Anti-BARF1 monoclonal antibody
10933133 ยท 2021-03-02
Assignee
Inventors
- Antonio Rosato (Campodarsego, IT)
- Riccardo Turrini (Albignasego, IT)
- Riccardo Dolcetti (Cordenons, IT)
- Debora Martorelli (Maniago, IT)
- Damiana Antonia Fae (Treviso, IT)
Cpc classification
A61K39/395
HUMAN NECESSITIES
G01N33/57484
PHYSICS
C12N2710/16222
CHEMISTRY; METALLURGY
G01N33/56994
PHYSICS
C12N15/63
CHEMISTRY; METALLURGY
C07K2317/732
CHEMISTRY; METALLURGY
C07K2317/73
CHEMISTRY; METALLURGY
C07K16/085
CHEMISTRY; METALLURGY
C12N2710/16234
CHEMISTRY; METALLURGY
International classification
C07K16/00
CHEMISTRY; METALLURGY
A61K39/395
HUMAN NECESSITIES
C12N15/63
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
Abstract
The present invention relates to a new anti-BARF1 monoclonal antibody.
Claims
1. A monoclonal antibody directed against BamH1-A rightward frame-1 (BARF1) comprising at least one heavy chain variable domain and at least one light chain variable domain, the at least one heavy chain variable domain VH comprising the CDR1, CDR2, CDR3 sequences encoded respectively by SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5, and the at least one light chain variable domain comprising the CDR1, CDR2, CDR3 sequences encoded respectively by SEQ ID NO:6, SEQ ID NO: 26 and SEQ ID NO:7.
2. The monoclonal antibody according to claim 1, wherein the at least one heavy chain variable domain comprises the amino acid sequence encoded by SEQ ID NO: 1 and the at least one light chain variable domain comprises the amino acid sequence encoded by SEQ ID NO: 2.
3. The monoclonal antibody according to claim 1, wherein the antibody comprises whole immunoglobulins or immunoglobulin fragments comprising at least one heavy chain variable domain and at least one light chain variable domain.
4. The monoclonal antibody according to claim 3, wherein the antibody comprises Fab fragments, F(ab)2 fragments, or single chain Fv fragments (scFv).
5. The monoclonal antibody according to claim 1, wherein the antibody is murine or humanized.
6. A pharmaceutical preparation comprising the antibody according to claim 1, and a pharmaceutically acceptable excipient.
7. A method for the treatment of a tumor comprising administering to a subject in need thereof a pharmacologically effective amount of the antibody according to claim 1, wherein said tumor expresses BARF1.
8. The method according to claim 7, wherein said tumor is an Epstein-Barr virus-related tumor.
9. The method according to claim 7, wherein said tumor is nasopharyngeal carcinoma (NPC), Hodgkin's lymphoma (HL), Burkitt's lymphoma, non-Hodgkin EBV+ lymphomas, post-transplant EBV+ lymphoproliferations, T-cell and NK-cell neoplasias, or gastric carcinoma (GC).
10. A method for the treatment of a tumor comprising administering to a subject in need thereof a pharmacologically effective amount of the antibody according to claim 1, wherein said tumor is nasopharyngeal carcinoma (NPC), Hodgkin's lymphoma (HL), Burkitt's lymphoma, non-Hodgkin EBV+ lymphomas, post-transplant EBV+ lymphoproliferations, T-cell and NK-cell neoplasias, or gastric carcinoma (GC) and wherein said tumor expresses BARF1.
11. A method for the treatment of a tumor comprising administering to a subject in need thereof a pharmacologically effective amount of the pharmaceutical preparation according to claim 6, wherein said tumor expresses BARF1.
