Method for improving heterologous synthesis of <i>Escherichia coli </i>into polyketides and use of same

10920229 ยท 2021-02-16

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a method for improving the heterologous synthesis of a polyketide by E. coli and use thereof. The yield of the polyketide heterologously synthesized by E. coli is significantly increased by attenuating the expression of seventy-two genes, such as sucC and talB, in a host strain, wherein the highest yield increase rate can reach 60% or more. Currently, erythromycin is the most clear model compound in the study on the biosynthesis of polyketids. The production strain of the present invention enables massive accumulation of 6-deoxyerythronolide (6-dEB), an erythromycin precursor, in the fermentation process, laying the foundation for the industrial production of the heterologous synthesis of erythromycin by E. coli.

Claims

1. A method for increasing the yield of heterologous synthesis of a polyketide 6-deoxyerythronolide B by 20% or more in an E. coli compared to unattenuated E. coli wherein the method comprises: (1) attenuating an expression of a target gene in the E. coli for synthesizing the polyketide 6-deoxyerythronolide B; wherein, the target gene is selected from: (a) a gene for nucleotide synthesis and other metabolism modules: phosphoribosyl glycinamide formyltransferase 2 purT, autoinducer-2ABC transporter lsrC, coproporphyrinogen III dehydrogenase hemN, glucose 6-phosphate-1-dehydrogenase zwf, 6-phosphogluconolactonase pgl, 6-phosphogluconate dehydrogenase gnd, ribulose-5-phosphate 3-epimerase rpe, transaldolase A talA, transaldolase talB, transketolase I tktA, transketolase II tktB, L-xylulose 5-phosphate 3-epimerase ulaE or predicted 6-phosphogluconolactonase yieK; (b) a gene for pentose phosphate and glyoxylate pathway modules: predicted lyase yaeR, ribose-5-phosphate isomerase A rpiA, allose-6-phosphate isomerase/ribose-5-phosphate isomerase B rpiB, AICAR transformylase purH, aspartate carbamoyltransferase, catalytic subunit pyrB, aspartate carbamoyltransferase, regulatory subunit pyrI, adenosine-3(2),5-bisphosphate nucleotidase cysQ, dihydroorotase pyrC, guanylate kinase gmk, GMP synthetase guaA, IMP dehydrogenase guaB, nucleoside diphosphate kinase ndk, orotidine-5-phosphate decarboxylase pyrF, orotate phosphoribosyltransferase pyrE, UMP kinase pyrH or hypoxanthine phosphoribosyltransferase hpt; (c) a gene for TCA cycle and oxidative phosphorylation modules: fumarate reductase frdD, fumarate reductase, a subunit frdA, succinate dehydrogenase A sdhA, succinate dehydrogenase B sdhB, succinate dehydrogenase C sdhC, succinate dehydrogenase D sdhD, succinyl-CoA synthetase, subunit sucC, succinyl-CoA synthetase sucD, cytochrome bo terminal oxidase subunit II cyoA or cytochrome bo terminal oxidase subunit I cyoB; (d) a gene for carbohydrate metabolism module: pyruvate dehydrogenase accF, phosphoglucose isomerase pgi, lipoamide dehydrogenase lpdA, polyphosphate kinase ppk, HPr protein of phosphoenolpyruvate-sugar phosphotransferase system ptsH, PTSI protein of phosphoenolpyruvate-sugar phosphotransferase system ptsI, glycolateoxidase, predicted iron-sulfur subunit glcF, glycolate oxidase, FAD-binding subunit glcE, fructose 6-phosphate aldolase 1 fsaA or N-acetylgalactosameine-specific IIC component 2 of PTS system agaW; (e) a gene for 6-dEB precursor metabolism module: methylmalonyl-CoA mutase scpA, propionate kinase tdcD, 2-ketobutyrate formatelyase/pyruvate formatelyase 4, inactive tdcE, pyruvate formatelyase pfiB, formate acetyltransferase 2 pfD, predicted 2,3-dehydroadipyl-CoA hydratase PaaF, acetate kinase ackA, phosphate acetyltransferase/phosphate propionyltransferase pta or pyruvate formatelyase ybiW; (f) a gene for fatty acid metabolism module: FadJ component of anaerobic fatty acid oxidation complex fadJ, fatty acid oxidation complex, a component fadB, dihydroxyacetone kinase subunit K dhaK1, dihydroxyacetone kinase dhaK2 or dihydroxyacetone kinase subunit M dhaH; (g) a gene for amino acid and protein synthetic metabolism modules: isopropylmalate isomerase leuC, isopropylmalate isomerase lcuD, 3-phosphoserine/phosphohydroxythreonine aminotransferase scrC, phosphoserine phosphatase scrB, D-3-phosphoglycerate dehydrogenase/a-ketoglutarate reductase serA, glutamate dehydrogenase gdhA or tryptophanase/L-cysteine desulhydrase tnaA; or (h) the combination of frdD+sucC, the combination of IsrC+frdD, the combination of IsrC+sucC, the combination of frdD+rpiA, the combination of talA+guaB or the combination of zwf+guaB; and (2) culturing the E. coli prepared in step (1), thereby synthesizing the polyketide 6-deoxyerythronolide, wherein attenuating the expression of the target gene in the E. coli comprises introducing an interfering molecule that inhibits the expression of the target gene or knocking out the target gene, wherein the interfering molecule that inhibits the expression of the target gene is directed to: a sequence shown in SEQ ID NO: 179 in talB or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 191 in guaB or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 37 in sucC or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 16 in yjiM or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 19 in dhaK2 or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 41 in glcE or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 51 in serC or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 174 in zwf or a full complementary sequence thereof and a sequence shown in SEQ ID NO: 191 in guaB or a full complementary sequence thereof, or a sequence shown in SEQ ID NO: 178 in talA or a full complementary sequence thereof and a sequence shown in SEQ ID NO: 191 in guaB or a full complementary sequence thereof, and wherein the increasing the yield of heterologous synthesis of a polyketide 6-deoxyerythronolide B is being compared to that of unattenuated E. coli.

2. The method of claim 1, wherein in (1), the target gene is selected from: (a) a gene for nucleotide synthesis and other metabolism modules: lsrC, zwf, pgl, gnd, rpe, talA, talB, tktA, tktB, ulaE or yieK; (b) a gene for pentose phosphate and glyoxylate pathway modules: rpiA, purH, pyrB, pyrI, cysQ, pyrC, gmk, guaA, guaB, ndk, pyrF, pyrE, pyrH or hpt; (c) a gene for TCA cycle and oxidative phosphorylation modules: frdD, frdA, sdhA, sucC or sucD; (d) a gene for carbohydrate metabolism module: ptsH, ptsI or glcE; (e) a gene for 6-dEB precursor metabolism module: yjiM, ackA, pta or ybiW; (f) a gene for fatty acid metabolism module: fadB or dhaK2; (g) a gene for amino acid and protein synthetic metabolism modules: serC; or (h) the combination of frdD+sucC, the combination of lsrC+frdD, the combination of lsrC+sucC, the combination of talA+guaB or the combination of zwf+guaB.

3. The method of claim 1, wherein the interfering molecule that inhibits the expression of the target gene is an siRNA.

4. The method of claim 3, wherein the siRNA comprises the following structure: a promoter, a target gene-inhibiting molecule and a terminator.

5. The method of claim 3, wherein the siRNA is included in an expression vector.

6. The method of claim 1, wherein the E. coli is capable of synthesizing the polyketide 6-deoxyerythronolide B.

7. The method of claim 6, wherein in the E. coli, the operon for propionic acid metabolism is knocked out and phosphopantetheinyl transferase gene sfp is integrated into the knockout site; or the operon for propionic acid metabolism is directly knocked out and sfp is incorporated into any non-essential gene or a non-functional DNA sequence region in the genome of the E. coli.

8. The method of claim 7, wherein the E. coli is transformed with a gene encoding polyketide synthetase DEBS2 of Streptomyces erythreus, a gene encoding polyketide synthetase DEBS3 of Streptomyces erythreus, a gene encoding propionyl-CoA carboxylase -CT subunit, a gene encoding propionyl-CoA carboxylase -CT subunit and a gene encoding polyketide synthetase DEBS1 of Streptomyces erythreus.

9. The method of claim 4, wherein the structure further comprises a micF sequence between the target gene-inhibiting molecule and the terminator.

10. The method of claim 1, wherein the interfering molecule that inhibits the expression of the target gene further comprises: a sequence shown in SEQ ID NO: 2 in tdcD or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 4 in scpA or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 5 in ybiW or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 6 in pflB or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 7 in tdcE or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 8 in pflD or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 9 in paaF or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 10 in fadJ or a full complementary sequence thereof and a sequence shown in SEQ ID NO: 11 in fadB or a full complementary sequence thereof, or a sequence shown in SEQ ID NO: 12 in ackA or a full complementary sequence thereof and a sequence shown in SEQ ID NO: 13 in pta or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 14 in leuD or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 15 in leuC or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 17 in purT or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 18 in dhaK1 or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 20 in dhaH or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 21 in ptsH or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 22 in ptsI or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 23 in fsaA or a full complementary sequence thereof and a sequence shown in SEQ ID NO: 24 in ppk or a full complementary sequence thereof, or a sequence shown in SEQ ID NO: 25 in aceF or a full complementary sequence thereof and a sequence shown in SEQ ID NO: 26 in cyoA or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 30 in frdD or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 31 in frdA or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 32 in pgi or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 33 in sdhA or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 34 in sdhB or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 35 in sdhC or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 36 in sdhD or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 38 in sucD or a full complementary sequence thereof and a sequence shown in SEQ ID NO: 39 in tnaA or a full complementary sequence thereof, or a sequence shown in SEQ ID NO: 40 in glcF or a full complementary sequence thereof and a sequence shown in SEQ ID NO: 42 in yaeR or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 43 in lsrC or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 44 in hemN or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 45 in agaW or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 46 in gdhA or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 47 in cyoB or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 48 in rpiA or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 49 in rpiB or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 50 in lpdA or a full complementary sequence thereof and a sequence shown in SEQ ID NO: 28 in serB or a full complementary sequence thereof, or a sequence shown in SEQ ID NO: 29 in serA or a full complementary sequence thereof and a sequence shown in SEQ ID NO: 175 in pgl or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 176 in gnd or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 177 in rpe or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 180 in tktA or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 181 in tktB or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 182 in ulaE or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 183 in yieK or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 184 in purH or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 185 in pyrB or a full complementary sequence thereof and a sequence shown in SEQ ID NO: 186 in pyrI or a full complementary sequence thereof, or a sequence shown in SEQ ID NO: 187 in cysQ or a full complementary sequence thereof and a sequence shown in SEQ ID NO: 188 in pyrC or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 189 in gmk or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 190 in guaA or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 192 in ndk or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 193 in pyrF or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 194 in pyre or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 195 in pyrH or a full complementary sequence thereof, a sequence shown in SEQ ID NO: 196 in hpt or a full complementary sequence thereof.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1, a schematic diagram of sRNA-expressing plasmid PJF650.

(2) FIG. 2, a schematic diagram of the construction process of E. coli WG.

(3) FIG. 3, the construction process of plasmid pZG07.

(4) FIG. 4, the construction process of plasmid pZG08.

