FURTHER NOVEL OLIGONUCLEOTIDE-LIGAND CONJUGATES
20210087570 ยท 2021-03-25
Inventors
Cpc classification
A61K47/605
HUMAN NECESSITIES
C12N2320/32
CHEMISTRY; METALLURGY
C07H21/00
CHEMISTRY; METALLURGY
A61K47/549
HUMAN NECESSITIES
A61P1/16
HUMAN NECESSITIES
C12N15/1138
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a compound comprising a modified saccharide moiety conjugated to a nucleic acid. The compound is useful in medicine for RNA interference therapy or for research and diagnostic purposes. In particular, the compound is useful in treating liver disease.
Claims
1. A compound having the formula I:
[SX.sup.1PX.sup.2].sub.3-A-X.sup.3Z(I) wherein: S represents a saccharide; X.sup.1 represents C.sub.3-C.sub.6 alkylene or (CH.sub.2CH.sub.2O).sub.m(CH.sub.2).sub.2 wherein m is 1, 2, or 3; P is a modified phosphate; X.sup.2 is C.sub.1-C.sub.8 alkylene; X.sup.3 represents a bridging unit; Z is a nucleic acid; the linkage between X.sup.3 and Z is a phosphate or thiophosphate; and A is a branching unit selected from: ##STR00020## wherein: R.sup.1 is hydrogen or C.sub.1-C.sub.10 alkylene; and R.sup.2 is C.sub.1-C.sub.10 alkylene.
2. A compound according to claim 1, wherein A has the structure: ##STR00021## wherein: R.sup.1 is hydrogen or C.sub.1-C.sub.10 alkylene; R.sup.2 is C.sub.1-C.sub.10 alkylene.
3. A compound according to claim 2, wherein A has a structure selected from: ##STR00022## wherein X.sup.3 is attached to the nitrogen atom; or ##STR00023## wherein X.sup.3 is attached to the nitrogen atom.
4. A compound of any of claims 1 to 3 wherein X.sup.3 is selected from C.sub.1-C.sub.20 alkylene-, C.sub.2-C.sub.20 alkenylene-, an alkylene ether of formula (C.sub.1-C.sub.20 alkylene)-O(C.sub.1-C.sub.20 alkylene)-, C.sub.0-C.sub.4 alkylene(Cy)C.sub.0-C.sub.4 alkylene- wherein Cy represents a substituted or unsubstituted 5 or 6 membered cycloalkylene, arylene, heterocyclylene or heteroarylene ring, C.sub.1-C.sub.4 alkylene-NHC(O)C.sub.1-C.sub.4 alkylene-, C.sub.1-C.sub.4 alkylene-C(O)NHC.sub.1-C.sub.4 alkylene-, C.sub.1-C.sub.4 alkylene-SC(O)C.sub.1-C.sub.4 alkylene-, C.sub.1-C.sub.4 alkylene-C(O)SC.sub.1-C.sub.4 alkylene-, C.sub.1-C.sub.4 alkylene-OC(O)C.sub.1-C.sub.4 alkylene-, C.sub.1-C.sub.4 alkylene-C(O)OC.sub.1-C.sub.4 alkylene-, and C.sub.1-C.sub.6 alkylene-SSC.sub.1-C.sub.6 alkylene-.
5. A compound according to claim 4, wherein X.sup.3 is C.sub.1-C.sub.20 alkylene-.
6. A compound according to claim 5, wherein X.sup.3 is selected from the group consisting of C.sub.3H.sub.6, C.sub.4H.sub.8, C.sub.6H.sub.12 and C.sub.8H.sub.16, especially C.sub.3H.sub.6.
7. A compound according to any preceding claim, wherein the modified phosphate is a thiophosphate.
8. A compound according to any preceding claim, wherein the saccharide is selected from N-acetyl galactosamine, mannose, galactose, glucose, glucosamine and fructose.
9. A compound according to claim 8, wherein the saccharide is N-acetyl galactosamine.
10. A compound according to any preceding claim, wherein X.sup.1 is (CH.sub.2CH.sub.2O).sub.m(CH.sub.2).sub.2 wherein m is 1, 2, or 3.
11. A compound according to any preceding claim, wherein X.sup.1 represents C.sub.3-C.sub.6 alkylene.
12. A compound of the following formula: ##STR00024## wherein Z is a nucleic acid.
13. A compound of the following formula: ##STR00025## wherein Z is a nucleic acid.
14. A compound of the following formula: ##STR00026## wherein Z is a nucleic acid.
15. A compound of the following formula: ##STR00027## wherein Z is a nucleic acid.
16. A compound according to any preceding claim, wherein the nucleic acid is selected from RNAi, siRNA, siNA, antisense nucleic acid, ribozymes, aptamers and spiegelmers.
17. A compound according to any preceding claim, wherein the nucleic acid is modified.
18. A compound according to claim 17 wherein the modification is selected from substitutions or insertions with analogues of nucleic acids or bases and chemical modification of the base, sugar or phosphate moieties.
19. A composition comprising a compound as defined in any one of claims 1 to 18 and a suitable carrier or excipient.
20. A compound as defined in any one of claims 1 to 18, or a composition as defined in claim 19, for use in medicine.
21. A compound as defined in any one of claims 1 to 18, or a composition as defined in claim 19, for use in the treatment of liver diseases, genetic diseases, hemophilia and bleeding disorders, liver fibrosis, non-alcoholic steotohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), viral hepatitis, rare diseases (e.g. acromegaly), metabolic diseases (e.g. hypercholesterolemia, dyslipidemia, hypertriglyceridemia), cardiovascular diseases, obesity, thalassemia, liver injury (e.g. drug induced liver injury), hemochromatosis, alcoholic liver diseases, alcohol dependence, anemia, and/or anemia of chronic diseases.
22. A method of delivery of nucleic acids to hepatocytes comprising contacting the hepatocyte with a compound according to any one of claims 1 to 18.
23. A process for making a compound of formula (I) as claimed in any one of claims 1 to 18, the process comprising adding together each component to form the compound of formula (I).
Description
BRIEF DESCRIPTION OF THE FIGURES
[0176]
[0177]
[0178]
[0179] The present application is exemplified by the following examples:
EXAMPLES
General Information
[0180] All reactions were carried out under a nitrogen atmosphere, unless stated otherwise. NMR spectra were recorded on a Bruker 400 MHz Ultrashield and all chemical shifts () were determined relative to TMS.
