containing beads to 96 deep well plate. [0416] 16. Place plate on magnetic rack for 10 min. [0417] 17. Aspirate supernatant to waste. [0418] 18. Add 1 mL of Wash Solution 2 (80% Ethanol, 10 mM Tris pH 8.0). [0419] 19. Mix for 3 minutes. [0420] 20. Place tubes on magnetic rack for 10 min. [0421] 21. Aspirate supernatant to waste. [0422] 22. Add 0.5 mL of Wash Solution 2. [0423] 23. Mix for 3 minutes. [0424] 24. Place tubes on magnetic rack for 5 min. [0425] 25. Aspirate supernatant to waste. [0426] 26. Add 0.25 mL of Wash Solution 2. [0427] 27. Mix for 3 minutes. [0428] 28. Place tubes on magnetic rack for 5 min. [0429] 29. Aspirate supernatant to waste. [0430] 30. Add 0.25 mL of Wash Solution 2. [0431] 31. Mix for 3 minutes. [0432] 32. Place tubes on magnetic rack for 5 min. [0433] 33. Aspirate supernatant to waste. [0434] 34. Place plate on heat block at 70 C., 15 minutes, with shaking. [0435] 35. Add 125 L of elution buffer (10 mM Tris-HCl, pH 8.0, 0.1 mM EDTA). [0436] 36. Incubate 65 C. for 25 minutes with shaking. [0437] 37. Place plate on magnet and let the beads collect and cool for 8 minutes. [0438] 38. Transfer eluate to 96-well plate and store at 80 C. The recoverable/transferrable volume is about 100 L.
IV. Pre-Bisulfite DNA Quantification
[0439] To measure DNA in samples using ACTB gene and to assess zebrafish process control recovery, the DNA may be measured prior to further treatment. Setup a QuARTS PCR-flap assay using 10 L of the extracted DNA using the following protocol: [0440] 1. Prepare 10 Oligo Mix containing forward and reverse primers each at 2 M, the probe and FRET cassettes at 5 M and dNTP's at 250 M each. (See below for primer, probe and FRET sequences)
TABLE-US-00014 Concentration Oligo Sequence(5-3) (M) ZFRASSF1UT CGCATGGTGGGCGAG 2 forward primer ZFRASSF1UT ACACGTCAGCCAATCGGG 2 reverse primer ZFRASSF1UT CCACGGACGGCGCGTGCGTTT 5 Probe(Arm3) /3C6/ Arm5FAM /FAM/TCT/BHQ-1/AGCCGGTTT 5 FRET TCCGGCTGAGACGTCCGTGG/3C6/ ACTBforward CCATGAGGCTGGTGTAAAG 2 primer3 ACTBReverse CTACTGTGCACCTACTTAATACAC 2 primer3 ACTBprobe CGCCGAGGGCGGCCTTGGAG/3C6/ 5 withArm1 Arm1 /Q670/TCT/BHQ-2/AGCCGGTT 5 QUASAR670 TTCCGGCTGAGACCTCGGCG/3C6/ FRET dNTPmix 250 [0441] 2. Prepare a master mix as follows:
TABLE-US-00015 Volume per Component reaction (L) Water 15.50 10X oligo Mix 3.00 20X QuARTS Enzyme Mix* 1.50 total volume 20.0 *20X enzyme mix contains 1 unit/L GoTaq Hot start polymerase (Promega), 292 ng/L Cleavase 2.0 flap endonuclease (Hologic). [0442] 3. Pipette 10 L of each sample into a well of a 96 well plate. [0443] 4. Add 20 L of master mix to each well of the plate. [0444] 5. Seal plate and centrifuge for 1 minutes at 3000 rpm. [0445] 6. Run plates with following reaction conditions on an ABI7500 or Light Cycler 480 real time thermal cycler
TABLE-US-00016 QuARTS Assat Reaction Cycle: Ramp Rate Number Signal Stage Temp/Time ( C. per second) of Cycles Acquisition Pre-incubation 95 C./3 min 4.4 1 No Amplification 95 C./2 sec 4.4 5 No 1 63 C./30 sec 2.2 No 70 C./30 sec 4.4 No Amplification 95 C./20 sec 4.4 40 No 2 53 C./1 min 2.2 Yes 70 C./30 sec 4.4 No Cooling 40 C./30 sec 2.2 1 No
