Recombinant microorganism having enhanced 2,3-butanediol producing ability and method for producing 2,3-butanediol using the same

10947547 ยท 2021-03-16

Assignee

Inventors

Cpc classification

International classification

Abstract

Disclosed herein is a recombinant microorganism having enhanced 2,3-butanediol producing ability, wherein a pathway for converting pyruvate to acetyl-CoA, a pathway for converting pyruvate to formic acid, or a pathway for converting pyruvate to lactate is inhibited in a microorganism having acetyl-CoA and lactate biosynthetic pathways.

Claims

1. A recombinant microorganism having enhanced 2,3-butanediol producing ability and decreased lactate producing ability, decreased ethanol producing ability, decreased formic acid producing ability and decreased acetic acid producing ability as compared to a corresponding wild-type microorganism, wherein an ldhA gene encoding a lactate dehydrogenase and a pflB gene encoding a pyruvate formate lyase are deleted in the recombinant microorganism, wherein the recombinant microorganism is a recombinant Klebsiella oxytoca microorganism, and the corresponding wild-type microorganism is a wild-type Klebsiella oxytoca microorganism, wherein the recombinant microorganism has higher selectivity of 2,3-butanediol or higher 2,3-butanediol productivity than a recombinant Klebsiella oxytoca in which an ldhA gene and a gene encoding alcohol dehydrogenation enzyme which converts acetyl-CoA to ethanol are deleted, wherein the recombinant microorganism has a selectivity of 2,3-butanediol of 70% or more based on batch culture or fed-batch culture, wherein the selectivity of 2,3-butanediol is calculated as:
selectivity of 2,3-butanediol (%)={Production amount (g) of 2,3-butanediol/(production amounts (g) of 2,3-butanediol,ethanol,acetoin,succinic acid,lactate,formate, and acetic acid)}100, and wherein the 2,3-butanediol productivity is calculated as: 2,3-butanediol productivity (g/L/h): an amount of 2,3-butanediol in grams produced per unit time of hours and unit volume of liters.

2. The recombinant microorganism of claim 1, wherein a yield of 2,3-butanediol is 0.35 gram or more per gram of carbon source.

3. A method for producing 2,3-butanediol, the method comprising: culturing the recombinant microorganism of claim 1 in a cell culture under conditions suitable for the production of 2,3-butanediol; and recovering 2,3-butanediol from the culture.

4. The method of claim 3, wherein the culturing is performed under aerobic conditions.

5. The method of claim 3, wherein the culturing comprises agitating the culture at an agitation speed of 450 rpm or less.

6. The method of claim 3, wherein the culturing comprises agitating the culture, and reducing agitation speed when a concentration of acetoin in the culture is 5 g/L or more.

7. The method of claim 3, wherein the culturing comprises controlling an amount of oxygen supply to the culture to control 2,3-butanediol productivity.

8. The method of claim 3, wherein the culturing comprises agitating the culture, and controlling agitation speed to control 2,3-butanediol productivity.

Description

DESCRIPTION OF DRAWINGS

(1) FIG. 1 is a diagram illustrating a pathway in which 2,3-butanediol is synthesized in a Klebsiella strain.

(2) FIG. 2 is an agarose gel image obtained by PCR amplification and electrophoresis in order to confirm that ldhA which is a gene of lactate dehydrogenase associated with the occurrence of lactic acid is removed.

(3) FIG. 3 is an agarose gel image obtained by PCR amplification and electrophoresis in order to confirm that pflB which is a gene of pyruvate-formate lyase associated with occurrence of formate is removed.

(4) FIG. 4 illustrates fermentation results of a Klebsiella oxytoca strain of Comparative Example 1.

(5) FIG. 5 illustrates fermentation results of a recombinant Klebsiella oxytoca strain of Comparative Example 2.

(6) FIG. 6 illustrates fermentation results of a recombinant Klebsiella oxytoca strain of Example 1.

(7) FIGS. 7 to 11 illustrate batch fermentation results of a recombinant Klebsiella oxytoca strain of Example 1 depending on an agitation speed of 150 rpm (FIG. 7), 250 rpm (FIG. 8), 350 rpm (FIG. 9), and 450 rpm (FIG. 10) (FIG. 11: concentrations of 2,3-butanediol per hour depending on agitation speed).

(8) FIG. 12 illustrates fed-batch fermentation results of a recombinant Klebsiella oxytoca strain of Example 1 performed by retaining an agitation speed at 450 rpm under aerobic condition.

(9) FIG. 13 illustrates fed-batch fermentation results of a recombinant Klebsiella oxytoca strain of Example 1 performed by controlling an agitation speed.

DESCRIPTION OF THE EXEMPLARY EMBODIMENTS

(10) The present invention relates to:

(11) a recombinant microorganism having enhanced 2,3-butanediol producing ability,

(12) wherein a pathway for converting pyruvate to acetyl-CoA, a pathway for converting pyruvate to formic acid, or a pathway for converting pyruvate to lactate is inhibited in a microorganism having acetyl-CoA and lactate biosynthetic pathways.

(13) In addition, the present invention relates to:

(14) a method for producing 2,3-butanediol, the method including: culturing the recombinant microorganism of the present invention;

(15) and

(16) recovering 2,3-butanediol from the cultured recombinant microorganism.

(17) Hereinafter, the present invention is described in detail.

(18) Recombinant Microorganism Having Enhanced Producing Ability of 2,3-butanediol

(19) The recombinant microorganism of the present invention is

(20) a recombinant microorganism having enhanced 2,3-butanediol producing ability,

(21) wherein the pathway for converting pyruvate to acetyl-CoA, the pathway for converting pyruvate to formic acid, or the pathway for converting pyruvate to lactate is inhibited in a microorganism having acetyl-CoA and lactate biosynthetic pathways.

(22) In addition, the recombinant microorganism of the present invention is a recombinant microorganism from which a gene encoding alcohol dehydrogenation enzyme (aldehyde/alcohol dehydrogenase), that is, adhE, is not deleted.

(23) Preferably, as illustrated in FIG. 1, the recombinant microorganism of the present invention is a recombinant microorganism in which the pathway for converting pyruvate to acetyl-CoA, the pathway for converting pyruvate to formic acid, or the pathway for converting pyruvate to lactate is inhibited while having acetyl-CoA and lactate biosynthetic pathways.