(5) FIG. 5, HPLC analysis of isolated fractions of 6-dEB.

(6) FIG. 6, hydrogen NMR spectrum of pure 6-dEB prepared.

(7) FIG. 7, HPLC-ELSD analysis diagram of 6-dEB at 40 mg/L.

(8) FIG. 8, effect of sRNA combinatorial regulation on the heterologous synthesis of 6-dEB by E. coli.

DETAILED DESCRIPTION OF EMBODIMENTS

(9) After an in-depth research, the present inventors have first disclosed a method for promoting a host strain for synthesizing the polyketide 6-dEB to synthesize the polyketide 6-dEB biologically, by attenuating individually or in combination the expression of sucC (which expresses succinyl-CoA synthetase) and other genes in E. coli, to significantly increase the yield of the polyketide heterologously synthesized in E. coli, wherein the highest yield increase rate can reach 60% or more. The present method enables massive accumulation of the polyketide in the fermentation process.

(10) As used herein, the interfering molecule that inhibits the expression of a target gene refers to an agent that can specifically reduce the expression level of the target gene, including a variety of molecules known in the art that can inhibit the expression of the target gene, such as, but not limited to, antisense nucleic acids, locked nucleic acids, peptide nucleic acids, siRNAs, shRNAs and microRNAs (collectively referred to as target gene-inhibiting molecules); or constructs that carry or express antisense nucleic acids, locked nucleic acids, peptide nucleic acids, siRNAs, shRNAs, microRNAs, etc.

(11) As used herein, the heterologous refers to the relationship between two or more nucleic acids or protein sequences from different sources, or the relationship between a protein (or nucleic acid) and a host cell from different sources. For example, if the combination of a nucleic acid and a host cell is usually not naturally occurring, the nucleic acid is heterologous to the host cell. A particular sequence is heterologous to the cell or organism into which it is inserted.

(12) As used herein, the host strain for synthesizing the polyketide 6-dEB refers to a host strain or host cell known in the art that can be applied to synthesize the polyketide 6-dEB. The host strain includes, but is not limited to, E. coli and improved E. coli (including strains transformed with pccB and pccA, strains transformed with eryAI, AII and/or AIII, etc.). Preferred host strain is E. coli which has its operon for propionic acid metabolism knocked out and phosphopantetheinyl transferase gene sfp integrated into the knockout site, and which is transformed with a gene encoding polyketide synthetase DEBS2 of Streptomyces erythreus, a gene encoding polyketide synthetase DEBS3 of Streptomyces erythreus, a gene encoding propionyl-CoA carboxylase -CT subunit, a gene encoding propionyl-CoA carboxylase a-CT subunit and a gene encoding polyketide synthetase DEBS1 of Streptomyces erythreus.

(13) In order to optimize the formation of the polyketide 6-dEB, the present inventors have made extensive studies to find a suitable target gene for improvement, down-regulation of the expression of which helps to promote the formation of 6-dEB. The various target genes disclosed in the present invention are genes known in the art, those skilled in the art can query the sequence information of these genes through GenBank and other platforms, and it is thus easy for those skilled in the art to obtain these genes.

(14) The present invention also provides a set of genes, wherein the set of genes comprises: (a) a gene for nucleotide synthesis and other metabolism modules, purT, lsrC, hemN, zwf, pgl, gnd, rpe, talA, talB, tktA, tktB, ulaE or yieK; (b) a gene for pentose phosphate and glyoxylate pathway modules, yaeR, rpiA, rpiB, purH, pyrB, pyrI, cysQ, pyrC, gmk, guaA, guaB, ndk, pyrF, pyrE, pyrH or hpt; (c) a gene for TCA cycle and oxidative phosphorylation modules, frdD, frdA, sdhA, sdhB, sdhC, sdhD, sucC, sucD, cyoA or cyoB; (d) a gene for carbohydrate metabolism module, aceF, pgi, lpdA, ppk, ptsH, ptsI, glcF, glcE, fsaA or agaW; (e) a gene for 6-dEB precursor metabolism module, yjiM, scpA, scpB, tdcD, tdcE, pflB, pflD, PaaF, ackA, pta or ybiW; (f) a gene target for fatty acid metabolism module, fadJ, fadB, dhaK1, dhaK2 or dhaH; and (g) a gene for amino acid and protein synthetic metabolism modules, leuC, leuD, serC, serB, serA, gdhA or tnaA. Those skilled in the art, according to the present disclosure, may select one or more genes from the set of genes to carry out the operation of the method as described in the present invention and design a material for down-regulating its expression in a host cell on the basis of the selected target gene, thereby promoting the formation of 6-dEB.

(15) As a preferred embodiment of the present invention, the interfering molecule that inhibits the interference of a target gene is sRNA or a construct (including expression vector) carrying the sRNA. Preferably, the sRNA comprises the following structure: a promoter, a target gene-inhibiting molecule (e.g., a target gene-binding sequence) and a terminator; and preferably, the following is also included between the target gene-inhibiting molecule and the terminator: micF sequence.

(16) The design of the promoter and terminator may be carried out according to the experience of those skilled in the art, and any suitable promoter and terminator are encompassed within the scope of the present invention. As a preferred embodiment of the present invention, the promoter is Pr promoter, and the terminator is TE terminator. However, those skilled in the art may consider changing the promoter and terminator, which are still encompassed within the scope of the present invention.

(17) Typically, the sRNA is located in an expression vector. Accordingly, the present invention also encompasses a vector comprising the sRNA. Generally, the expression vector also contains a replication origin and/or a marker gene, etc. Methods well known to those skilled in the art can be used to construct an expression vector required for the present invention. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. It will be appreciated that any expression vector may be selected as long as the sRNA can be inserted and the expression of the target gene can be down-regulated after transforming a cell. In addition, the expression vector preferably comprises one or more selectable marker genes to provide a phenotypic trait for selecting a transformed host cell. Transformation of a host cell with an expression vector can be carried out using conventional techniques well known to those skilled in the art.

(18) The present invention also provides a host strain for synthesizing the polyketide 6-dEB, wherein the host strain is transformed with an interfering molecule that inhibits the expression of a target gene. The host strain can efficiently produce the polyketide 6-dEB.

(19) The present invention also provides a kit for promoting a host strain for synthesizing the polyketide 6-dEB to synthesize the polyketide 6-dEB biologically, the kit comprising: transformed with the sum of all the host strains for synthesizing the polyketide 6-dEB of the present invention (from which one or more strains those skilled in the art can select for production); and preferably, the kit comprising: transformed with the sum of the more preferred host strains for synthesizing the polyketide 6-dEB (host strains transformed with an interfering molecule that down-regulates the gene expression of the target gene or the target gene combination) of the present invention.

(20) Or, the kit comprises: the sum of the sRNAs of the present invention (from which one or more sRNAs those skilled in the art can select for application); and preferably, the kit comprises: the sum of the more preferred sRNAs (sRNAs that down-regulate the gene expression of the target gene or the target gene combination) of the present invention.

(21) The kit comprises: the sum of vectors that comprise the sRNA of the present invention (from which one or more vectors those skilled in the art can select for application); and preferably, the kit comprises: the sum of vectors that comprise the more preferred sRNAs (sRNAs that down-regulate the gene expression of the target gene or the target gene combination) of the present invention.

(22) The present invention will be further illustrated with reference to specific examples below. It is to be understood that these examples are merely illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental methods not specified for the specific conditions in the following examples are generally carried out in accordance with conventional conditions, such as the conditions described in J. Sambrook et al. (eds), Molecular Cloning: A Laboratory Manual, 3rd Edition, Science Press, 2002, or in accordance with the conditions recommended by the manufacturer.

(23) The strains, culture media and related reagents used in the present invention were as follows.

(24) The strain E. coli DH10B was used as the clone host, and the strain E. coli WG (pZG07/pZG08) was used as the host for synthesizing the polyketide 6-dEB (see, L U Zhiguo, Doctoral Dissertation of East China University of Science and Technology, 2011). The molecular cloning-related enzymes and kits for the extraction and purification of DNA fragments and plasmids were provided by NEB, TaKaRa and Axygen, respectively. The various medium components, antibiotics and other related reagents were purchased from Oxiod, Sinopharm Group and Shanghai Bioengineering Co., Ltd. The primers were synthesized by GenScript (Nanjing) Co., Ltd.

(25) The formulation of the 6-dEB fermentation medium involved in the present invention was as follows (g/L): NaCl, 10; peptone, 10; yeast extract, 5; glycerin, 15; and 100 mM HEPES, with pH adjusted to 7.6. The inducers involved in the present invention were as follows: IPTG: 24 g/ml; and precursor: sodium propionate 20 mM. The induction conditions involved in the present invention were as follows: 10 ml of culture medium charged in a 100 ml shake flask was fermented and cultured for 5 days at 22 C., 250 rpm.

(26) The antibiotic concentrations involved in the present invention were ampicillin 100 mg/L, kanamycin 50 mg/L and chloramphenicol 34 mg/L, respectively.

Example 1

Construction of sRNA-Expressing Plasmids

(27) The present invention regulated the expression of a target gene via sRNA interference technology, that is, an sRNA was expressed to bind to the mRNA of the target gene, thereby inhibiting the binding of the mRNA of the target gene to the ribosome and then inhibiting the expression of the target gene. In the present invention, a target gene conducive to improving the synthesis of a polyketide was identified by attenuating the selected gene target.

(28) A deoB-sRNA gene sequence fragment synthesized chemically (synthesize by Shanghai Jieduan Bioengineering Co., Ltd.) comprised Pr promoter, deoB target gene-binding site (the DNA sequence is 24 bp in length, caccataataaatgcacgtttcat (SEQ ID NO: 1); completely complementary to 24 bp starting from the ATG initiating sequence of the pentose phosphate mutase deoB gene, Genbank No. of the deoB gene: NC_012971.2), micF sequence (Genbank No.: NC_000913.3) and TE terminator, and digestion sites NdeI and HindIII were introduced at both ends. The DNA sequence of this sRNA gene sequence fragment was as follows (SEQ ID NO: 52):

(29) catatgggatcctaacaccgtgcgtgttgactattttacctctggcggtgataatggttgccaccataataaatgc acgtttcattttctgttgggccattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggctt tttttctcgagctcgagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgtttttgtc ggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttataactagtagatctaagctt

(30) In the construction of an sRNA-expressing plasmid, the pACYCDuet-1 plasmid (purchased from Novagen) was used as the PCR template, a vector fragment only containing chloramphenicol resistance and p15A replicon was obtained by cloning with primers pACYC-F and pACYC-R (digestion sites NdeI and HindIII were introduced at both ends of the primers), and this vector fragment was double digested with NdeI and HindIII after recovering with a cleaning and recovering kit (purchased from Axygen); and the above deoB-sRNA sequence fragment synthesized chemically was double digested with NdeI and HindIII at the same time. The double-digested vector fragment and deoB-sRNA fragment were directly recovered with the cleaning and recovering kit, and the two recovered fragments were then ligated with T4 ligase to obtain template plasmid pJF650 (FIG. 1), for attenuating the expression of the deoB gene in E. coli.