12. A method for the treatment of a tumor comprising administering to a subject in need thereof a pharmacologically effective amount of the pharmaceutical preparation according to claim 6, wherein said tumor is nasopharyngeal carcinoma (NPC), Hodgkin's lymphoma (HL), Burkitt's lymphoma, non-Hodgkin EBV+ lymphomas, post-transplant EBV+ lymphoproliferations, T-cell and NK-cell neoplasias, and gastric carcinoma (GC), and wherein said tumor expresses BARF1.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
DETAILED DESCRIPTION OF THE INVENTION
(6) The following sequences were identified:
(7) VH Hybridoma 3D4
(8) TABLE-US-00001 SEQIDNO:1: CACCATGGGCAGGCTTACATCCTCATTCCTGCTGCTGATTGTCCCTGCAT ATGTCCTTTCCCAGGTTACTCTGAAAGAGTCTGGCCCTGGGATATTGCAG CCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAG CACTTCTGGTATGGGTGTGAGCTGGATTCGTCAGCCTTCAGGAAAGGGTC TGGAGTGGCTGGCACACATTTACTGGGATGATGACAAGCGCTATAACCCA TCCCTGAAGAGCCGGCTCACAATCTCCAAGGATACCTCCAGAAACCAGGT ATTCCTCAAGATCACCAGTGTGGACACTGCAGATACTGCCACATACTACT GTGCTCGAAGAGATGGGACACGGGGGTTTGACTACTGGGGCCAAGGCACC ACTCTCACAGTCTCCTCAGCCAAAACAACAGCCCCATCGGTCTATCCACT GGCCCCTGTGTGTGGAGATACAACTGGCTCCTCGGTGACTCTAGGATGCC TGGTCAAG
wherein
(9) TABLE-US-00002 CACCATGGGCAGGCTTACATCCTCAT FR1 SEQIDNO:16 TCCTGCTGCTGATTGTCCCTGCATAT GTCCTTTCCCAGGTTACTCTGAAAGA GTCTGGCCCTGGGATATTGCAGCCCT CCCAGACCCTCAGTCTGACTTGTTCT TTCTCT GGGTTTTCACTGAGCACTTCTGGTAT CDR1 SEQIDNO:3 GGGT GTGAGCTGGATTCGTCAGCCTTCAGG FR2 SEQIDNO:17 AAAGGGTCTGGAGTGGCTGGCACAC ATTTACTGGGATGATGACAAG CDR2 SEQIDNO:4 CGCTATAACCCATCCCTGAAGAGCCG FR3 SEQIDNO:18 GCTCACAATCTCCAAGGATACCTCCA GAAACCAGGTATTCCTCAAGATCACC AGTGTGGACACTGCAGATACTGCCAC ATACTACTGT GCTCGAAGAGATGGGACACGGGGGTT CDR3 SEQIDNO:5 TGACTAC TGGGGCCAAGGCACCACTCTCACAGT FR4 SEQIDNO:19 CTC CTCAGCCAAAACAACAGCCCCATCGG CH1 SEQIDNO:20 TCTATCCACTGGCCCCTGTGTGTGGA GATACAACTGGCTCCTCGGTGACTCT AGGATGCCTGGTCAAG
VK Hybridoma 3D4
(10) TABLE-US-00003 SEQIDNO:2: VKhybridoma3D4 CACCATGGATTTTCAGGTGCAGATTTTCAGCTTCCTGCTAATCAGTGCCT CAGTCATAATGTCCAGAGGACAAATTGTTCTCACCCAGTCTCCAGCAATC ATGTCTGCATCTCTAGGGGAACGGGTCACCATGACCTGCACTGCCACCTC AAGTGTAAGTTCCAGTTACTTGCACTGGTACCAGCAGAAGCCAGGATCCT CCCCCAAACTCTGGATTTATAGCACATCCAACCTGGCTTCTGGAGTCCCA GCTCGCTTCAGTGGCAGTGGGTCTGGGACCTCTTACTCTCTCACAATCAG CAGCATGGAGGCTGAAGATGCTGCCACTTATTACTGCCACCAGTATCATC GTTCCCCACCGTGGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAACGG GCTGATGCTGCACCAACTGTATCCATCTCCCCCCATCCAGTGTA
wherein:
(11) TABLE-US-00004 CACCATGGATTTTCAGGTGCAGATTT FR1 SEQIDNO:21 TCAGCTTCCTGCTAATCAGTGCCTCA GTCATAATGTCCAGAGGACAAATTGT TCTCACCCAGTCTCCAGCAATCATGT CTGCATCTCTAGGGGAACGGGTCACC ATGACCTGCACTGCCACC TCAAGTGTAAGTTCCAGTTAC CDR1 SEQIDNO:6 TTGCACTGGTACCAGCAGAAGCCAGG FR2 SEQIDNO:22 ATCCTCCCCCAAACTCTGGATTTAT AGCACATCC CDR2 SEQIDNO:26 AACCTGGCTTCTGGAGTCCCAGCTCG FR3 SEQIDNO:23 CTTCAGTGGCAGTGGGTCTGGGACCT CTTACTCTCTCACAATCAGCAGCATG GAGGCTGAAGATGCTGCCACTTATTA CTGC CACCAGTATCATCGTTCCCCACCGTG CDR3 SEQIDNO:7 GACG TTCGGTGGAGGCACCAAGCTGGAAAT FR4 SEQIDNO:24 CAAA CGGGCTGATGCTGCACCAACTGTATC CL SEQIDNO:25 CATCTCCCCCCATCCAGTGTA