Example 1Synthesis of GalNAc Phosphoramidites
[0181] ##STR00014##
(2R,3R,4R,5R,6R)-5-acetamido-2-(acetoxymethyl)-6-(2-(2-(2-(benzyloxy)ethoxy)ethoxy)ethoxy)tetrahydro-2H-pyran-3,4-diyldiacetate (19)
[0182] To a solution of 15 (64.2 g, 166 mmol) in 1,2-dichloroethane (700 mL) was added trimethylsilyl trifluoromethanesulfonate (22.10 g, 99 mmol, 18.04 mL, 0.6 equiv) and the brown suspension was stirred for 15 minutes. Grinded 4A molecular sieves (85 g) were added and stirring was continued for 15 minutes. Triethyleneglycolmonobenzyl ether (51.8 g, 215 mmol, 47.5 mL, 1.3 equiv) was added, via drop wise addition, over a period of 15 minutes and stirring was continued at room temperature. The reaction mixture was filtered over a plug of kieselguhr followed by rinsing with warm dichloromethane. The filtrate was quenched by pouring in ice-cold aqueous saturated NaHCO.sub.3 solution (800 mL) and stirred vigerously. The layers were separated and the aqueous layer was extracted twice more with dichloromethane (2300 mL). The combined organic layers were washed with water (600 mL) and brine (600 mL), dried over Na.sub.2SO.sub.4, filtered and concentrated in vacuo to obtain a yellow oil. Purification was performed by flash column chromatography (5-100% EtOAc in heptane) to obtain a mixture of 19 and triethyleneglycolmonobenzyl ether (64 g). This material was dissolved in dichloromethane (430 mL) followed by the addition of triethylamine (38.4 g, 380 mmol, 52.8 ml, 4 equiv) and DMAP (2.321 g, 19.00 mmol, 0.2 equiv). Then, via batch wise addition, was added TBDMSCl (21.47 g, 142 mmol, 1.5 equiv) and stirring was continued at room temperature for 2 hours. The reaction mixture was filtered and followed by pouring in an ice cold saturated solution of NaHCO3 (1 L). The layers were separated and the aqueous layer was extracted twice more with dichloromethane (2300 mL). The combined organic layers were washed once with brine (1 L) and dried over Na.sub.2SO.sub.4. After concentrating in vacuo, followed by flash column chromatography (70-100% EtOAc in heptane), 19 was obtained as a colourless oil (36 g, yield 30%) .sup.1H NMR (400 MHz, Chloroform-d) 7.38-7.28 (m, 5H), 6.58 (d, J=9.5 Hz, 1H), 5.26 (d, J=3.3 Hz, 1H), 4.96 (dd, J=11.2, 3.4 Hz, 1H), 4.79 (d, J=8.6 Hz, 1H), 4.53 (d, J=1.3 Hz, 2H), 4.28 (dt, J=11.2, 9.0 Hz, 1H), 4.16-4.06 (m, 2H), 3.88 (dd, J=6.0, 2.7 Hz, 2H), 3.75 (td, J=5.7, 2.7 Hz, 4H), 3.71-3.58 (m, 7H), 2.15 (s, 3H), 2.04 (s, 3H), 1.97 (s, 3H), 1.95 (s, 3H).
(2R,3R,4R,5R,6R)-5-acetamido-2-(acetoxymethyl)-6-(2-(2-(2-hydroxyethoxy)ethoxy)ethoxy)tetrahydro-2H-pyran-3,4-diyl diacetate (ST20)
[0183] To a solution of 19 (47.68 g, 84 mmol) in tetrahydrofuran (330 ml) and 2-propanol (330 ml) was added 10% palladium on activated carbon (12.92 g, 12.14 mmol, 1.45 equiv). The reaction mixture was charged with hydrogen (balloon) and stirring was continued at room temperature overnight. The reaction mixture was filtered over kieselguhr and rinsed with warm dichloromethane. After concentrating in vacuo, ST20 was obtained (37 g, yield 94%) .sup.1H NMR (400 MHz, DMSO-d.sub.6) 7.81 (d, J=9.2 Hz, 1H), 5.22 (d, J=3.3 Hz, 1H), 4.97 (dd, J=11.2, 3.4 Hz, 1H), 4.61 (t, J=5.4 Hz, 1H), 4.56 (d, J=8.4 Hz, 1H), 4.03 (s, 3H), 3.88 (dt, J=11.1, 8.9 Hz, 1H), 3.82-3.73 (m, 1H), 3.63-3.45 (m, 9H), 3.41 (t, J=5.1 Hz, 2H), 2.11 (s, 3H), 2.00 (s, 3H), 1.89 (s, 3H), 1.78 (s, 3H).
(2R,3R,4R,5R,6R)-5-acetamido-2-(acetoxymethyl)-6-(2-(2-(2-(((2-cyanoethoxy)(diisopropylamino)phosphino)oxy)ethoxy)ethoxy)ethoxy)tetrahydro-2H-pyran-3,4-diyl diacetate (ST21)
[0184] To a solution of 4,5-dicyanoimidazole (961 mg, 8.13 mmol, 0.65 equiv) in anhydrous acetonitrile (8 mL) and dry dichloromethane (40 ml) were added grinded 4A molecular sieves (4.4 g). Then, 2-cyanoethyl tetraisopropylphosphoro-diamidite (4903 mg, 16.27 mmol, 5.16 ml, 1.3 equiv) was added via a syringe and stirred at room temperature for 10 minutes. Then, a solution of ST20 (6000 mg, 12.51 mmol) in dry dichloromethane (20 ml) was added to the reaction mixture over a period of 10 minutes. The reaction mixture was filtered over a cotton plug followed by concentrating in vacuo. Purification by flash column chromatography was performed twice (10-100% EtOAc in heptane) to obtain ST21 as a pale yellow oil (6.9 g, yield 74%). .sup.1H NMR (400 MHz, DMSO-d.sub.6) 7.81 (d, J=9.3 Hz, 1H), 5.21 (d, J=3.4 Hz, 1H), 4.97 (dd, J=11.2, 3.4 Hz, 1H), 4.55 (d, J=8.5 Hz, 1H), 4.03 (d, J=3.0 Hz, 3H), 3.88 (dt, J=11.2, 8.9 Hz, 1H), 3.82-3.45 (m, 16H), 2.77 (t, J=6.1 Hz, 2H), 2.11 (s, 3H), 2.00 (s, 3H), 1.89 (s, 3H), 1.77 (s, 3H), 1.13 (dd, J=6.8, 3.1 Hz, 12H).
##STR00015##
(3aR,5R,6R,7R,7aR)-5-(acetoxymethyl)-2-methyl-5,6,7,7a-tetrahydro-3aH-pyrano[3,2-d]oxazole-6,7-diyl diacetate (15)
[0185] To a suspension of Galactosamine pentaacetate (125 g, 321 mmol) in dichloromethane (870 mL) at room temperature was added, via drop wise addition, trimethylsilyltrifluoromethanesulfonate (107 g, 482 mmol, 87 mL, 1.5 equiv) over a period of 30 minutes. The reaction mixture was heated to 40 C. for a period of 2 hours, after which it was cooled back to room temperature and quenched by pouring in an ice-cold aqueous saturated NaHCO.sub.3 solution (1000 mL). The layers were separated and the aqueous layer was extracted twice more with dichloromethane (2300 mL). The combined organic layers were washed with water (500 mL) and brine (800 mL), followed by drying over Na.sub.2SO.sub.4. After concentrating in vacuo 15 was obtained as a pale yellow oil (109 g, crude yield 103%). .sup.1H NMR (400 MHz, Chloroform-d) 6.00 (d, J=6.8 Hz, 1H), 5.47 (t, J=3.0 Hz, 1H), 4.91 (dd, J=7.4, 3.3 Hz, 1H), 4.29-4.06 (m, 3H), 4.03-3.97 (m, 1H), 2.13 (s, 3H), 2.07 (d, J=1.0 Hz, 6H), 2.06 (d, J=1.3 Hz, 3H).