(24) In addition, the recombinant microorganism of the present invention has high selectivity, yield, concentration, and productivity of 2,3-butanediol. That is, in the recombinant microorganism of the present invention, selectivity of 2,3-butanediol is 70% or more, preferably, 80% or more, and a yield of 2,3-butanediol is 0.35 g/g or more based on batch culture or fed-batch culture. Further, due to the recombination, the recombinant microorganism of the present invention better inhibits a producing ability of formic acid, acetic acid, or ethanol as compared to a wild-type microorganism.

(25) Biosynthetic Pathway of Acetyl-CoA

(26) A biosynthetic pathway of acetyl-CoA of the present invention means a pathway in which acetyl-CoA is synthesized from a specific metabolite in a microorganism. The biosynthetic pathway of acetyl-CoA of the present invention may be a pathway for synthesizing acetyl-CoA from pyruvate, and the like.

(27) Biosynthetic Pathway of Lactate

(28) A biosynthetic pathway of lactate of the present invention means a pathway in which lactate is synthesized from a specific metabolite in a microorganism. The biosynthetic pathway of lactate of the present invention may be a pathway for synthesizing lactate from pyruvate, and the like.

(29) Microorganism Having Acetyl-CoA and Lactate Biosynthetic Pathways

(30) The microorganism having the biosynthetic pathway of acetyl-CoA and the biosynthetic pathway of lactate of the present invention is not specifically limited as long as it has the above-described biosynthetic pathways. In addition, the microorganism of the present invention may be a microorganism having the acetyl-CoA biosynthetic pathway and the lactate biosynthetic pathway in a wild-type or a recombinant microorganism having the acetyl-CoA biosynthetic pathway and the lactate biosynthetic pathway by gene recombination. For example, the microorganisms of the present invention may be included in Klebsiella genus, Bacillus genus, Serratia genus, or Enterobacter genus, preferably, Klebsiella oxytoca (K. oxytoca), Klebsiella pneumoniae (K. pneumoniae), and the like, and the most preferably, Klebsiella oxytoca (K. oxytoca).

(31) Inhibition of Pathway for Converting Pyruvate to Acetyl-CoA

(32) Pyruvate-formate lyase controls conversion of pyruvate to acetyl-CoA. A pathway for converting pyruvate to acetyl-CoA may be inhibited by inhibiting the pyruvate-formate lyase. The inhibition of the pyruvate-formate lyase may be achieved by inhibition of expression of the pyruvate-formate lyase, inhibition of enzyme activity of the pyruvate-formate lyase, and the like. For example, the pyruvate-formate lyase may be inhibited by selecting appropriate methods by a person skilled in the art, the appropriate methods such as deletion of pflB which is a gene encoding the pyruvate-formate lyase, development of mutants in the gene (a mutant inhibiting expression of a normal gene by mutating, substituting or deleting partial bases from the gene, or by introducing partial bases into the gene), regulation of gene expression in a transcription process or a translation process, and the like.

(33) Inhibition of Pathway for Converting Pyruvate to Formic Acid

(34) Pyruvate-formate lyase controls conversion of pyruvate to formic acid. A pathway for converting pyruvate to formic acid may be inhibited by inhibiting the pyruvate-formate lyase. The inhibition of the pyruvate-formate lyase may be achieved by inhibition of expression of the pyruvate-formate lyase, inhibition of enzyme activity of the pyruvate-formate lyase, and the like. For example, the pyruvate-formate lyase may be inhibited by selecting appropriate methods by a person skilled in the art, the appropriate methods such as deletion of pflB which is a gene encoding the pyruvate-formate lyase, development of mutants in the gene (a mutant inhibiting expression of a normal gene by mutating, substituting or deleting partial bases from the gene, or by introducing partial bases into the gene), regulation of gene expression in a transcription process or a translation process, and the like.

(35) Inhibition of Pathway for Converting Pyruvate to Lactate

(36) Lactate dehydrogenase controls conversion of pyruvate to lactate A pathway for converting pyruvate to lactate may be inhibited by inhibiting the lactate dehydrogenase. The inhibition of the lactate dehydrogenase may be achieved by inhibition of expression of the lactate dehydrogenase, inhibition of enzyme activity of the lactate dehydrogenase, and the like. For example, the lactate dehydrogenase may be inhibited by selecting appropriate methods by a person skilled in the art, the appropriate methods such as deletion of ldha which is a gene encoding the lactate dehydrogenase, development of mutants in the gene (a mutant inhibiting expression of a normal gene by mutating, substituting or deleting partial bases from the gene, or by introducing partial bases into the gene), regulation of gene expression in a transcription process or a translation process, and the like.

(37) Alcohol Dehydrogenation Enzyme

(38) An alcohol dehydrogenation enzyme (aldehyde/alcohol dehydrogenase) controls a pathway for converting acetyl-CoA to ethanol. Accordingly, there is a case of promoting an increase of production of 2,3-butanediol by deleting adhE which is a gene encoding alcohol dehydrogenation enzyme to inhibit occurrence of ethanol (Ji et al., Appl. Microbiol. Biotechnol., 85: 1751, 2010). However, in the recombinant microorganism of the present invention, when adhE is additionally deleted, a production amount, selectivity, and productivity of 2,3-butanediol are remarkably decreased. Accordingly, adhE which is a gene encoding the alcohol dehydrogenation enzyme is not deleted in the present invention.

(39) Method for Producing 2,3-Butanediol

(40) A method for producing 2,3-butanediol of the present invention includes culturing the recombinant microorganism of the present invention; and recovering 2,3-butanediol from the cultured recombinant microorganism.

(41) The culturing is performed under aerobic condition, preferably, microaerobic condition. For example, the culturing is performed while supplying oxygen, that is, air during the culturing, and specifically, the supplying of the oxygen may be performed by agitating. Preferably, the culturing is performed while agitating at an agitation speed of 450 rpm or less, more preferably, 50 to 450 rpm, and still more preferably, 150 to 450 rpm.

(42) Preferably, the culturing may control productivity of 2,3-butanediol by controlling an oxygen supply amount. As a method for controlling the oxygen supply amount during the culturing, for example, the culturing of the present invention may be performed while agitating, and the culturing may control productivity of 2,3-butanediol by controlling the agitation speed during the culture. For example, when a concentration of acetoin is increased to be 5 g/L or more, preferably, 10 g/L or more, an agitation speed may be decreased, which increases concentration and productivity of 2,3-butanediol and inhibits occurrence of by-products.

BEST MODE

(43) Various advantages and features of the present invention and methods accomplishing thereof will become apparent from the following description of embodiments with reference to the accompanying drawings. However, the present invention is not limited to exemplary embodiment disclosed herein but will be implemented in various forms. The exemplary embodiments are provided by way of example only so that a person of ordinary skilled in the art can fully understand the disclosures of the present invention and the scope of the present invention. Therefore, the present invention will be defined only by the scope of the appended claims.