V. Bisulfite Conversion and Purification of DNA
[0446] 1. Thaw all extracted DNA samples from the DNA extraction from plasma step and spin down DNA. [0447] 2. Reagent Preparation:
TABLE-US-00017 Component Abbreviation Name Formulation BIS SLN Bisulfate Conversion 56.6% Ammonium Bisulfite Solution DES SLN Desulfonation Solution 70% Isopropyl alcohol, 0.1 N NaOH BND BDS Binding Beads Maxwell RNA Beads (16 mg/mL), (Promega Corp.) BND SLN Binding Solution 7 M Guanidine HCl CNV WSH Conversion Wash 10 mM Tris-HCl, 80% Ethanol ELU BUF Elution Buffer 10 mM Trist, 0.1 mM EDTA, pH 8.0 [0448] 3. Add 5 L of 100 ng/L BSA DNA Carrier Solution to each well in a deep well plate (DWP). [0449] 4. Add 80 L of each sample into the DWP. [0450] 5. Add 5 L of freshly prepared 1.6N NaOH to each well in the DWP(s). [0451] 6. Carefully mix by pipetting with pipette set to 30-40 L to avoid bubbles. [0452] 7. Incubate at 42 C. for 20 minutes. [0453] 8. Add 120 L of BIS SLN to each well. [0454] 9. Incubate at 66 C. for 75 minutes while mixing during the first 3 minutes. [0455] 10. Add 750 L of BND SLN [0456] 11. Pre-mix of silica beads (BND BDS) and add of 50 L of Silica beads (BND BDS) to the wells of DWP. [0457] 12. Mix at 30 C. on heater shaker at 1,200 rpm for 30 minutes. [0458] 13. Collect the beads on a plate magnet for 5 minutes followed by aspiration of solutions to waste. [0459] 14. Add 1 mL of wash buffer (CNV WSH) then move the plate to a heater shaker and mix at 1,200 rpm for 3 minutes. [0460] 15. Collect the beads on a plate magnet for 5 minutes followed by aspiration of solutions to waste. [0461] 16. Add 0.25 mL of wash buffer (CNV WSH) then move the plate to the heater shaker and mix at 1,200 rpm for 3 minutes. [0462] 17. Collect the beads on a plate magnet followed by aspiration of solutions to waste. [0463] 18. Add of 0.2 mL of desulfonation buffer (DES SLN) and mix at 1,200 rpm for 7 minutes at [0464] 30 C. [0465] 19. Collect the beads for 2 minutes on the magnet followed by aspiration of solutions to waste. [0466] 20. Add of 0.25 mL of wash buffer (CNV WSH) then move the plate to the heater shaker and mix at 1,200 rpm for 3 minutes. [0467] 21. Collect the beads for 2 minutes on the magnet followed by aspiration of solutions to waste. [0468] 22. Add of 0.25 mL of wash buffer (CNV WSH) then move the plate to the heater shaker and mix at 1,200 rpm for 3 minutes. [0469] 23. Collect the beads for 2 minutes on the magnet followed by aspiration of solutions to waste. [0470] 24. Allow the plate to dry by moving to heater shaker and incubating at 70 C. for 15 minutes while mixing at 1,200 rpm. [0471] 25. Add 80 L of elution buffer (ELU BFR) across all samples in DWP. [0472] 26. Incubated at 65 C. for 25 minutes while mixing at 1,200 rpm. [0473] 27. Manually Transfer eluate to 96 well plate and store at 80 C. [0474] 28. The recoverable/transferrable volume is about 65 L.