(2R,3R,4R,5R,6R)-5-acetamido-2-(acetoxymethyl)-6-(4-(benzyloxy)butoxy)tetrahydro-2H-pyran-3,4-diyl diacetate (16)
[0186] To a solution of 15 (109 g, 331 mmol) in dichloromethane (1200 mL) were added powdered molsieves 4A (75 g) followed by stirring for 15 minutes at room temperature. To the mixture was added 4-benzyloxy-1-butanol (89 g, 497 mmol, 87 mL, 1.5 equiv) and stirring was continued for another 15 minutes. Then, via dropwise addition, was added trimethylsilyltrifluoromethanesulfonate (44.1 g, 199 mmol, 36.0 mL, 0.6 equiv) over a period of 15 minutes. Stirring of the reaction mixture was continued for 2 hours. Filtration of the mixture was performed over a plug of kieselguhr followed by rinsing once with dichloromethane (200 mL). The filtrate was then quenched by pouring in an ice-cold saturated aqueous NaHCO.sub.3 solution (1000 mL). The layers were separated followed by extracting the aqueous layer twice more with dichloromethane (2500 mL). The combined organic layers were washed with water (600 mL) and brine (600 mL) followed by drying over Na.sub.2SO.sub.4. After concentrating in vacuo, purification was performed by flash column chromatography on silica neutralized with 1% Et.sub.3N (20-80% EtOAc in heptane) to obtain 16 as a colourless oil which slowly crystalized (109 g, yield 65%). .sup.1H NMR (400 MHz, DMSO-d.sub.6) 7.83 (d, J=9.3 Hz, 1H), 7.39-7.23 (m, 5H), 5.21 (d, J=3.5 Hz, 1H), 4.96 (dd, J=11.2, 3.5 Hz, 1H), 4.48 (d, J=8.5 Hz, 1H), 4.44 (s, 2H), 4.07-3.97 (m, 3H), 3.87 (dt, J=11.2, 8.8 Hz, 1H), 3.72 (p, J=5.3 Hz, 1H), 3.49-3.37 (m, 3H), 2.10 (s, 3H), 1.99 (s, 3H), 1.89 (s, 3H), 1.76 (s, 3H), 1.54 (qd, J=8.0, 5.2, 4.6 Hz, 4H).
(2R,3R,4R,5R,6R)-5-acetamido-2-(acetoxymethyl)-6-(4-hydroxybutoxy)tetrahydro-2H-pyran-3,4-diyl diacetate (17)
[0187] To a solution of 16 (109.6 g, 215 mmol) in tetrahydrofuran (1000 mL) and 2-propanol (1000 mL) was added 10% palladium on carbon (17.17 g, 16.13 mmol, 10%, 0.075 equiv) and the flask was charged with hydrogen (atmospheric pressure). Stirring of the reaction mixture was continued overnight at room temperature. The mixture was filtered over a plug of kieselguhr and concentrated in vacuo. After stripping the material twice with toluene (2300 mL) and dichloromethane (2300 mL), 17 was obtained as a white sticky solid (87 g, yield 97%). .sup.1H NMR (400 MHz, Methanol-d.sub.4) 5.33 (dd, J=3.5, 1.0 Hz, 1H), 5.05 (dd, J=11.3, 3.3 Hz, 1H), 4.55 (d, J=8.5 Hz, 1H), 4.20-3.97 (m, 4H), 3.87 (dt, J=10.1, 5.8 Hz, 1H), 3.60-3.48 (m, 3H), 3.30 (p, J=1.8 Hz, 1H), 2.14 (s, 3H), 2.02 (s, 3H), 1.94 (s, 3H), 1.92 (s, 3H), 1.61 (dtd, J=16.8, 11.0, 10.1, 3.6 Hz, 4H).
(2R,3R,4R,5R,6R)-5-acetamido-2-(acetoxymethyl)-6-(4-(((2-cyanoethoxy)(diisopropylamino)phosphino)oxy)butoxy)tetrahydro-2H-pyran-3,4-diyl diacetate (ST23)
[0188] To a solution of 4,5-dicyanoimidazole (1.940 g, 16.43 mmol, 0.65 equiv) in dry acetonitrile (20 mL) and dry dichloromethane (20 mL), under an argon atmosphere, were added grinded Molsieves 4A (9 g). Then, 2-cyanoethyl tetraisopropylphosphoro-diamidite (10.00 g, 33.2 mmol, 10.53 mL, 1.31 equiv) was added via a syringe and stirred at room temperature for 10 minutes. Via drop wise addition was then added a solution of 17 (10.6 g, 25.3 mmol) in dry dichloromethane (50 mL) over a period of 10 minutes. After stirring for an additional 30 minutes, the reaction mixture was filtered over a cotton plug and concentrated in vacuo. Purification of the material was performed by multiple flash column chromatograph steps (0-100% EtOAc in heptane with 5% Et.sub.3N) to obtain ST23 as a pale yellow oil (11.75 g, yield 72%). .sup.1H NMR (400 MHz, DMSO-d.sub.6) 7.82 (d, J=9.2 Hz, 1H), 5.21 (d, J=3.4 Hz, 1H), 4.96 (dd, J=11.2, 3.5 Hz, 1H), 4.48 (d, J=8.5 Hz, 1H), 4.02 (s, 3H), 3.93-3.82 (m, 1H), 3.78-3.65 (m, 3H), 3.64-3.49 (m, 4H), 3.48-3.40 (m, 1H), 2.76 (t, J=5.9 Hz, 2H), 2.11 (s, 3H), 2.00 (s, 3H), 1.89 (s, 3H), 1.77 (s, 3H), 1.62-1.46 (m, 4H), 1.13 (dd, J=6.8, 3.6 Hz, 12H). .sup.31P NMR (162 MHz, Chloroform-d) 147 (d, J=8.6 Hz)
##STR00016##
6-(benzyloxy)hexan-1-ol (18)
[0189] To a cooled and vigerously stirred suspension of sodium hydride (90 g, 2242 mmol, 3.5 equiv) in tetrahydrofuran (500 mL) was added, via dropwise addition, a solution of 1,6-hexanediol (265 g, 2242 mmol, 3.5 equiv) in tetrahydrofuran (1000 mL) over a period of one hour. After stirring for an additional 30 minutes, a solution of benzyl bromide (76 mL, 641 mmol, 1 equiv) in tetrahydrofuran (500 mL) was added over a period of 30 minutes. Upon complete addition, the reaction mixture was allowed to reach room temperature and stirring was continued overnight. The reaction mixture was cooled to a temperature of 5 C. followed by the slow addition of water (200 mL). The mixture was then concentrated in vacuo, redissolved in dichloromethane (600 mL) and washed with water (3000 mL). The aqueous layer was extracted three more times with dichloromethane (3500 mL). The combined organic layers were washed with water (3400 mL) and brine (1500 mL) followed by drying over Na.sub.2SO.sub.4 and concentrating in vacuo. Purification was performed by gravity column chromatography (0-50% EtOAc in heptane) to obtain 18 (25 g, yield 20%). .sup.1H NMR (400 MHz, Chloroform-d) 7.40-7.27 (m, 5H), 4.50 (s, 2H), 3.64 (t, J=6.7 Hz, 2H), 3.47 (t, J=6.6 Hz, 2H), 1.68-1.51 (m, 4H), 1.47-1.31 (m, 4H), 1.27 (s, 1H).