(31) Using template plasmid pJF650 as the template together with the primers in Table 1 and the PCR conditions in Table 2, sRNA plasmid libraries were directly obtained by site-directed mutagenesis PCR amplification that were capable of attenuating the expression of different target genes as follows in E. coli: (1) genes for TCA cycle and oxidative phosphorylation modules, frdD, frdA, sdhA, sdhB, sdhC, sdhD, sucC, sucD, cyoA and cyoB; (2) genes for carbohydrate metabolism module, aceF, pgi, lpdA, ppk, ptsH, ptsI, glcF, glcE, fsaA and agaW; (3) genes for 6-dEB precursor metabolism module, yjiM, scpA, scpB, tdcD, tdcE, pflB, pflD, PaaF, ackA, pta and ybiW; (4) genes for pentose phosphate and glyoxylate pathway modules, yaeR, rpiA, rpiB, purH, pyrB, pyrI, cysQ, pyrC, gmk, guaA, guaB, ndk, pyrF, pyrE, pyrH and hpt; (5) gene targets for fatty acid metabolism module, fadJ, fadB, dhaK1, dhaK2 and dhaH; (6) genes for amino acid and protein synthetic metabolism modules, leuC, leuD, serC, serB, serA, gdhA and tnaA; and (7) genes for nucleotide synthesis and other metabolism modules, purT, lsrC, hemN, zwf, pgl, gnd, rpe, talA, talB, tktA, tktB, ulaE and yieK; wherein the sRNA plasmid libraries were pSJ01 (target gene tdcD), pSJ02 (target gene scpB), pSJ03 (target gene scpA), pSJ04 (target gene ybiW), pSJ05 (target gene pflB), pSJ06 (target gene tdcE), pSJ07 (target gene pflD), pSJ08 (target gene paaF), pSJ09 (target gene fadJ), pSJ10 (target gene fadB), pSJ11 (target gene ackA), pSJ12 (target gene pta), pSJ13 (target gene leuD), pSJ14 (target gene leuC), pSJ15 (target gene yjiM), pSJ16 (target gene purT), pSJ17 (target gene dhaK1), pSJ18 (target gene dhaK2), pSJ19 (target gene dhaH), pSJ20 (target gene ptsH), pSJ21 (target gene ptsI), pSJ22 (target gene fsaA), pSJ24 (target gene ppk), pSJ26 (target gene aceF), pSJ29 (target gene cyoA), pSJ30 (target gene frdD), pSJ33 (target gene frdA), pSJ34 (target gene pgi), pSJ35 (target gene sdhA), pSJ36 (target gene sdhB), pSJ37 (target gene sdhC), pSJ38 (target gene sdhD), pSJ39 (target gene sucC), pSJ40 (target gene sucD), pSJ41 (target gene tnaA), pSJ43 (target gene glcF), pSJ44 (target gene gleE), pSJ50 (target gene yaeR), pSJ53 (target gene lsrC), pSJ54 (target gene hemN), pSJ66 (target gene agaW), pJF663 (target gene zwf), pJF666 (target gene pgl), pJF670 (target gene gnd), pSJ128 (target gene rpe), pSJ129 (target gene talA), pSJ130 (target gene talB), pSJ131 (target gene tktA), pSJ132 (target gene tktB), pSJ133 (target gene ulaE), pSJ141 (target gene yieK), pSJ147 (target gene purH), pSJ148 (target gene pyrB), pSJ149 (target gene pyrI), pSJ150 (target gene cysQ), pSJ151 (target gene pyrC), pSJ152 (target gene gmk), pSJ153 (target gene guaA), pSJ154 (target gene guaB), pSJ155 (target gene ndk), pSJ156 (target gene pyrF), pSJ157 (target gene pyrE), pSJ158 (target gene pyrH), pSJ159 (target gene hpt), pJF656 (target gene gdhA), pJF664 (target gene cyoB), pJF667 (target gene rpiA), pJF668 (target gene rpiB), pJF671 (target gene lpdA), pJF672 (target gene serC), pJF673 (target gene serB) and pJF674 (target gene serA) (Table 3). Taking the construction of an sRNA plasmid for attenuating the target gene sucC (which expresses succinyl-CoA synthetase) as an example, the deoB target gene-binding site with a length of 24 bp in the skeleton of the pJF650 plasmid was directly mutated into sucC target gene-binding site (completely complementary to the DNA sequence with a length of 24 bp starting from the ATG initiating sequence of the sucC gene) by site-directed mutagenesis PCR using template plasmid pJF650 as the template together with the sucC-sRNA-F and sucC-sRNA-R primers in Table 1 and the PCR conditions in Table 2, obtaining sRNA plasmid pSJ39 that is capable of attenuating the expression of the sucC gene.

