PEPTIDES AND METHODS FOR TREATMENT OF NEURODEGENERATIVE DISEASES
20210060116 ยท 2021-03-04
Inventors
Cpc classification
A61P29/00
HUMAN NECESSITIES
A61K38/04
HUMAN NECESSITIES
C07K14/00
CHEMISTRY; METALLURGY
C07K7/00
CHEMISTRY; METALLURGY
A61P25/28
HUMAN NECESSITIES
C07K7/04
CHEMISTRY; METALLURGY
International classification
A61K38/04
HUMAN NECESSITIES
A61P25/28
HUMAN NECESSITIES
Abstract
The present disclosure provides pharmaceutical compositions comprising rationally designed peptide analogs of the p65-TAD binding region of GILZ to selectively sequester activated p65. Structural and functional analyses suggest that select GILZ analog (GA) bind p65-TAD with optimum affinity, exhibit an estimated half minimal lethal dose comparable to known peptide drugs and suppress A1-42 induced cytotoxicity. Furthermore, the present disclosure provides uses and methods of using the pharmaceutical compositions, and uses and methods of using pharmaceutical formulations comprising the pharmaceutical compositions, for the treatment of neurodegenerative diseases such as Alzheimer's Disease, Parkinson's Disease, multiple sclerosis, and amyotrophic lateral sclerosis (ALS).
Claims
1.-20. (canceled)
21. A method of treating a neurodegenerative disease in a patient, the method comprising the step of administering to the patient a composition comprising: a polypeptide from 8 to 12 amino acid residues, the polypeptide comprising the sequence of XPXXP, wherein P is proline; and the first X is A or K, and the third X is Q, A, or S, wherein the polypeptide forms a PP.sub.II helical conformation and interacts with p65 residues F.sup.534 and F.sup.542.
22. The method of claim 21, wherein the polypeptide comprises the sequence of APKPYQPRG (SEQ ID NO: 29).
23. The method of claim 21, wherein the polypeptide comprises the sequence of EPAPXXPXX (SEQ ID NO: 1), and wherein the polypeptide comprises a sequence selected from the group consisting of EPAPLAPYG (SEQ ID NO: 13), EPAPYQPEG (SEQ ID NO: 24), EPAPESPQV (SEQ ID NO: 17), and EPAPEQPDG (SEQ ID NO: 18).
24. The method of claim 21, wherein the polypeptide comprises the sequence of EPAPLAPYG (SEQ ID NO: 13).
25. The method of claim 21, wherein the polypeptide comprises the sequence of EPAPYQPEG (SEQ ID NO: 24).
26. The method of claim 21, wherein the polypeptide comprises the sequence of EPAPESPQV (SEQ ID NO: 17).
27. The method of claim 21, wherein the polypeptide comprises the sequence of EPAPEQPDG (SEQ ID NO: 18).
28. The method of claim 21, wherein the neurodegenerative disease is Alzheimer's Disease.
29. The method of claim 21, wherein the neurodegenerative disease is Parkinson's Disease.
30. The method of claim 21, wherein the neurodegenerative disease is multiple sclerosis.
31. The method of claim 21, wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS).
32. The method of claim 21, wherein the first X is A.
33. The method of claim 21, wherein the first X is K.
34. The method of claim 21, wherein the third X is Q.
35. The method of claim 21, wherein the third X is S.
36. The method of claim 1, wherein the first X is A, and the third X is Q, S, or A.
37. The method of claim 21, wherein the first X is A, and the third X is Q.
38. The method of claim 21, wherein the first X is A, and the third X is S.
39. The method of claim 21, wherein the first X is A, and the third X is A.
40. The method of claim 21, wherein the first X is K, and the third X is Q.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040] The following numbered embodiments are contemplated for the present disclosure and are non-limiting:
[0041] 1. A pharmaceutical composition comprising a polypeptide from about 8 to about 12 amino acid residues, the polypeptide comprising a tetrapeptide having the sequence of PXXP, wherein
[0042] P is proline; and
[0043] X is any amino acid.
[0044] 2. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of Formula I: X1-X2-X3-P-X4-X5-P-X6-X7, wherein each of X1, X2, X3, X4, X5, X6, and X7 is independently any amino acid.
[0045] 3. The pharmaceutical composition of clause 2, wherein X1 is E.
[0046] 4. The pharmaceutical composition of clause 2, wherein X1 is A.
[0047] 5. The pharmaceutical composition of any of clauses 2 to 4, wherein X2 is P.
[0048] 6. The pharmaceutical composition of any of clauses 2 to 4, wherein X2 is A.
[0049] 7. The pharmaceutical composition of any of clauses 2 to 6, wherein X3 is A.
[0050] 8. The pharmaceutical composition of any of clauses 2 to 6, wherein X3 is L.
[0051] 9. The pharmaceutical composition of any of clauses 2 to 6, wherein X3 is K.
[0052] 10. The pharmaceutical composition of any of clauses 2 to 9, wherein X4 is selected from the group consisting of R, L, E, A, and Y.
[0053] 11. The pharmaceutical composition of any of clauses 2 to 10, wherein X5 is selected from the group consisting of Q, A, and S.
[0054] 12. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of XXXPXXPXX.
[0055] 13. The pharmaceutical composition of clause 12, wherein the polypeptide comprises a sequence of EPAPXXPXX (SEQ ID NO: 1).
[0056] 14. The pharmaceutical composition of clause 12, wherein the polypeptide comprises a sequence of EPLPXXPXX (SEQ ID NO: 2).
[0057] 15. The pharmaceutical composition of clause 12, wherein the polypeptide comprises a sequence of EAAPXXPXX (SEQ ID NO: 3).
[0058] 16. The pharmaceutical composition of clause 12, wherein the polypeptide comprises a sequence of APAPXXPXX (SEQ ID NO: 4).
[0059] 17. The pharmaceutical composition of clause 12, wherein the polypeptide comprises a sequence of APKPXXPXX (SEQ ID NO: 5).
[0060] 18. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of Formula II: X1-X2-X3-P-X4-X5-P-X6-X7-X8, wherein each of X1, X2, X3, X4, X5, X6, X7, and X8 is independently any amino acid.
[0061] 19. The pharmaceutical composition of clause 18, wherein X1 is E.
[0062] 20. The pharmaceutical composition of clause 18, wherein X1 is A.
[0063] 21. The pharmaceutical composition of any one of clauses 18 to 20, wherein X2 is P.
[0064] 22. The pharmaceutical composition of any one of clauses 18 to 20, wherein X2 is A.
[0065] 23. The pharmaceutical composition of any one of clauses 18 to 22, wherein X3 is A.
[0066] 24. The pharmaceutical composition of any one of clauses 18 to 22, wherein X3 is L.
[0067] 25. The pharmaceutical composition of any one of clauses 18 to 22, wherein X3 is K.
[0068] 26. The pharmaceutical composition of any one of clauses 18 to 25, wherein X4 is selected from the group consisting of R, L, E, A, and Y.
[0069] 27. The pharmaceutical composition of any one of clauses 18 to 26, wherein X5 is selected from the group consisting of Q, A, and S.
[0070] 28. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of XXXPXXPXXX.
[0071] 29. The pharmaceutical composition of clause 28, wherein the polypeptide comprises a sequence of EPAPXXPXXX (SEQ ID NO: 6).
[0072] 30. The pharmaceutical composition of clause 28, wherein the polypeptide comprises a sequence of EPLPXXPXXX (SEQ ID NO: 7).
[0073] 31. The pharmaceutical composition of clause 28, wherein the polypeptide comprises a sequence of EAAPXXPXXX (SEQ ID NO: 8).
[0074] 32. The pharmaceutical composition of clause 28, wherein the polypeptide comprises a sequence of APAPXXPXXX (SEQ ID NO: 9).
[0075] 33. The pharmaceutical composition of clause 28, wherein the polypeptide comprises a sequence of APKPXXPXXX (SEQ ID NO: 10).
[0076] 34. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of EPAPRQPAT (SEQ ID NO: 11).
[0077] 35. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of EPAPRAPEG (SEQ ID NO: 12).
[0078] 36. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of EPAPLAPYG (SEQ ID NO: 13).
[0079] 37. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of EPAPRAPGT (SEQ ID NO: 14).
[0080] 38. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of EPAPRAPDG (SEQ ID NO: 15).
[0081] 39. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of EPLPEAPDT (SEQ ID NO: 16).
[0082] 40. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of EPAPESPQV (SEQ ID NO: 17).
[0083] 41. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of EPAPEQPDG (SEQ ID NO: 18).
[0084] 42. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of APAPASPQV (SEQ ID NO: 19).
[0085] 43. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of EAAAESPQV (SEQ ID NO: 20).
[0086] 44. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of APAPAAPET (SEQ ID NO: 21).
[0087] 45. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of EAAAEAAET (SEQ ID NO: 22).
[0088] 46. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of EPAPEAPEGY (SEQ ID NO: 23).
[0089] 47. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of EPAPYQPEG (SEQ ID NO: 24).
[0090] 48. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of EPAYEAQET (SEQ ID NO: 25).
[0091] 49. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of EPAPEAGET (SEQ ID NO: 26).
[0092] 50. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of EPAPEAPET (SEQ ID NO: 27).
[0093] 51. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of EPAPESPQV (SEQ ID NO: 17).
[0094] 52. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of EPAPYQPRG (SEQ ID NO: 28).
[0095] 53. The pharmaceutical composition of clause 1, wherein the polypeptide comprises a sequence of APKPYQPRG (SEQ ID NO: 29).
[0096] 54. The pharmaceutical composition of clause 1, wherein the polypeptide consists essentially of a sequence of EPAPRQPAT (SEQ ID NO: 11).
[0097] 55. The pharmaceutical composition of clause 1, wherein the polypeptide consists essentially of a sequence of EPAPRAPEG (SEQ ID NO: 12).
[0098] 56. The pharmaceutical composition of clause 1, wherein the polypeptide consists essentially of a sequence of EPAPLAPYG (SEQ ID NO: 13).
[0099] 57. The pharmaceutical composition of clause 1, wherein the polypeptide consists essentially of a sequence of EPAPRAPGT (SEQ ID NO: 14).
[0100] 58. The pharmaceutical composition of clause 1, wherein the polypeptide consists essentially of a sequence of EPAPRAPDG (SEQ ID NO: 15).
[0101] 59. The pharmaceutical composition of clause 1, wherein the polypeptide consists essentially of a sequence of EPLPEAPDT (SEQ ID NO: 16).
[0102] 60. The pharmaceutical composition of clause 1, wherein the polypeptide consists essentially of a sequence of EPAPESPQV (SEQ ID NO: 17).
[0103] 61. The pharmaceutical composition of clause 1, wherein the polypeptide consists essentially of a sequence of EPAPEQPDG (SEQ ID NO: 18).
[0104] 62. The pharmaceutical composition of clause 1, wherein the polypeptide consists essentially of a sequence of APAPASPQV (SEQ ID NO: 19).
[0105] 63. The pharmaceutical composition of clause 1, wherein the polypeptide consists essentially of a sequence of EAAAESPQV (SEQ ID NO: 20).
[0106] 64. The pharmaceutical composition of clause 1, wherein the polypeptide consists essentially of a sequence of APAPAAPET (SEQ ID NO: 21).
[0107] 65. The pharmaceutical composition of clause 1, wherein the polypeptide consists essentially of a sequence of EAAAEAAET (SEQ ID NO: 22).
[0108] 66. The pharmaceutical composition of clause 1, wherein the polypeptide consists essentially of a sequence of EPAPEAPEGY (SEQ ID NO: 23).
[0109] 67. The pharmaceutical composition of clause 1, wherein the polypeptide consists essentially of a sequence of EPAPYQPEG (SEQ ID NO: 24).
[0110] 68. The pharmaceutical composition of clause 1, wherein the polypeptide consists essentially of a sequence of EPAYEAQET (SEQ ID NO: 25).
[0111] 69. The pharmaceutical composition of clause 1, wherein the polypeptide consists essentially of a sequence of EPAPEAGET (SEQ ID NO: 26).
[0112] 70. The pharmaceutical composition of clause 1, wherein the polypeptide consists essentially of a sequence of EPAPEAPET (SEQ ID NO: 27).
[0113] 71. The pharmaceutical composition of clause 1, wherein the polypeptide consists essentially of a sequence of EPAPESPQV (SEQ ID NO: 17).
[0114] 72. The pharmaceutical composition of clause 1, wherein the polypeptide consists essentially of a sequence of EPAPYQPRG (SEQ ID NO: 28).
[0115] 73. The pharmaceutical composition of clause 1, wherein the polypeptide consists essentially of a sequence of APKPYQPRG (SEQ ID NO: 29).
[0116] 74. The pharmaceutical composition of clause 1, wherein the polypeptide consists of a sequence of EPAPRQPAT (SEQ ID NO: 11).
[0117] 75. The pharmaceutical composition of clause 1, wherein the polypeptide consists of a sequence of EPAPRAPEG (SEQ ID NO: 12).