(2R,3R,4R,5R,6R)-5-acetamido-2-(acetoxymethyl)-6-((6-(benzyloxy)hexyl)oxy)tetrahydro-2H-pyran-3,4-diyl diacetate (ST30Bn)
[0190] To a solution of 15 (28 g, 85 mmol) in dichloromethane (320 mL) were added powdered molsieves 4A (10 g) followed by stirring for 5 minutes. Then, 18 (26.6 g, 128 mmol, 1.5 equiv) was added and stirring was continued for another 15 minutes. Trimethylsilyl trifluoromethanesulfonate (9.26 mL, 51.0 mmol, 0.6 equiv) was added, via drop wise addition, over a period of 15 minutes. Stirring was continued at room temperature for 2 hours. The reaction mixture was filtered over a cotton plug followed by quenching with an ice-cold saturated aqueous NaHCO.sub.3 solution (300 mL). The layers were separated and extraction was performed twice more with dichloromethane (2150 mL). The combined organic layers were washed with water (150 mL) and brine (150 mL) followed by drying over Na.sub.2SO4 and concentrating in vacuo. Purification was performed by flash column chromatography (20-100% EtOAc in heptane) to obtain ST30Bn as a colourless oil (25 g, yield 55%). .sup.1H NMR (400 MHz, Chloroform-d) 7.38-7.27 (m, 5H), 5.43 (t, J=6.9 Hz, 1H), 5.38-5.27 (m, 2H), 4.71 (d, J=8.3 Hz, 1H), 4.50 (s, 2H), 4.21-4.07 (m, 2H), 3.96-3.81 (m, 3H), 3.47 (t, J=6.3 Hz, 3H), 2.14 (s, 3H), 2.05 (s, 3H), 2.00 (s, 3H), 1.94 (s, 3H), 1.68-1.51 (m, 4H), 1.44-1.30 (m, 4H).
(2R,3R,4R,5R,6R)-5-acetamido-2-(acetoxymethyl)-6-((6-hydroxyhexyl)oxy)tetrahydro-2H-pyran-3,4-diyl diacetate (ST30)
[0191] To a solution of ST30Bn (29 g, 54 mmol) in tetrahydrofuran (250 mL) and 2-Propanol (250 mL) was added 10% palladium on carbon (0.582 g, 0.547 mmol, 0.075 equiv). The flask was charged with hydrogen (atmospheric pressure) and stirring of the mixture was continued overnight at room temperature. The reaction mixture was filtered over a plug of kieselguhr and the filtrate was concentrated in vacuo. After stripping twice with toluene (2200 mL) and dichloromethane (2200 mL) ST30 was obtained as a colourless oil (24 g, yield 99%). .sup.1H NMR (400 MHz, Methanol-d4) 5.37-5.26 (m, 1H), 5.10-4.97 (m, 1H), 4.67-4.48 (m, 2H), 4.20-3.93 (m, 4H), 3.92-3.77 (m, 1H), 3.52 (hept, J=9.4, 8.1 Hz, 3H), 3.36-3.23 (m, 1H), 2.17-2.09 (m, 3H), 2.05-1.98 (m, 3H), 1.97-1.87 (m, 6H), 1.63-1.45 (m, 4H), 1.43-1.29 (m, 4H).
(2R,3R,4R,5R,6R)-5-acetamido-2-(acetoxymethyl)-6-((6-(((2-cyanoethoxy)(diisopropylamino)phosphino)oxy)hexyl)oxy)tetrahydro-2H-pyran-3,4-diyl diacetate (ST31)
[0192] To a solution of ST30 (21.2 g, 47.4 mmol) in dry dichloromethane (550 mL), under an argon atmosphere, was added DIPEA (83 mL, 474 mmol, 10 equiv) and Molsieves 4A (30 g). The reaction mixture was cooled to a temperature of 0 C. followed by the drop wise addition of 2-cyanoethyl N,N-diisopropylchlorophosphoramidite (13.46 g, 56.9 mmol, 1.2 equiv) over a period of 10 minutes. Stirring of the mixture was continued while allowing it to warm up over a period of 30 minutes. The reaction mixture was filtered over a cotton plug and directly coated on, with Et.sub.3N treated, silica (60 g). Purification was performed by flash column chromatography (10-60% EtOAc in heptane, 5% Et.sub.3N) to obtain ST31 as a yellow tar (24.8 g, yield 78%). .sup.1H NMR (400 MHz, DMSO-d.sub.6) 7.82 (d, J=9.2 Hz, 1H), 5.21 (d, J=3.4 Hz, 1H), 4.96 (dd, J=11.3, 3.4 Hz, 1H), 4.48 (d, J=8.5 Hz, 1H), 4.02 (s, 3H), 3.91-3.81 (m, 1H), 3.79-3.63 (m, 3H), 3.63-3.49 (m, 4H), 3.45-3.37 (m, 1H), 2.76 (t, J=5.8 Hz, 2H), 2.10 (s, 3H), 2.00 (s, 3H), 1.89 (s, 3H), 1.77 (s, 3H), 1.58-1.40 (m, 4H), 1.37-1.22 (m, 4H), 1.13 (dd, J=6.8, 3.9 Hz, 12H).
Example 2Synthesis of the Trebler Synthons
[0193] ##STR00017##
3,3-((2-amino-2-((2-cyanoethoxy)methyl)propane-1,3-diyl)bis(oxy))dipropanenitrile (11)
[0194] To a vigerously stirred mixture of tris (50 g, 413 mmol) and 40% aqueous KOH (5.96 g, 42.5 mmol, 5.68 mL, 0.1 equiv) in 1,4-dioxane (100 mL) at 0 C. was added, via drop wise addition, acrylonitril (75 g, 1420 mmol, 94 mL, 3.44 equiv) over a period of 60 minutes. Upon complete addition the ice bath was removed and stirring of the mixture was continued overnight. To the mixture was added 1M aqueous HCl until pH=7. Additional water (100 mL) was added and the product was extracted with dichloromethane (2200 mL). The combined organic layers were dried over Na.sub.2SO.sub.4 and concentrated in vacuo. Purification was performed by gravity column chromatography (0-4% MeOH in dichloromethane) to obtain 11 as a yellow oil (78 g, yield 67%). .sup.1H NMR (400 MHz, Chloroform-d) 3.70 (td, J=6.0, 2.5 Hz, 6H), 3.45 (d, J=2.8 Hz, 6H), 2.63 (qd, J=5.7, 1.8 Hz, 6H), 1.61 (s, 2H).