Materials and Methods
Cell Lines:
(12) The following human cell lines were used: GRANTA-519 (mantle B-cell lymphoma, EBV+, BARF1+), C-666 (NPC, EBV+, BARF1+), BL-41 (Burkitt's lymphoma, EBV), BL-41 B95.8 (the same cell line infected with EBV), Raji (lymphoblastic-like cell line B, EBV+, but BARF1), and MKN-45 (gastric carcinoma, EBV).
(13) B95.8 is a monkey cell line used for the generation of EBV virions. All cell lines, except for MKN-45, were cultured in RPMI 1640 medium (Euroclone), supplemented with 10% heat-inactivated fetal calf serum (FBS, Gibco), 10 mM Hepes, 1 mM Na pyruvate, 2 mM Ultraglutamine (all from Lonza BioWhittaker), and 1% antibiotic/antifungal (Gibco), hereinafter referred to as complete RPMI medium.
(14) MKN-45 was grown in DMEM supplemented with the same additives, referred to as complete DMEM medium.
(15) The NS0 cell line is a mouse myeloma line used for the generation of hybridomas. NS0 cells are cultured in DMEM supplemented with 10% heat-inactivated FBS, 10 mM Hepes, 510.sup.3 mM -mercaptoethanol, 2 mM Ultraglutamine, 1% antibiotic/antifungal.
(16) Antibody Production
(17) The BARF1 sequence was analyzed using bioinformatics tools.
(18) Three major epitopes were identified:
(19) TABLE-US-00005 05/08.sub.201-221 CVGKNDKEEAHGVYVSGYLSQ SEQIDNO:8 06/08.sub.104-120 CRMKLGETEVTKQEHLS SEQIDNO:9 08/08.sub.27-40 ERVTLTSYWRRVSL SEQIDNO:10 08/08.sub.28-38 RVTLTSYWRRV SEQIDNO:14
(20) The peptides were conjugated to KLH (Keyhole Limpet Hemocyanin) using the Imject Maleimide Activated mcKLH kit (Thermo Scientific) and used for the vaccination of mice.
(21) The anti-BARF1 hybridoma was derived from the fusion of murine NS0 myeloma cells with spleen cells of a BALB/c mouse which had been immunized once subcutaneously with 100 g of each of the KLH-conjugated peptides in Complete Freund's Adjuvant (CFA) and then twice with 100 g of each of the KLH-conjugated peptides in Incomplete Freund's Adjuvant (IFA).
(22) When necessary, additional vaccinations were carried out in IFA.
(23) Spleen cells from immunized mice were collected and fused with NS0 myeloma cells using polyethylene glycol (PEG) according to standard procedures.
(24) After fusion, cells were seeded in 96-well plates and hybridomas were selected in a medium containing hypoxanthine-aminopterin-thymidine (HAT).
(25) Hybridoma lines capable of growing in the selection medium were screened for anti-BARF1 reactivity by enzyme immunoassay (ELISA) and flow cytometry.