(44) Material and Method 2,3-butanediol concentration (g/L): Amount of 2,3-butanediol to be produced per unit volume 2,3-butanediol yield (g/g): Production amount (g) of 2,3-butanediol/carbon source (g)100 2,3-butanediol productivity (g/L/h): Amount of 2,3-butanediol to be produced per unit time and unit volume

(45) Selectivity (%) of 2,3-butanediol: Production amount (g) of 2,3-butanediol/(production amounts (g) of 2,3-butanediol, ethanol, acetoin, succinic acid, lactate formate, and acetic acid)100

<Experimental Example 1> Production of Recombinant Microorganism

(46) In order to inactivate a target gene of Klebsiella oxytoca produced with a DNA fragment including a homologous region of the target gene, a recombinant mechanism of bacteria was used, and the homologous region of the gene to be removed was amplified by PCR. Then, the corresponding DNA fragment including the homologous region was transferred to bacteria, and then, the target gene was removed by the recombinant mechanism by recombinase between the homologous region of the gene in the DNA fragment and a gene in chromosome of Klebsiella oxytoca.

(47) First, in order to perform cloning of lactate dehydrogenase of Klebsiella oxytoca, a homologous region 1 (SEQ ID NO: 2) of ldhA (SEQ ID NO: 1) which is a target gene was amplified with primers of SEQ ID NOs: 3 and 4 by PCR. In addition, a homologous region 2 (SEQ ID NO: 5) thereof was amplified with primers of SEQ ID NOs: 6 and 7 by PCR. Then, both of the homologous regions 1 and 2 were simultaneously used as a template and amplified by PCR, thereby completing a DNA fragment (SEQ ID NO: 8) including the homologous regions 1 and 2.

(48) Meanwhile, in order to perform cloning of a homologous region of pyruvate-formate lyase of Klebsiella oxytoca, a homologous region 1 (SEQ ID NO: 10) of pflB (SEQ ID NO: 9) which is a target gene was amplified with primers of SEQ ID NOs: 11 and 12 by PCR. In addition, a homologous region 2 (SEQ ID NO: 13) thereof was amplified with primers of SEQ ID NOs: 14 and 15 by PCR. Then, both of the homologous regions 1 and 2 were simultaneously used as a template and amplified by PCR, thereby completing a DNA fragment (SEQ ID NO: 16) including the homologous regions 1 and 2 (Table 1). In order to increase recombination probability of the target gene, the completed DNA fragment may include an anti-biotic resistance gene, and the like. Further, the DNA fragment may include a sacB gene encoding a levansucrase enzyme, in order to remove the recombinant anti-biotic resistance gene in chromosome.