diethyl 3,3-((2-amino-2-((3-ethoxy-3-oxopropoxy)methyl)propane-1,3-diyl)bis(oxy))dipropanoate (12)
[0195] A solution of 11 (78 g, 278 mmol) in ethanol (400 mL) was bubbled through with hydrochloric acid gas for 15 minutes to obtain an opaque reaction mixture. this mixture was then refluxed overnight to observe the formation of ammonium chloride. The reaction mixture was cooled back to room temperature and bubbled through with nitrogen. Filtration was performed over a glass filter to remove the solids, followed by concentrating the filtrate in vacuo. The obtained brown oil was dissolved in dichloromethane (500 mL) and washed twice with aqueous saturated NaHCO.sub.3 solution (2500 mL) and twice with water (2500 mL). The organic layer was dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The obtained brown oil was redissolved in ethanol (400 mL), bubbled through with hydrochloric acid gas and refluxed overnight. The next day, the newly formed ammonium chloride was filtered off and the filtrate was concentrated in vacuo. The obtained yellow oil was dissolved in dichloromethane (500 mL) and washed twice with aqueous saturated NaHCO.sub.3 solution (2500 mL) and twice with water (2500 mL). to obtain 12 as a yellow oil (63 g, yield 54%). .sup.1H NMR (400 MHz, Chloroform-d) 4.15 (q, J=7.1 Hz, 6H), 3.69 (t, J=6.4 Hz, 6H), 3.31 (s, 6H), 2.55 (t, J=6.4 Hz, 6H), 1.57 (s, 2H), 1.27 (t, J=7.2 Hz, 9H).
diethyl 3,3-((2-(((benzyloxy)carbonyl)amino)-2-((3-ethoxy-3-oxopropoxy)methyl)propane-1,3-diyl)bis(oxy))dipropanoate (13)
[0196] To a solution of 12 (63 g, 149 mmol) in 1,4-dioxane (630 mL) was added a solution of potassium carbonate (22.72 g, 164 mmol, 1.1 equiv) in water (63 mL). Then, the mixture was cooled to a temperature of 10 C. and via drop wise addition, over a period of 30 minutes, was added benzyl chloroformate (33.1 g, 194 mmol, 27.7 mL, 1.3 equiv). Stirring of the yellow suspension was continued overnight at room temperature. The reaction mixture was acidified to pH2 by the addition of 6M aqueous HCl. The white solids were removed by filtration over a glass filter and the filtrate was concentrated in vacuo. Purification was performed by gravity column chromatography (15-40% EtOAc in heptane) to obtain 13 as a pale yellow oil (68 g, yield 82%). .sup.1H NMR (400 MHz, Chloroform-d) 7.38-7.28 (m, 5H), 5.26 (s, 1H), 5.04 (s, 2H), 4.13 (q, J=7.1 Hz, 6H), 3.75-3.60 (m 12H), 2.52 (t, J=6.3 Hz, 6H), 1.24 (t, J=7.1 Hz, 9H).
3,3-((2-((3-hydroxypropoxy)methyl)-2-(methylamino)propane-1,3-diyl)bis(oxy))bis(propan-1-ol) (14)
[0197] A solution of 2.4 M lithium aluminium hydride in tetrahydrofuran (37.5 mL, 90 mmol, 10 equiv) in dry tetrahydrofuran (100 mL) was cooled to a temperature of 13 C. Then, to the reaction mixture was added a solution of 13 (5 g, 9.00 mmol, 1 equiv) in dry tetrahydrofuran (50 mL), via drop wise addition, over a period of one hour. Stirring of the reaction mixture was continued overnight while allowing it to slowly reach room temperature. Upon cooling, the reaction was quenched by the slow addition of water (3.4 mL), 4M aqueous NaOH (3.4 mL) and water (10 mL). The white precipitate was removed by filtration over a dry Na.sub.2SO.sub.4 plug followed by rinsing twice with tetrahydrofuran. The filtrate was concentrated in vacuo to obtain crude 14 as a pale yellow oil (2.92 g, yield corrected for purity 810%). .sup.1H NMR (400 MHz, Chloroform-d) 3.78-3.70 (m, 6H), 3.63 (q, J=5.8 Hz, 6H), 3.42 (s, 6H), 2.91 (br, 3H), 2.35 (s, 3H), 1.80 (p, J=5.4 Hz, 6H), 1.72-1.66 (m, 1H).
9,9-bis((3-hydroxypropoxy)methyl)-2,2,3,3,8-pentamethyl-4,11-dioxa-8-aza-3-silatetradecan-14-ol (ST47)
[0198] To a solution of 14 (2.9 g, 7.22 mmol) and 3-(tert-Butyldimethylsiloxy)propionaldehyde (1.863 mL, 7.94 mmol, 1.1 equiv) in dichloromethane (58 mL) was added sodium triacetoxyborohydride (2.294 g, 10.83 mmol, 1.5 equiv). Stirring was continued for 1.5 hours at room temperature, followed by pouring the reaction mixture in a saturated aqueous solution of NaHCO.sub.3 (25 mL). The layers were separated and the aqueous layer was extracted once more with dichloromethane (25 mL). The combined organic layers were dried over Na.sub.2SO.sub.4 and concentrated in vacuo. Purification of the crude material was performed by flash column chromatography (0-10% MeOH in dichloromethane) to obtain ST47 as a pale yellow oil (1.27 g, yield 33%). .sup.1H NMR (400 MHz, Chloroform-d) 3.75 (t, J=5.4 Hz, 6H), 3.66-3.56 (m, 8H), 3.50 (s, 6H), 3.11 (br s, 3H), 2.64 (t, J=7.3 Hz, 2H), 2.33 (s, 3H), 1.80 (p, J=5.4 Hz, 6H), 1.64 (p, J=6.3 Hz, 2H), 0.90 (s, 9H), 0.05 (s, 6H).
8-((3-(bis(4-methoxyphenyl)(phenyl)methoxy)propoxy)methyl)-N-(3-((tert-butyldimethylsilyl)oxy)propyl)-1,1,15,15-tetrakis(4-methoxyphenyl)-N-methyl-1,15-diphenyl-2,6,10,14-tetraoxapentadecan-8-amine (ST47DMTrTBDMS)
[0199] Residual water was removed from ST47 (1.27 g, 2.42 mmol) by stripping twice with pyridine, followed by redissolving in pyridine (60 mL) under an argon atmosphere. To the reaction mixture were added molecular sieves 4A (4 g) and stirring was continued for 15 minutes. Solid DMTrCl (4.16 g, 12.28 mmol, 5 equiv) was added in batches over a period of 15 minutes. Stirring of the now dark orange mixture was continued overnight at room temperature. The reaction was quenched by the addition of MeOH (4.4 mL, 109 mmol, 45 equiv) and it was stirred for 5 minutes. Then, the reaction mixture was filtered over a cotton plug and the filtrate was coated on, with Et.sub.3N neutralized, silica (10 g). Purification was performed by flash column chromatography (0-100% EtOAc in heptane, 5% Et.sub.3N) to obtain ST47DMTrTBDMS as a yellow foaming oil (2.37 g, yield 52%). .sup.1H NMR (400 MHz, Chloroform-d) 7.43-7.37 (m, 6H), 7.32-7.21 (m, 18H), 7.19-7.13 (m, 3H), 6.81-6.76 (m, 12H), 3.75 (s, 18H), 3.54 (q, J=6.2, 5.4 Hz, 2H), 3.39 (t, J=6.5 Hz, 6H), 3.32 (s, 6H), 3.07 (t, J=6.5 Hz, 6H), 2.51 (t, J=7.4 Hz, 2H), 2.19 (s, 3H), 1.80 (p, J=6.4 Hz, 6H), 1.62-1.52 (m, 2H), 0.86 (s, 9H), 0.01 (s, 6H).