[0118] 76. The pharmaceutical composition of clause 1, wherein the polypeptide consists of a sequence of EPAPLAPYG (SEQ ID NO: 13).
[0119] 77. The pharmaceutical composition of clause 1, wherein the polypeptide consists of a sequence of EPAPRAPGT (SEQ ID NO: 14).
[0120] 78. The pharmaceutical composition of clause 1, wherein the polypeptide consists of a sequence of EPAPRAPDG (SEQ ID NO: 15).
[0121] 79. The pharmaceutical composition of clause 1, wherein the polypeptide consists of a sequence of EPLPEAPDT (SEQ ID NO: 16).
[0122] 80. The pharmaceutical composition of clause 1, wherein the polypeptide consists of a sequence of EPAPESPQV (SEQ ID NO: 17).
[0123] 81. The pharmaceutical composition of clause 1, wherein the polypeptide consists of a sequence of EPAPEQPDG (SEQ ID NO: 18).
[0124] 82. The pharmaceutical composition of clause 1, wherein the polypeptide consists of a sequence of APAPASPQV (SEQ ID NO: 19).
[0125] 83. The pharmaceutical composition of clause 1, wherein the polypeptide consists of a sequence of EAAAESPQV (SEQ ID NO: 20).
[0126] 84. The pharmaceutical composition of clause 1, wherein the polypeptide consists of a sequence of APAPAAPET (SEQ ID NO: 21).
[0127] 85. The pharmaceutical composition of clause 1, wherein the polypeptide consists of a sequence of EAAAEAAET (SEQ ID NO: 22).
[0128] 86. The pharmaceutical composition of clause 1, wherein the polypeptide consists of a sequence of EPAPEAPEGY (SEQ ID NO: 23).
[0129] 87. The pharmaceutical composition of clause 1, wherein the polypeptide consists of a sequence of EPAPYQPEG (SEQ ID NO: 24).
[0130] 88. The pharmaceutical composition of clause 1, wherein the polypeptide consists of a sequence of EPAYEAQET (SEQ ID NO: 25).
[0131] 89. The pharmaceutical composition of clause 1, wherein the polypeptide consists of a sequence of EPAPEAGET (SEQ ID NO: 26).
[0132] 90. The pharmaceutical composition of clause 1, wherein the polypeptide consists of a sequence of EPAPEAPET (SEQ ID NO: 27).
[0133] 91. The pharmaceutical composition of clause 1, wherein the polypeptide consists of a sequence of EPAPESPQV (SEQ ID NO: 17).
[0134] 92. The pharmaceutical composition of clause 1, wherein the polypeptide consists of a sequence of EPAPYQPRG (SEQ ID NO: 28).
[0135] 93. The pharmaceutical composition of clause 1, wherein the polypeptide consists of a sequence of APKPYQPRG (SEQ ID NO: 29).
[0136] 94. The pharmaceutical composition of any one of clauses 1 to 93, wherein the composition suppresses p65 binding.
[0137] 95. The pharmaceutical composition of any one of clauses 1 to 93, wherein the composition suppresses p65 activation.
[0138] 96. The pharmaceutical composition of any one of clauses 1 to 93, wherein the composition inhibits NF-B translocation to the nucleus of a cell.
[0139] 97. A pharmaceutical formulation comprising the pharmaceutical composition of any one of clauses 1 to 96.
[0140] 98. The pharmaceutical formulation of clause 97 further comprising a pharmaceutically acceptable carrier.
[0141] 99. The pharmaceutical formulation of clause 97 or clause 98 optionally including one or more other therapeutic ingredients.
[0142] 100. The pharmaceutical formulation of any one of clauses 97 to 99 wherein the formulation is a single unit dose.
[0143] 101. A lyophilisate or powder of the pharmaceutical formulation of any one of clauses 97 to 100.
[0144] 102. An aqueous solution produced by dissolving the lyophilisate or powder of clause 101 in water.
[0145] 103. Use of the pharmaceutical composition or the pharmaceutical formulation of any one of clauses 1-100 for the treatment of a neurodegenerative disease in a patient.
[0146] 104. The use of clause 103 wherein the neurodegenerative disease is Alzheimer's Disease.
[0147] 105. The use of clause 103 wherein the neurodegenerative disease is Parkinson's Disease.
[0148] 106. The use of clause 103 wherein the neurodegenerative disease is multiple sclerosis.
[0149] 107. The use of clause 103 wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS).
[0150] 108. A method of treating a neurodegenerative disease in a patient, said method comprising the step of administering the pharmaceutical composition or the pharmaceutical formulation of any one of clauses 1-100 to the patient in need thereof.
[0151] 109. The method of clause 108 wherein the neurodegenerative disease is Alzheimer's Disease.
[0152] 110. The method of clause 108 wherein the neurodegenerative disease is Parkinson's Disease.
[0153] 111. The method of clause 108 wherein the neurodegenerative disease is multiple sclerosis.
[0154] 112. The method of clause 108 wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS).
[0155] 113. Use of the pharmaceutical composition or the pharmaceutical formulation of any one of clauses 1-100 for the treatment of a spinal cord injury in a patient.
[0156] 114. The use of clause 113, wherein the administration of the pharmaceutical composition reduces inflammation in the spinal cord of the patient.
[0157] 115. The use of clause 113, wherein the administration of the pharmaceutical composition reduces inflammation in the brain of the patient.
[0158] 116. The use of clause 113, wherein the administration of the pharmaceutical composition reduces the presence of one or more cytokines in the spinal cord of the patient or in the brain of the patient.
[0159] 117. The use of clause 116, wherein the cytokine is IFN-.
[0160] 118. The use of clause 116, wherein the cytokine is IL-17.
[0161] 119. A method of treating a spinal cord injury in a patient, said method comprising the step of administering the pharmaceutical composition or the pharmaceutical formulation of any one of clauses 1-100 to the patient in need thereof.
[0162] 120. The method of clause 119, wherein the administration of the pharmaceutical composition reduces inflammation in the spinal cord of the patient.
[0163] 121. The method of clause 119, wherein the administration of the pharmaceutical composition reduces inflammation in the brain of the patient.
[0164] 122. The method of clause 119, wherein the administration of the pharmaceutical composition reduces the presence of one or more cytokines in the spinal cord of the patient or in the brain of the patient.
[0165] 123. The method of clause 122, wherein the cytokine is IFN-.
[0166] 124. The method of clause 122, wherein the cytokine is IL-17.
[0167] In particular, the following analogs were developed and evaluated:
TABLE-US-00001 Analog Sequence SEQIDNO: Name Analog1 EPAPRQPAT 11 Analog2 EPAPRAPEG 12 Analog3(GA-2) EPAPLAPYG 13 PGA-2 Analog4 EPAPRAPGT 14 Analog5 EPAPRAPDG 15 Analog6 EPLPEAPDT 16 Analog7(GA-4) EPAPESPQV 17 PGA-4 Analog8(GA-5) EPAPEQPDG 18 PGA-5 Analog9 APAPASPQV 19 Analog10 EAAAESPQV 20 Analog11 APAPAAPET 21 Analog12 EAAAEAAET 22 Analog13 EPAPEAPEGY 23 Analog14(GA-3) EPAPYQPEG 24 PGA-3 Analog15 EPAYEAQET 25 Analog16 EPAPEAGET 26 Analog17 EPAPEAPET 27 Analog18 EPAPESPQV 17 Analog19 EPAPYQPRG 28 Analog20(GA-1) APKPYQPRG 29 PGA-1
[0168] Furthermore, the following analogs were tested:
TABLE-US-00002 Name Sequence SEQIDNO: PGA-1 APKPYQPRG 29 PGA-2 EPAPLAPYG 13 PGA-3 EPAPYQPEG 24 PGA-4 EPAPESPQV 17 PGA-5 EPAPEQPDG 18
[0169] Increased NF- p65 secondary to aging and environmental stimuli contribute significantly to the inflammation and degeneration in AD. Synthetic compounds including terpenoids like adenanthin and resveratrol or other sirtuin activators interact with NF- p65, suppress inflammation and cytotoxicity in AD models. As opposed to high throughput screening, computational design of interface peptide mimics followed by functional evaluation represents an efficient method in the drug design and discovery process. Here we report the design and physicochemical characteristics of peptide analogs of the GILZ:p65 interface, show that select analogs bind p65-TAD and suppress A induced toxicity in human fetal brain cells exhibiting potential therapeutic value for AD.
[0170] In human interactome, preponderant transient intermolecular interactions are mediated by proline rich epitope of one protein binding the aromatic residue rich flat interface of the second protein. Often the proline rich epitope adopts an extended PP.sub.II helical conformation that behaves as an adaptable glove in obtaining the correct binding orientation. Here it is pertinent to note that the template based modeling suggested that the p65 binding domain of GILZ exhibits a PP.sub.II helical conformation and that the p65-TAD is unstructured or flat. Mutational analyses identified .sup.120PEA(S)P.sup.124 of GILZ as hot spot residues for interacting with NF-B p65. In the GILZ:p65-TAD complex, the critical proline of GILZ, .sup.120P exhibits and angles of 675 of 142.515 respectively and is in close proximity with the conserved phenylalanines (.sup.534F, .sup.542F) of p65-TAD. Collectively, these observations suggest that the GILZ:p65-TAD complex represents a druggable target for development of specific therapeutic leads.
[0171] Incorporating rational substitutions in the polyproline motif of GILZ in the context of the p65-TAD interface we designed multiple peptide analogs of GILZ or GA. Molecular superposition is one of the most important means to interpret the relations between three-dimensional structures. The low RMSD upon superimposition with experimental PP.sub.II and wild type GILZ suggests that the select GA represent true structural mimic of the p65 binding domain of GILZ. Significantly docking analyses showed that the top ranked GA exhibited >20% contact with the functionally critical p65-TAD residues (F.sup.534, F.sup.542) in >90% of docked solutions.
[0172] An important advantage of proline-rich motif at interface of transient intermolecular interactions is the weak binding kinetics without compromising affinity. Furthermore, it allows for introduction of small changes in the sequence of the motif or its binding domain to mediate large changes in the affinity of the interaction. We observed that the GA-1 and GA-2 evaluated by functional analysis exhibited greater affinity for binding r-p65 than the full length r-GILZ. Previously, proline rich peptides that bind Src homology 3 binding domain or the transcription factor human estrogen receptor alpha or the cell surface CD80 ligand have been shown to exhibit dissociation constant (KD) in the micromolar range and inhibit protein:protein interactions.
[0173] Many peptide drugs including copaxone, leuprolide acetate/goserelin (peptide antagonists of GnRH receptor), octreotide (a cyclic octapeptide mimicking natural hormone somatostatin) and glucagon like peptide-1(GLP-1) analog have been evaluated in models of AD substantiating the credibility of peptide drugs for AD. Proline rich PP.sub.II helical peptides such as apidaecin, oncocin and drosocin have shown to exhibit significant influx into CNS and distribution within the brain parenchyma. Hence PGA is likely to cross the blood brain barrier and reach optimal concentration in the brain to be clinically efficient. Significantly, the estimated LD50 for GA-1 and GA-2 as determined by the method of Speilmann et al. is within the range of these peptide drugs. Furthermore the ability of GA-1 and GA-2 to suppress A induced inflammatory and cytotoxic responses in human fetal brain cells suggests potential as AD therapeutic agents.
[0174] The goal of biological therapies is to restore healthy balance by targeting specific molecules that are critical for mediating or perpetuating imbalanced cellular responses. In recent years peptide-based drugs have gained considerable value in the discovery phase of drug development, in particular in the design of interface mimotopes. The functionally active peptides are amenable to further modifications into peptidomimetic compounds or small molecules with improved pharmacokinetic properties. In this context, the low molecular weight GA-1 and GA-2 can act as lead compounds in the development of specific small molecule inhibitors of NF- p65 with significant therapeutic potential for chronic neurodegenerative diseases including AD (see
[0175] In some embodiments, the pharmaceutical formulations described herein further comprise a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical formulations described herein further comprise a pharmaceutically acceptable diluent. Diluent or carrier ingredients used in the pharmaceutical compositions containing polypeptides can be selected so that they do not diminish the desired effects of the polypeptide. Examples of suitable dosage forms include aqueous solutions of the polypeptides, for example, a solution in isotonic saline, 5% glucose or other well-known pharmaceutically acceptable liquid carriers such as alcohols, glycols, esters and amides.
[0176] As used herein, carrier refers to any ingredient other than the active component(s) in a formulation. Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition (see, e.g., Remington's Pharmaceutical Sciences, 17th ed. (1985)). The choice of carrier will to a large extent depend on factors such as the particular mode of administration, the effect of the carrier on solubility and stability, and the nature of the dosage form. In one illustrative aspect, the carrier is a liquid carrier.
[0177] As used herein, the term pharmaceutically acceptable includes veterinarily acceptable, and thus includes both human and animal applications independently. For example, a patient as referred to herein can be a human patient or a veterinary patient, such as a domesticated animal (e.g., a pet).