(49) TABLE-US-00001 TABLE1 SEQ ID NO. SEQUENCES 1 ATGAAAATCGCTGTGTATAGTACAAAACAGTACGACAAGAAGTATCTGCAGGATGTTAATGATG CATATGGCTTTGAACTGGAGTTTTTTGACTTCCTGCTAACCGAAAAAACCGCCAAAACCGCCA ACGGCTGTGAAGCGGTGTGTATCTTCGTAAACGATGACGGTAGCCGCCCGGTACTTGAAGAA CTGAAAGCCCACGGCGTGCAGTACATCGCGCTGCGCTGCGCGGGGTTCAACAACGTTGACC TCGATGCCGCCAAAGAGCTGGGCCTGGGGGTGGTGCGCGTCCCGGCCTACTCGCCGGAAG CGGTCGCTGAGCACGCGATACGGCATGATGATGTCGCTGAACCGCCGCATTCACCGTGCCTA TCAGCGCACCCGCGACGCGAACTTCTCTCTGGAAGGGCTGACCGGTTTCACCATGCACGGT AAAACCGCCGGCGTTATTGGCACCGGTAAAATCGGCGTCGCCGCGCTGCGCATTCTTAAAG GCTTCGGTATGCGTCTGCTGGCGTTTGATCCCTACCCAAGCGCCGCCGCGCTGGATATGGG CGTGGAGTATGTCGATCTTGAAACCCTGTACGGGAGTCCGATGTTATCTCACTGCACTGCC CACTGACCGATGAAAACTACCATTTGCTGAACCATGCCGCGTTCGATCGCATGAAAGACGGG GTGATGATCATCAACACCAGCCGCGGCGCGCTCATCGATTCGCAGGCAGCGATCGACGCCC TGAAGCATCAGAAAATTGGCGCGCTGGGGATGGACGTGTATGAGAACGAACGCGATCTGTTC TTTGAAGATAAGTCTAATGACGTGATTCAGGATGATGTGTTCCGCCGTCTCTCCGCCTGCCAT AACGTCCTGTTTACCGGTCACCAGGCGTTTCTGACCGCGGAAGCGTTGATCAGCATTTCGCA AACCACCCTCGACAACCTGCGTCAAGTGGATGCAGGCGAAACCTGTCCTAACGCACTGGTCT GA 2 ATGACGTTCGCTAAATCCTGCGCCGTCATCTCGCTGCTGATCCCGGGCACCTCCGGGCTACT GCTGTTCGGCACCCTGGCATCGGCCAGCCCGGGACATTTCCTGTTAATGTGGATGAGCGCC AGCCTCGGCGCTATCGGCGGATTCTGGCTCTCGTGGCTGACGGGCTACCGCTACCGGTACC ATCTGCATCGTATCCGGTGGCTTAATGCCGAACGCCTCGGCTCGCGGCCAGTTGTTCCTGCGC CGCCACGGCGCGTGGGCAGTCTTTTTTAGCCGCTTTCTCTCTCCGCTGCGCGCCACCGTGC CGCTGGTAACCGGCGCCAGCGGCACCTCTCTCTGGCAGTTTCAGCTCGCCAACGTCAGCTC CGGGCTGCTCTGGCCGCTGATCCTGCTGGCGCCAGGCGCGTTAAGCCTCAGCTTTTGATGA AAGGTATTGTCTTTTAAAGAGATTTCTTAACACCGCGATATGCTCTAGAATTATTACTATAACCT GCTGATTAAACTAGTTTTTAACATTTGTAAGATTATTTTAATTATGCTACCGTGACGGTATTATCA CTGGAGAAAAGTCTTTTTTCCTTGCCCTTTTGTGC 3 Ko_IdhA_FP1-CACGGATCCATGACGTTCGCTAAATCCTGC 4 Ko_IdhA_RP1-GCACAAAAGGGCAAGGAAAAAAGACTTTTCTCCAGTGATA 5 TATCACTGGAGAAAAGTCTTTTTTCCTTGCCCTTTTGTGCTCCCCCTTCGCGGGGGGCACATT CAGATAATCCCCACAGAAATTGCCTGCGATAAAGTTACAATCCCTTCATTTATTAATACGATAA ATATTTATGGAGATTAAATGAACAAGTATGCTGCGCTGCTGGCGGTGGGAATGTTGCTATCGG GCTGCGTTTATAACAGCAAGGTGTCGACCAGAGCGGAACAGCTTCAGCACCACCGTTTTGTG CTGACCAGCGTTAACGGGCAGCCGCTGAATGCCGCGGATAAGCCGCAGGAGCTGAGCTTC GGCGAAAAGATGCCCATTACGGGCAAGATGTCTGTTTCAGGTAATATGTGCAACCGCTTCAG CGGCACGGGCAAAGTCTCTGACGGCGAGCTGAAGGTTGAAGAGCTGGCAATGACCCGCATG CTCTGCACGGACTCGCAGCTTAACGCCCTGGACGCCACGCTGAGCAAAATGCTGCGCGAAG GCGCGCAGGTCGACCTGACGGAAACGCAGCTAACGCTGGCGACCGCCGACCAGACGCTGG TGTATAAGCTCGCCGACCTGATGAATTAATAATTA 6 Ko_IdhA_FP2-TATCACTGGAGAAAAGTCTTTTTTCCTTGCCCTTTTGTGC 7 Ko_IdhA_RP2-CCTGCGGCCGCTAATTATTAATTCATCAGGTC 8 ATGACGTTCGCTAAATCCTGCGCCGTCATCTCGCTGCTGATCCCGGGCACCTCCGGGCTACT GCTGTTCGGCACCCTGGCATCGGCCAGCCCGGGACATTTCCTGTTAATGTGGATGAGCGCC AGCCTCGGCGCTATCGGCGGATTCTGGCTCTCGTGGCTGACGGGCTACCGCTACCGGTACC ATCTGCATCGTATCCGCTGGCTTAATGCCGAACGCCTCGCTCGCGGCCAGTTGTTCCTGCGC CGCCACGGCGCGTGGGCAGTCTTTTTTAGCCGCTTTCTCTCTCCGCTTCGCGCCACCGTGC CGCTGGTAACCGGCGCCAGCGGCACCTCTCTCTGGCAGTTTCAGCTCGCCAACGTCAGCTC CGGGCTGCTCTGGCCGCTGATCCTGCTGGCGCCAGGCGCGTTAAGCCTCAGCTTTTGATGA AAGGTATTGTCTTTTAAAGAGATTTCTTAACACCGCGATATGCTCTAGAATTATTACTATAACCT GCTGATTAAACTAGTTTTTAACATTTGTAAGATTATTTTAATTATGCTACCGTGACGGTATTATCA CTGGAGAAAAGTCTTTTTTCCTTGCCCTTTTGTGCTCCCCCTTCGCGGGGGGCACATTCAGAT AATCCCCACAGAAATTGCCTGCGATAAAGTTACAATCCCTTCATTTATTAATACGATAAATATTT ATGGAGATTAAATGAACAAGTATGCTGCGCTGCTGGCGGTGGGAATGTTGCTATCGGGCTGC GTTTATAACAGCAAGGTGTCGACCAGAGCGGAACAGCTTCAGCACCACCGTTTTGTGCTGAC CAGCGTTAACGGGCAGCCGCTGAATGCCGCGGATAAGCCGCAGGAGCTGAGCTTCGGCGA AAAGATGCCCATTACGGGCAAGATGTCTGTTTCAGGTAATATGTGCAACCGCTTCAGCGGCA CGGGCAAAGTCTCTGACGGCGAGCTGAAGGTTGAAGAGCTGGCAATGACCCGCATGCTCTG CACGGACTCGCAGCTTAACGCCCTGGACGCCACGCTGAGCAAAATGCTGCGCGAAGGCGC GCAGGTCGACCTGACGGAAACGCAGCTAACGCTGGCGACCGCCGACCAGACGCTGGTGTA TAAGCTCGCCGACCTGATGAATTAATAATTA 9 ATGTCCGAGCTTAATGAAAAGTTAGCCACAGCCTGGGAAGGTTTTGCGAAAGGTGACTGGCA GAACGAAGTCAACGTCCGCGACTTCATCCAGAAAAACTATACCCCGTACGAAGGTGACGAGT CCTTCCTGGCTGGCGCAACTGACGCGACCACCAAGCTGTGGGACACCGTAATGGAAGGCGT TAAACAGGAAAACCGCACTCACGCGCCTGTTGATTTTGATACTTCCCTTGCATCCACCATCAC TTCTCATGACGCTGGCTACATCGAGAAAGGTCTCGAGAAAATCGTTGGTCTGCAGACTGAAG CTCCGCTGAAACGCGCGATTATCCCGTTCGGCGGCATCAAAATGGTCGAAGGTTCCTGCAAA GCGTACGATCGCGAGCTGGACCCGATGCTGAAGAAAATCTTCACTGAATACCGTAAAACTCA CAACCAGGGCGTGTTTGACGTTTACACCAAAGACATCCTGAACTGCCGTAAATCTGGTGTTCT GACCGGTCTGCCGGATGCCTATGGCCGTGGTCGTATCATCGGTGACTACCGTCGCGTTGCG CTGTACGGTATCGACTTCCTGATGAAAGACAAATACGCTCAGTTCGTTTCTCTGCAAGAGAAA CTGGAAAACGGCGAAGATCTGGAAGCAACCATCCGTCTGCGCGAAGAAATCTCTGAACAGCA CCGCGCGCTGGGTCAGATCAAAGAAATGGCGGCTAAATATGGCTGCGATATCTCTGGTCCTG