(32) TABLE-US-00001 TABLE1 Primersforplasmidconstruction Con- Primer Target structed SEQ gene-binding plasmid Primer Primersequence ID sequence name name (from5 to3) NO: (SEQIDNO:) pJF650 pACYC- CCCAAGCTTCTGAAACCTCAGGCATTTG 53 F A pACYC- CGGGATCCGCGCAACGCAATTAATGTA 54 R A pSJ01 scpB-sRN aacgttaacatactgataagacatTTTCTGTTGGGCCA 55 targetingscpB A-F TTGCATTGCC Aacgttaacatactgata scpB-sRN atgtcttatcagtatgttaacgttGCAACCATTATCACC 56 agacat(2) A-R GCCAGAGGTA pSJ02 tdcD-sRN caaaacaaccggaaattcattcatTTTCTGTTGGGCCA 57 targetingtdcD A-F TTGCATTGCC Caaaacaaccggaaatt tdcD-sRN atgaatgaatttccggttgttttgGCAACCATTATCAC 58 cattcat(3) A-R CGCCAGAGGTA pSJ03 scpA-sR ttgccactcctgcacgttagacatTTTCTGTTGGGCCA 59 targetingscpA: NA-F TTGCATTGCC Ttgccactcctgcacgtt scpA-sR atgtctaacgtgcaggagtggcaaGCAACCATTATCA 60 agacat(4) NA-R CCGCCAGAGGTA pSJ04 ybiW-sR cgtgtccagtttcagtgtggtcatTTTCTGTTGGGCCA 61 targetingybiW: NA-F TTGCATTGCC Cgtgtccagtttcagtgt ybiW-sR atgaccacactgaaactggacacgGCAACCATTATC 62 ggtcat(5) NA-R ACCGCCAGAGGTA pSJ05 pflB-sRN taacttttcattaagctcggacatTTTCTGTTGGGCCAT 63 targetingpflB: A-F TGCATTGCC Taacttttcattaagctcg pflB-sRN atgtccgagcttaatgaaaagttaGCAACCATTATCA 64 gacat(6) A-R CCGCCAGAGGTA pSJ06 tdcE-sRN gctggtatcaatatctaccttcatTTTCTGTTGGGCCAT 65 targetingtdcE: A-F TGCATTGCC Gctggtatcaatatctac tdcE-sRN atgaaggtagatattgataccagcGCAACCATTATCA 66 cttcat(7) A-R CCGCCAGAGGTA pSJ07 pflD-sRN gaggcgagagatacgattcgtcatTTTCTGTTGGGCC 67 targetingpflD: A-F ATTGCATTGCC Gaggcgagagatacga pflD-sRN atgacgaatcgtatctctcgcctcGCAACCATTATCAC 68 ttcgtcat(8) A-R CGCCAGAGGTA pSJ08 paaF-sRN acggctgacgatcagttcgctcatTTTCTGTTGGGCC 69 targetingpaaF: A-F ATTGCATTGCC Acggctgacgatcagtt paaF-sRN atgagcgaactgatcgtcagccgtGCAACCATTATCA 70 cgctcat(9) A-R CCGCCAGAGGTA pSJ09 fadJ-sRN ggtaaacgctgatgtcatttccatTTTCTGTTGGGCCA 71 targetingfadJ: A-F TTGCATTGCC Ggtaaacgctgatgtcat fadJ-sRN atggaaatgacatcagcgtttaccGCAACCATTATCA 72 ttccat(10) A-R CCGCCAGAGGTA pSJ10 fadB-sRN cagggtgtcgcctttgtaaagcatTTTCTGTTGGGCCA 73 targetingfadB: A-F TTGCATTGCC Cagggtgtcgcctttgta fadB-sRN atgctttacaaaggcgacaccctgGCAACCATTATCA 74 aagcat(11) A-R CCGCCAGAGGTA pSJ11 ackA-sR aaccagtactaacttactcgacatTTTCTGTTGGGCCA 75 targetingackA: NA-F TTGCATTGCC Aaccagtactaacttact ackA-sR atgtcgagtaagttagtactggttGCAACCATTATCAC 76 cgacat(12) NA-R CGCCAGAGGTA pSJ12 pta-sRNA- gatcagcataataatacgggacacTTTCTGTTGGGCC 77 targetingpta: F ATTGCATTGCC Gatcagcataataatacg pta-sRNA- gtgtcccgtattattatgctgatcGCAACCATTATCAC 78 ggacac(13) R CGCCAGAGGTA pSJ13 leuD-sRN gtgtttgataaatttctctgccatTTTCTGTTGGGCCAT 79 targetingleuD: A-F TGCATTGCC Gtgtttgataaatttctctg leuD-sRN atggcagagaaatttatcaaacacGCAACCATTATCA 80 ccat(14) A-R CCGCCAGAGGTA pSJ14 leuC-sRN tttttcgtataacgtcttagccatTTTCTGTTGGGCCAT 81 targetingleuC: A-F TGCATTGCC Tttttcgtataacgtcttag leuC-sRN atggctaagacgttatacgaaaaaGCAACCATTATCA 82 ccat(15) A-R CCGCCAGAGGTA pSJ15 yjiM-sRN gggtagatcggtgacaagtgacatTTTCTGTTGGGCC 83 targetingyjiM: A-F ATTGCATTGCC Gggtagatcggtgacaa yjiM-sRN atgtcacttgtcaccgatctacccGCAACCATTATCAC 84 gtgacat(16) A-R CGCCAGAGGTA pSJ16 purT-sRN cagcgcagtgcctaataacgtcatTTTCTGTTGGGCC 85 targetingpurT: A-F ATTGCATTGCC Cagcgcagtgcctaata purT-sRN atgacgttattaggcactgcgctgGCAACCATTATCA 86 acgtcat(17) A-R CCGCCAGAGGTA pSJ17 dhaK1-sR cacatcattgatcaattttttcatTTTCTGTTGGGCCAT 87 targetingdhaK1: NA-F TGCATTGCC Cacatcattgatcaattttt dhaK1-sR atgaaaaaattgatcaatgatgtgGCAACCATTATCA 88 tcat(18) NA-R CCGCCAGAGGTA pSJ18 dhaK2-sR aatttgagttctgctcagtgacatTTTCTGTTGGGCCA 89 targetingdhaK2 NA-F TTGCATTGCC Aatttgagttctgctcagt dhaK2-sR atgtcactgagcagaactcaaattGCAACCATTATCA 90 gacat(19) NA-R CCGCCAGAGGTA pSJ19 dhaH-sR tgaaactatgaccaggtttaccatTTTCTGTTGGGCCA 91 targetingdhaH: NA-F TTGCATTGCC Tgaaactatgaccaggtt dhaH-sR atggtaaacctggtcatagtttcaGCAACCATTATCAC 92 taccat(20) NA-R CGCCAGAGGTA pSJ20 ptsH-sRN aatggtaacttcttgctggaacatTTTCTGTTGGGCCA 93 targetingptsH: A-F TTGCATTGCC Aatggtaacttcttgctg ptsH-sRN atgttccagcaagaagttaccattGCAACCATTATCAC 94 gaacat(21) A-R CGCCAGAGGTA pSJ21 ptsI-sRN ggatgctaaaatgcctgaaatcatTTTCTGTTGGGCCA 95 targetingptsI: A-F TTGCATTGCC Ggatgctaaaatgcctg ptsI-sRN atgatttcaggcattttagcatccGCAACCATTATCAC 96 aaatcat(22) A-R CGCCAGAGGTA pSJ22 fsaA-sRN tgaagtatccagatacagttccatTTTCTGTTGGGCCA 97 targetingfsaA: A-F TTGCATTGCC Tgaagtatccagataca fsaA-sRN atggaactgtatctggatacttcaGCAACCATTATCAC 98 gttccat(23) A-R CGCCAGAGGTA pSJ24 ppk-sRN gatgtatagcttttcctgacccatTTTCTGTTGGGCCA 99 targetingppk: A-F TTGCATTGCC Gatgtatagcttttcctga ppk-sRN atgggtcaggaaaagctatacatcGCAACCATTATCA 100 cccat(24) A-R CCGCCAGAGGTA pSJ26 aceF-sRN cggtactttgatttcgatagccatTTTCTGTTGGGCCA 101 targetingaceF: A-F TTGCATTGCC Cggtactttgatttcgata aceF-sRN atggctatcgaaatcaaagtaccgGCAACCATTATCA 102 gccat(25) A-R CCGCCAGAGGTA pSJ29 cyoA-sR tttattgtatttcctgagtctcatTTTCTGTTGGGCCATT 103 targetingcyoA: NA-F GCATTGCC Tttattgtatttcctgagtc cyoA-sR atgagactcaggaaatacaataaaGCAACCATTATCA 104 tcat(26) NA-R CCGCCAGAGGTA pSJ30 frdD-sRN acgctttggatttggattaatcatTTTCTGTTGGGCCAT 105 targetingfrdD: A-F TGCATTGCC Acgctttggatttggatta frdD-sRN atgattaatccaaatccaaagcgtGCAACCATTATCA 106 atcat(30) A-R CCGCCAGAGGTA pSJ33 frdA-sRN aagatcggcttgaaaggtttgcacTTTCTGTTGGGCC 107 targetingfrdA: A-F ATTGCATTGCC Aagatcggcttgaaagg frdA-sRN gtgcaaacctttcaagccgatcttGCAACCATTATCAC 108 tttgcac(31) A-R CGCCAGAGGTA pSJ34 pgi-sRNA- ctgcgttggattgatgtttttcatTTTCTGTTGGGCCAT 109 targetingpgi: F TGCATTGCC Ctgcgttggattgatgtttt pgi-sRNA- atgaaaaacatcaatccaacgcagGCAACCATTATCA 110 tcat(32) R CCGCCAGAGGTA pSJ35 sdhA-sR aaattctctgactggcaatttcatTTTCTGTTGGGCCAT 111 targetingsdhA: NA-F TGCATTGCC Aaattctctgactggcaa sdhA-sR atgaaattgccagtcagagaatttGCAACCATTATCA 112 tttcat(33) NA-R CCGCCAGAGGTA pSJ36 sdhB-sR ataaattgaaaactcgagtctcatTTTCTGTTGGGCCA 113 targetingsdhB: NA-F TTGCATTGCC Ataaattgaaaactcgag sdhB-sR atgagactcgagttttcaatttatGCAACCATTATCAC 114 tctcat(34) NA-R CGCCAGAGGTA pSJ37 sdhC-sR ttgttttttcacatttcttatcatTTTCTGTTGGGCCATT 115 targetingsdhC: NA-F GCATTGCC Ttgttttttcacatttcttat sdhC-sR atgataagaaatgtgaaaaaacaaGCAACCATTATCA 116 cat(35) NA-R CCGCCAGAGGTA pSJ38 sdhD-sR taatgcggaggcgttgcttaccatTTTCTGTTGGGCCA 117 targetingsdhD: NA-F TTGCATTGCC Taatgcggaggcgttgc sdhD-sR atggtaagcaacgcctccgcattaGCAACCATTATCA 118 ttaccat(36) NA-R CCGCCAGAGGTA pSJ39 sucC-sRN tgcctgatattcatgtaagttcatTTTCTGTTGGGCCAT 119 targetingsucC: A-F TGCATTGCC Tgcctgatattcatgtaa sucC-sRN atgaacttacatgaatatcaggcaGCAACCATTATCA 120 gttcat(37) A-R CCGCCAGAGGTA pSJ40 sucD-sR gtttttatcgattaaaatggacatTTTCTGTTGGGCCAT 121 targetingsucD: NA-F TGCATTGCC Gtttttatcgattaaaatg sucD-sR atgtccattttaatcgataaaaacGCAACCATTATCAC 122 gacat(38) NA-R CGCCAGAGGTA pSJ41 tnaA-sRN agggagatgtttaaagttttccatTTTCTGTTGGGCCA 123 targetingtnaA: A-F TTGCATTGCC Agggagatgtttaaagtt tnaA-sRN atggaaaactttaaacatctccctGCAACCATTATCAC 124 ttccat(39) A-R CGCCAGAGGTA pSJ43 glcF-sRN ctcttcagttaattgggtttgcatTTTCTGTTGGGCCAT 125 targetingglcF: A-F TGCATTGCC Ctcttcagttaattgggttt glcF-sRN atgcaaacccaattaactgaagagGCAACCATTATCA 126 gcat(40) A-R CCGCCAGAGGTA pSJ44 glcE-sRN gctgtaatcacactcgcgtagcatTTTCTGTTGGGCCA 127 targetingglcE: A-F TTGCATTGCC Gctgtaatcacactcgcg glcE-sRN atgctacgcgagtgtgattacagcGCAACCATTATCA 128 tagcat(41) A-R CCGCCAGAGGTA pSJ50 yaeR-sR gtgaacctgttttaaacccagcatTTTCTGTTGGGCCA 129 targetingyaeR: NA-F TTGCATTGCC Gtgaacctgttttaaacc yaeR-sR atgctgggtttaaaacaggttcacGCAACCATTATCA 130 cagcat(42) NA-R CCGCCAGAGGTA pSJ53 lsrC-sRN gttgttctgaataaacttcagcatTTTCTGTTGGGCCA 131 targetinglsrC: A-F TTGCATTGCC Gttgttctgaataaacttc lsrC-sRN atgctgaagtttattcagaacaacGCAACCATTATCAC 132 agcat(43) A-R CGCCAGAGGTA pSJ54 hemN-sR ccagtcgatttgctgtacagacatTTTCTGTTGGGCCA 133 targetinghemN: NA-F TTGCATTGCC Ccagtcgatttgctgtac hemN-sR atgtctgtacagcaaatcgactggGCAACCATTATCA 134 agacat(44) NA-R CCGCCAGAGGTA pSJ66 agaW-sR tgcctgcaacaggctgatttccatTTTCTGTTGGGCCA 135 targetingagaW: NA-F TTGCATTGCC Tgcctgcaacaggctga agaW-sR atggaaatcagcctgttgcaggcaGCAACCATTATCA 136 tttccat(45) NA-R CCGCCAGAGGTA pJF656 gdhA-F ctccagagaatatgtctgatccatTTTCTGTTGGGCCA 137 targetinggdhA: TTGCAT Ctccagagaatatgtctg gdhA-R ATGGATCAGACATATTCTCTGGAGGCAA 138 atccat(46) CCATTATCACCGCCAG pJF664 cyoB-F ATCAAGTGATAATTTTCCGAACATTTTC 140 targetingcyoB: TGTTGGGCCATTGCAT Atgttcggaaaattatca cyoB-B atgttcggaaaattatcacttgatGCAACCATTATCAC 141 cttgat(47) CGCCAG pJF667 rpiA-F ttttttcaattcatcctgcgtcatTTTCTGTTGGGCCAT 142 targetingrpiA: TGCAT Ttttttcaattcatcctgcg rpiA-R ATGACGCAGGATGAATTGAAAAAAGCA 143 tcat(48) ACCATTATCACCGCCAG pJF668 rpiB-F acagccaaatgcaatctttttcatTTTCTGTTGGGCCA 144 targetingrpiB: TTGCAT Acagccaaatgcaatctt rpiB-R ATGAAAAAGATTGCATTTGGCTGTGCAA 145 tttcat(49) CCATTATCACCGCCAG pJF671 lpdA-F ctgagttttgatttcagtactcatTTTCTGTTGGGCCAT 146 targetinglpdA: TGCAT Ctgagttttgatttcagta lpdA-R ATGAGTACTGAAATCAAAACTCAGGCA 147 ctcat(50) ACCATTATCACCGCCAG pJF672 serC-F actaaaattgaagatttgagccatTTTCTGTTGGGCCA 148 targetingserC: TTGCAT Actaaaattgaagatttg serC-R ATGGCTCAAATCTTCAATTTTAGTGCAA 149 agccat(51) CCATTATCACCGCCAG pJF673 serB-F gtcgcaccaggtaatgttaggcatTTTCTGTTGGGCC 150 targetingserB: ATTGCAT Gtcgcaccaggtaatgtt serB-R ATGCCTAACATTACCTGGTGCGACGCAA 151 aggcat(28) CCATTATCACCGCCAG pJF674 serA-F tttctccagcgatacctttgccatTTTCTGTTGGGCCAT 152 targetingserA: TGCAT Tttctccagcgataccttt serA-R ATGGCAAAGGTATCGCTGGAGAAAGCA 153 gccat(29) ACCATTATCACCGCCAG pJF663 zwf-sRN ctgggctgtttgcgttaccgccatTTTCTGTTGGGCCA 197 targetingzwf: A-R TTGCAT Ctgggctgtttgcgttac zwf-sRN atggcggtaacgcaaacagcccagGCAACCATTATC 198 cgccat(174) A-R ACCGCCAG pJF666 pgl-sRNA- ggcgatataaactgtttgcttcatTTTCTGTTGGGCCA 199 targetingpgl: F TTGCAT Ggcgatataaactgtttg pgl-sRNA- ATGAAGCAAACAGTTTATATCGCCGCAA 200 cttcat(175) F CCATTATCACCGCCAG pJF670 gnd-sRN tacgccgatctgttgcttggacatTTTCTGTTGGGCCA 201 targetinggnd: A-F TTGCAT tacgccgatctgttgcttg gndsRNA- ATGTCCAAGCAACAGATCGGCGTAGCA 202 gacat(176) F ACCATTATCACCGCCAG pSJ128 rpe-sRNA- gggggcaatcaaatactgtttcatTTTCTGTTGGGCCA 203 targetingrpe: F TTGCATTGCC gggggcaatcaaatact rpe-sRNA- atgaaacagtatttgattgcccccGCAACCATTATCAC 204 gtttcat(177) R CGCCAGAGGTA pSJ129 talA-sRN tttgatgccgtctaactcgttcatTTTCTGTTGGGCCAT 205 targetingtalA: A-F TGCATTGCC tttgatgccgtctaactcgt ta1A-sRN atgaacgagttagacggcatcaaaGCAACCATTATCA 206 tcat(178) A-R CCGCCAGAGGTA pSJ130 ta1B-sRN aagggaggtcaatttgtccgtcatTTTCTGTTGGGCCA 207 targetingtalB: A-F TTGCATTGCC aagggaggtcaatttgtc talB-sRN atgacggacaaattgacctcccttGCAACCATTATCA 208 cgtcat(179) A-R CCGCCAGAGGTA pSJ131 tktA-sRN ggcaagctctttacgtgaggacatTTTCTGTTGGGCC 209 targetingtktA: A-F ATTGCATTGCC Ggcaagctctttacgtga tktA-sRN atgtcctcacgtaaagagcttgccGCAACCATTATCA 210 ggacat(180) A-R CCGCCAGAGGTA pSJ132 tktB-sRN attggcaaggtcttttcgggacatTTTCTGTTGGGCCA 211 targetingtktB: A-F TTGCATTGCC attggcaaggtcttttcgg tktB-sRN atgtcccgaaaagaccttgccaatGCAACCATTATCA 212 gacat(181) A-R CCGCCAGAGGTA pSJ133 ulaE-sRN aagcgggatttgtttggacaacatTTTCTGTTGGGCCA 213 targetingulaE: A-F TTGCATTGCC aagcgggatttgtttgga ulaE-sRN atgttgtccaaacaaatcccgcttGCAACCATTATCAC 214 caacat(182) A-R CGCCAGAGGTA pSJ141 yieK-sRN atcttcggtaatgattaatttcatTTTCTGTTGGGCCAT 215 targetingyieK: A-F TGCATTGCC atcttcggtaatgattaatt yieK-sRN atgaaattaatcattaccgaagatGCAACCATTATCAC 216 tcat(183) A-R CGCCAGAGGTA pSJ147 purH-sR gcggactggacgacgttgttgcatTTTCTGTTGGGCC 217 targetingpurH: NA-F ATTGCATTGCC gcggactggacgacgtt purH-sR atgcaacaacgtcgtccagtccgcGCAACCATTATCA 218 gttgcat(184) NA-R CCGCCAGAGGTA pSJ148 pyrB-sRN tttctgatatagcggattagccatTTTCTGTTGGGCCA 219 targetingpyrB: A-F TTGCATTGCC tttctgatatagcggatta pyrB-sRN atggctaatccgctatatcagaaaGCAACCATTATCA 220 gccat(185) A-R CCGCCAGAGGTA pSJ149 pyrI-sRN ctgcaatttattatcgtgtgtcatTTTCTGTTGGGCCAT 221 targetingpyrI: A-F TGCATTGCC ctgcaatttattatcgtgtg pyrI-sRN atgacacacgataataaattgcagGCAACCATTATCA 222 tcat(186) A-R CCGCCAGAGGTA pSJ150 cysQ-sR aagctggcatacttgatctaacatTTTCTGTTGGGCCA 223 targetingcysQ: NA-F TTGCATTGCC aagctggcatacttgatct cysQ-sR atgttagatcaagtatgccagcttGCAACCATTATCAC 224 aacat(187) NA-R CGCCAGAGGTA pSJ151 pyrC-sRN taatacctgggatggtgcagtcatTTTCTGTTGGGCCA 225 targetingpyrC: A-F TTGCATTGCC taatacctgggatggtgc pyrC-sRN atgactgcaccatcccaggtattaGCAACCATTATCA 226 agtcat(188) A-R CCGCCAGAGGTA pSJ152 gmk-sRN aatataaagcgtgccttgagccatTTTCTGTTGGGCCA 227 targetinggmk: A-F TTGCATTGCC aatataaagcgtgccttg gmk-sRN atggctcaaggcacgctttatattGCAACCATTATCAC 228 agccat(189) A-R CGCCAGAGGTA pSJ153 guaA-sR atgcttatgaatgttttccgtcatTTTCTGTTGGGCCAT 229 targetingguaA: NA-F TGCATTGCC atgcttatgaatgttttccg guaA-sR atgacggaaaacattcataagcatGCAACCATTATCA 230 tcat(190) NA-R CCGCCAGAGGTA pSJ154 guaB-sR agcttctttagcgatacgtagcatTTTCTGTTGGGCCA 231 targetingguaB: NA-F TTGCATTGCC agcttctttagcgatacgt guaB-sR atgctacgtatcgctaaagaagctGCAACCATTATCA 232 agcat(191) NA-R CCGCCAGAGGTA pSJ155 ndk-sRN ggaaaaagtacgttcaatagccatTTTCTGTTGGGCC 233 targetingndk: A-F ATTGCATTGCC ggaaaaagtacgttcaat ndk-sRN atggctattgaacgtactttttccGCAACCATTATCAC 234 agccat(192) A-R CGCCAGAGGTA pSJ156 pyrF-sRN agaagatgaagcagttaacgtcatTTTCTGTTGGGCC 235 targetingpyrF: A-F ATTGCATTGCC agaagatgaagcagttaa pyrF-sRN atgacgttaactgcttcatcttctGCAACCATTATCAC 236 cgtcat(193) A-R CGCCAGAGGTA pSJ157 pyrE-sRN aaactggcgctgatatggtttcatTTTCTGTTGGGCCA 237 targetingpyrE: A-F TTGCATTGCC aaactggcgctgatatgg pyrE-sRN atgaaaccatatcagcgccagtttGCAACCATTATCA 238 tttcat(194) A-R CCGCCAGAGGTA pSJ158 pyrH-sR gacgggttttgcattggtagccatTTTCTGTTGGGCCA 239 targetingpyrH: NA-F TTGCATTGCC gacgggttttgcattggta pyrH-sR atggctaccaatgcaaaacccgtcGCAACCATTATCA 240 gccat(195) NA-R CCGCCAGAGGTA pSJ159 hpt-sRNA- cattacttctacagtatgtttcatTTTCTGTTGGGCCAT 241 targetinghpt: F TGCATTGCC cattacttctacagtatgttt hpt-sRNA- atgaaacatactgtagaagtaatgGCAACCATTATCA 242 cat(196) R CCGCCAGAGGTA