[0178] In some embodiments, the pharmaceutical formulations described herein optionally include one or more other therapeutic ingredients. As used herein, the term active ingredient or therapeutic ingredient refers to a therapeutically active compound, as well as any prodrugs thereof and pharmaceutically acceptable salts, hydrates, and solvates of the compound and the prodrugs. Other active ingredients may be combined with the described polypeptides and may be either administered separately or in the same pharmaceutical formulation. The amount of other active ingredients to be given may be readily determined by one skilled in the art based upon therapy with described polypeptides.
[0179] In some embodiments, the pharmaceutical formulations described herein are a single unit dose. As used herein, the term unit dose is a discrete amount of the composition comprising a predetermined amount of the described polypeptides. The amount of the described polypeptides is generally equal to the dosage of the described polypeptides which would be administered to an animal or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.
[0180] In one illustrative aspect, parenteral formulations may be suitably formulated as a sterile non-aqueous solution or as a dried form to be used in conjunction with a suitable vehicle such as sterile, pyrogen-free water. The preparation of parenteral formulations under sterile conditions, for example, by lyophilization, may readily be accomplished using standard pharmaceutical techniques well known to those skilled in the art.
[0181] The aqueous preparations according to the invention can be used to produce lyophilisates by conventional lyophilization or powders. The preparations according to the invention are obtained again by dissolving the lyophilisates in water or other aqueous solutions. The term lyophilization, also known as freeze-drying, is a commonly employed technique for presenting proteins which serves to remove water from the protein preparation of interest. Lyophilization is a process by which the material to be dried is first frozen and then the ice or frozen solvent is removed by sublimation in a vacuum environment. An excipient may be included in pre-lyophilized formulations to enhance stability during the freeze-drying process and/or to improve stability of the lyophilized product upon storage. For example, see Pikal, M. Biopharm. 3(9)26-30 (1990) and Arakawa et al., Pharm. Res., 8(3):285-291 (1991).
[0182] In one embodiment, the solubility of the polypeptides used in the preparation of a parenteral formulation may be increased by the use of appropriate formulation techniques, such as the incorporation of solubility-enhancing agents.
[0183] In various embodiments, formulations for parenteral administration may be formulated to be for immediate and/or modified release. Modified release formulations include delayed, sustained, pulsed, controlled, targeted and programmed release formulations. Thus, a polypeptide may be formulated as a solid, semi-solid, or thixotropic liquid for administration as an implanted depot providing modified release of the active compound.
[0184] The formulations can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials. The formulations can also be presented in syringes, such as prefilled syringes.
[0185] In various embodiments, the dosages of the polypeptides can vary significantly depending on the patient condition and the severity of the disease to be treated. The effective amount to be administered to a patient is based on body surface area, patient weight or mass, and physician assessment of patient condition.
[0186] Suitable dosages of the polypeptides can be determined by standard methods, for example by establishing dose-response curves in laboratory animal models or in humans in clinical trials. Illustratively, suitable dosages of polypeptides (administered in a single bolus or over time) include from about 1 pg/kg to about 10 g/kg, from about 1 pg/kg to about 1 g/kg, from about 100 pg/kg to about 500 ng/kg, from about 1 pg/kg to about 1 ng/kg, from about 1 pg/kg to about 500 pg/kg, from about 100 pg/kg to about 500 ng/kg, from about 100 pg/kg to about 100 ng/kg, from about 1 ng/kg to about 10 mg/kg, from about 1 ng/kg to 1 mg/kg, from about 1 ng/kg to about 1 g/kg, from about 1 ng/kg to about 500 ng/kg, from about 100 ng/kg to about 500 g/kg, from about 100 ng/kg to about 100 g/kg, from about 1 g/kg to about 500 g/kg, or from about 1 g/kg to about 100 g/kg. In each of these embodiments, dose/kg refers to the dose per kilogram of a patient's or animal's mass or body weight.
[0187] The present disclosure provides uses and methods of using the pharmaceutical compositions, and uses and methods of using pharmaceutical formulations comprising the pharmaceutical compositions, for the treatment of neurodegenerative diseases such as Alzheimer's Disease, Parkinson's Disease, multiple sclerosis, and amyotrophic lateral sclerosis (ALS).
[0188] The present disclosure also provides uses and methods of using the pharmaceutical compositions, and uses and methods of using pharmaceutical formulations comprising the pharmaceutical compositions, for treating a spinal cord injury in a patient. In some embodiments, the administration of the pharmaceutical composition reduces inflammation in the spinal cord of the patient. In some embodiments, administration of the pharmaceutical composition reduces inflammation in the brain of the patient. In various embodiments, administration of the pharmaceutical composition reduces the presence of one or more cytokines in the spinal cord of the patient or in the brain of the patient. In certain embodiments, the cytokine is IFN-. In other embodiments, the cytokine is IL-17.
EXAMPLES
Example 1
[0189] Peptides and reagents: All GILZ peptides were synthesized as peptide amides with amino-terminal acetylation (Genescript, Piscataway, N.J.) at 95% purity as confirmed by mass spectrometry. To facilitate intracellular delivery the GA were either co-synthesized with the cell penetrating agent, TAT (transactivator of transcription) peptide or used as covalent mixture with Pep-1 chariot peptide (Anaspec, Fremont, Calif.). Recombinant human p65 protein (r-p65) with DDK tag (catalog number TP320780), purified recombinant human GILZ protein (r-GILZ) with GST tag and biotinylated anti-DDK antibody were from Ori-Gene Technologies Inc., Rockville, Md. Purified A.sub.1-42 peptide was purchased from American Peptide company (American peptide company, Sunnyvale, Calif.: Product #62-0-80 Lot #1310160T). A.sub.1-42 peptide stock (1 mg/mL) was prepared in cell culture medium and incubated at 37 C. for 24 hours prior to use in cell cultures.
[0190] Comparative modeling: Models of human GILZ and its mimics were built by the CPH models and Geno3D servers using delta sleep inducing peptide (DSIP-PDB:1DIP) as template based on >90% sequence similarity. While the Geno3D system builds models based on topology mapping, the CPH system uses profile-based alignment as seed for developing energy-minimized homology model. The secondary structure assignment of the GILZ models was independently assessed by the PROSS (Protein dihedral angle-based Secondary Structure assignment) program. Superimposition of the model of each GILZ mimic with experimentally determined PP.sub.II helix and wild type GILZ determined the similarity between the structures in terms of root mean square deviation (RMSD). Homology models of p65-TAD was developed similarly using elongation factor eEF3 (PDB:3H7H) as template with which it shares 42% sequence similarity.
[0191] Design and modeling of GILZ mimic: Strategies to determine the smallest biologically active fragment of a lead peptide involves truncation, deletion, alanine scanning and substitution of residues. Deletion studies suggested that the amino terminal helix of GILZ is critical for dimerization but is not involved in the interaction with NF-. Truncation mutants suggested that the residues spanning .sup.120P-P.sup.127 of the GILZ were critical for GILZ mediated inhibition of NF- transactivation. Molecular modeling showed that the GILZ-COOH or a 22 residue peptide derived from the proline rich region adopted an extended PP.sub.II helical conformation and interacted with the p65-TAD exhibiting weak binding kinetics. Alanine scanning mutagenesis suggested that the substitution of the .sup.120PXXP.sup.123 motif abrogated the ability to inhibit NF- transactivation potentially due to loss of PP.sub.II conformation. In human and mouse GILZ, hydrogen bonding between the side chain of Ser or Thr and the backbone carbonyl of Glu or Pro respectively could contribute to the stability of PP.sub.II conformation. We designed 40 GILZ mimics by incorporating rational substitutions in the p65 binding motif of GILZ with residues that increase the propensity for PP.sub.II helical conformation and stabilize it. Comparative modeling with substituted residues for all 40 GA was performed to obtain structural representation of each with reference to the adjacent residues of human GILZ. In addition we introduced conformational constraints by superimposing each GILZ mimic model on structures with solved or experimental PP.sub.II helix and wild type human GILZ to select for mimics with significant structural homology (see
Example 2
[0192] GILZ:p65-TAD docking: Models of human GILZ or GILZ mimic and the p65-TAD were applied as probe and target respectively in PatchDock, a geometry based algorithm that yields docked transformations scored on the basis of molecular shape complementarity and atomic desolvation energy. Top one thousand solutions were refined using FireDock (Fast Interaction Refinement in molecular docking), a program that optimizes binding of the probe by restricting side-chain flexibility to clashing interface residues. The refined docking solutions were scored based on softened van der Waals interactions, atomic contact energy, electrostatic and additional binding free energy estimations. The top ranked solutions so obtained were further screened using Chimera for interatomic distance of <5 between the residues of GILZ mimic and the functionally critical residues of p65-TAD. The solution with most contacts was further refined by FlexPepDock using the wild type GILZ:p65-TAD complex with greater than 50% intermolecular residue contacts as reference.
[0193] Docking of GILZ mimic and p65-TAD: To be of potential therapeutic value, the GILZ mimic should adopt PP.sub.II helical conformation in the context of the critical binding residues in p65-TAD. The p65-TAD is commonly divided into two distinct regions, TAD-1521-551 consisting of 36 amino acids and TAD-2428-520 with 92 residues. It has been reported that the TAD.sub.1 accounts for nearly 95% of the transactivation potential of full-length p65 and that the TAD2 alone is less potent mediating about 30% activation. In particular, the highly conserved aromatic residues (F.sup.534, F.sup.542), acidic residues (D.sup.531,D.sup.553) and phosphorylation sites (Ser.sup.529,Ser.sup.536) in p65-TAD1 have been identified as critical for transactivation.
[0194] Homology model of p65-TAD was built using solution structure of the elongation factor eEF3 (PDB: 2XI3, 2WI3) with which it shares 42% sequence similarity. The spatial orientations of wild type GILZ and top 20 GILZ mimics with p65-TAD were assessed by multiple docking algorithms. One thousand interaction possibilities identified by rigid-docking algorithm were improved by coarse refinement to restrict side-chain flexibility at the interface. The docked complexes were ranked using an optimized global energy function for higher probability prediction. Top ten solutions of each GILZ mimic were evaluated for proximity to p65-TAD residues. In general two residues are considered in contact with each other if the distance between the CP atoms is <5 . Interactions between the conserved F.sup.534-F.sup.542 in the p65-TADi and the critical prolines P.sup.120/P.sup.123 of GILZ could promote C-H interaction and provide substantial binding energy in the GILZ:p65-TAD complex. All solutions that exhibited an RMSD of <5 with the critical F.sup.534 and F.sup.542 were selected for further screening (Table 1).
TABLE-US-00003 TABLE 1 Characteristics of GILZ mimics p65-Transactivation Domain Superimposition % TA2 GILZ % TA1 CR-1 CR-2 CR-3 % PPII PPII model 521-531 435-455 462-479 491-505 PGA-1 14.3 0.82 0.216 19 43 39 20 PGA-2 42.9 0.531 0.216 18 32 13 9 PGA-3 14.3 0.109 0.428 11 14 23 4 PGA-4 14.3 1.049 0.482 4 13 47 29 PGA-5 28.6 1.234 0.586 11 14 23 4 PGA-6 14.3 0.844 0.645 21 54 34 9 PGA-7 14.3 0.156 0.681 30 20 0 11 PGA-8 14.3 1.72 0.842 15 41 32 5 PGA-9 42.9 0.257 0.88 24 42 29 13 PGA-10 28.6 0.161 0.9 12 38 23 7 PGA-11 28.6 0.703 0.912 20 46 23 6 PGA-12 42.9 1.17 1 10 12 18 6 PGA-13 14.3 0.58 1.018 3 35 55 6 PGA-14 28.6 1.172 1.033 32 28 10 2 PGA-15 14.3 0.391 1.047 12 36 8 7 PGA-16 14.3 0.252 1.154 18 38 33 1 PGA-17 28.6 1.293 1.227 15 25 24 9 PGA-18 14.3 1.248 1.243 16 24 31 22 PGA-19 28.6 0.581 1.49 7 22 24 7 PGA-20 42.9 1.174 1.613 37 43 9 2
[0195] Table 1 shows the characteristics of twenty GILZ mimics: GILZ models (GM) with substituted residues at the proline rich region of wild type GILZ sequence were developed using Geno3D and CPHModels. Each GA model was superimposed over wild type GILZ and experimentally determined polyproline (PP.sub.II) helical structures. The root mean square deviation (RMSD) of each superimposition as a measure of structural similarity is shown. Each GM was docked with the molecular model of p65-TAD and the docked complexes were screened for interface p65-TAD residues within 5 distance of GM.