3-((8-((3-(bis(4-methoxyphenyl)(phenyl)methoxy)propoxy)methyl)-1,1,15,15-tetrakis(4-methoxyphenyl)-1,15-diphenyl-2,6,10,14-tetraoxapentadecan-8-yl)(methyl)amino)propan-1-ol (ST47DMTrOH)
[0200] To a solution of ST47DMTrTBDMS (2.37 g, 1.280 mmol) in dry tetrahydrofuran (20 mL) was added a 1.0M TBAF solution in THF (1.433 mL, 1.433 mmol, 1.17 equiv) and the solution was stirred overnight. The material was coated on, with Et.sub.3N treated, silica and purification was performed by flash column chromatography (0-100% EtOAc in heptane) to obtain ST47DMTrOH as a white solid (1.37 g, yield 84%). .sup.1H NMR (400 MHz, Chloroform-d) 7.43-7.38 (m, 6H), 7.32-7.22 (m, 18H), 7.19-7.14 (m, 3H), 6.82-6.76 (m, 12H), 3.75 (s, 18H), 3.63 (t, J=4.9 Hz, 2H), 3.38 (t, J=6.4 Hz, 6H), 3.31 (s, 6H), 3.07 (t, J=6.4 Hz, 6H), 2.66 (t, 2H), 2.15 (s, 3H), 1.80 (p, J=6.3 Hz, 6H), 1.58-1.46 (m, 3H).
3-((8-((3-(bis(4-methoxyphenyl)(phenyl)methoxy)propoxy)methyl)-1,1,15,15-tetrakis(4-methoxyphenyl)-1,15-diphenyl-2,6,10,14-tetraoxapentadecan-8-yl)(methyl)amino)propyl (2-cyanoethyl) diisopropylphosphoramidite (ST48)
[0201] To a solution of ST47DMtrOH (1.37 g, 1.075 mmol) in dry dichloromethane (20 mL) was added DIPEA (1.87 mL, 10.75 mmol, 10 equiv) and molecular sieves 4A (4 g) followed by cooling to a temperature of 0 C. Then, to the reaction was added 2-cyanoethyl N,N-diisopropylchlorophosphoramidite (0.305 g, 1.290 mmol, 1.2 equiv) via drop wise addition over a period of 5 minutes. Stirring of the reaction mixture was continued for another 15 minutes while allowing it to reach room temperature. The reaction mixture was filtered over a cotton plug and the filtrate was coated on, with Et.sub.3N treated, silica (6 g). Purification was performed by flash column chromatography (0-100% EtOAc in heptane, 5% Et.sub.3N) to obtain ST48 as a colourless tar (1.27 g, yield 80%). .sup.1H NMR (400 MHz, Chloroform-d) 7.43-7.37 (m, 6H), 7.33-7.21 (m, 18H), 7.20-7.13 (m, 3H), 6.82-6.75 (m, 12H), 3.83-3.68 (m, 20H), 3.66-3.48 (m, 4H), 3.38 (t, J=6.5 Hz, 6H), 3.31 (s, 6H), 3.07 (t, J=6.4 Hz, 6H), 2.60-2.48 (m, 4H), 2.19 (s, 3H), 1.80 (p, J=6.5 Hz, 6H), 1.66 (p, J=6.9 Hz, 2H), 1.15 (t, J=7.1 Hz, 12H).
##STR00018##
di-tert-butyl 4-(3-(tert-butoxy)-3-oxopropyl)-4-((3-((tert-butyldimethylsilyl) oxy)propyl)amino)heptanedioate (5)
[0202] To a solution of aminotriester (1 g, 2.406 mmol) in dichloromethane (10 ml) was added 3-(tert-Butyldimethylsiloxy)propionaldehyde (0.565 ml, 2.406 mmol) and stirring was continued for 45 minutes. Then, to the reaction mixture was added sodium triacetoxyborohydride (1.530 g, 7.22 mmol) and stirring of the reaction mixture was continued at room temperature for 2 hours. The reaction mixture was washed with an aqueous saturated NaHCO.sub.3 solution (10 mL). the organic layer was filtered over a phase separator and the filtrate was concentrated in vacuo. Purification was performed by flash column chromatography (0-20% EtOAc in heptane) to obtain 5 as a colourless oil (1.07 g, 76% yield). .sup.1H NMR (400 MHz, Chloroform-d) 3.68 (t, J=6.1 Hz, 2H), 2.50 (t, J=6.6 Hz, 2H), 2.23-2.10 (m, 6H), 1.66-1.50 (m, 8H), 1.44 (s, 27H), 0.89 (s, 9H), 0.05 (s, 6H).
di-tert-butyl 4-(3-(tert-butoxy)-3-oxopropyl)-4-((3-((tert-butyldimethylsilyl)oxy)propyl)(methyl)amino)heptanedioate (6)
[0203] A solution of 5 (1 g, 1.701 mmol), acetic acid (0.097 ml, 1.701 mmol) and formaldehyde 37% in water (1.266 ml, 17.01 mmol) in methanol (10 ml) was stirred for 30 minutes at room temperature. Then, sodium cyanoborohydride (0.321 g, 5.10 mmol) was added and stirring was continued for 2 hours. To the reaction was added a saturated solution of Na.sub.2CO.sub.3 (10 mL) and this was stirred vigerously. Additional water was added (15 mL) and the aqueous layer was extracted twice with EtOAc (20 mL). The combined organic layers were washed with brine (20 ml) and dried over Na.sub.2SO.sub.4. After concentrating in vacuo 6 was obtained (1.00 g, 98% yield). .sup.1H NMR (400 MHz, Chloroform-d) 3.62 (t, J=6.6 Hz, 2H), 2.54 (t, J=7.2 Hz, 2H), 2.28-2.15 (m, 9H), 1.78-1.55 (m, 8H), 1.44 (s, 28H), 0.89 (s, 9H), 0.05 (s, 6H).