VI. QuARTS-X for Methylated DNA Detection and Quantification
[0475] A. Multiplex PCR (mPCR) Setup: [0476] 1. Prepare a 10 primer mix containing forward and reverse primers for each methylated marker of interest to a final concentration of 750 nM each. Use 10 mM Tris-HCl, pH 8, 0.1 mM EDTA as diluent, as described in the examples above. [0477] 2. Prepare 10 multiplex PCR buffer containing 100 mM MOPS, pH 7.5, 75 mM MgCl2, 0.08% Tween 20, 0.08% IGEPAL CA-630, 2.5 mM dNTPs. [0478] 3. Prepare multiplex PCR master mix as follows:
TABLE-US-00018 Volume per Component reaction (L) Water 9.62 10X Primer Mix (0.75 M each) 7.5 mPCR Buffer 7.5 Hot Start GoTaq (5 units/l) 0.38 total volume 25.0 [0479] 4. Thaw DNA and spin plate down. [0480] 5. Add 25 L of master mix to a 96 well plate. [0481] 6. Transfer 50 L of each sample to each well. [0482] 7. Seal plate with aluminum foil seal (do not use strip caps) [0483] 8. Place in heated-lid thermal cycler and proceed to cycle using the following profile, for about 5 to 20 cycles, preferably about 10 to 13 cycles:
TABLE-US-00019 Number Stage Temp/Time of Cycles Pre-incubation 95 C./5 min 1 Amplification 1 95 C./30 sec 12 64 C./60 sec Cooling 4 C./hold 1 [0484] 9. After completion of the thermal cycling, perform a 1:10 dilution of amplicon as follows: [0485] a. Transfer 180 L of 10 mM Tris-HCl, pH 8, 0.1 mM EDTA to each well of a deep well plate. [0486] b. Add 20 L of amplified sample to each pre-filled well. [0487] c. Mix the diluted samples by repeated pipetting using fresh tips and a 200 L pipettor (be careful not to generate aerosols). [0488] d. Seal the diluted plate with a plastic seal. [0489] e. Centrifuge the diluted plate at 1000 rpm for 1 min. [0490] f. Seal any remaining multiplex PCR product that has not been diluted with a new aluminum foil seal. Place at 80 C.
[0491] B. QuARTS Assay on Multiplex-Amplified DNA: [0492] 1. Thaw fish DNA diluent (20 ng/L) and use to dilute plasmid calibrators (see, e.g., U.S. patent application Ser. No. 15/033,803, which is incorporated herein by reference) needed in the assay. Use the following table as a dilution guide:
TABLE-US-00020 Initial Plasmid Final plasmid L of L of total Concentration, Concentration, plasmid diluent to volume, copies per L copies per L to add add L 1.00E+05 1.00E+04 5 45 50 1.00E+04 1.00E+03 5 45 50 1.00E+03 1.00E+02 5 45 50 1.00E+02 1.00E+01 5 45 50 [0493] 2. Prepare 10 triplex QuARTS oligo mix using the following table for markers A, B, and C (e.g., markers of interest, plus run control and internal controls such as -actin or B3GALT6 (see, e.g., U.S. Pat. Appln. Ser. No. 62/364,082, incorporated herein by reference).