[0196] Sixty of the top one hundred predictions of wild type GILZ exhibited close proximity with nearly 50% of p65-TADi residues suggesting near-native interactions (
Example 3
[0197] Binding of GILZ and human r-p65: Previously we observed that the r-GILZ exhibits ten times higher affinity than a 22 residue GILZ peptide for r-p65. We used similar method to determine direct binding kinetics of GA hexapeptides with human r-p65. High binding ELISA plates were coated with increasing concentrations of r-GILZ (0.5 M to 20 M) or each GA or control peptide (20 M-640 M) and probed with 80 pM r-p65 followed by detection with anti-DDK antibody. Absorbance at 650 nm was measured with a mixing time of 30 s using BIORAD microplate reader. Percent bound p65 was determined considering the binding response of r-GILZ (20 pM) with r-p65 as 100%. The dissociation constant of the interaction between the GA or the control peptide and r-p65 was determined by the method of Friguet et al., as described. A fraction of the bound r-p65 (x) and the ratio of bound r-p65 to the free GA or control peptide (y) was determined by the equations: x=(A.sub.0A)/(A.sub.0), where A.sub.0 is the absorbance of r-p65anti-p65 complex in the absence of bound GA or control peptide and y=(A.sub.0A)/(a.sub.0i.sub.0)(A.sub.0A)/(A.sub.0), where a.sub.0 is the total concentration of GA or control peptide and i.sub.0 is the total concentration of r-p65. KD for the interaction was determined by the Scatchard equation: x=1+K.sub.D/y.
[0198] Kinetics of GA: p65 interaction: Previously the strength of interaction between rGILZ or wild type GILZ-P and r-p65 has been shown to be 5.912.4*10.sup.7M and 1.120.25*10.sup.6M, respectively. We evaluated the binding kinetics of individual GA at increasing concentrations with the plate bound r-p65 protein at constant concentration. We observed that the percent bound r-p65 was over 25% with GA-1, GA-2 and CP-1 even at the lowest concentration evaluated (
Example 4
[0199] Cell Titer-Glo (CTG) luminescent cell viability assay: Human neuroblastoma (SK-N-SH) cells cultured in minimal essential medium (MEM) supplemented with 1% fetal bovine serum (FBS) and 1% penicillin (100 U/ml)/streptomycin (100 g/ml) were differentiated with 10 M all-trans retinoic acid for 7 days. After resting for 24 hours in the low serum medium, the cells were seeded in 24 well (10.sup.5 cells/well) culture plates in fresh medium and incubated with 50 M or 500 M of individual GA or control peptide for additional 24 hours. The cultures were then photographed using a phase contrast Leica microscope (Leica Microsystems Inc, Buffalogrove, Ill.). Subsequently, the cells were harvested, lysed with lysis buffer (M-PER, Pierce) and the lysate was assessed for metabolic activity using the luciferase based CTG assay (CTG, Promega, Madison, Wis.). Briefly, cell lysate (5 L) in 25 L of phosphate buffered saline was transferred to an opaque white 96-well plate, and then 30 L of CTG assay solution was added. The relative luminescent signal (RLT) was quantified using a Glowmax luminometer (Promega).
[0200] Effect of GA on cellular morphology and metabolic activity: Any compound with potential therapeutic effect should be biocompatible and nontoxic. So, we first screened the effects of GA on cellular morphology and viability. Cultures of neuroblasts exposed to 50 M or 500 M of individual GA or CP-1 or CP-2 did not show any change in cell morphology suggesting that the four peptides were not toxic. Exposure to CP-3 at either concentration showed morphological changes consistent with cell death (
Example 5
[0201] Lactate dehydrogenase (LDH) assay: To detect direct GA-induced cell lysis we performed LDH release assays (Roche Molecular Diagnostics). Human glioblastoma (U373) cells were maintained in MEM supplemented with 10% FBS and 1% penicillin (100 U/ml)/streptomycin (100 g/ml) at 37 C. in 5% CO.sub.2-humidified incubators and sub-cultured once or twice a week. Approximately 510.sup.4 U373 cells/well were cultured in 96-well plates in the presence of increasing concentrations of individual GA or control peptide from 0.5 M to 500 M. Cells treated with 2% triton-X 100 (Sigma Aldrich, St. Louis, Mo.) for 10 minutes served as positive control. Untreated cells served as controls for spontaneous LDH-release. Specific LDH-release was calculated according to the following formula: LDH-release %=100*(GA or control peptide treated cellsuntreated cells)/(positive control-untreated cells). The IC50 values were extrapolated by logarithmic estimation. The LD50 in mg/kg was predicted using the formula, Log (LD50)=0.506(log IC50)+0.475.
[0202] Detection apoptosis by flow cytometry: To further assess cell cytotoxicity, the apoptotic effects of individual GA or control peptide was evaluated by the Annexin-V and propidium iodide (PI) dual staining method (Annexin-V-Fluos staining kit, Roche Diagnostics, Mannheim, Germany). As opposed to apoptotic cells, necrotic cells with ruptured cell membrane take up PI, the DNA binding dye. Thus, cells which take up both fluorochromes are a mixture of apoptotic and necrotic cells, whereas cells that exclude PI but bind Annexin V are (early) apoptotic cells. U373 cells cultured with varying concentrations of individual GA or control peptide (0.5 M to 50 M) for 24 hours were centrifuged and suspended in 100 l of Annexin V/PI labelling solution (20 l each of Annexin-V-Fluos labelling reagent and PI in 1 ml of binding buffer) for 15 min at room temperature. After washing the cells were resuspended in PBS:1% paraformaldehyde and analyzed using a FACScan flow cytometer (BD Biosciences, San Jose, Calif.).
[0203] Effect of GA on membrane integrity and apoptosis: Membrane integrity as a measure of cell survival was assessed by the leakage of intracellular LDH molecules into culture medium. Treatment with GA-1 and GA-2 were best tolerated as indicated by the reduced % LDH release at all concentrations as compared to untreated cultures or cultures exposed to control peptides (
Example 6
[0204] Functional assays in human primary mixed brain cultures (HFB). Primary cultures of mixed HFB were prepared from the brain parenchyma of aborted fetuses (80-100 days gestational age). The tissues were obtained from the Birth Defects Research Laboratory (BDRL) at the University of Washington, Seattle with approval from the Indiana University Institutional Review Board (IRB). The IRB determined that the use of anonymous human biological materials received from this depository is not considered as human subjects research (supplementary document, s1). The NIH funded BDRL tissue distribution program operates separately in full compliance with all relevant state and federal laws and regulations with donors providing written informed consent.
[0205] Fetal brain materials (10-20 g) were shipped overnight in chilled Hibernate-E medium (Invitrogen) supplemented with B27 (Invitrogen), GlutaMAX (Invitrogen) and antibiotic-antimycotic solution (Cellgro). HFB were prepared and cultured as described. Briefly, cells were cultured in Neurobasal medium (Invitrogen) without phenol red supplemented with 1B27, 50 mM GlutaMAX, 1antibiotic cocktail, 5 ng/mL recombinant fibroblast growth factor 2 (bFGF) (Invitrogen), and 2 L/mL Normocin (InVivoGen, San Diego, Calif., USA). Cells were counted and seeded onto poly-D-lysine (Sigma-Aldrich) coated 24-well plates (Corning, Lowell, Mass., USA) at 1.510.sup.5 cells per well and maintained at 37 C. in a 5% CO.sub.2 incubator. Half media changes were performed every 4th day of culture and morphology was monitored via phase contrast microscopy. Culture medium was removed from cells on day 17 (DIV17) and replaced with Neurobasal medium with B27. Appropriate wells were then added vehicle, or carrier peptide or individual GA or control peptide (at 50 M) for 30 min followed by exposure to A.sub.1-42 at a final concentration of 10 M/well and incubated for 4 hours or 48 hours. Cells and conditioned media were harvested and stored for further analysis. Relative ATP concentration was measured using the CTG kit (Promega). Data is presented as RLU=RLU of A.sub.1-42 exposed cells-RLU unexposed cells. Conditioned media collected were assessed for specific cytokines using the OptEIA kits (BD Biosciences). Nuclear and cytoplasmic fractions were extracted using the CelLytic NuCLEAR Extraction Kit (Sigma) following manufacturer's protocol. Five microgram of nuclear extracts was incubated in a 96-well plate coated with oligonucleotides containing the NF- consensus nucleotide sequence (5-GGGACTTTCC-3) (SEQ ID NO: 30). The activated NF- bound to DNA was detected by anti-p65 antibody followed by a peroxidase coupled secondary antibody and substrate using the TransAM kit protocol (Active Motif). Nuclear extracts of Raji cells was used as the positive control.
[0206] Select GA protect against A.sub.1-42 induced toxicity in human fetal brain cells. We used an in-vitro neurodegeneration model in which primary human fetal brain cells are allowed to mature gradually. The system provides an opportunity to test the pharmacological and toxicological effects of GA on differentiated neurons and glia simultaneously. The relative ATP concentration of GA or control peptide treated HFB cultures in the presence or absence of A.sub.1-42 over the cultures exposed to vehicle alone (A-RLU) was determined by the CTG assay. Cultures exposed to GA were best tolerated while the cultures treated with CP-2 or CP-3 exhibited significant toxicity (
[0207] Select GA treatment inhibits activated p65: Previously A.sub.1-42 has been shown to enhance expression of activated NF-B in glia and post-mitotic neurons. We measured nuclear p65 binding activity using activated NF-B specific ELISA. Nuclear p65 was significantly higher in cells exposed to A.sub.1-42 than in unexposed cells (
[0208] Comparative analysis of physical and functional characteristics of known receptor antagonists and peptide drugs in clinical use today with that of GA, suggest that the GA-1 and GA-2 exhibit significant drug like properties (Table 2).
TABLE-US-00004 TABLE 2 Physical and functional characteristics of GILZ analog and control peptides Structural similarity RMSD Wild % type PPII Docking features # rotatable K.sub.D LD50 apoptosis GILZ peptide % TA1 % TA2 % PPII bonds Log P (uM) (mM) at LD50 Overall <1 >1 <1 >1 >25 <25 >25 <25 >25 <25 <10 >10 <5 >5 <3 >3 >100 <100 <25 >25 rank 1 0 1 0 1 0 1 0 1 0 1 0 PGA1 1 1 1 0 0 0 0 0 0 0 3 PGA2 1 1 1 1 1 1 1 1 1 1 10 PGA3 1 0 1 0 1 0 1 0 1 1 6 PGA4 1 1 1 1 1 1 1 0 1 1 9 PGA5 1 1 0 1 0 0 0 0 1 0 4
Example 7
[0209] Design and selection of PGA: Human GILZ has an amino terminal a-helix for dimerizing and a carboxy terminal proline glutamic acid rich region for intermolecular interactions. Mutational and binding analyses showed that the proline rich region of GILZ adopts an extended PP.sub.II helical conformation and binds the p65-TAD. In the GILZ:p65 complex, interaction between the imino ring of P.sup.120/P.sup.123 of GILZ and the side chain of F.sup.534/F.sup.542 in the p65-TAD could promote C-H interactions and provide substantial binding energy. Functional studies have shown that the highly conserved F.sup.534 and F.sup.542 in the transactivation domain are critical for p65 induced transactivation.
[0210] Forty PGA were designed by incorporating rational substitutions in the p65 binding domain of GILZ with residues that facilitate PP.sub.II formation and stabilization at the interface with the p65-TAD. Homology models of PGA built using delta sleep inducing peptide (DSIP; PDB:1DIP) as template were screened for conformational constraints by superimposing on experimental PP.sub.II and wild type human GILZ. The PP.sub.II content of all PGA as determined by PROSS method ranged from 14.3%, 28.6% and 42.9%. Since PP.sub.II helix formation is often a locally driven event, the synthetic PGA with blocked end groups will likely adopt a similar conformation as in the predicted model. Twenty PGA that exhibit structural congruence with DSIP (<1 A), wild type GILZ and experimental PP.sub.II structure (<2 ) were selected for docking analysis.
[0211] Homology model of p65-TAD was built using elongation factor eEF3 (PDB:3H7H) as template. Spatial orientation of wild type GILZ peptide or each PGA with p65-TAD was assessed by multiple algorithms including rigid-docking based on shape complementarity and coarse refinement methods that restrict side-chain flexibility at interface. The docked complexes were ranked using an optimized global energy function. Significantly most solutions of top ten PGA exhibited close proximity to the phenylalanines (F.sup.534, F.sup.542) and the putative LXXLL motif in p65-TAD (see
Example 8
[0212] Kinetics of PGA:-p65 interaction: The binding kinetics of top five PGA with full length human r-p65 was assessed as described. Plate bound GILZ-P or PGA at increasing concentrations was probed with r-p65-DDK (Ori-Gene Technologies Inc., Rockville, Md.) at constant concentration and detected with anti-DDK. The percent bound r-p65 increased with increasing concentration of PGA (see
Example 9
[0213] Effects of PGA on membrane integrity and apoptosis: The top five PGA were covalently synthesized with the cell penetrating TAT (transcriptional transactivation) peptide to facilitate intracellular delivery (Genescript, N.J.). Membrane integrity of U373 microglial cells exposed to increasing concentration of each PGA from 0.5 m to 500 M was assessed by the leakage of intracellular lactate dehydrogenase (LDH) into culture medium (Roche, Ind.).