(33) TABLE-US-00002 TABLE 2 PCR conditions Name Conditions System 2x GC buffer I: 25 l; upstream and downstream primers: each 1 l; dNTP: 5 l; template plasmid: 0.3; enayme LA- Taq: 0.5 l; ddH.sub.2O: the reaction system was made up to 50 l; Program pre-denaturation at 95 C.: 3 min; 30 cycles: denaturation at 94 C.: 30 s, annealing at 55 C.: 30 s, and extending at 72 C.: 3 min; 72 C.: 10 min; maintaining at 16 C.

(34) TABLE-US-00003 TABLE 3 Regulation of target function through sRNA technology Target regulated through sRNA Plasmid Genbank No. technology Target function pSJ39 NC_012971.2 sucC succinyl-CoA synthetase, subunit pSJ15 NC_012971.2 yjiM hypothetical protein pSJ30 NC_012892.2 frdD fumarate reductase pSJ53 NC_012892.2 lsrC Autoinducer-2ABC transporter pSJ44 NC_012971.2 glcE glycolate oxidase, FAD-binding subunit pSJ04 NC_012971.2 ybiW pyruvate formatelyase pSJ35 NC_012971.2 sdhA succinate dehydrogenase pSJ20 NC_012892.2 ptsH HPr protein of phosphoenolpyruvate-sugar phosphotransferase system (PTS system) npSJ18 NC_012971.2 dhaK2 dihydroxyacetone kinase pSJ40 NC_012971.2 sucD succinyl-CoA synthetase pSJ33 NC_012971.2 frdA fumarate reductase, subunit pSJ21 NC_012971.2 ptsI PTSI protein of phosphoenolpyruvate-sugar phosphotransferase system (PTS system) pSJ10 NC_012971.2 fadB fatty acid oxidation complex, component pSJ11 NC_012971.2 ackA acetate kinase pJF672 NC_012971.2 serC 3-phosphoserine/phosphohydroxythreonine aminotransferase pJF667 NC_012971.2 rpiA ribose-5-phosphate isomerase A pSJ12 NC_012971.2 pta phosphate acetyltransferase/phosphate propionyltransferase pSJ05 NC_012971.2 pflB pyruvate formatelyase (inactive) pSJ17 NC_012971.2 dhaK1 dihydroxyacetone kinase subunit K pJF673 NC_012971.2 serB phosphoserine phosphatase pSJ13 NC_012892.2 leuD isopropylmalate isomerase pSJ36 NC_012892.2 sdhB succinate dehydrogenase pSJ14 NC_012892.2 leuC isopropylmalate isomerase LeuC pSJ22 NC_012892.2 fsaA fructose 6-phosphate aldolase 1 pSJ06 NC_012892.2 tdcE 2-ketobutyrate formatelyase/pyruvate formatelyase 4, inactive pSJ38 NC_012892.2 sdhD succinate dehydrogenase pSJ09 NC_012892.2 fadJ FadJ component of anaerobic fatty acid oxidation complex pJF668 NC_012971.2 rpiB allose-6-phosphate isomerase/ribose-5-phosphate isomerase B pSJ34 NC_012892.2 pgi phosphoglucose isomerase pSJ43 NC_012892.2 glcF glycolateoxidase, predicted iron-sulfur subunit pSJ01 NC_012892.2 scpB methylmalonyl-CoA decarboxylase pSJ02 NC_012892.2 tdcD propionate kinase pSJ03 NC_012892.2 scpA methylmalonyl-CoA mutase pSJ37 NC_012892.2 sdhC succinate dehydrogenase pSJ19 NC_007779.1 dhaH dihydroxyacetone kinase subunit M pSJ24 NC_012971.2 ppk polyphosphate kinase pJF671 NC_012971.2 lpdA lipoamide dehydrogenase pSJ29 NC_012971.2 cyoA cytochrome bo terminal oxidase subunit II pSJ26 NC_012892.2 aceF pyruvatede hydrogenase pSJ08 NC_007779.1 PaaF predicted 2,3-dehydroadipyl-CoA hydratase pSJ16 NC_012971.2 purT phosphoribosyl glycinamide formyltransferase 2 pJF656 NC_012971.2 gdhA glutamate dehydrogenase pSJ66 NC_012971.2 agaW N-acetylgalactosameine-specific IIC component 2 of PTS system pJF674 NC_012971.2 serA D-3-phosphoglycerate dehydrogenase/-ketoglutarate reductase pSJ50 NC_012971.2 yaeR predicted lyase pSJ41 NC_012971.2 tnaA tryptophanase/L-cysteine desulfhydrase pSJ07 NC_012971.2 pflD formate acetyltransferase 2 pSJ54 NC_012971.2 hemN coproporphyrinogen III dehydrogenase pJF664 NC_012971.2 cyoB cytochrome bo terminal oxidase subunit I pJF663 NC_000913.3 zwf glucose 6-phosphate-1-dehydrogenase pJF666 NC_000913.3 pgl 6-phosphogluconolactonase pJF670 NC_000913.3 gnd 6-phosphogluconate dehydrogenase pSJ128 NC_007779.1 rpe ribulose-5-phosphate 3-epimerase pSJ129 NC_000913.3 talA transaldolase A pSJ130 NC_000913.3 talB transaldolase pSJ131 NC_000913.3 tktA transketolase I pSJ132 NC_000913.3 tktB transketolase II pSJ133 NC_000913.3 ulaE L-xylulose 5-phosphate 3-epimerase pSJ141 NC_000913.3 yieK predicted 6-phosphogluconolactonase pSJ147 NC_000913.3 purH AICAR transformylase pSJ148 NC_000913.3 pyrB aspartate carbamoyltransferase, catalytic subunit pSJ149 NC_000913.3 pyrI aspartate carbamoyltransferase, regulatory subunit pSJ150 NC_000913.3 cysQ adenosine-3(2),5-bisphosphate nucleotidase pSJ151 NC_000913.3 pyrC dihydroorotase pSJ152 NC_000913.3 gmk guanylate kinase pSJ153 NC_000913.3 guaA GMP synthetase pSJ154 NC_000913.3 guaB IMP dehydrogenase pSJ155 NC_000913.3 ndk nucleoside diphosphate kinase pSJ156 NC_000913.3 pyrF orotidine-5-phosphate decarboxylase pSJ157 NC_000913.3 pyrE orotate phosphoribosyltransferase pSJ158 NC_000913.3 pyrH UMP kinase pSJ159 NC_000913.3 hpt hypoxanthine phosphoribosyltransferase