TABLE-US-00021 Concentration Oligo Sequence(5-3) (M) MarkerAForwardprimer NA 2 MarkerAReverseprimer NA 2 MarkerAprobe-Arm1 NA 5 Marker13Forwardprimer NA 2 Marker13Reverseprimer NA 2 Marker13probe-Arm5 NA 5 MarkerCForwardprimer NA 2 MarkerCReverseprimer NA 2 MarkerCprobe-Arm3 NA 5 A1HEXFRET /HEX/TCT/BHQ- 5 1/AGCCGGTTTTCCGGCTGAGACCTCGGCG/3C6/ A5FAMFRET /FAM/TCT/BHQ- 5 1/AGCCGGTTTTCCGGCTGAGACGTCCGTGG/3C6/ A3QUASAR-670FRET /Q670/TCT/BHQ- 5 2/AGCCGGTTTTCCGGCTGAGACTCCGCGTC/3C6/ dNTPmix 250
[0494] For example, the following might be used to detect bisulfate-treated -actin, B3GALT6, and zebrafish RASSF1 markers:
TABLE-US-00022 Concentration OligoDescription Sequence(5-3) (M) ZFRASSF1BT TGCGTATGGTGGGCGAG 2 Forwardprimer ZFRASSF1BT CCTAATTTACACGTCAACCAATCGAA 2 Reverseprimer ZFRASSF1BTprobe- CCACGGACGGCGCGTGCGTTT/3C6/ 5 Arm5 B3GALT6Forward GGTTTATTTTGGTTTTTTGAGTTTTCGG 2 primer B3GALT6Reverse TCCAACCTACTATATTTACGCGAA 2 primer B3GALT6probe-Arm CGCCGAGGGCGGATTTAGGG/3C6/ 5 1 BTACTForward GTGTTTGTTTTTTTGATTAGGTGTTTAAGA 2 primer BTACTReverse CTTTACACCAACCTCATAACCTTATC 2 primer BTACTprobe-Arm3 GACGCGGAGATAGTGTTGTGG/3C6/ 5 Arm1HEXFRET /HEX/TCT/BHQ- 5 1/AGCCGGTTTTCCGGCTGAGACCTCGGCG/3C6/ Arm5FAMFRET /FAM/TCT/BHQ- 5 1/AGCCGGTTTTCCGGCTGAGACGTCCGTGG/3C6/ Arm3QUASAR-670 /Q670/TCT/BHQ- 5 FRET 2/AGCCGGTTTTCCGGCTGAGACTCCGCGTC/3C6/ dNTPmix 2500 [0495] 3. Prepare a QuARTS flap assay master mix using the following table:
TABLE-US-00023 Volume per Component reaction (L) Water 15.5 10X Triplex oligo Mix 3.0 20X QuARTS Enzyme Mix* 1.5 total volume 20.0 *20X enzyme mix contains 1 unit/L GoTaq Hot start polymerase (Promega), 292 ng/L Cleavase 2.0 flap endonuclease (Hologic). [0496] 4. Using a 96 well ABI plates, pipette 20 L of QuARTS master mix into each well. [0497] 5. Add 10 L of appropriate calibrators or diluted mPCR samples. [0498] 6. Seal plate with ABI clear plastic seals. [0499] 7. Centrifuge the plate using 3000 rpm for 1 minute. [0500] 8. Place plate in ABI thermal cycler programmed to run the following thermal protocol then start the instrument
TABLE-US-00024 QuARTS Assat Reaction Cycle: Ramp Rate Number Signal Stage Temp/Time ( C. per second) of Cycles Acquisition Pre-incubation 95 C./3 min 4.4 1 none Amplification 95 C./2 sec 4.4 5 none 1 63 C./30 sec 2.2 none 70 C./30 sec 4.4 none Amplification 95 C./20 sec 4.4 40 none 2 53 C./1 min 2.2 Yes 70 C./30 sec 4.4 none Cooling 40 C./30 sec 2.2 1 none
Example 8
Comparison of Chaotropic Salts in First Wash Solution
[0501] During development of the technology, the effects of using different chaotropic salts, e.g., guanidine thiocyanate vs. guanidine hydrochloride in the first wash solution were compared. DNA was extracted from plasma samples as described in Example 7, with either guanidine thiocyanate-ethyl alcohol or guanidine hydrochloride-ethyl alcohol used as a first wash solution (i.e., 57% ethyl alcohol with either 3 M guanidine hydrochloride or 3 M guanidine thiocyanate). The samples were otherwise processed as described in Example 7 and a portion of the DNA was bisulfite-converted. The amount of resulting unconverted DNA was measured by detection of the process control and -actin (ACTB) using a QuARTS PCR flap assay, as described above, and the bisulfite-converted DNA was measured by detection of the process control, B3GALT6, and -actin (BTACT) using a multiplex pre-amplification and QuARTS PCR-flap assay, as described above. The results are shown in
Example 9
Comparison of Ethyl Alcohol with Guanidine Thiocyanate or Guanidine Hydrochloride to Ethyl Alcohol with Buffer in a First Wash Step
[0502] During development of the technology, the effects of using a mixture of ethyl alcohol (ethanol) with a chaotropic salt solution, e.g., guanidine thiocyanate (GTC) or guanidine hydrochloride (GuHCl) in the first wash step of the plasma DNA extraction described in Example 7, part III i.e., using 57% ethyl alcohol with 3 M guanidine hydrochloride (wash solution 1 in Example 7, part III) or 50% ethyl alcohol with 2.4 M guanidine thiocyanate, was compared to using 80% ethyl alcohol with 10 mM Tris HCl, pH 8.0 (wash solution 2 in Example 7, part III) in the first wash step. The 80% ethanol-Tris buffer solution was used in the subsequent wash steps, as described in Example 7.