[0214] All five PGA exhibited a dose dependent LDH release (
Example 10
[0215] Select PGA protects against A.sub.1-42 induced toxicity, prevents p65 activation and cytokine response in human fetal brain (HFB) cells. Primary HFB cells pretreated with vehicle or each PGA at IC.sub.50 concentration were cultured in the presence of A.sub.1-42 aggregates (10 M) for 24 hours at 37 C. and 5% CO.sub.2. Viability in terms of relative luminescent Units (RLU) was quantified using a Glowmax luminometer (Promega, Wis.). Data are presented as RLU=RLU of A.sub.1-42 exposed cells-RLU of unexposed cells. HFB cultures exposed to PGA-2, PGA-3 and PGA-4 were well tolerated. Cultures treated with PGA-1 and PGA-5 exhibited significant toxicity (
Example 11
[0216] Evaluation of the effect of PGA-2 and PGA-4 on AD-relevant cells. An in-vitro neurodegeneration model derived from primary HFNC can be utilized in the instant example. Previously maturing HFNC cultures have been shown to exhibit positive staining for neuronal, glial and synaptic markers. Further, the neuronal population has been shown to increase with time and exhibit physiological activity. In addition the cells are capable of being transfected with external agents providing a tool for evaluating the efficacy of potential drug candidates for CNS pathologies. Importantly, abundant A production and tau proteins make this a powerful model for Alzheimer's research. The effects of PGA-2 and PGA-4 on neuronal and glial cell morphology, BACE-1 and A production in primary HFNC can be evaluated. (see
[0217] HFNC: Briefly, human brain cells derived from aborted fetus (90-110 days gestational age) can be plated in poly D-lysine coated 24-well plates (Sigma, St. Louis, Mo.) using defined culture medium (Neurobasal medium with 1B27, 50 mM Glutamax, 1antibiotics cocktail and recombinant human basic fibroblast growth factor 2 (bFGF) at 5 ng/mL (Gibco, Grand Island, N.Y.) and incubated at 37 C., 5% CO.sub.2. Half media changes can be performed every fourth day and morphology monitored by phase contrast microscopy. The procedure usually results in 75% pure neurons. Purity of the cultured cells has been demonstrated by visualization of neurons and glia using pan-neuronal antibody (Millipore, Billerica, Mass.) and glial fibrillary acidic protein (GFAP) (Sigma) respectively.
[0218] PGA treatment and immunocytochemistry: PGAs were covalently synthesized with the cell penetrating TA T to facilitate intracellular delivery as peptide amides with amino terminal acetylation. At DIV16 (mixed population of neuronal and glial cells) or DIV20 (predominantly mature neurons) of HFNC, the defined culture medium can be replaced with Neurobasal medium supplemented only with B27. PGA-2 (168.9 M), PGA-4 (101.7 M) at IC50 concentration or TAT peptide (100 M) can be added and the cultures continued to be incubated for 24 hours. The effect on neuronal and glial cell morphology can be assessed by immunostaining using fluorophore conjugated astroglial markers (GFAP) and neuron specific proteins (Nestin, Pan N). Stained sections can be visualized with an inverted fluorescent microscope (Leica Microsystems) and appropriate sets of filters.
[0219] Quantitation of BACE-1 and AB: Separate HFNC cultures at Div16 can be added PGA-2, PGA-4 or TAT (carrier). Equal quantity of cDNA isolated from cells harvested after 24 hours can be amplified for BACE-1, APP and reference genes -2 microglobulin and GAPDH by real time polymerase chain reaction (Applied Biosystems; assay IDs: human BACE-1 (Hs00201573_m1), human APP (Hs01552283_m1), human GAPDH (4333764T), human B2M (4333766T). Fold changes can be calculated using the delta-Ct method normalized to the geometric mean of the reference genes. Levels of A.sub.1-40 and A.sub.1-42 in the culture medium can be measured using specific commercially available ELISA kits (Covance, Princeton, N.J.). Absolute A values (in pg/ml of culture medium) can be normalized to total protein and scaled relative to levels in untreated cultures.
[0220] As PGA-2 or PGA-4 did not affect the morphology of HFNC as seen under inverted bright field microscope, HFNC exposed to either PGA may exhibit significant neuronal staining on day-20 suggesting neuropreservation. Transfection of human brain cells with NF-B dependent miRNA has been shown to downregulate BACE-1, APP and AP production. By blocking p65, PGA-2 and PGA-2 treatment may reduce BACE-1 transcription and consequent A production.
Example 12
[0221] Investigation of the molecular effects of PGA on AD relevant cells: Accumulating environmental and oxidative stress induces NF-B p65 activation in neuronal and glial cells contributing to AD pathogenesis. Quantitation of biologically active molecules integrally involved in AD pathology is used as outcome measures in early stages of drug discovery.
[0222] Cell culture: HFNC cultures at Div16 added PGA-2 or PGA-4 at IC50 or TAT (carrier) as above can be exposed 30 minutes later to H.sub.2O.sub.2 (10 M) or sodium nitroprusside (SNP) (30 pM) as radical oxygen or nitric oxide donor respectively for 4 hours or 24 hours. Some cultures can be added a cell permeable 2,7-dichlorofluorescin diacetate (DCFH-DA) (10 M) (Molecular Probes, Eugene, Oreg.) probe at the time of PGA treatment to measure reactive oxygen species (ROS). Cells and culture medium can be collected for RNA and protein analysis.
[0223] Evaluation of activated NF-B. cytokines and glutamate: The effect of PGA on p65 transactivation in each cell type can be evaluated by co-labeling of cells harvested at 4 hours using fluorophore conjugated markers for neuron (NSE, Nestin, Pan N), astrocytes (GFAP); microglia (IBA1) and nuclear p65 (Abcam Cambridge, Mass.) and visualized with an inverted fluorescent microscope. Activated p65 in nuclear fraction of cells can be quantitated by ELISA. IFN-, IL-i and IL-6 and glutamate in culture medium collected at 24 hours can be measured using specific ELISA kits (R&D Systems, Minn.) and enzymatic assays (BioVision Inc. Milpitas, Calif.) respectively.
[0224] Cytoprotection assays: Fluorescence in cell lysates added DCFH-DA and collected at 4 hours can be measured at 504/529 nm and data expressed as ratio of ROS to total protein. Activated caspase in culture medium can be measured using caspase-3 assay kit (R&D systems). Total protein isolated from cells harvested at 24 hours can be probed by immunoblot (Abcam) for apoptosis related proteins Bax, Bcl-2 and caspase-3 using specific antibodies. Fold changes in these apoptotic proteins transcripts can be determined by polymerase chain reaction arrays (Applied Biosystems; Human TaqMan Human Apoptosis Array; Cat. #4414072).
[0225] Other neuroprotective agents suppressed caspase-3 and Bax in neuronal cells. Preliminary data suggest that PGA-2 and PGA-4 may suppress cytokines and cytotoxic mediators. Alternatively primary rat cortical neuronal cells (PRCN) can be used to evaluate the effects of PGA.
Example 13
[0226] Evaluation of the In-Vivo Efficacy of PGA in a Transgenic Mouse Model of AD.
[0227] Selection of Animal Model: The R1.40 APP YAC transgenic mice created by introducing entire genomic copies of mutant human APP (with K670N/M671L FAD substitutions) into the mouse genome can be utilized in the instant example. As compared to the cDNA based hAPP transgenic mice, the R1.40 APP YAC transgenic mice exhibit regional AO distribution, preferential deposition of A.sub.1-42, overlapping deposition of APOE, extensive neuritic abnormalities, and increased markers of inflammation mimicking many characteristics of human AD. Inhibition of NF-B by tolfenamic acid has been shown to reduce cerebral A plaque burden in homozygous R1.40 mice.
[0228] Experimental procedures:
[0229] Animals: Starter pair of R1.40 [B6.129-Tg(APPSw)40Btla/Mmjax mice (Stock #034831)] can be purchased from Jackson Laboratory (Bar Harbor, Me.). Breeding colonies can be genotyped and maintained under standard animal housing conditions in a 12-hour dark light cycle with free access to food and water at the laboratory animal resource facility (LARC) at IU School of Medicine (IUSM). The background strain for R1.40 is mixed, which can serve as non-AD controls. All experiments can be conducted according to the Institutional Animal Care and Use Committee (IACUC) and approved by the local ethics committee.
[0230] PGA dosing and treatment regimen: The LD50 calculated using the in-vitro IC50 values and the regression equation [log (LD50)=0.506log (IC50)+0.47551] for PGA-2 and PGA-4 equals 1396.83 mg/kg and 1693.87 mg/kg bodyweight respectively. Appropriate dose of PGA-2 and PGA-4 can be dissolved in 100 l of sterile PBS for i.p administration. R1.40 APP YAC transgenic mice develop parenchymal and vascular amyloid deposits by 12-13 months and exhibit reactive gliosis by 14-16 months. Four groups with 7 homozygous mutant APP YAC transgenic mice each can be administered daily either saline, PGA-2, PGA-4 or carrier peptide (TAT) at 1300 mg/kg (equivalent to LD50 of PGA-2) for four weeks beginning at week 40.
[0231] Histology: Mice can be perfused transcardially with ice cold PBS 4% paraformaldehyde at the end of four weeks. Brain tissues can be harvested, frozen and stored for histological analysis. Sections of entorhinal cortex, orbitofrontal cortex, and frontal cortex can be stained for congophilic dense-core amyloid plaques and immunostained for A plaques and inflammatory markers including Iba1, IL-6, IL-1, TNF-, and NF-B-P65.
[0232] Photomicrographs can be analyzed for percent stained area for plaque load and inflammation. An inflammatory focus is defined as the presence of clusters of 20 or more aggregated mononuclear cells. The total number of inflammatory foci can be counted from 3 different sections of each specimen.
[0233] Leuprolide (5 g/kg) and glatiramer acetate (230 mg/kg) administered i.p. for similar periods were efficacious in models of AD. These peptides have been measured in the cerebrospinal fluid in optimum concentrations suggesting efficient CNS delivery and substantiating the credibility of peptide drugs for AD. Based on the mechanisms of actions of GILZ and preliminary data, percent stained area of congo red positive plaques, A plaques and inflammation may be significantly reduced in PGA treated mice.
Example 14
[0234] Transformation of PGA into small molecule agents: PGA peptides are rationally designed structural mimics of GILZ in the contest of the p65-TAD binding interface. Specific inhibition of activated p65 by PGA has been shown to suppress inflammatory and cytotoxic responses in-vitro and in-vivo.
[0235] Three dimensional structure databases incorporated within the modeling programs of CAVEAT and PHASE can be searched to identify templates with bonds that adopt PP.sub.II orientation and serve as attachment points. The functional groups of critical proline of human GILZ or the substituted PGA residue can be grafted onto the non-peptide scaffold. The resultant PGA pharmacophore can be characterized by binding affinity and functional studies. A similar approach has been previously used successfully in developing inhibitors of Factor Xa for treating coagulation pathologies.
[0236] PepMMsMIMIC is a virtual screening platform tool used to identify pharmacophore or chemical compounds that mimic a natural peptide or protein in 3D space. Using this tool, a three dimensional similarity search of PGA-2/PGA-4 structure can be initiated amongst seventeen million conformers calculated from commercially available chemicals. Top peptide mimetic can be ranked by two different scoring functions taking into account high electrostatic, chemical and shape complementarity together with pharmacophore fingerprints similarity. Using this method, multiple small molecule nutlin analogues have been identified as peptidomimetics of MDM2/p53 interaction. Preliminary search suggests that the chemical moiety, methyl-N-butyl-N [2,6-di-nitro-4-(trifluormethyl)phenyl] carbamate, may be similar to PGA-2 peptide.
[0237] Modified amino acids or incorporation of enantiomers may be used to enhance identification of PGA specific pharmacophore.
Example 15
Suppression of Pathology in an Alzheimer's Disease Model
[0238] Peptides: GA-1 and GA-2 are peptides designed to mimic the PP.sub.II helical orientation of the p65 binding motif of the GILZ. The control peptides include sequence control consisting of residues with little propensity for PP.sub.II helix (CP-1) formation and/or for binding p65-TAD (CP-2) or unstructured peptide with no p65 binding potential (CP-3). All peptides were co-synthesized with the cell penetrating agent TAT (GRKKRRQRRRPQ, SEQ ID NO: 31) for intracellular delivery as peptide amides with amino terminal acetylation (Genescript, Piscataway, N.J.). All peptides were purified by semipreparative RP-HPLC and the identity of the purified peptide was confirmed by mass spectrometry.
[0239] Animals and lipopolysaccharide induced neuroinflammation: Male C57/6J mice weighing 32 to 37 grams were housed five per cage at a temperature of 222 C. with 12 hour light/12 hour dark cycles with free access to laboratory food and water. Lipopolysaccharides (LPS) from Escherichia coli 026:B6, =10,000 EU/mg, purified by phenol extraction was purchased from Sigma (Sigma Aldrich, Mo., USA). The mice were randomly divided into seven groups: LPS, LPS+GA-1 or GA-2 or CP-1 or CP-2 or CP-3 or TAT. The LPS was administered intraperitoneally at 250 mg/kg in 100 l of sterile saline followed by corn oil in the morning daily for six days. The GA or CP was administered intravenously at 25 mg/kg in 100 l of sterile saline on alternate days. Additional control group included mice receiving saline alone. All animals were sacrificed on day 7.