Example 2

Construction of an E. coli WG Strain

(35) The operon for propionic acid metabolism was knocked out in E. coli and phosphopantetheinyl transferase gene sfp from the gene cluster of the surfactin synthesis pathway in B. subtilis was integrated into the site to construct an E. coli WG strain suitable for the biosynthesis of a polyketide, wherein the specific steps were as follows:

(36) first, the sfp gene (encoding phosphopantetheinyl transferase, Genbank No.: NC_000964) with a length of 675 bp was amplified by PCR using the genome of B. subtilis as the template together with primers sfp-F and sfp-R (Table 4), and then the PCR product and plasmid pET21c-sfp (purchased from Novagen) were ligated with T4 DNA ligase after being respectively digested with NdeI and BamHI, constructing plasmid pET21c-sfp;

(37) then, a Kan-SacB fragment (about 2.8 Kb) having a selective marker gene with homologous arms was amplified using plasmid pUC19-sacB/kan as the template together with primers SacB/Kan-F and SacB/Kan-R (Table 4), and then Kan-SacB was integrated into the operon for propionic acid metabolism in the chromosome of E. coli BL21 (DE3) using the Red/ET homologous recombination method (Datsenki et al., PNAS, 2000, 97: 6640-6645), replacing the DNA fragments of prpR, prpB, prpC and prpD in the operon for propionic acid metabolism; using WG-F and WG-R as the primers, the SacB/Kan gene located in the chromosome of the recombinant strain was amplified for verification;

(38) then, the T7 promoter-carrying sfp gene was amplified from pET21c-sfp using sfpR-F and sfpR-R; and the SacB-Kan fragment of the recombinant strain was replaced with the T7-sfp-T7 fragment again using the Red/ET homologous recombination method, and finally an E. coli WG strain required by the present invention was obtained that was suitable for the biosynthesis of a polyketide, wherein the schematic diagram of the specific restructuring process was as shown in FIG. 2.

(39) TABLE-US-00004 TABLE4 Primersusedinthisexampleandthe correspondingbasesequencesthereof SEQ ID Primer Basesequence NO: Sfp-F CTAGGGATCCTTATAAAAGCTCTTCGTACG 154 Sfp-R GGAATTCCATATGATGAAGATTTACGGAATTTA 155 sfpR-F TGGCGTAATGCAGCAGAAAATGGCCCGCGAAATTAAT 156 ACGACTCACTATAGG sfpR-R GATAAAATTCGCTAAAAGACATATGTATATCTCCTTCT 157 TAAAGTTAAACAAAATTATTTCTAGAGGGGAATTGTTA TCCGCTCACAATTCCCCTATAGTGAGTCGTATTAATTTC GCGGGTTATAAAAGCTCTTCGTACG sacB/ TGGCGTAATGCAGCAGAAAATGGTCAGAAGAACTCGT 158 Kan-F CAAGAAG sacB/ GATAAAATTCGCTAAAAGACATCATCACATATACCTGC 159 Kan-R CGTTC WG-F GAACGTCGTCCGGCTGATGCC 160 WG-R TGGTATCGGTCTGCGATTCCGAC 161

Example 3

Construction of Plasmid pZG07

(40) Genes eryAII (encoding polyketide synthetase DEBS2 of Streptomyces erythreus, derived from Genbank No.: NC_009142) and eryAIII (encoding polyketide synthetase DEBS3 of Streptomyces erythreus, derived from Genbank No.: NC_009142) were respectively PCR amplified using the genomic DNA of Saccharopolyspora erythraea as the template together with primers eryAII-F and eryAII-R as well as eryAIII-F and eryAIII-R (Table 5), the purified PCR products were respectively double digested with NdeI/HindIII, and then the double-digested PCR products were respectively ligated with T4 DNA ligase to plasmid pET21c subjected to the same digestion, respectively obtaining plasmids pZG05 (containing eryAII) and pZG06 (containing eryAIII); and then, pZG06 was digested with XbaI/EcoRI, the DNA fragment containing eryAIII gene was ligated with T4 DNA ligase to plasmid pZG05 digested with SpeI/EcoRI after being recovered, constructing plasmid pZG07, wherein the schematic diagram of the construction process of the polyketone synthesis gene cluster plasmid pZG07 was as shown in FIG. 3.

(41) TABLE-US-00005 TABLE5 Primersusedinthisexampleandthe correspondingbasesequencesthereof SEQ ID Primer Basesequence NO: eryA GGAATTCCATATGGTGACTGACAGCGAGAAGGTGGC 162 II-F eryA CTAGAGAATTCCTAGTCTACAGGTCCTCTCCCCCGCC 163 II-R eryA GGAATTCCATATGATGAGCGGTGACAACGGCATGA 164 III-F eryA GATGAATTCTCATGAATTCCCTCCGCCCAGC 165 III-R

Example 4

Construction of Plasmid pZG08

(42) Gene pccB (encoding propionyl-CoA carboxylase -CT subunit, derived from Genbank No.: NC_003888.3) and gene accA (encoding propionyl-CoA carboxylase a-CT subunit, derived from Genbank No.: NC_003888.3) were respectively amplified using the genomic DNA of Streptomyces coelicolor as the template together with primers pccB-F and pccB-R as well as accA2-F and accA2-R (Table 6), the purified PCR products were respectively double digested with NcoI/EcoRI, and then the double-digested PCR products were respectively ligated with T4 DNA ligase to the pET28a plasmid double digested with NcoI/EcoRI, constructing plasmids pZG01 and pZG02; and then, pZG02 was double digested with XbaI/EcoRI, the DNA fragment containing the gene accA2 was recovered and ligated with T4 DNA ligase to the pZG01 plasmid double digested with SpeI/EcoRI, obtaining plasmid pZG03.

(43) Gene eryAI (encoding polyketide synthetase DEBS1 of Streptomyces erythreus, Genbank No.: NC_009142) was PCR amplified using the genomic DNA of Saccharopolyspora erythraea as the template together with primers eryAI-F and eryAI-R, the purified PCR product was double digested with NdeI/EcoRI and then ligated with T4 DNA ligase to plasmid pET28a double digested with NdeI/EcoRI, constructing plasmid pZG04;

(44) pZG04 was linearized with Bg/II and the linearized fragment was recovered, the ends of the linearized fragment were then digested with exonuclease I to convert the cohesive ends resulting from the digestion of Bg/II to blunt ends, after which the linearized fragment was recovered again, and finally the fragment was digested with HindIII to recover the eryAI gene fragment; and

(45) pZG03 was first linearized with EcoRI and recovered, the cohesive ends of EcoRI were then converted to blunt ends by the use of exonuclease I and recovered, and finally the linearized pZG03 was digested with HindIII and recovered.

(46) The above recovered pZG03 was ligated to the eryAI gene fragment, constructing plasmid pZG08, wherein the schematic diagram of the construction process of the plasmid pZG08 was as shown in FIG. 4.

(47) TABLE-US-00006 TABLE6 Primersusedinthisexampleandthe correspondingbasesequencesthereof SEQ ID Primer Basesequence NO: eryA GGAATTCCATATGGTGGCGGACCTGTCAAAGCTCTC 166 I-F eryA GATGAATTCTCAATCGCCGTCGAGCTCCCG 167 I-R pccB- GGAATTCCATATGATGGGCAGCAGCCATCATCATC 168 F pccB- CTAGACTAGTTTACAGGGGGATGTTGCCGTG 169 R accA2- CATGCCATGGATATGCGCAAGGTGCTCATCGC 139 F accA2- GATGAATTCGAATTCTCAGTCCTTGATCTCGCAGATGGC 27 R

Example 5

Construction of an Engineered Strain of the Polyketide 6-dEB and its Fermentation Culture in a 5 L Tank

(48) The plasmids pZG07 and pZG08 were co-transformed into the above-obtained host strain E. coli WG for heterologously synthesizing a polyketide, obtaining an engineered strain E. coli WG (pZG07/pZG08) (for producing 6-dEB, an erythromycin precursor) that is capable of effectively synthesizing the polyketide. Single colonies were picked into 2 ml of LB medium supplemented with 100 mg/L of carbenicillin and 50 mg/L of kanamycin, and the mixture was cultured at 220 rpm, 37 C. overnight, giving primary seeds.

(49) Then, the above-obtained primary seeds were inoculated into a 500 ml shake flask containing 50 ml of LB medium supplemented with 100 mg/L of carbenicillin and 50 mg/L of kanamycin at an inoculum size of 1%, and the mixture was cultured at 220 rpm, 37 C. until the OD600 was about 1, giving secondary seeds.

(50) Then, the resulting secondary seeds were inoculated into a 5 L tank containing 4 L of fermentation medium supplemented with 100 mg/L of carbenicillin and 50 mg/L of kanamycin at an inoculum size of 1%, IPTG with a final concentration of 0.1 mM and 20 mM of sodium propionate were added at the same time, and the fermentation was completed after inducing and culturing the mixture at 22 C., 250 rpm for 5 days.

Example 6

Preparation of 6-dEB and HPLC-ELSD Analysis and Detection

(51) The fermentation broth of Example 5 was extracted three times with an equal volume of ethyl acetate and concentrated under reduced pressure to give a crude extract. The crude extract was eluted in a reversed phase C-18 column using methanol-water system, wherein the ratios of methanol were 30%, 50%, 70% and 100%, respectively. The isolated fractions were analyzed using Ultimate 3000 analytical HPLC. The analysis results showed that the product 6-dEB was mainly present in the fraction with a methanol ratio of 70%, and the HPLC analysis was shown in FIG. 5.

(52) The above crude fraction containing 6-dEB was isolated by a reverse phase C-18 column and analyzed and prepared by HPLC-ELSD to give pure 6-dEB. The HPLC-ELSD detection and preparation conditions were as follows. The fraction eluted with 70% methanol was isolated and prepared by Ultimate 3000 preparative HPLC, wherein the chromatographic column model was: TSK-100V, 5 m, 19*150 mm, flow rate 15 ml/min, and mobile phase 50% acetonitrile/water system for isocratic elution. The ELSD detector conditions were as follows: evaporative light scattering detector drift tube temperature: 95 C.; gas flow rate: 1.6 l/min; and gain: 16. Retention time t.sub.R: 10.3 min.