(26) The ELISA test was performed as follows: 96-well plates were incubated overnight at 4 C. with 100 L/well of the specific peptide (10 g/mL); after blocking with 1% BSA for 2 hours at 37 C., they were incubated for 1 hour at 37 C. with 100 L of hybridoma supernatant and, after repeated washing, for 1 hour with HRP-conjugated anti-mouse goat antibody (GE Healthcare).
(27) After signal development using OPD (Sigma-Aldrich), the reaction was quenched with 50 L of 3 N hydrochloric acid and the absorbance was read at 450 nm with a Victor Multilabel X3 plate reader (Perkin Elmer). For flow cytometry, GRANTA-519 cells were labeled with the clone supernatant, then a secondary FITC anti-mouse antibody was added (Dako) and the cells were analyzed using FACSCalibur (BD).
(28) Only the clones that gave a positive signal as evaluated by flow cytometry were used for the subsequent experiments.
(29) Antibody specificity was evaluated by Dot Blot.
(30) Briefly, 8-mer peptides overlapping of 4-amino acids derived from the original peptides 08/08.sub.27-40 and 08/08.sub.28-38, were synthesized: in fact, the mAb used for all experiments is derived from a mouse immunized with this latter peptide.
(31) The 8-mer overlapping peptides and the original 08/08.sub.27-40, 08/08.sub.28-38, 05/08.sub.201-221 and 06/08.sub.104-120 peptides were transferred on a PVDF membrane (about 10 g/spot, Millipore).
(32) After blocking with PBS/10% Tween/3% BSA, plates were incubated with anti-BARF1 mAb, then with an HRP-conjugated anti-mouse goat Ig, and finally the signal was detected using the ECL Plus Western Blotting Substrate (Pierce).
(33) Chemiluminescence was evaluated using the XRS Chemidoc instrument and QuantityOne software (vers. 4.6) (both from BioRad).
(34) In Vitro Assays
(35) Labels
(36) EBV-negative (BL-41), EBV-positive but BARF1-negative (Raji) and EBV-positive and BARF1-positive (GRANTA-519, C-666 and BL-41 B95.8) cell lines were labeled with 1 g of anti-BARF1 mAb for 15 minutes on ice and then with a secondary anti-mouse FITC IgG.
(37) In order to specifically identify BARF1, a BARF1-transduced cell line was generated.
(38) The BARF1 plasmid was kindly provided by the laboratory of Dottor Dolcetti and used to transfect Phoenix cells as described above.
(39) BARF1-retroviral (BARF1-RV) particles were stored at 80 C.
(40) An EBV-negative cell line, MKN-45, was plated (410.sup.6) with 2 mL BARF1-RV in a 6-well plate in the presence of polybrene (8 mg/mL).
(41) After centrifugation (45 min. at 1800 rpm), the cells were incubated at 32 C. for 2 hours, and the medium was replaced with 2 mL of fresh medium containing BARF1-RV and polybrene.
(42) After further centrifugation, the MKN-45 cells were incubated at 32 C. for 4 hours, then the medium was replaced with fresh complete DMEM medium and left overnight at 37 C.
(43) The next day, complete DMEM medium was replaced with 4 ml of BARF1-RV with polybrene and centrifuged; after incubation at 32 C. for 5 hours, the medium containing the viral particles was replaced with complete DMEM and incubated at 37 C.
(44) The selection with G418 (250 g/mL, Sigma-Aldrich) started the next day.
(45) After one week in culture in the presence of G418, BARF1-transduced cells and wild-type cells were analyzed for the presence of BARF1 mRNA by RT-PCR.
(46) The cells were also analyzed by flow cytometry using an anti-BARF1 antibody.
(47) Complement-Dependent Cytotoxicity (CDC)
(48) Target cells (610.sup.5 GRANTA-519 cells, C-666, and Raji) were loaded with 100 Ci Na.sub.2.sup.51CrO.sub.4 (Perkin-Elmer) for 1 hour and 30 minutes at 37 C.
(49) The cells were then seeded at 210.sup.3 cells/well in triplicate and labeled with about 1 g anti-BARF1 mAb.
(50) Then, cells were resuspended in 200 L of RPMI containing 25% human serum (non-heat inactivated, thereby keeping all the proteins of the complement still active; Lonza), for 1 hour at 37 C.