[0240] Histology and immunohistochemistry: The mice were sacrificed on day 7 by intra-cardial perfusion of 25 ml of 0.9% saline. Brain from each mouse was removed, one half was immediately frozen and the other half fixed in 4% paraformaldehyde for 24 h and later in 10% neutral buffered formalin for additional 24 h. Fixed tissues were subsequently processed for paraffin embedding. Tissue sections (50 stained with Harris's haematoxylin and counterstained with eosin were assessed for inflammation.
[0241] Immunohistochemistry: Serial 5 thick coronal sections of each brain specimen were immunostained for markers of microglial cells, astrocytes and NF-B p65. Briefly, after deparaffinization and hydration sections were subjected to antigen retrieval by microwave incubation in 10 mM sodium citrate buffer (pH 6.0) followed by sequential incubation in 30% hydrogen peroxide and blocking buffer (Enzo biosciences,) to reduce non-specific binding. The sections were then stained with the following primary monoclonal antibodies from EMD Millipore Corporation, Temecula, Calif., USA: anti-Iba-1 (AIF1 clone: Cat. #MABN92) or anti-glial fibrillary acidic protein (GFAP) clone GA5 (Cat. #MAB3402, Millipore) or anti-CD11b (Cat. #MABF513) clone M1/70 or anti-NF-B p65 subunit clone 12H11 (Cat. #MAB3026). For mono-staining of Iba-1 and GFAP, detection was with the use of IHC select immunoperoxidase secondary detection system (Millipore). The peroxidase conjugated streptavidin-biotin method was used and brown staining was considered positive. For dual staining of CD11b and NF-B p65 detection was achieved using the MULTIVIEW (mouse-HRP/rabbit-AP) IHC kit (Catalog #: ADI-950-100, ENZO Lifesciences, Farmingdale, N.Y., USA). For each marker, to confirm the specificity of the antibodies, a separate set of sections from each group were incubated with only the secondary antibodies, a condition in which no staining was present.
[0242] Quantitative analysis of staining intensity: Images of the IHC stained sections were captured using the NIKON Multiphoton microscope with attached DS Ri2 camera. Five areas encompassing the hippocampus of each brain section were analyzed using the ImageJ Software. The number and the relative optical density of Iba1+ and GFAP+ glial cells was determined using the multi-point tool and the IHC-tool box. A training for brown/red color was performed prior to measurement to define the threshold for positive selection. Regions of interest encompassing the hippocampus were identified in each section, and the corresponding images were quantified using integrated optical density, normalized to the background optical density. Measurement of pixel intensity was restricted to the DAB or AP stained pixels of cells within defined circularity. Five consecutive coronal sections were assessed for each mouse.
[0243] Enzyme linked immunosorbent assay for cytokines: Frozen brain tissue was homogenized in RIPA lysis buffer (50 mmol/LTris-HCl, pH 6.8, 150 mmol/L NaCl, 5 mmol/L EDTA, 0.5% sodium deoxycholate, 0.5% NP-40) supplemented with a cocktail containing protease and phosphatase inhibitors (Chemicon, Millipore) on ice and then centrifuged at 16,000g for 30 min. Supernatant was stored at 80 C. until further analysis. For each sample, 10 L of extracted protein was used for measuring the cytokines IL-6, TNF-, IFN-, IL-10 and TGF- using specific OptEIA kits (BD Biosciences, Calif.).
[0244] NF-B assay: Brain homogenates processed as above were assessed by the Cell Signaling Technology PathScan Phospho-NF-B p65 (Ser.sup.536) Sandwich ELISA kit following manufacturer's protocol (Cell Signaling Technology, Boston, Mass.). Briefly, 40 l of the extracted protein mixed with 60 l of the sample diluent was added to phosphor p65 (Ser.sup.536) mouse mAb coated microwells and incubated overnight at 4 C. After extensive washing, the captured phospho-NF-B p65 protein was detected by incubating with horse radish peroxidase (HRP) conjugated NF-B p65 rabbit mAb followed by washing and color development using the TMB substrate. Absorbance at 450 nM was measured using a microplate reader (Model 680; Bio-Rad Laboratories, Hercules, Calif., USA). Nuclear extracts of Raji cells was used as the positive control.
[0245] Real time polymerase chain reaction. Total cellular RNA was isolated from each brain tissue using Qiagen kit (Invitrogen, Carlsbad, Calif.) following manufacturer's protocol and reverse transcribed using iScript cDNA synthesis kit (Biorad, Calif.). Equal amount of cDNA measured by the Nanodrop (ThermoFisher Scientific, Waltham, USA) was used for amplification of IL-1, IL-12, CD14, Bcl.sub.XL and Bcl2. Real time PCR was performed using SYBR green/ROX qPCR master mix (SA Biosciences, Frederick, Md.) on the ABI Prism 7000 sequence detection system (Applied Biosystem, Foster City, Calif., USA). Each reaction contains 212.5 l of master mix, 1 l of 10 M of primers and 50 ng of the cDNA, to a total volume of 25 l. The thermal cycling conditions included an initial denaturation step at 50 C. for 2 min, 95 C. for 3 min, 39 cycles at 95 C. for 30 s, annealing temperature at 62 C. for 30 s and extension at 72 C. for 30 s.
TABLE-US-00005 TheprimersareF-Actin: (SEQIDNO:32) 5TCATGAAGTGTGACGTTGACATCCGTA3; R-Actin: (SEQIDNO:33) 5CCTAGAAGCATTTGCGCTGCACGATGG3(102bp); F-IL-1: (SEQIDNO:34) 5AGCTGATGGCCCTAAACAGA3; R-IL-1: (SEQIDNO:35) 5GGTCGGAGATTCGTAGCTGG3(89bp); F-CD14: (SEQIDNO:36) 5GAGCTAGACGAGGAAAGTTGT3; R-CD14: (SEQIDNO:37) 5ACCGTAAGCCGCTTTAAGGACAGA3(206bp); F-Bcl.sub.XL: (SEQIDNO:38) 5TGGAGTAAACTGGGGTCGCATC-3; R-Bcl.sub.XL: (SEQIDNO:39) 5AGCCACAGTCATGCCCGTCAGG3(84bp); and F-Bcl2: (SEQIDNO:40) 5CTCGTCGCTACCGTCGTCACTTCG3; R-Bcl2: (SEQIDNO:41) 5GTGGCCCAGGTATGACCCAG3(96bp).
[0246] The gene specific threshold cycle (Ct) for each sample (Ct) was corrected by subtracting the Ct for the housekeeping gene -actin. Untreated controls were chosen as the reference samples. The Ct for all experimental samples was subtracted by the Ct for the control samples (Ct).The difference in each gene specific threshold between the sample from vehicle treated and GA or CP treated cells was determined to obtain the relative change in the specific mRNA. The magnitude of change in the mRNA was expressed as 2.sup.Ct. Each measurement of a sample was performed in duplicates.
Example 16
Identification of Druggable Site: The Interface of p65:GILZ Interaction
[0247] Structurally p65 has dimerizing amino terminal rel homology domain, a nuclear localization sequence masked by the IB inhibitory complex and carboxy terminal TAD. The transactivation activity of p65 is mediated by interactions of the TAD with co-regulators and the basal transcription machinery. The p65-TAD is commonly divided into two distinct regions, TAD-1.sup.521-551 consisting of 36 amino acids and TAD-2.sup.428-520 with 92 residues. While TAD1 accounts for nearly 95% of the transactivation potential of full-length p65, TAD2 alone is less potent mediating about 30% activation. In particular, the conserved aromatic residues (F.sup.534, F.sup.542), acidic residues (D.sup.531, D.sup.533) and phosphorylation sites (Ser.sup.529,Ser.sup.536) in p65-TAD1 have been identified as critical for transactivation.
[0248] GILZ is a p65-TAD binding protein that sequesters activated p65 and inhibits transactivation of inflammatory and apoptotic factors. Mutational, binding and structural studies suggested that the PER region of GILZ adopts a PP.sub.II helical conformation in the context of critical phenylalanine in p65-TAD. PP.sub.II helices highly represented at interfaces of transient protein interactions in human proteome and often behave as adaptable gloves in obtaining the correct binding orientation. The specificity of PP.sub.II interaction is determined by residues of the interacting partner. PP.sub.II interface mimics constitute excellent drug templates. GA are rationally designed peptides with residue substitutions in the GILZ-PER with increased propensity to form stability of PP.sub.II helical conformation in the context of p65-TAD (see
Example 17
GA Prevented LPS Induced Microglial and Astrocyte Activation in the Hippocampus
[0249] Peripherally-injected LPS induces a variety of central effects. Multiple injections of LPS increase the number of F4/80+, CD11b+, or Iba1+ cells and induce morphological changes characteristic of activated microglia in the CNS. It was observed that the mice induced neuroinflammation and treated with GA-1 or GA-2 exhibited reduced Iba1+ microglial cells and GFAP+ astroglial cells in the hippocampus as compared to that in the hippocampus of mice treated with control peptides or left untreated (see
Example 18
GA Suppresses LPS-Induced Accumulation of Inflammatory Proteins in the Hippocampus
[0250] Brain tissues were investigated for cytokines known to be critical for microglial activation and gliosis in LPS-induced neuroinflammation. Brain tissue homogenates of GA-1 or GA-2 treated mice exhibited reduced IL-6 (18.7+/2 pg/ml and 19.6+/0.84 pg/ml respectively) treated mice as compared to the homogenates of untreated (32.4+/4.7 pg/ml) or control peptide treated mice (
Example 19
GA Treatment Suppressed Activated NF-B p65 in LPS-Induced Neuroinflammation
[0251] Since LPS is a potent stimulator of NF-B and GA are designed to sequester activated p65, the activated p65 in the brain homogenates was measured using specific ELISA kits. It was observed that the absorbance suggestive of activated p65 was significantly lower in the brain protein extract from mice treated with GA-1 (0.098+/0.03) or GA-2 (0.12+/0.07) as compared to that of extract from mice left untreated (0.29+/0.08) or treated with CP-3 (0.23+/0.09) (
Example 20
GA Treatment Inhibited LPS-Induced Suppression of Anti-Apoptotic Factors
[0252] To investigate the effects of GA on neurotoxicity, the expressions of anti-apoptotic factors Bcl.sub.XL and Bcl2 were determined by real time PCR. In addition, inhibition of LPS-induced cytokine secretion correlated with the decreased levels of steady-state mRNA for IL-1 in the brain tissues of in GA-1 or GA-2 treated mice (
Example 21
Investigation of the Role of GILZ in the GC Mediated Neuronal Survival and Apoptosis
[0253] GILZ exhibits opposing effects of increased proliferation and reduced survival in many cell types. While GILZ induces apoptosis in thymocytes, it protected activated T cells from apoptosis. Although GILZ expression in mouse brain has been observed, little is known about the role of GILZ in neurons.
[0254] Preliminary results: The expression of GILZ in human neuroblastoma cells was evaluated. SK-N-SH cells were cultured in minimal essential medium and differentiated with 10 M all-trans retinoic acid for 7 days as described. After resting, the cells were cultured with increasing concentrations of dexamethasone (Dex: 0-10 M) for 24 h and viability was determined by the MTT assay by measuring the absorbance of the intracellular formazon resulting from the reduction of the yellow tetrazolium MTT by the cell metabolic activity. Absorbance of vehicle treated cells was taken as 100% viable. GILZ expression was measured in protein extracts from separate SK-N-SH cultures by Western blot analysis using GILZ mAb [Santa Cruz Biotechnology, Dallas, Tex.]. Total RNA isolated from similar SK-N-SH cultures was reverse transcribed and the GILZ mRNA was amplified using the SYBR green qPCR mix (SA Biosciences, Fredrick, Md.) on the ABI Prism 7000 system (Applied Biosystem, Calif.).
TABLE-US-00006 Theprimerswere:GILZ-F: (SEQIDNO:42) 5-CATGGAGGTGGCGGTCTATC-3; GILZ-R: (SEQIDNO:43) 5-CACCTCCTCTCTCACAGCGT-3 and GAPDH-F: (SEQIDNO:44) 5AGGTCGGTGTGAACGGATTTG-3 and GAPDH-R: (SEQIDNO:45) 5-TGTAGACCATGTAGTTGAGGTCA-3.
Results: DEX at 1 M was not toxic but at higher (10 M) concentration reduced the viability of SK-N-SH cells by 25% (
[0255] At low GC concentration, MR induced GILZ can facilitate neuronal survival, but in high GC state GILZ expression can be decreased with loss of protection.