CTACCACCGCTCAGGAAGCTATCCAGTGGACCTACTTCGGTTACCTGGCTGCCGTAAAATCT CAGAACGGCGCGGCAATGTCCTTCGGTCGTACCTCCAGCTTCCTGGACATCTTCATCGAACG TGACCTGAAAGCCGGTAAAATCACCGAGCAAGACGCACAGGAAATGATTGACCACCTGGTCA TGAAACTGCGTATGGTTCGTTTCCTGCGTACCCCTGAATATGATGAACTGTTCTCTGGCGACC CGATCTGGGCAACAGAATCTATCGGCGGTATGGGCGTTGACGGCCGTACTCTGGTCACCAA AAACAGCTTCCGTTTCCTGAACACCCTGTACACCATGGGGCCGTCTCCGGAGCCGAACATCA CCATTCTGTGGTCTGAAAAACTGCCGCTGAGCTTCAAAAAATACGCCGCGAAAGTGTCCATC GATACCTCTTCTCTGCAGTACGAGAACGATGACCTGATGCGTCCTGACTTCAACAACGATGAC TACGCTATCGCTTGCTGCGTAAGCCCGATGGTTGTTGGTAAGCAAATGCAGTTCTTCGGCGC GCGTGCTAACCTGGCGAAAACCATGCTGTACGCAATCAACGGCGGCGTTGATGAAAAACTGA AAATGCAGGTTGGTCCTAAATCTGAACCGATCAAAGGCGACGTTCTGAACTTCGACGAAGTGA TGGACCGCATGGATCACTTCATGGACTGGCTGGCTAAACAGTACGTCACTGCGCTGAACATC ATCCACTACATGCACGACAAGTACAGCTACGAAGCTTCCCTGATGGCGCTGCACGACCGTGA TGTTATCCGCACCATGGCATGTGGTATCGCAGGTCTTTCCGTTGCGGCTGACTCCCTGTCTG CAATCAAATATGCGAAAGTTAAACCGATTCGTGACGAAAACGGTCTGGCTGTCGACTTCGAAA TCGAAGGCGAATACCCGCAGTTTGGTAACAACGACTCTCGCGTCGATGATATGGCCGTTGAC CTGGTTGAACGTTTCATGAAGAAAATTCAGAAACTGCACACCTACCGCAACGCTATCCCGACT CAGTCCGTTCTGACCATCACCTCTAACGTTGTGTATGGTAAGAAAACCGGCAACACCCCTGA CGGTCGTCGCGCTGGCGCTCCGTTCGGACCAGGTGCTAACCCGATGCACGGCCGTGACCA GAAAGGCGCTGTTGCCTCTCTGACCTCCGTTGCAAAACTGCCGTTTGCTTACGCGAAAGATG GTATTTCTTACACCTTCTCTATCGTGCCGAACGCGCTGGGTAAAGACGACGAAGTTCGTAAAA CTAACCTCGCCGGCCTGATGGATGGTTACTTCCACCACGAAGCGTCCATCGAAGGCGGTCA GCATCTGAACGTCAACGTTATGAACCGCGAAATGCTGCTCGACGCGATGGAAAACCCGGAAA AATATCCGCAGCTGACCATCCGCGTATCCGGCTACGCAGTACGTTTTAACTCCCTGACTAAAG AACAGCAGCAGGACGTTATTACTCGTACCTTCACTCAGACCATGTAA 10 GGGTCAACTGGCGAAAAACTGGCTCAACGTCTATGTTGGTAACCTGATTGGTTGCTTACTGTT TGTATTGCTGATGTGGCTTTCAGGCGAATATATGACTGCCAACGGTCAATGGGGACTTAACGT TCTGCAAACCGCCGACCACAAAATGCACCATACTTTTGTTGAAGCCGTGTGCCTGGGTATCCT GGCAAACCTGATGGTCTGCCTTGCGGTATGGATGAGTTACTCCGGCCGTAGCCTGATGGATA AAGCCATGATTATGGTTTTACCGGTGGCAATGTTTGTTGCCAGCGGGTTTGAGCACAGTATCG CGAACATGTTTATGATCCCGCTGGGTATCGTTATCCGCGACTTTGCAAGCCCGGAATTCTGGA CCGCAGTTGGTTCAACTCCGGAAAGTTTCTCTCACCTGACCGTCATGAACTTCATCACTGATA ACCTGATTCCGGTAACTATCGGGAACATCATCGGCGGTGGTCTGCTGGTTGGGTTGACATAC TGGGTCATTTACCTGCGTGGCGACGACCATCACTAAGGGTTGTTTCAGGCAGTAAATAAAAAA TCCACTTAAGAAGGTAGGTGTTACATGTCCGAGCTTAATGAAAAGTTACAGCAGCAGGACGTT ATTACTC 11 Ko_pflB_FP1-ATCGGATCCGGGTCAACTGGCGAAAAACTGGCTCAACGT 12 Ko_pflB_RP1-GAGTAATAACGTCCTGCTGCTGTAACTTTTCATTAAGCTCGGACAT 13 ATGTCCGAGCTTAATGAAAAGTTACAGCAGCAGGACGTTATTACTCGTACCTTCACTCAGACC ATGTAATGGTATTGACTGAAATCGTACAGTAAAAAGCGTACAATAAAGGCTCCACGCAAGTGG GGCCTTTTTAGCAATATCATCCTGCCCCAGTCTCTTTTGTCTGCTGTCTATACTTTATGGATAA CAGCCAAAACAGACTCGACATAGCCTTTGAGCTGTGCATCTACATAGGCCCCGGATGGGCCA AATTCGGAGATATCACCGCAATGTCAACAATTGGTCGCATTCACTCCTTTGAATCCTGTGGCA CCGTCGATGGCCCGGGGATTCGCTTTATCACCTTCTTCCAGGGCTGCCTGATGCGCTGCCTC TATTGCCACAACCGCGATACCTGGGATACCCACGGCGGCAAAGAGATTACCGTTGAAGAGCT GATGAAAGAGGTGGTGACCTATCGCCACTTTATGAACGCTTCCGGCGGCGGCGTGACGGCA TCCGGCGGCGAGGCTATCCTGCAGGCCGAATTTGTTCGCGACTGGTTCCGCGCCTGTAAGA AAGAAGGTATTCATACCTGTCTCGATACCAACGGCTTTGTGCGCCGCTACGATCCGGTTATTG ATGAACTGCTGGAGGTCACCGACCTGGTGATGCTCGATCTCAAGC 14 Ko_pflB_FP2-ATGTCCGAGCTTAATGAAAAGTTACAGCAGCAGGACGTTATTACTC 15 Ko_pflB_RP2-ACTGCGGCCGCGCTTGAGATCGAGCATCACCAGGTCGGTGA 16 GGGTCAACTGGCGAAAAACTGGCTCAACGTCTATGTTGGTAACCTGATTGGTTGCTTACTGTT TGTATTGCTGATGTGGCTTTCAGGCGAATATATGACTGCCAACGGTCAATGGGGACTTAACGT TCTGCAAACCGCCGACCACAAAATGCACCATACTTTTGTTGAAGCCGTGTGCCTGGGTATCCT GGCAAACCTGATGGTCTGCCTTGCGGTATGGATGAGTTACTCCGGCCGTAGCCTGATGGATA AAGCCATGATTATGGTTTTACCGGTGGCAATGTTTGTTGCCAGCGGGTTTGAGCACAGTATCG CGAACATGTTTATGATCCCGCTGGGTATCGTTATCCGCGACTTTGCAAGCCCGGAATTCTGGA CCGCAGTTGGTTCAACTCCGGAAAGTTTCTCTCACCTGACCGTCATGAACTTCATCACTGATA ACCTGATTCCGGTAACTATCGGGAACATCATCGGCGGTGGTCTGCTGGTTGGGTTGACATAC TGGGTCATTTACCTGCGTGGCGACGACCATCACTAAGGGTTGTTTCAGGCAGTAAATAAAAAA TCCACTTAAGAAGGTAGGTGTTACATGTCCGAGCTTAATGAAAAGTTACAGCAGCAGGACGTT ATTACTCGTACCTTCACTCAGACCATGTAATGGTATTGACTGAAATCGTACAGTAAAAAGCGTA CAATAAAGGCTCCACGCAAGTGGGGCCTTTTTAGCAATATCATCCTGCCCCAGTCTCTTTTGT CTGCTGTCTATACTTTATGGATAACAGCCAAAACAGACTCGACATAGCCTTTGAGCTGTGCAT CTACATAGGCCCCGGATGGGCCAAATTCGGAGATATCACCGCAATGTCAACAATTGGTCGCA TTCACTCCTTTGAATCCTGTGGCACCGTCGATGGCCCGGGGATTCGCTTTATCACCTTCTTCC AGGGCTGCCTGATGCGCTGCCTCTATTGCCACAACCGCGATACCTGGGATACCCACGGCGG CAAAGAGATTACCGTTGAAGAGCTGATGAAAGAGGTGGTGACCTATCGCCACTTTATGAACG CTTCCGGCGGCGGCGTGACGGCATCCGGCGGCGAGGCTATCCTGCAGGCCGAATTTGTTC GCGACTGGTTCCGCGCCTGTAAGAAAGAAGGTATTCATACCTGTCTCGATACCAACGGCTTT GTGCGCCGCTACGATCCGGTTATTGATGAACTGCTGGAGGTCACCGACCTGGTGATGCTCG ATCTCAAGC