(53) The pure 6-dEB was verified by nuclear magnetic analysis. The hydrogen spectrum was shown in FIG. 6. It can be seen from the figure that the chemical shift of H spectrum of the prepared pure product was consistent with that reported in the literature (Xin Gao, Sang Kook Woo, Michael J. Krische, Total Synthesis of 6-Deoxyerythronolide B via CC Bond-Forming Transfer Hydrogenation, J. Am. Chem. Soc. 2013, 135, 4223-4226), determining that this compound is 6-dEB.

(54) The prepared standard was formulated as 40 mg/L of methanol solution and analyzed by Ultimate 3000 analytical HPLC, with conditions as follows: chromatographic column TSK-100V, 5 m, 4.6*150 mm; flow rate 1 ml/min; and mobile phase acetonitrile/water, with 50% of acetonitrile, for gradient elution. ELSD was used as the detector and the conditions were as follows: evaporative light scattering detector drift tube temperature: 95 C.; gas flow rate: 1.6 l/min; and gain: 16. It can be seen from FIG. 7 that the pure 6-dEB prepared had a very high purity, with the purity up to 98% or more.

Example 7

Transformation and Fermentation of sRNA Plasmids

(55) The various sRNA plasmids expressed in Example 1 (using pACYCDuet-1 (purchased from Novagen) as a blank control) were respectively transformed into the host cells E. coli WG (pZG07/pZG08) (for producing 6-dEB, an erythromycin precursor), single colonies were respectively picked into 2 ml of LB medium containing carbenicillin (100 mg/L), kanamycin (50 mg/L) and chloramphenicol (34 mg/L), and the mixture was cultured at 37 C., 250 rpm/min overnight for 12 h as seeds for shaker fermentation culture.

(56) The above seeds were inoculated in a 100 ml shake flask containing 10 ml of 6-dEB fermentation medium (containing carbenicillin, kanamycin and chloramphenicol antibiotics) at an inoculum size of 1%, and sodium propionate precursor with a final concentration of 20 mM and 100 mM of isopropyl--D-thiogalactopyranoside (IPTG) were added at the same time for initial induction, wherein each sample was run three times in parallel. The shake flask was placed in a shaker at 22 C., 250 rpm/min to ferment for 5 days. After the fermentation was completed, the fermentation broth was poured into a 10 ml centrifuge tube and stored at 20 C. for subsequent detection and analysis.

Example 8

Analysis and Detection of 6-dEB of the Fermentation Broth in Example 7

(57) The fermentation broth of Example 7 was analyzed and detected by a high performance liquid chromatography-evaporative light scattering detector (HPLC-ELSD). The conditions were as follows: chromatographic column TSK-100V, 5 m, 4.6*150 mm; flow rate 1 ml/min; and mobile phase acetonitrile/water, with 50% of acetonitrile, for isocratic elution. ELSD was used as the detector and the conditions were as follows: evaporative light scattering detector drift tube temperature: 95 C.; gas flow rate: 1.6 l/min; and gain: 16.

(58) The results of the effects of attenuation of different genes on the synthesis of 6-dEB were shown in Table 7 (the yield of 6-dEB in the control group E. coli WG (pZG07/pZG08/pACYCDunet-1) was 100%). As can be seen from Table 7: attenuation of each of these key target genes by the use of sRNA was beneficial to the synthesis of the target product 6-dEB. For example, the key target gene regulated by the strain E. coli WG (pZG07/pZG08/pSJ39) was sucC (synthetase: succinyl-CoA synthetase, subunit). Compared with the control group E. coli WG (pZG07/pZG08/pACYCDunet-1), attenuation of sucC may allow the yield increase rate of 6-dEB synthesized by the host to reach 63.2%. E. coli WG (pZG07/pZG08/pSJ130) may increase the highest yield, the key target gene regulated thereby is talB (transaldolase), and attenuation of talB may allow the yield increase rate of 6-dEB synthesized by the host to reach 1008.81%.

(59) Using an sRNA method to regulate the metabolic network of the chassis cells of E. coli, the heterologous synthesis of the polyketide can be significantly improved by attenuating these genes. Targets through attenuating which to increase the yield of the polyketide by 20% or more were as follows: ybiW, fadB, ackA, pta, yjiM, dhaK2, ptsH, ptsI, frdD, frdA, sdhA, sucC, sucD, glcE, lsrC, rpiA, serC, talA, talB, zwf, pyrI, cysQ, gmk, guaB, pyrH and hpt.

(60) TABLE-US-00007 TABLE 7 Effect of sRNA interference on the synthesis of 6-dEB by heterologous host E. coli Target attenuated by Yield of 6-dEB an sRNA plasmid (mg/L) Yield increase rate of 6-dEB (%) sucC 23.34 63.2406 yjiM 21.97 53.6493 frdD 21.33 49.1429 lsrC 20.95 46.5013 glcE 20.02 39.9762 ybiW 19.97 39.6476 sdhA 19.82 38.5955 ptsH 19.66 37.4517 dhaK2 19.11 33.6389 sucD 19.11 33.6232 frdA 18.61 30.1259 ptsI 18.58 29.9126 fadB 18.25 27.6126 ackA 17.76 24.169 serC 17.74 24.0419 rpiA 17.50 22.3742 Pta 17.18 20.1588 pflB 17.12 19.7255 dhaK1 17.05 19.2565 serB 16.81 17.5799 lueD 16.59 16.0076 sdhB 16.52 15.5126 lueC 16.38 14.5198 fsaA 16.30 13.9704 tdcE 16.09 12.5035 sdhD 16.08 12.4802 fadJ 15.98 11.7827 rpiB 15.88 11.0452 Pgi 15.75 10.1108 glcF 15.67 9.57697 scpB 15.59 9.00411 tdcD 15.57 8.85684 scpA 15.51 8.47025 sdhC 15.51 8.46854 dhaH 15.50 8.36834 Ppk 15.27 6.76265 lpdA 15.27 6.75137 cyoA 15.18 6.12731 aceF 15.12 5.72787 PaaF 15.05 5.26518 purT 15.02 5.00937 gdhA 15.01 4.97136 agaW 14.82 3.62747 sera 14.62 2.24778 yaeR 14.56 1.84435 tnaA 14.56 1.81189 pflD 14.41 0.77645 hemN 14.35 0.37817 cyoB 14.35 0.3568 talB 158.57 1008.881 talA 121.34 748.5315 zwf 93.06 550.7692 pgl 77.56 442.3776 rpe 63.46 343.7762 tktA 60.36 322.0979 gnd 56.41 294.4755 ulaE 50.83 255.4545 tktB 47.67 233.3566 yieK 47.44 231.7483 guaB 127.21 789.5804 hpt 110.28 671.1888 cysQ 108.14 656.2238 pyrI 97.03 578.5315 pyrH 95.0 564.3357 gmk 94.32 559.5804 pyrF 89.30 524.4755 guaA 86.37 503.986 pyrE 85.24 496.0839 purH 77.85 444.4056 ndk 77.678 443.2028 pyrB 75.08 425.035 pyrC 54.10 278.3217 pACYCDuent-1 14.30 0 (control)

Example 9

Combined Attenuation Through Co-Transformation of sRNA Plasmids Further Improves the Yield of the Polyketide 6-dEB

(61) As can be seen from the data in Example 8: targets after attenuating which to increase the yield of the polyketide by 20% or more, ybiW, fadB, ackA, pta, yjiM, dhaK2, ptsH, ptsI, frdD, frdA, sdhA, sucC, sucD, glcE, lsrC, rpiA and serC, were selected, chloramphenicol resistance in these attenuated plasmids above was replaced with apramycin resistance for resistance screening of subsequent combination-co-transformation.

(62) Construction of a plasmid with its resistance replaced was based on the POE-PCR technical method (You et al., Simple cloning via direct transformation of PCR product (DNA Multimer) to Escherichia coli and Bacillus subtilis. Appl Environ Microbiol, 78(5): 1593-1595), by taking the replacement of the resistance of the control plasmid pACYCDuent-1 as an example, the apramycin resistance gene of the pKC1139 plasmid was first directly amplified by PCR using pKC1139 (a universal plasmid for Streptomyces) as the template together with the Aparamycin-F and Aparamycin-R primers in Table 8 and the PCR conditions (see Table 9); and sequences except for the chloramphenicol resistance gene of the pACYCDuent-1 plasmid were amplified by PCR using pACYCDuent-1 as the template together with the sRNA-Aparamycin-F and sRNA-Aparamycin-R primers in Table 8 and the PCR conditions. Then, PCR was carried out using the PCR conditions in Table 9 (note: primers were not added, and the templates were the apramycin resistance gene and the pACYCDuent-1 without the chloramphenicol resistance gene amplified in the first step, each 1 l), this PCR product was directly transformed into DH10B after being recovered by a PCR cleaning and recovering kit, and the mixture was plated on an LB solid medium plate containing 50 mg/L of apramycin and cultured overnight. Single colonies were picked into 2 ml of LB medium containing 50 mg/L of apramycin, the mixture was cultured at 220 rpm, 37 C. overnight, and a plasmid extraction kit was used to extract a plasmid, obtaining plasmid pSJ77.

(63) TABLE-US-00008 TABLE8 PrimerinformationandPCRconditions SEQ Primer ID name Sequence(5.fwdarw.3) NO: Aparamycin- caccaataactgccttaaaaaaaGCCAATCGACT 170 F GGCGAGCGG Aparamycin- tcgagattttcaggagctaaggaagctaaaATGC 171 R AATACGAATGGCGAAA sRNA- ccgctcgccagtcgattggctttttttaaggcag 172 Aparamycin- ttattggtg F sRNA- tttcgccattcgtattgcattttagcttccttag 173 Aparamycin- ctcctgaaaatctcga R

(64) TABLE-US-00009 TABLE 9 PCR conditions Name PCR conditions System 5x PS buffer: 5 l; dNTP: 2.5 l; template: 0.3 l; upstream and downstream primers: each 0.5 l; PrimeStar enzyme: 0.25 l; ddH.sub.2O: to make up to 25 l; Program pre-denaturation at 98 C.: 3 min; 30 cycles: denaturation at 98 C.: 10 s, annealing at 55 C.: 15 s, and extending at 72 C.: 3 min 10 s; 72 C.: 10 min; maintaining at 16 C.

(65) The replacement of the resistance of the remaining sRNA-expressing plasmids was the same as above by using the same primers and PCR conditions to replace chloramphenicol resistance in a plasmid with apramycin resistance, and the information of each sRNA plasmid was as shown in Table 10.