[0256] The GILZ gene has six GRE in its promoter region and hence its expression is highly regulated by both endogenous and exogenous GC. Furthermore, complete concordance observed between the GILZ protein and the mRNA implies that the regulation occurs at the transcriptional level. However, the dynamics of GILZ induction appear to vary in different tissues, suggesting that the local milieu could modulates its transcription. The goal of this example is to characterize the functions of neuronal GILZ and its regulation by GC.
[0257] Experimental Approach:
[0258] Culture of primary rat cortical neurons (PRCN): PRCN cultures can be generated as described. Briefly, brain tissues dissected from a 16-week old adult female Sprague-Dawley rat can be digested with papain. Neuronal cells isolated by gradient centrifugation using different Optiprep concentrations can be cultured for 12 days in Neurobasal medium supplemented with bFGF and Normocin (InvivoGen, San Diego, Calif.) at 37 C. and 5% CO.sub.2 at which time point the cultures are rich in mature neurons. The purity of neurons can be identified by morphology (phase contrast appearance as bright cells, with smooth rounded somata and distinct processes) and immunocytochemical staining for NueN. Corticosterone (CORT) treatment: After transferring to serum free medium, the effects of a range of CORT concentrations (1 nM-10 M) on cellular viability, cytotoxicity and GILZ induction in PRCN cultures can be analyzed. Since MR exhibits ten-fold higher affinity than GR for GC, we can next determine the relative contribution of MR and GR in GILZ induction. Separate PRCN cultures will be treated with MR antagonist spinorolactone (1 M) or GR antagonist RU 486 (50 nM) prior to treatment with varying CORT concentration (1 nM-1 M) to selectively block MR and GR respectively. In the preparation of CORT, RU486 and spinorolacotone the concentration of 100% ethanol can be at <0.1% in the culture medium.
[0259] The PRCN cultures in each experiment can be harvested at the end of 24 h, 48 h and 72 h. The primary read outs for these experiments can include i) assessment of cell viability and toxicity by MTT and lactate dehydrogenase (LDH) assays using cell lysates, ii) measurement of GR transactivation in nuclear extracts by the enzyme-linked immunosorbent assay-based TransAM GR kit (Active Motif, Calif.), iii) quantitate GILZ protein by immunocytochemistry and immunoblot in cell lysates and iv) quantitate GILZ mRNA by RT-PCR.
[0260] The role of GILZ in the bimodal effects of glucocorticoid mediated neuronal survival and apoptosis will be analyzed via overexpression of GILZ in PRCN: PRCN can be transfected with pCMV6-GILZ-Myc-DDK using Tsc22d3 (NM 001077364) Mouse Tagged ORF Clone (CAT#: MG225004, OriGene Technologies Inc., Rockwille, Md.) as per manufacturer's protocol. Initial transduction at different multiplicity of infection can be performed to determine the optimal transduction efficiency and GILZ expression. After resting, transfected cells can be exposed to 1 M CORT for 24 h. Equal amount of cDNA isolated from control and GILZ overexpressing cells can be used for gene expression studies by Pathway-specific PCR arrays (RT.sup.2 Neurotrophins & Receptors and Apoptosis) to identify changes in genes related to survival and death of neurons (Qiagen Inc, Germantown, Md.).
[0261] Cortisol treatment has been shown to mediate dose-dependent, bimodal effects on neuronal cell viability and proliferation. Specifically, the protective responses at low GC concentration is attributed to MR mediated transactivation. Pertinent to this study, in mouse hippocampal HT-22 cells that only express GR, GILZ was upregulated only in cells stably transfected with MR. Hence, the GILZ mRNA can be upregulated in PRCN exposed to low dose CORT via MR. In lymphocytes, much like GC, GILZ regulated apoptosis by modulating the ratio of anti-apoptotic (Bcl.sub.2, Bcl.sub.XL) to pro-apoptotic (Bax) molecules. Hence, the GILZ overexpression can suppress pro-apoptotic genes even in PRCN exposed to high dose of corticosterone.
Example 22
Pro-Inflammatory Role for Elevated GC in the CNS
[0262] Although traditionally conceptualized as anti-inflammatory agents, considerable evidence support a potent pro-inflammatory role for elevated GC in the CNS. This has been partially attributed to the reduced GR mediated transactivation of anti-inflammatory genes such as GILZ. GILZ overexpression or supplement suppressed inflammatory cytokines and pathology in models of arthritis and colitis.
[0263] Adult C57BL/6 mice (Jackson Laboratory, Bar Harbor, Me.) were administered LPS (Sigma Aldrich, Mo.) intraperitoneally at 250 mg/kg for 6 days. Serial 5 thick coronal sections of brain from nave and LPS treated mice were immunostained for GILZ using TSC22D3 mAb (Catalog #: H00001831, Abnova, Walnut, Calif.). The peroxidase conjugated streptavidin biotin method was used for detection and brown staining was considered positive. Staining specificity was confirmed by incubation with secondary antibody alone. Total RNA isolated from brain homogenates was reverse transcribed. Equal amount of cDNA was used for amplification of GILZ, CD14, CD4 and -actin using SYBR green/Rox qPCR mix (SA Biosciences) on the ABI 7000 system (Applied Biosystem).
TABLE-US-00007 Primersusedwere: F-Actin: (SEQIDNO:32) 5TCATGAAGTGTGACGTTGACATCCGTA3 R-Actin: (SEQIDNO:46) 5CCTAGAAGCATTTGCGCTGCACGATGG3(102bp); F-CD14: (SEQIDNO:47) 5GATGACATGGTGAAGACGGC3; R-CD14 (SEQIDNO:48) 5AGGCACAGGTCATCATCAA3(89bp); F-CD4: (SEQIDNO:49) 5GAGAGTCAGCGGAGTTCTC3; R-CD4: (SEQIDNO:50) 5CTCACAGGTCAAAGTATTGTTG3(92bp); and F-GILZ: (SEQIDNO:51) 5AAGGCTAGCTCCGCAGGTGC-3; R-GILZ: (SEQIDNO:52) 5AGGTGAGCGGCACTCGGTCT3(120bp).
Fold change was determined by the 2.sup.Ct method.
[0264] Results are shown in
[0265] GILZ Overexpression can Protect Against Neuronal Apoptosis:
[0266] Generation of conditional GILZ-transgenic (GILZ-Tg) mice: The standard Cre/loxP systems can be used to develop conditional GILZ-Tg mice. Using a Gateway-compatible ROSA26 locus targeting vector, transgenic mice can be generated overexpressing GILZ in neurons. The target vector can include mouse Tsc22d3/Gilz-1 cDNA preceded by a loxP flanked stop cassette under control of the ROSA26 promoter followed by an IRES-EGFP cDNA. Embryonic stem cell clones with gilz transgene can be identified by Southern blotting. Conditional GILZ-Tg mice can be generated by crossing mice homozygous for the loxP flanked stop cassette and Thy1-cre mice expressing cre in the neurons of the postnatal cortex and hippocampus. Controls can include wild type mice with the same genetic background as the GILZ-Tg and Thy1-cre mice. The expression of GILZ mRNA and protein in the CNS can be determined. (See quotation from vendor and Co-I support letter for Thy1-Cre).
[0267] Assessment of the GILZ-Tg mice: The phenotype of GILZ-Tg mice can be recorded with respect to body weight, length and physical appearance. Brain tissue can be assessed for gain of GILZ protein by immunohistochemistry and Western blot and by quantitative-PCR for GILZ mRNA. In addition, the neuronal structure of the brain in the GILZ-Tg mice can be assessed by Nissl staining followed by immunohistochemical staining for neurons (Neu N), microglia (Iba1) and astrocytes (GFAP).
[0268] Cellular assays: Single cell suspensions from the brain homogenates of wild type and GILZ-Tg mice can be processed to separate neuronal and glial cells by gradient centrifugation. Neuronal cell cultures can be exposed to Dex (1 M) or A.sub.1-42 (10 M). Cells harvested at the end of 24 h and 48 h can be assessed for inflammatory markers (NF-B, cytokines), anti-apoptosis (Bcl2, Bcl.sub.XL) and pro-apoptotic (caspases, Bax, Bak) protein and gene expressions by Western blot, flow cytometry and RT-PCR.
[0269] Expected results, pitfalls and alternative measures: The use of Cre-based technology is an incredibly important tool to investigate body systems in health and disease. Although Thy1-cre is expressed robustly throughout postnatal brain it is also observed in additional tissues. To differentiate real effects from artifacts and avoid misinterpretation of results, the following controls can be included: a) Cre background strains (C57BL/6), floxed controls, wild type controls and Thy1-Cre controls. Alternatively, the effects of GILZ can be assessed by introducing TAT-GILZ recombinant protein incrementally into wild type neuronal cells.
[0270] GILZ overexpression in macrophages or cardiomyocytes has been shown to enhance Bcl-.sub.XL, suppress caspase-8 and protected against apoptosis. It was observed that the GILZ expression was reduced in the brain of mice induced neuroinflammation and the reduction correlated with the enhanced cytokines. The expressions of apoptosis markers can be higher in GILZ-Tg mice. As A could potentiate GC mediated neurotoxicity and the GILZ effect is unknown, to compensate for compounding factors, the response of wild type neuronal cells exposed to high CORT will be analyzed.
Example 23
Investigation of the Role of GILZ in AD
[0271] Evidence suggests that the inflammation aggravates neurotoxicity and accelerates neurodegeneration in AD. NF-B is a critical transcription factor that regulates inflammatory responses, A generation and tau deposition. Mechanistically, GILZ exerts anti-inflammatory and anti-proliferative effects by sequestering activated p65, the functionally critical subunit of NF-B.
[0272] Overexpression of GILZ can Suppress Neuroinflammation and Prevent Neurodegeneration:
[0273] Selection of AD model: To address whether GILZ is mechanistically involved in the pathogenesis of AD, 5FAD mice that overexpress GILZ in the nervous tissue can be generated. The 5FAD is a rapid onset mouse model of AD that bears 5 mutations linked to AD and recapitulates main features of AD. In this model, A deposition and inflammation are observed as early as 6 weeks.
[0274] Animals: Breeding colonies of 5FAD can be maintained in transgenic animal housing conditions in a 12-hour dark light cycle with access to food and water. Non-transgenic wild type littermates can serve as controls. Hemizygous 5FAD mice can be crossbred to the conditional GILZ-Tg mice. Genotyping can be performed by PCR analysis of tail DNA. All experiments can be done blind with respect to the genotype of mice. The following groups of mice can be included: 1) experimental group of GILZ-Tg 5FAD mice; control groups can include 2) 5FAD, 3) wild type C57BL/6, 4) wild type, Thy1-Cre and 5) 5FAD, Thy1-Cre.
[0275] All mice can be assessed for spatial learning and memory by Novel object recognition test and Morris water Maze at 4 weeks of age and then sacrificed for assessing CNS pathology, inflammation, A load, gliosis and neuronal apoptosis by immunohistochemical, biochemical and molecular analyses.
[0276] Suppression of neuroinflammation by a GILZ mimetic prevented decrease in GILZ expression in the hippocampus of 5FAD mice (see
Example 24
Decrease of Cytokines in Spinal Cord and Brain
[0277] Following spinal cord injury (SCI), inflammatory responses occur not only in the spinal cord, but also in the brain, as demonstrated by increased microglial activation (see
[0278] Seven days following thoracic level 10 compression SCI, mice were sacrificed by approved methods and 4 mm spinal cord lesion area and total brain tissue were homogenized in RIPA lysis buffer and inflammatory cytokine levels for IFN- and IL-17 were upregulated at this time point (blue bars). GILZ analog peptide given intraperitoneally on day 6 post-SCI reduced these levels in brain, and partially in the injured cord tissue (right bars) (
Example 25
Mechanisms by which the Immune-Inflammatory Responses Induced Post-SCI Increase the Risk for Neuroinflammation in the Brain
[0279] Preliminary data indicate hippocampus microglial activity is upregulated following SCI, and other reports show that HMGB1 is upregulated in the injured cord following SCI. Thus, elevated HMGB1 protein in acute injured spinal cord tissue homogenate can activate reactivity and induce pro-inflammatory responses in hippocampal and cortical microglia.
[0280] Isolation of microglia from adult mouse brain: Microglia can be isolates from the hippocampus and cortex of 6 adult C57BL/6 mice (5 weeks old). In brief, adult mice can be euthanized via approved methods, and the brains removed, and the fresh hippocampus and cortex tissue quickly dissected and enzymatically digested. The resulting digested tissue can be triturated and washed in Hank's balanced salt solution (HBSS) and centrifuged to form a pellet. The pellet can be resuspended in culture medium (DMEM/F12+10% fetal bovine serum [FBS]+1% penicillin/streptomycin) and washed again. Next the pellet can be centrifuged in a 30-70% Percoll gradient, and the microglia (visible at the 70-37% gradient interphase) will be collected and washed with HBSS. The microglia can be counted and seeded in culture medium for further experimentation.