4-((3-((tert-butyldimethylsilyl)oxy)propyl)(methyl)amino)-4-(3-hydroxypropyl)heptane-1,7-diol (7)
[0204] To a cooled solution of 2.4 M lithium aluminium hydride in THF (0.757 g, 19.94 mmol) in dry tetrahydrofuran (20 ml) was added a solution of 6 (1 g, 1.661 mmol) in dry tetrahydrofuran (10 ml) via drop wise addition. The reaction mixture was allowed to warm up to room temperature and stirring was continued overnight. The reaction mixture was cooled to a temperature of 11 C. followed by the drop wise addition of water (0.76 mL), 4M NaOH (0.76 mL) and additional water (2.3 mL). The obtained white suspension was filtered over a kieselguhr plug and concentrated in vacuo to obtain 7 as a pale yellow oil (677 mg, 85% purity, 88% yield). .sup.1H NMR (400 MHz, Chloroform-d) 3.67-3.53 (m, 8H), 2.71 (t, J=7.9 Hz, 2H), 2.36 (s, 3H), 1.76-1.50 (m, 14H), 1.28 (s, 3H), 0.89 (s, 9H), 0.05 (s, 6H).
1,7-bis(bis(4-methoxyphenyl)(phenyl)methoxy)-4-(3-(bis(4-methoxyphenyl) (phenyl)methoxy)propyl)-N-(3-((tert-butyldimethylsilyl)oxy)propyl)-N-methylheptan-4-amine (ST49)
[0205] 7 (0.677 g, 1.729 mmol) was stripped twice with pyridine, followed by redissolving in pyridine (7 ml) and placing under a nitrogen atmosphere. Then, to the reaction mixture was added DMTrCl (2.64 g, 7.78 mmol) via batch wise addition to obtain a dark red solution. Stirring was continued overnight at room temperature to obtain a brown suspension. The material was coated on, with Et.sub.3N neutralized, silica and purification was performed by flash column chromatography (0-40% EtOAc in heptane both treated with 5% Et.sub.3N) to obtain ST49 as a yellow foaming solid (1.4 g, 55% yield). .sup.1H NMR (400 MHz, Chloroform-d) 7.47-7.40 (m, 6H), 7.37-7.21 (m, 18H), 7.20-7.13 (m, 3H), 6.82-6.74 (m, 12H), 3.75 (s, 18H), 3.61 (t, J=6.5 Hz, 2H), 3.00 (t, J=6.4 Hz, 6H), 2.54 (t, J=7.1 Hz, 2H), 2.23 (s, 3H), 1.67-1.52 (m, 8H), 1.46-1.33 (m, 6H), 0.84 (s, 9H), 0.01 (s, 6H).
3-((1,7-bis(bis(4-methoxyphenyl)(phenyl)methoxy)-4-(3-(bis(4-methoxyphenyl)(phenyl)methoxy)propyl)heptan-4-yl)(methyl)amino)propan-1-ol (ST490H)
[0206] To a solution of ST49 (1.4 g, 0.949 mmol) in dry tetrahydrofuran (23 ml) was added 1M TBAF in THF (1.613 ml, 1.613 mmol) via a single stream and stirring of the orange solution was continued overnight. The reaction mixture was coated on, with Et.sub.3N neutralized, silica and purification was performed by flash column chromatography (0-70% EtOAc in heptane both treated with 5% Et.sub.3N) to obtain ST490H as a white foam (853 mg, 73% yield). .sup.1H NMR (400 MHz, Chloroform-d) 7.46-7.38 (m, 6H), 7.36-7.20 (m, 18H), 7.20-7.13 (m, 3H), 6.82-6.74 (m, 12H), 3.82-3.70 (m, 20H), 3.03 (t, J=5.9 Hz, 6H), 2.80 (t, J=5.4 Hz, 2H), 2.28 (s, 3H), 1.73-1.45 (m, 15H).
3-((1,7-bis(bis(4-methoxyphenyl)(phenyl)methoxy)-4-(3-(bis(4-methoxyphenyl)(phenyl)methoxy)propyl)heptan-4-yl)(methyl)amino)propyl (2-cyanoethyl) diisopropylphosphoramidite (ST50)
[0207] ST490H (852 mg, 0.719 mmol) was dissolved in dry dichloromethane (10 mL) followed by the addition of 4A molecular sieves (1.7 g) and DIPEA (1.256 ml, 7.19 mmol). The mixture was cooled to a temperature of 15 C. and to this was added 2-CyanoethylN,N-diisopropylchlorophosphoramidite (203 mg, 0.856 mmol) via drop wise addition over a period of 10 minutes. Stirring of the reaction mixture was continued while allowing it to reach room temperature. The reaction mixture was filtered over a cotton plug followed by coating on, with ET.sub.3N treated, silica. Purification was performed by flash column chromatography (0-40% EtOAc in heptane both treated with 5% Et.sub.3N) to obtain ST50 as a pale yellow tar (624 mg, 62% yield). .sup.1H NMR (400 MHz, Chloroform-d) 7.47-7.40 (m, 6H), 7.35-7.21 (m, 18H), 7.21-7.13 (m, 3H), 6.83-6.74 (m, 12H), 3.74 (s, 21H), 3.62-3.49 (m, 3H), 3.00 (t, J=6.3 Hz, 6H), 2.65-2.43 (m, 4H), 2.23 (s, 3H), 1.77-1.67 (m, 2H), 1.63-1.50 (m, 6H), 1.49-1.33 (m, 6H), 1.13 (dd, J=18.3, 6.7 Hz, 12H).
Example 3Synthesis of Nucleic Acid Conjugates
[0208] All Oligonucleotides were synthesized on an AKTA oligopilot synthesizer. Commercially available solid support and 2O-Methyl RNA phosphoramidites, 2Fluoro, 2Deoxy RNA phosphoramidites and commercially available long trebler phosphoramidite (STKS) (Glen research) were used. Oligonucleotide synthesis, deprotection and purification followed standard procedures that are known in the art. Oligonucleotide and oligonucleotide conjugate synthesis was performed by a commercial oligonucleotide manufacturer (Biospring, Frankfurt, Germany).
##STR00019##
[0209] Conjugation of the GalNAc synthons (ST21, ST23, ST31) or trebler synthons (STKS, ST48, ST50) was achieved by coupling of the respective phosphoramidite to the 5 end of the oligochain under standard phosphoramidite coupling conditions. Phosphorothioates were introduced using standard commercially available thiolation reagents (EDITH, Link technologies).
[0210] The single strands were cleaved off the CPG by using aqueous Methylamine and the resulting crude oligonucleotide was purified by Ionexchange chromatography (Resource Q, 6 mL, GE Healthcare) on a AKTA Pure HPLC System using a Sodium chloride gradient. Product containing fractions were pooled, desalted on a size exclusion column (Zetadex, EMP Biotech) and lyophilised.
[0211] For Duplexation, equimolar amounts of the respective single strands were dissolved in water and heated to 80 C. for 5 min. After cooling the resulting Duplex was lyophilised.