[0503] Eight replicates were performed for each set of wash conditions. The samples were otherwise processed as described in Example 7 and the DNA was not treated with bisulfite. The amount of resulting DNA was measured by detection of -actin (ACTB) using a QuARTS PCR flap assay, as described above. The results (mean of DNA strands detected) are shown in the table below. These data show that use of ethyl alcohol with either guanidine thiocyanate or guanidine hydrochloride in the first wash step, followed by additional washes with the ethanol-buffer wash, produced higher yields than the use of the ethanol-buffer wash for all wash steps.
TABLE-US-00025 Wash Condition Mean SD CV Ethanol-Tris buffer 1099 50.80 4.62 Ethanol-GuHCl 1434 76.49 5.33 Ethanol-GTC 1416 189.45 13.38
Example 10
Test of Addition of Lysis Reagent in One Step or Two Step
[0504] During development of the technology, the effects of adding the lysis reagent at one or two steps in the isolation procedure were compared. Using aliquots of 2 mL or 4 mL from 6 different plasma samples, the first procedure comprised adding 7 mL of a lysis reagent of 4.3 M guanidine thiocyanate with 10% IGEPAL with proteinase K and a process control as described in Example 1, incubation of the plasma/protease/process control mixture at 55 C. for 60 min, followed by addition of isopropanol. The second procedure comprised adding one aliquot of 3 mL of 4.3 M guanidine thiocyanate with 10% IGEPAL with the protease and process control, and a further aliquot of 4 mL added after the 55 C. incubation, along with the addition of isopropanol. The samples were then further incubated at 30 C. for 30 min., then processed as described in Example 1. A portion of the resulting DNA was bisulfite-converted as described.
[0505] The amount of resulting unconverted DNA was measured by detection of the process control and -actin (ACTB) using a QuARTS assay, as described above, and the bisulfite-converted DNA was measured by detection of the process control, B3GALT6, and -actin (BTACT) using a multiplex pre-amplification and QuARTS PCR-flap assay, as described above. The results are shown in
TABLE-US-00026 Average fold difference of 2 additions vs. 1 addition Unconverted Bisulfite-converted PC ACTB PC B3GALT BTACT 1.07 1.12 1.04 1.12 1.20
[0506] These data show that addition of the lysis reagent in two steps, with the first in the absence of isopropanol and the second added in combination with isopropanol, produces higher yields of detectable DNA.
[0507] All publications and patents mentioned in the above specification are herein incorporated by reference in their entireties for all purposes. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which the various embodiments described herein belongs. When definitions of terms in incorporated references appear to differ from the definitions provided in the present teachings, the definition provided in the present teachings shall control.
[0508] Various modifications and variations of the described compositions, methods, and uses of the technology will be apparent to those skilled in the art without departing from the scope and spirit of the technology as described. Although the technology has been described in connection with specific exemplary embodiments, it should be understood that the technology as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the technology that are obvious to those skilled in pharmacology, biochemistry, medical science, or related fields are intended to be within the scope of the following claims.