(50) Development of Recombinant Microorganism

(51) The produced DNA fragments were transferred to Klebsiella oxytoca by using electroporation (25 uF, 200, 18 kV/cm), and the target gene was capable of being removed by using a recombinant mechanism of the microorganism.

(52) The DNA fragment including the homologous region of an ldha gene was transferred to a wild-type Klebsiella oxytoca to produce a recombinant Klebsiella oxytoca from which the ldha gene was removed (Comparative Example 2). Meanwhile, after the ldhA gene was removed from the wild-type Klebsiella oxytoca, the DNA fragment including the homologous region of a pflB gene was transferred to produce Klebsiella oxytoca from which the pflB gene was additionally removed together with the removal of the ldha gene (Example 1).

(53) Electroporation was performed, and the recombinant microorganisms were cultured at 30 C. for 1 hour and stabilized. Then, the recombinant microorganisms were cultured by spreading them on an LB composite solid medium containing anti-biotics (such as kanamycin, chloramphenicol, and the like) at 37 C., respectively.

(54) Then, colony PCR was performed on the colonies grown on the solid medium, and it was confirmed that the corresponding genes were removed from the colonies (FIG. 2 illustrates deletion of ldha and FIG. 3 illustrates deletion of pflB, respectively). Here, in order to confirm that the ldha gene was removed, PCR was performed with primers of SEQ ID NOs: 17 and 18, and in order to confirm that the pflB gene was removed, PCR was performed with primers of SEQ ID NOs: 19 and 20 (Table 2).

(55) TABLE-US-00002 TABLE2 SEQ ID NO. SEQUENCES 17 Ko_IdhA_Sc_FP-CCATCTGCATCGTATCCGCTGGCTTAAT 18 Ko_IdhA_Sc_RP-GCTGAAGCGGTTGCACATATTACCTG 18 Ko_pflB_Sc_FP-ACCATCACTAAGGGTTGTTTCAGGCAGTAA 20 Ko_pflB_Sc_RP-GCTAAAAAGGCCCCACTTGCGTGGAGCCTT

(56) In next test, a wild-type Klebsiella oxytoca was used as Comparative Example 1. Meanwhile, a recombinant Klebsiella oxytoca from which ldhA and adhE genes were deleted was produced by additionally deleting the adhE gene from the recombinant Klebsiella oxytoca from which ldha was deleted according to Comparative Example 2, the adhE gene being a gene encoding an alcohol dehydrogenation enzyme (aldehyde/alcohol dehydrogenase) directly involved in occurrence of ethanol. The produced recombinant Klebsiella oxytoca from which ldhA and adhE genes were deleted was tested as Comparative Example 3. The adhE gene was removed in a similar manner to the method for removing the ldhA gene or the pflB gene. The DNA fragment including the homologous region of the adhE gene was transferred to the Klebsiella oxytoca from which the ldha was removed, thereby producing Klebsiella oxytoca from which the adhE gene was additionally removed together with the removal of the ldha gene.

Experimental Example 2

(57) Batch culture was performed by using microorganisms of Example 1, Comparative Examples 1 and 2 prepared in Experimental Example 1 above. First, Klebsiella oxytoca strains were inoculated in 250 ml of composite medium including 9 g/L glucose (50 mM) and cultured at 37 C. for 16 hours, and then the culture fluids were inoculated in 3 L of composite medium and cultured. Here, the fermentation was performed under a micro-aerobic condition (an aerobic speed of 1 vvm and an agitation speed of 150 rpm), at an initial glucose concentration of 90 g/L, pH 6.8, and a culture temperature of 37 C. 5N NH.sub.4OH was used to control the pH during the fermentation. Samples for the Klebsiella oxytoca strains were taken during the fermentation, and growth rates were obtained by measuring optical density 600 (OD 600) of the taken samples. Then, the taken samples were centrifuged at 13,000 rpm for 10 minutes, and metabolites of supernatants and concentration of 2,3-butanediol thereof were analyzed by liquid chromatography (HPLC).