[0281] Spinal cord injury: 8 week old female C57BL/6 mice can be randomly assigned to four groups to produce a time course of injured spinal cord tissue homogenate to treat isolated and cultured adult mouse brain microglia: 1) sham surgery group (no SCI), 2) 1 d post-SCI, 3) 3d post-SCI, 4) 7d and 28d post-SCI (n=4/group=20 mice). To produce SCI in the mice, surgery and clip compression SCI can be performed. In brief, mice can be anesthetized with isoflurane, and the paraspinal muscles along the T8-T11 vertebrae can be carefully dissected and the T10 vertebra exposed. A laminectomy of the dorsal portion of the T10 vertebrae exposing the spinal cord can be performed, and a 30 g force vascular clip can be placed on the sides of the cord and carefully closed for compression. The cord can remain compressed for 1 minute, which will produce a moderate SCI.
[0282] The clip can then be removed, and the injured cord observed under the surgical microscope for confirmation of proper injury. A band of bruising and hemorrhage of blood in the cord can be visible at the location of clip compression. The muscle can be closed with sterile nylon suture, followed by the skin. The surgical site can be treated with antibacterial ointment and the mice placed in a clean home cage on a warming pad set to 37 C. to recover. The mice quickly recover from isoflurane anesthesia and bilateral paralysis of the hindlimbs can be observed as further confirmation of successful SCI. Mice in the sham surgery group can undergo all steps of the surgery except spinal cord compression.
[0283] Spinal cord isolation and homogenate preparation: Mice can be sacrificed in each group at the designated time points and transcardially perfused with normal saline. A 5 mm region of spinal cord centered over the injury site can be rapidly dissected and minced in RIPA buffer as previously described. Tissue in RIPA buffer can then be homogenized with a dounce homogenizer, the tubes centrifuged to pellet debris, and the supernatant homogenate isolated for treating microglial cultures.
[0284] HMGB1 ELISA: To test the concentration of HMGB1 from the homogenates in our SCI model, protein samples from the sham, 1d, 3d, 7d and 28d groups can be assayed using a sandwich enzyme-linked immunosorbent assay (ELISA) for mouse HMGB1 (LifeSciences Biospan, Inc.), and absorbance read on a plate reader (BioTek, Inc.) and concentrations determined against a standard control curve. Purified recombinant mouse HMGB1 protein (Biolegend, Inc.) can be assayed as a positive control.
[0285] Microglial treatment with spinal cord homogenates: Isolated microglia can be seeded in 12-well culture dishes at a density of 2.510.sup.5 cells/ml in minimal essential medium (MEM) supplemented with 1% fetal bovine serum (FBS) and 1% penicillin (100 U/ml)/streptomycin (100 g/ml) and grown to 80% confluence. HMGB1 is known to increase within hours in the injured spinal cord. To test the effects of SCI homogenates on microglial activation and response, the experiment as described in Table 3 will be performed.
TABLE-US-00008 TABLE 3 Experimental Design SC Homogenates (days post-SCI) Hippocampal and cortical Sham 1 3 7 28 microglial isolation Number of mice 4 4 4 4 4 6 Microglial Treatment Groups Normal culture medium only 1 g/ml lipopolysaccharide (LPS) 1% SC homogenate 10% SC homogenate 20% SC homogenate 3 M HMGB1 w/o neutralizing antibody 3 M HMGB1 w/neutralizing antibody SC = Spinal Cord
[0286] Three concentrations of homogenates in culture medium (1%, 10% and 20% vol/vol) can be applied to microglial cells and incubated at 37 C. and 5% CO.sub.2 for 12 h or 24 h The concentrations are extrapolated from previous studies suggesting that 0.3 M of HMBG1 inhibiting A phagocytosis by microglia. Normal culture medium only can serve as a negative control and 1 g/ml lipopolysaccharide (LPS), a known stimulator of microglial activity, in normal culture medium will serve as a positive control. Cultures treated with known concentrations of HMBG-1 (1-3 M) in the presence or absence of monoclonal antibody against HMBG1 can be included as a means of confirmation of the role of HMBG1 in SCI homogenate.
[0287] Assessment of Microglial Responses:
[0288] Immunocytochemistry: Twelve hours after culture, microglia can be gently rinsed with PBS, and fixed with 4% paraformaldehyde. Cells can then be immunostained for TLR-4, the chemokine ligand CCL12, the costimulatory receptors CD80 and CD86 and nuclear NF-B p65. Furthermore, cells can be incubated with Hoechst 33342 to visualize microglial nuclei. Labeled fluorescence can be detected using a laser scanning confocal microscope LSM 510 (Carl Zeiss, Jena, Germany).
[0289] ELISA for cytokines: The concentrations of inflammatory cytokines IL-6 and TNF- in culture supernatants harvested at the end of 12 h, 24 h and 48 h can be assessed using appropriate OptEIA kits (BD Biosciences).
[0290] Quantitative RT-PCR (qRT-PCR): Total RNA isolated from cultured microglia can be reverse transcribed and qRT-PCR will be performed in ABI 7000 system using the Superscript III Platinum SYBR Green One-Step qRT-PCR kit (Invitrogen), as described.
TABLE-US-00009 Primers:TLR4: (FP5-GCTTTCACCTCTGCCTTCAC-3(SEQIDNO:53); RP5-GAAACTGCCATGTTTGAGCA-3(SEQIDNO:54), IL-6: (FP5-AGTTGCCTTCTTGGGACTGA-3(SEQIDNO:55); RP5-TCCACGATTTCCCAGAGAAC-3(SEQIDNO:56), and RPS3: (FP5AATGAACCGAAGCACACCATA-3(SEQIDNO:57); RP5-ATCAGAGAGTTGACCGCAGTT-3)(SEQIDNO:58).
[0291] Product specificity can be confirmed by melting curve analysis and visualization of single, appropriately sized band on a 2% agarose gel. Gene expression levels can be quantified using a cDNA standard curve and data were normalized to RPS3, a housekeeping gene that was unaffected by traumatic injury. Ability of HMGB1 primed microglia to respond to A.sub.1-42 peptide:
[0292] Cultures of microglia exposed to spinal cord homogenates for 24 h as above, can be rested in serum free media for 24 h. The cells can then be washed in fresh culture medium and exposed to A.sub.1-42 at a final concentration of 10 M/well and incubated for 4 h or 48 h. Cells and conditioned media will be harvested and stored for further analysis. Relative ATP concentration can be measured using the CTG kit (Promega) as described. Conditioned media collected can be assessed for specific cytokines using the OptEIA kits (BD Biosciences). The cell surface expression of activation markers including MHC Class II, CD80 and CD 86 can be assessed by immunocytochemistry and flow cytometry.
[0293] The concentration of HMBG1 in the spinal cord homogenates has been shown to be elevated within few hours after acute-SCI in both humans and animal models. Furthermore, the level remains high for extended periods in chronic SCI. The hippocampal microglia have been shown to express elevated CCL12 in mice day 12 post-SCI. HMBG1 has been shown to activate microglia via TLR-4/NF-B pathway. Hence, the TLR-4, CCL12 and nuclear p65 can be elevated in microglia exposed to spinal cord homogenates obtained day 3-14 post-SCI. Previously, HMGB1 exposure has been shown to prime hippocampal microglial response to LPS. Since A reactive T cells have been shown to increase with aging, increase can be due to microglia function as efficient A presenting cells. The SCI homogenate primed hippocampal and cortical microglia can exhibit activated phenotype.
Example 26
Investigation of Suppression of Activated NF-B Mediated Inflammation Following SCI as a Measure to Prevent Hippocampal Microglial Activation
[0294] The NF-B pathway is important for the regulation of inflammation and apoptosis following SCI. The clinical benefits of the commonly prescribed high-dose methylprednisolone steroid in the management of SCI, is compromised by adverse effects. Glucocorticoid induced leucine zipper (GILZ) is a recently identified protein that mimics only the beneficial effects of steroids and act by inhibiting the NF-B p65 protein. GILZ overexpression has been shown to suppress tissue damage in SCI. The suppression of NF-B p65 can inhibit gliosis at the injury site in SCI and prevent activation of hippocampal microgliosis.
[0295] This Example evaluates the efficacy of peptide analogs of GILZ (GA) in inhibiting microgliosis at injury sites and in the hippocampus of mice subjected to SCI (see Table 4). Adult C57BL/6 mice (Jackson Laboratory, Bar Harbor, Me.) can be administered lipopolysaccharide (LPS) (Sigma Aldrich, Mo.) intraperitoneally at 250 mg/kg for 6 days. Serial 5 thick coronal sections of brain from nave and LPS treated mice can be immunostained for GILZ using TSC22D3 mAb (Catalog #: H00001831, Abnova, Walnut, Calif.). The peroxidase conjugated streptavidin biotin method can be used for detection and brown staining was considered positive. Staining specificity was confirmed by incubation with secondary antibody alone. RNA isolated from brain homogenates was reverse transcribed.
TABLE-US-00010 TABLE 4 Experimental Design Biochemical Analysis Histologic Analysis n = 6/group = 36 mice n = 6/group = 36 mice Groups Analyses: Cytokine Analyses: Brain and spinal Shamsurgery ELISA cord microglial stereologic 7 d SCI + saline quantification and 7 d SCI + GA1 immunofluorescence 7 d SCI + GA2 labeling 7 d SCI + control peptide 7 d SCI + TAT carrier GA = GILZ analog, SCI = spinal cord injury
[0296] Spinal cord injury and treatment: SCI surgery can be performed as described previously. To test the effect of GA peptides on CNS microgliosis post-SCI, C57BL/6 mice can be randomly assigned to six groups: 1) sham surgery, 2) SCI+saline, 3) SCI+GA peptide 1, 4) SCI+GA peptide 2, 5) SCI+non-specific peptide (control) and 6) SCI+carrier tag (GAG-TAT) injection (control) (n=12 per group [6 for biochemistry, 6 for histologic analysis]6 groups=72 mice).
[0297] GA preparation and administration: GA can be synthesized as peptide amides with amino terminal acetylation. The GA can be covalently synthesized with a cell penetrating peptide for intracellular delivery. Based on our studies in the AD model, GA1 (19 mM) and GA 2 (22 mM) can be administered intraperitoneally on days 1 and 7 post SCI. Brain tissues harvested at each time-point and end of the study can be evaluated for inflammation and neuronal loss/protection. Control groups can include untreated SCI and scrambled peptide treated mice.
[0298] Protein preparation for biochemical analysis: After 7 days post-surgery, 6 mice per group designated for biochemical analysis of NF-B-mediated inflammation can be transcardially perfused with saline and brain and spinal cord tissue isolated and prepared as described previously. In brief, the brain can be dissected and the cortex and hippocampus removed and placed in RIPA lysis buffer, and homogenized with a dounce homogenizer. The lysed tissue can be centrifuged and the supernatant collected. The protein concentration of the supernatant can be determined with bichincionic acid assay (BCA, Pierce).
[0299] ELISA for cytokine expression analysis: Spinal cord and brain homogenates can be assessed for cytokines (TNF-, IL-12, IFN-g) and HMBG1 as described above.
[0300] Histologic assessment of brain and spinal cord microgliosis: The remaining 6 mice can be euthanized on day 7 post-surgery, transcardially perfused with saline followed by perfusion with 4% paraformaldehyde (PFA) for fixation and histological assessment of microglial activation in the brain and spinal cord as described previously. Briefly, perfused brain and spinal cord tissue can be dissected and post-fixed in 4% PFA for 24 hours. Then, the tissue can be placed in a 30% sucrose in 0.1 M phosphate buffered saline (PBS) for cryopreservation, and then embedded in Optimal Cutting Temperature medium for subsequent cryostat sectioning. Tissue can be serially sectioned at 20 um and mounted on Superfrost Plus slides (Fisher Scientific). Immunofluorescence labeling will be performed as previously described. Briefly, brain and spinal cord sections can be immunolabeled for microglia with rabbit anti-Iba1 (1:500; Wako) overnight at 4 C., and the following day, the sections will be incubated with fluorophore-conjugated goat anti-rabbit secondary antibody (1:200; Jackson ImmunoResearch Lab). Sections will then be incubated with Hoechst 33342 (1:500, Sigma-Aldrich) in PBS for nuclear labeling, washed and coverslip mounted with Fluoromount G. In adjacent slides in the series, immunohistochemistry for Iba1 (1:500; Abcam, Inc.) can also be performed for unbiased stereologic quantification of reactive microglia using a Stereolnvestigator system (Microbrightfield, Inc.) as previously described. Pre-immune serum can be used as a control to confirm antibody specificity. Images can be obtained with an epifluorescent microscope (Nikon) and microglial reactivity can be assessed as a percentage of fluorescent labeling area per unit tissue area.
[0301] Expected results: We have shown that both GA1 and GA2 suppressed gliosis and proinflammatory cytokines in the brain homogenates of mice subjected to lipopolysaccharide induced neuroinflammation. Treatment with GA1 or GA2 can suppress inflammation at site of injury and this will be reflected in a decrease in the number of microglia in the hippocampus.