(66) TABLE-US-00010 TABLE 10 sRNA plasmid information Name Plasmid information Resistance pSJ77 pACYCDuet-1-derived plasmid, with apramycin chloramphenicol resistance changed into apramycin resistance, an sRNA empty plasmid pSJ78 pSJ04-derived plasmid, with chloramphenicol apramycin resistance changed into apramycin resistance, expresses an sRNA with ybiW attenuated pSJ79 pSJ10-derived plasmid, with chloramphenicol apramycin resistance changed into apramycin resistance, expresses an sRNA with fadB attenuated pSJ80 pSJ11-derived plasmid, with chloramphenicol apramycin resistance changed into apramycin resistance, expresses an sRNA with ackA attenuated pSJ81 pSJ12-derived plasmid, with chloramphenicol apramycin resistance changed into apramycin resistance, expresses an sRNA with pta attenuated pSJ82 pSJ15-derived plasmid, with chloramphenicol apramycin resistance changed into apramycin resistance, expresses an sRNA with yjiM attenuated pSJ83 pSJ18-derived plasmid, with chloramphenicol apramycin resistance changed into apramycin resistance, expresses an sRNA with dhaK2 attenuated pSJ84 pSJ20-derived plasmid, with chloramphenicol apramycin resistance changed into apramycin resistance, expresses an sRNA with ptsH attenuated pSJ85 pSJ21-derived plasmid, with chloramphenicol apramycin resistance changed into apramycin resistance, expresses an sRNA with ptsI attenuated pSJ86 pSJ30-derived plasmid, with chloramphenicol apramycin resistance changed into apramycin resistance, expresses an sRNA with frdD attenuated pSJ87 pSJ33-derived plasmid, with chloramphenicol apramycin resistance changed into apramycin resistance, expresses an sRNA with frdA attenuated pSJ88 pSJ35-derived plasmid, with chloramphenicol apramycin resistance changed into apramycin resistance, expresses an sRNA with sdhA attenuated pSJ89 pSJ39-derived plasmid, with chloramphenicol apramycin resistance changed into apramycin resistance, expresses an sRNA with sucC attenuated pSJ90 pSJ40-derived plasmid, with chloramphenicol apramycin resistance changed into apramycin resistance, expresses an sRNA with sucD attenuated pSJ92 pS44-derived plasmid, with chloramphenicol apramycin resistance changed into apramycin resistance, expresses an sRNA with glcE attenuated pSJ93 pSJ53-derived plasmid, with chloramphenicol apramycin resistance changed into apramycin resistance, expresses an sRNA with lsrC attenuated pSJ94 pJF667-derived plasmid, with chloramphenicol apramycin resistance changed into apramycin resistance, expresses an sRNA with rpiA attenuated pSJ95 pJF672derived plasmid, with chloramphenicol apramycin resistance changed into apramycin resistance, expresses an sRNA with serC attenuated

(67) The sRNA-expressing plasmids (using pSJ77 as a blank control) constructed above and the sRNA-expressing plasmids constructed in Example 1 for increasing the relative yield by 20% were combined in pairs, and co-transformed in the host cells E. coli WG (pZG07/pZG08) (for producing 6-dEB, an erythromycin precursor), using the fermentation method in Example 7 and the analysis and detection of 6-dEB in Example 8.

(68) In the sRNA combined fermentation experiment, the yield of 6-dEB in the control group E. coli WG (pZG07/pZG08/pSJ39/pSJ77) was 100%, and the yield of the polyketide 6-dEB was further increased by attenuating the key target genes in combination.

(69) The experimental results of the effect of combined sRNA interference on the synthesis of 6-dEB by heterologous host E. coli were as shown in Table 11.

(70) TABLE-US-00011 TABLE 11 Effect of combined sRNA interference on the synthesis of 6-dEB by heterologous host E. coli Target Relative Name of plasmid attenuated by an Yield of 6-dEB yield increase combination sRNA plasmid (mg/L) rate of 6-dEB (%) pSJ30 + pSJ39 frdD + sucC 28.73 24.36 pSJ53 + pSJ30 lsrC + frdD 27.11 17.36 pSJ53 + pSJ39 lsrC + sucC 24.15 4.53 pSJ30 + pSJ94 frdD + rpiA 23.24 0.59 pSJ39 + pSJ77 sucC + 23.10 0.00 pACYCDuent-1 (control) pSJ30 + pSJ88 frdD + sdhA 23.07 0.14 pSJ30 + pSJ84 frdD + ptsH 22.54 2.43 pSJ30 + pSJ82 frdD + yjiM 22.33 3.33 pSJ30 + pSJ81 frdD + pta 22.20 3.89 pSJ53 + pSJ80 lsrC + ackA 22.00 4.75 pSJ30 + pSJ39 frdD + sucD 21.90 5.20 pSJ30 + pSJ79 frdD + fadB 21.87 5.34 pSJ53 + pSJ94 lsrC + rpiA 21.42 7.26 pSJ30 + pSJ80 frdD + ackA 21.08 8.76 pSJ53 + pSJ92 lsrC + glcE 20.87 9.65 pSJ53 + pSJ79 lsrC + fadB 20.64 10.63 pSJ53 + pSJ85 lsrC + ptsI 20.63 10.68 pSJ30 + pSJ83 frdD + dhaK2 20.55 11.06 pSJ53 + pSJ81 lsrC + pta 20.12 12.91 pSJ53 + pSJ39 lsrC + sucC 20.09 13.02 pSJ30 + pSJ85 frdD + ptsI 19.67 14.86 pSJ30 + pSJ78 frdD + ybiW 19.56 15.34 pSJ53 + pSJ87 lsrC + frdA 19.34 16.28 pSJ53 + pSJ90 lsrC + sucD 18.87 18.33 pSJ30 + pSJ83 lsrC + dhaK2 18.37 20.48 pSJ53 + pSJ78 lsrC + ybiW 17.81 22.91 pSJ53 + pSJ88 lsrC + sdhA 17.70 23.36 pSJ53 + pSJ95 lsrC + serC 17.46 24.41 pSJ30 + pSJ87 frdD + frdA 17.24 25.37 pSJ53 + pSJ82 lsrC + yjiM 16.29 29.46 pSJ53 + pSJ84 lsrC + ptsH 13.94 39.65 pSJ30 + pSJ95 frdD + serC 12.28 46.83

(71) The experimental results showed that although most combined attenuations cannot effectively improve the synthesis of the polyketide, combined attenuation of frdD and sucC may further increase the yield of 6-dEB by 24% or more compared with the yield by attenuating sucC alone, and attenuating lsrC and frdD simultaneously may further increase the yield of 6-dEB by 17% or more.

Example 10

sRNA Plasmids with Two Targets Attenuated Further Increase the Yield of the Polyketide 6-dEB

(72) It can be seen according to the data in Example 8: targets attenuated were as follows that increased the yield of the polyketide by more than 550%: genes talA, talB and zwf for nucleotide synthesis and other metabolism modules and genes pyrI, cysQ, gmk, guaB, pyrH and hpt for pentose phosphate and glyoxylate pathway modules, and the effect of the simultaneous attenuation of the targets of the two modules on the yield of the polyketide 6-dEB synthesized was investigated.

(73) sRNA plasmids with two targets attenuated were all constructed by a digestion and series connection method. Taking the construction of pSJ333 as an example: a ta1B-targeting sRNA skeleton was amplified using pSJ130 as the template and sRNA-F/R as the primers (Table 12), wherein the PCR conditions were the same as that in Table 9 of Example 9. The PCR product was digested with BamHI and HindIII after being cleaned and recovered; and pSJ129 as the vector was digested with BglII and HindIII at the same time and cleaned and recovered. The above PCR digested-product was ligated with T4 DNA ligase to the double-digested pSJ129 product, obtaining plasmid pSJ333. The remaining plasmids were obtained in the same way, obtaining plasmids pSJ404-pSJ421 finally, and the plasmid information was as shown in Table 13.

(74) TABLE-US-00012 TABLE12 Primerinformation Primer name Sequence(5.fwdarw.3) sRNA-F CGGGATCCTAACACCGTGCGTGTTGACTATTTTA sRNA-R CCCAAGCTTAGATCTACTAGTTATAAACGCAGAAAGG

(75) TABLE-US-00013 TABLE 13 Combined sRNA plasmid information Target regulated (attenuated) by sRNA Name technology Resistance pSJ333 talA + talB chloramphenicol pSJ334 cysQ + guaB chloramphenicol pSJ404 talA + pyrI chloramphenicol pSJ405 talA + cysQ chloramphenicol pSJ406 talA + gmk chloramphenicol pSJ407 talA + guaB chloramphenicol pSJ408 talA + pyrH chloramphenicol pSJ409 talA + hpt chloramphenicol pSJ410 talB + pyrI chloramphenicol pSJ411 talB + cysQ chloramphenicol pSJ412 talB + gmk chloramphenicol pSJ413 talB + guaB chloramphenicol pSJ414 talB + pyrH chloramphenicol pSJ415 talB + hpt chloramphenicol pSJ416 zwf + pyrI chloramphenicol pSJ417 zwf + cysQ chloramphenicol pSJ418 zwf + gmk chloramphenicol pSJ419 zwf + guaB chloramphenicol pSJ420 zwf + pyrH chloramphenicol pSJ421 zwf + hpt chloramphenicol

(76) The combined sRNA-expressing plasmids (using pACYCDuent-1 as a blank control) constructed above were transformed in the host cells E. coli WG (pZG07/pZG08) (for producing 6-dEB, an erythromycin precursor), using the fermentation method in Example 7 and the analysis and detection of 6-dEB in Example 8.

(77) In the sRNA combined fermentation experiment, the yield of 6-dEB in the control group E. coli WG (pZG07/pZG08/pSJ39/pSJ77) was 100%, and the yield of the polyketide 6-dEB was further increased by attenuating the key target genes in combination.

(78) The experimental results of the effect of combined sRNA interference on the synthesis of 6-dEB by heterologous host E. coli were as shown in Table 14 and FIG. 8. The experiment showed that although all the combined attenuations can effectively improve the synthesis of the polyketide, only combined attenuations of talA+guaB and zwf+guaB may further increase the yield of 6-dEB by 32% or more compared with the yield by attenuating talB alone and by 1300% or more compared with the yield of the control group, enabling the shake flask yield of 6-dEB to reach 210 mg/L or more.

(79) TABLE-US-00014 TABLE 14 Effect of combined sRNA interference on the synthesis of 6-dEB by heterologous host E. coli Target Relative attenuated by an Yield of 6-dEB yield increase Plasmid name sRNA plasmid (mg/L) rate of 6-dEB (%) pACYCDuent-1 control 14.30 0.00 pSJ404 talA + pyrI 135.10 844.76 pSJ405 talA + cysQ 128.87 801.19 pSJ406 talA + gmk 117.09 718.81 pSJ407 talA + guaB 209.38 1364.20 pSJ408 talA + pyrH 153.30 972.03 pSJ409 talA + hpt 118.84 731.05 pSJ410 talB + pyrI 145.38 916.64 pSJ411 talB + cysQ 120.11 739.93 pSJ412 talB + gmk 138.00 865.03 pSJ413 talB + guaB 60.05 319.93 pSJ414 talB + pyrH 149.79 947.48 pSJ415 talB + hpt 100.32 601.54 pSJ416 zwf + pyrI 152.75 968.18 pSJ417 zwf + cysQ 130.45 812.24 pSJ418 zwf + gmk 119.39 734.90 pSJ419 zwf + guaB 210.42 1371.47 pSJ420 zwf + pyrH 75.35 426.92

(80) All the documents mentioned in the present invention are incorporated by reference in the present application, as if each document is alone incorporated by reference. In addition, it should be understood that after reading the above-mentioned teaching contents of the present invention, those skilled in the art would be able to make various modifications or amendments to the present invention, and these equivalent forms likewise fall within the scope defined by the appended claims of the present application.