(58) As a result, in the strain of Comparative Example 2, a production amount of 2,3-butanediol was 29.91 g/L, and a production yield of 2,3-butanediol (gram of 2,3-butanediol/gram of glucose) was 0.32. In addition, in the strain of Comparative Example 2, a productivity (g/L/h) of 2,3-butanediol was 1.07, and selectivity thereof was 59%. As compared to Comparative Example 1 which is a wild-type Klebsiella oxytoca, it was confirmed that the recombinant strain of Comparative Example 2 improved all of production concentration, production yield, productivity and selectivity of 2,3-butanediol while decreasing lactic acid production and increasing producing ability of 2,3-butanediol. However, the recombinant Klebsiella oxytoca of Comparative Example 2 still produced excessive amounts of by-products including formic acid and ethanol, which is considered as a cause of inhibiting a production concentration, a production yield, selectivity, and the like, of 2,3-butanediol of Comparative Example 2 (FIG. 4 illustrates Comparative Example 1 and FIG. 5 illustrates Comparative Example 2).

(59) Meanwhile, as compared to Comparative Example 2 (Klebsiella oxytoca ldhA, 2,3-BDO 29.91 g/L), in the recombinant strain of Example 1, a production amount of 2,3-butanediol was increased to be 39.171.51 g/L. In addition, it was confirmed in the recombinant strain of Example 1 that a production amount of formic acid was decreased by 90% or more, and a production amount of ethanol was decreased by 73% or more, and a production yield of 2,3-butanediol (gram of 2,3-butanediol/gram of glucose) was also significantly increased from 0.32 to 0.45. Upon considering that a theoretical yield of 2,3-butanediol (a yield when it is assumed that all glucose supplied to Klebsiella oxytoca are converted to 2,3-butanediol) is 0.5, a yield of Example 1 (the theoretical yield thereof is 90%) was remarkably high.

(60) Accordingly, it could be confirmed that occurrence of by-products was remarkably decreased, and 2,3-butanediol was produced with high purity by simultaneously removing by-products such as formic acid, ethanol, and the like, through removal of the ldhA and the pflB genes. Regarding this, it could be continued that the removal of the gene (ldha) encoding the lactic acid dehydrogenation enzyme (lactate dehydrogenase) of Klebsiella oxytoca and the gene (pflB) encoding the pyruvate-formate lyase is significantly important for production of 2,3-butanediol in various stages of pathways for producing 2,3-butanediol (FIG. 6) (Table 3).

(61) TABLE-US-00003 TABLE 3 2,3-butanediol Concentration (g/L) of by-products Concentration Yield Productivity Selectivity Succinic Formic Acetic Strain (g/L) (g/g) (g/L/h) (%) Lactate Acid Ethanol Acid Acid Comparative 17.31 0.18 0.58 27 32.20 1.92 1.61 3.88 1.27 Example 1 Comparative 29.91 0.32 1.07 59 1.93 2.27 3.54 6.11 0.92 Example 2 Example 1 39.17 1.51 0.45 0.43 0.02 83.33 1.53 3.24 1.77 0.53 0.97 0.15

Experimental Example 3

(62) Whether or not a producing ability of 2,3-butanediol was improved was tested at the time of removing a gene involved in occurrence of by-products in competition with biosynthesis of 2,3-butanediol in a 2,3-butanediol-producing microorganism. adhE is a gene encoding an alcohol dehydrogenation enzyme (aldehyde/alcohol dehydrogenase) directly involved in occurrence of ethanol which is a by-product in production of 2,3-butanediol. Accordingly, a recombinant Klebsiella oxytoca of Comparative Example 3 from which ldhA and adhE were removed was cultured and compared to that of Example 1. Here, culture conditions of the recombinant microorganism of Comparative Example 3 were the same as those of Experimental Example 2.

(63) As a result, in Comparative Example 3 from which ldhA and adhE were simultaneously removed from Klebsiella oxytoca, a production amount of 2,3-butanediol was rather decreased to be 25.96 g/L as compared to Comparative Example 2 (Klebsiella oxytoca ldhA, 2,3-BDO 29.91 g/L). In addition, in Comparative Example 3, a production yield of 2,3-butanediol was 0.27, which was lower than that of Comparative Example 2 (0.32), and selectivity thereof was 55%, which was lower than that of Comparative Example 2 (59%), and productivity (g/L/h) was 0.36, which was remarkably lower than that of Comparative Example 2 (1.07). Further, in Comparative Example 3, a production amount of ethanol was decreased as compared to Comparative Example 2; however, a producing ability of 2,3-butanediol was rather deteriorated.

(64) In addition, although being compared to Example 1, it could be appreciated that a producing ability of 2,3-butanediol of Comparative Example 3 was remarkably decreased (Table 4). Accordingly, it could be confirmed that even though the gene involved in occurrence of by-products was removed, it was not favorable to the production of 2,3-butanediol.

(65) TABLE-US-00004 TABLE 4 2,3-butanediol Concentration (g/L) of by-products Concentration Yield Productivity Selectivity Succinic Formic Acetic Strain (g/L) (g/g) (g/L/h) (%) Lactate Acid Ethanol Acid Acid Comparative 17.31 0.18 0.58 27 32.20 1.92 1.61 3.88 1.27 Example 1 Comparative 29.91 0.32 1.07 59 1.93 2.27 3.54 6.11 0.92 Example 2 Comparative 25.96 0.27 0.36 55 2.71 2.32 0.89 4.13 6.43 Example 3 Example 1 39.17 1.51 0.45 0.43 0.02 83.33 1.53 3.24 1.77 0.53 0.97 0.15

<Experimental Example 4> Change in Production of 2,3-Butanediol According to Change in Oxygen Supply Amount

(66) Effects of change in dissolved oxygen amount of a medium depending on an agitation speed during the culturing, on a production yield, a productivity, and selectivity of 2,3-butanediol were evaluated by using the recombinant Klebsiella oxytoca of Example 1.

(67) First, the recombinant microorganism of Example 1 was inoculated in 250 ml of composite medium including 9 g/L glucose (50 mM) and cultured at 37 C. for 16 hours. Then, the obtained culture fluid was inoculated in 3 L of composite medium, and batch fermentation was performed. The fermentation was performed under a micro-aerobic condition (aerobic speed of 1 vvm), at an initial glucose concentration of 90 g/L, pH 6.8, and a culture temperature of 37 C., with a variety of agitation speeds, for example, 150 rpm, 250 rpm, 350 rpm, and 450 rpm. 5N NH.sub.4OH was used to control the pH during the fermentation. Samples for the recombinant Klebsiella oxytoca strains were taken during the fermentation, and growth rates were obtained by measuring optical density 600 (OD 600) of the taken samples. Then, the taken samples were centrifuged at 13,000 rpm for 10 minutes, and metabolites of supernatants and concentration of 2,3-butanediol (2,3-BDO) thereof were analyzed by liquid chromatography (HPLC).