Sequences
[0212] Modifications key for the following sequences:
f denotes 2Fluoro 2deoxyribonucleotide
m denotes 2O Methyl ribonucleotide
(ps) denotes phosphorothioate linkage
TABLE-US-00002 STS016L14 Antisensestrand: 5mU(ps)fU(ps)mAfUmAfGmAfGmCfAmAfG mAfAmCfAmCfUmG(ps)fU(ps)mU3 Sensestrand: (ST23(ps)).sub.3ST48(ps)fAmAfCmAfGmUfGmUfU mCfUmUfGmCfUmCfUmAfU(ps)mA(ps)fA STS016L15 Antisensestrand: 5mU(ps)fU(ps)mAfUmAfGmAfGmCfAmA fGmAfAmCfAmCfUmG(ps)fU(ps)mU3 Sensestrand: (ST31(ps)).sub.3ST48(ps)fAmAfCmAfGmUfGmU fUmCfUmUfGmCfUmCfUmAfU(ps)mA(ps)fA GN_Luc(nontargetingcontrol) Antisensestrand: 5mU(ps)fC(ps)mGfAmAfGmUfAmUfUmCfCm GfCmGfUmA(ps)fC(ps)mG3 Sensestrand: 5(ST23(ps)).sub.3STKS(ps)fCmGfUmAfCmGfCmG fGmAfAmUfAmCfUmUfC(ps)mG(ps)fA3
TABLE-US-00003 TABLE 2 Mass spectrometry data for oligonucleotides Oligonucleotide MS found MS calculated antisense strand (STS016 L14 6943 Da 6943.33 Da and L15) STS016 L14 sense strand 8372 Da 8375.52 Da STS016 L15 sense strand 8456 Da 8459.52 Da GN_Luc antisense 6260 Da 6259.93 Da GN_Luc sense 7799 Da 7800.21 Da
Example 4In Vitro Determination of TTR Knockdown of Various TTR siRNA GalNAc Conjugates
[0213] In vitro determination of TTR knockdown of various TTR siRNA GalNAc conjugates STS016 L14 and L15 was determined in a hepatocyte assay.
[0214] Primary Hepatocytes (Life technology) were seeded into 6 well plates (600,000 cells per well) according to manufacturer's protocol and incubated with the respective concentration of the GalNAc conjugate. Cells were harvested 24 h post incubation and RNA was isolated and analysed using Taqman analysis as described below:
Target Gene Expression In Vitro:
[0215] 25-100 ng total RNA was used for quantitative TaqMan RT-PCR with the amplicon sets obtained from BioTez GmBH, Berlin, Germany: The TaqMan RT-PCR reactions were carried out with an ABI PRISM 7700 Sequence Detector (Software: Sequence Detection System v1.6.3 (ABI Life Technologies)) or StepOnePlus Real Time PCR System (ABI) using a standard protocol for RT-PCR as described previously (Fehring et al.) 5 with primers and probes at a concentration of 300 and 100 nmol/l respectively. TaqMan data were calculated by using the comparative Ct method. mRNA level were normalised against PTEN.
TABLE-US-00004 AmpliconsetsfordetectionofTTRmRNA mmTTR:467U22TGGACACCAAATCGTACTGGAA mmTTR:550L22CAGAGTCGTTGGCTGTGAAAAC mmTTR:492U27FLACTTGGCATTTCCCCGTTCCATGAATT AmpliconsetsfordetectionofPTENmRNA PTENCACCGCCAAATTTAACTGCAGA PTENAAGGGTTTGATAAGTTCTAGCTGT PTENTGCACAGTATCCTTTTGAAGACCATAACCCA
[0216] Both siRNA GalNAc conjugates L14 and L15 were very effective in reducing TTR levels. Results are shown in
Example 5In Vivo Assay and Duration of TTR Knockdown in Mice
[0217] 8 weeks old male C57BL/6JOlaHsd mice were injected with the dose of 1 mg/kg with a single subcutaneous Injection of 300 uL/kg (4 animals per group). PBS was used as control.
[0218] Blood was taken after each timepoint (day 8, 15, 22 post injection) and analysed for TTR level using commercially available murineTTR specific Elisa Kit.
[0219] All different siRNA GalNAc conjugates STS016 L14 and STS016 L15 were very effective in reducing TTR levels. Results are shown in
REFERENCES
[0220] 1. Fire, A.; Xu, S.; Montgomery, M. K.; Kostas, S. A.; Driver, S. E.; Mello, C. C., Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 1998, 391 (6669), 806-11. [0221] 2. Elbashir, S. M.; Lendeckel, W.; Tuschl, T., RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes &development 2001, 15 (2), 188-200. [0222] 3. Dubber, M.; Frechet, J. M., Solid-phase synthesis of multivalent glycoconjugates on a DNA synthesizer. Bioconjugate chemistry 2003, 14 (1), 239-46. [0223] 4. Weigel, P. H.; Yik, J. H., Glycans as endocytosis signals: the cases of the asialoglycoprotein and hyaluronan/chondroitin sulfate receptors. Biochim Biophys Acta 2002, 1572 (2-3), 341-63. [0224] 5. Ishibashi, S.; Hammer, R. E.; Herz, J., Asialoglycoprotein receptor deficiency in mice lacking the minor receptor subunit. J Biol Chem 1994, 269 (45), 27803-6. [0225] 6. Biessen, E. A.; Broxterman, H.; van Boom, J. H.; van Berkel, T. J., The cholesterol derivative of a triantennary galactoside with high affinity for hepatic asialoglycoprotein receptor: a potent cholesterol lowering agent. J Med Chem 1995, 38 (11), 1846-52. [0226] 7. Akinc, A.; Querbes, W.; De, S.; Qin, J.; Frank-Kamenetsky, M.; Jayaprakash, K. N.; Jayaraman, M.; Rajeev, K. G.; Cantley, W. L.; Dorkin, J. R.; Butler, J. S.; Qin, L.; Racie, T.; Sprague, A.; Fava, E.; Zeigerer, A.; Hope, M. J.; Zerial, M.; Sah, D. W.; Fitzgerald, K.; Tracy, M. A.; Manoharan, M.; Koteliansky, V.; Fougerolles, A. d.; Maier, M. A., Targeted Delivery of RNAi Therapeutics With Endogenous and Exogenous Ligand-Based Mechanisms. Molecular therapy: the journal of the American Society of Gene Therapy 2010, 18 (7), 1357-1364. [0227] 8. Fehring, V.; Schaeper, U.; Ahrens, K.; Santel, A.; Keil, O.; Eisermann, M.; Giese, K.; Kaufnann, J., Delivery of therapeutic siRNA to the lung endothelium via novel Lipoplex formulation DACC. Mol Ther 2014, 22 (4), 811-20. [0228] 9. Prakash, T. P.; Brad Wan, W.; Low, A.; Yu, J.; Chappell, A. E.; Gaus, H.; Kinberger, G. A.; stergaard, M. E.; Migawa, M. T.; Swayze, E. E.; Seth, P. P., Solid-phase synthesis of 5-triantennary N-acetylgalactosamine conjugated antisense oligonucleotides using phosphoramidite chemistry. Bioorganic & medicinal chemistry letters 2015, 25 (19), 4127-4130. [0229] 10. Li, L.-C.; Okino, S. T.; Zhao, H.; Pookot, D.; Place, R. F.; Urakami, S.; Enokida, H.; Dahiya, R., Small dsRNAs induce transcriptional activation in human cells. Proceedings of the National Academy of Sciences 2006, 103 (46), 17337-17342.