(68) As a result, in the recombinant Klebsiella oxytoca strain of Example 1, productivity (g/L/h) of 2,3-butanediol was largely changed depending on change in agitation speed. That is, it could be confirmed that at the time of agitating at an agitation speed of 450 rpm, productivity of 2,3-butanediol was increased by 5 times or more as compared to agitating at an agitation speed of 150 rpm (Table 5, FIGS. 7 to 11). It could be confirmed that the change in oxygen supply amount depending on the agitation speed could improve productivity of Example 1.

(69) TABLE-US-00005 TABLE 5 agitation 2,3-Butanediol Speed Concentration Yield Productivity Selectivity (rpm) (g/L) (g/g) (g/L/h) (%) 150 39.17 1.51 0.45 0.43 0.02 83.33 1.53 250 33.51 0.23 0.39 0.01 0.77 0.02 84 350 31.39 1.68 0.37 0.02 1.40 0.12 80 1.00 450 30.79 1.46 0.35 0.02 2.71 0.21 84 4.58

<Experimental Example 5> Production of 2,3-Butanediol Through Fed-Batch Fermentation Under Aerobic Condition (Agitating at Agitation Speed of 450 Rpm)

(70) Fed-batch fermentation for production of 2,3-butanediol was performed by using the strain of Example 1 while maintaining an agitation speed at 450 rpm which exhibited the most improved productivity based on the results of Experimental Example 4.

(71) First, the recombinant Klebsiella oxytoca strain of Example 1 was inoculated in 250 ml of composite medium including 9 g/L glucose (50 mM) and cultured at 37 C. for 16 hours, and then the obtained culture fluid was inoculated in 3 L of composite medium and fed-batch culture was performed. Here, the fermentation was performed under a micro-aerobic condition (aerobic speed of 1 vvm), at an initial glucose concentration of 90 g/L, pH 6.8, and a culture temperature of 37 C. The agitation speed was continuously maintained at 450 rpm. 5N NH.sub.4OH was used to control the pH during the fermentation. When a glucose concentration was decreased to be 10 g/L or less during the fermentation, a glucose solution of 700 g/L or more was fed. A sample for the recombinant Klebsiella oxytoca strain was taken during the fermentation, and a growth rate was obtained by measuring optical density 600 (OD 600) of the taken sample. Then, the taken sample was centrifuged at 13,000 rpm for 10 minutes, and a metabolite of supernatant and concentration of 2,3-butanediol thereof were analyzed by liquid chromatography (HPLC).

(72) As a result, it could be confirmed that when the agitation speed was continuously maintained at 450 rpm, a producing ability of 2,3-butanediol was not continuously maintained (Table 6). In particular, it could be confirmed that when a concentration of acetoin was over 10 g/L, the producing ability of 2,3-butanediol was remarkably decreased (FIG. 12). It could be appreciated that the agitation speed of the fed-batch culture was required to be controlled based on results of the fed-batch culture performed at the agitation speed maintained at 450 rpm, and a time point for controlling the agitation speed was required to be determined based on the concentration of acetoin to be accumulated.

(73) TABLE-US-00006 TABLE 6 2,3-Butanediol Succinic Acetic Concentration Productivity Yield Selectivity Acetoin Acid Acid Strain (g/L) (g/L/h) (g/g) (%) (g/L) (g/L) (g/L) Example 1 57.7 1.65 29 63 13.44 12.38 5.32

<Experimental Example 6> Production of 2,3-Butanediol Through Fed-Batch Fermentation

(74) The recombinant Klebsiella oxytoca strain of Example 1 was inoculated in 250 ml of composite medium including 9 g/L glucose (50 mM) and cultured at 37 C. for 16 hours. Then, the obtained culture fluid was inoculated in 3 L of composite medium, and fed-batch culture was performed. Here, the fermentation was performed under a micro-aerobic condition (aerobic speed of 1 vvm), at an initial glucose concentration of 90 g/L, pH 6.8, a culture temperature of 37 C., and an agitation speed of 450 rpm. 5N NH.sub.4OH was used to control the pH during the fermentation. When a glucose concentration was decreased to be 10 g/L or less during the fermentation, a glucose solution of 700 g/L or more was fed. In addition, at a time point at which the concentration of acetoin which is one of the by-products, is 7 g/L, the fermentation was performed by changing the agitation speed from 450 rpm to 350 rpm. A sample for the recombinant Klebsiella oxytoca strain was taken during the fermentation, and a growth rate was obtained by measuring optical density 600 (OD 600) of the taken sample. Then, the taken sample was centrifuged at 13,000 rpm for 10 minutes, and a metabolite of supernatant and concentration of 2,3-butanediol thereof were analyzed by liquid chromatography (HPLC).

(75) As a result, as compared to the fed-batch culture performed by uniformly maintaining the agitation speed at 450 rpm in Experimental Example 5, all of the concentration, the productivity, the yield, and the selectivity of 2,3-butanediol were largely increased by 74.5%, 29.7%, 55.2%, and 27.0%, respectively. Therefore, it could be confirmed that the production of 2,3-butanediol using the recombinant strain of Example 1 was largely affected by the control of the dissolved oxygen amount depending on the agitation speed. Accordingly, it was determined that the productivity of 2,3-butanediol could be improved by controlling the agitation speed to control the dissolved oxygen amount in the medium (Table 7, FIG. 13).

(76) TABLE-US-00007 TABLE 7 2,3-Butanediol Concen- Produc- Selec- Succinic Acetic tration tivity tivity Acetoin Acid Acid Strain (g/L) (g/L/h) (%) (g/L) (g/L) (g/L) Example 1 100.66 2.14 80 5.19 14.76 2.73

INDUSTRIAL APPLICABILITY

(77) The present invention relates to a recombinant microorganism having enhanced 2,3-butanediol producing ability, wherein a pathway for converting pyruvate to acetyl-CoA, a pathway for converting pyruvate to formic acid, or a pathway for converting pyruvate to lactate is inhibited in a microorganism having acetyl-CoA and lactate biosynthetic pathways. The recombinant microorganism of the present invention may produce 2,3-butanediol with high selectivity and concentration.