(51) Negative (or spontaneous release) controls were not labeled with the mAb, while 100 L of 5% Triton (Sigma-Aldrich) were added for the positive control (maximum release).
(52) After incubation, 100 L of supernatant were evaluated for radioactivity using a -ray counter (Cobra Gamma Counting System, Packard Instrument Company).
(53) The cytotoxicity index was evaluated as follows:
(54)
where:
% test is the percentage of cytotoxicity obtained with mAb plus complement,
% spont is the percentage of cytotoxicity of the complement alone.
Antibody-Dependent Cell-Mediated Cytotoxicity (ADCC)
(55) ADCC was performed using the calcein-AM protocol (Invitrogen).
(56) In brief, 110.sup.6 target cells were resuspended in 1 mL of Hank's balanced salt solution supplemented with 5% FBS (HBSS-FBS, 5.4 mM KCl, 0.3 mM Na.sub.2HPO.sub.4, 0.4 mM KH.sub.2PO.sub.4, 0.2 mM NaHCO.sub.3, 0.5 mM MgCl.sub.2, 0.4 mM MgSO.sub.4, 137 mM NaCl, all from Sigma-Aldrich) and labeled with 7.5 L calcein-AM 1 mg/mL for 30 minutes at 37 C.
(57) Cells were then labeled with anti-BARF1 mAb at a concentration of 20 g/mL, 10 g/mL and 5 g/mL; negative controls were carried out with HBSS-FBS only.
(58) As positive control, target cells were lysed with 5% Triton.
(59) After seeding, cells were added to effector cells: PBMCs just thawed from healthy donors were seeded at different effector:target ratios (300:1, 150:1 and 75:1) for 4 hours at 37 C., then 100 L of supernatant were collected and seeded on an opaque 96-well plate (Nunc).
(60) After 15 minutes at RT, the plate was read at 485 nm using the Victor X3 Multilabel Reader Plate instrument.
(61) The percentage of lysis (% Lys) was calculated as follows:
(62)
where:
test is the experimental value,
spont is the value of target cells not treated, and
max is the positive control value.
In Vivo Assays
Biodistribution
(63) In order to study the biodistribution of antibodies, the monoclonal anti-BARF1 was conjugated with Alexa 680, using the SAIVI Rapid Antibody Labeling Kit (Invitrogen) and following the manufacturer's directions.
(64) SCID mice were injected subcutaneously with an EBV-negative cell line (such as MKN-45) on one side and with an EBV-positive cell line (such as BARF1-MKN-45, C-666 or SNU-719) on the other side.
(65) As soon as both tumors became palpable, 100 g of Alexa-680 anti-BARF1 antibody were injected into the caudal vein of the anesthetized animal and the fluorescence signal was analyzed every 24 hours by using the eXplore Optix device (GE Healthcare).
(66) The fluorescence intensity detected on the tumor masses was compared and the trend analyzed with the ANOVA statistical test for repeated measurements.
(67) Therapy
(68) Mice were kept in plastic cages at a constant temperature and with a balanced diet in an SPF (Specific Pathogen Free) animal house.
(69) Procedures involving animals and their care were conducted in accordance with institutional guidelines in compliance with national laws (Legislative Decree No. 116/92) and Ceasa (University of Padua, Ethics Committee for animal experimentation).
(70) All in vivo tumor growth experiments were conducted in accordance with the guidelines of the United Kingdom Co-ordinating Committee on Cancer Research (UKCCCR) (Cancer Metastasis 1989 UKCCCR guidelines for the welfare of animals in experimental neoplasia).
(71) SCID and RAG.sup./-chain.sup./ mice aged six to eight weeks were injected s.c. with 510.sup.6 GRANTA-519 or C-666 cells.
(72) Mice were then divided into untreated and treated groups, respectively, receiving 1 mL of PBS or 1 mg of monoclonal anti-BARF1 (5 i.p. injections of 0.2 mL each, one every two days).
(73) Tumor mass growth was evaluated every two days by measuring the maximum and minimum diameter, and was calculated by applying the formula:
(74)
where d is the minimum diameter and D is the maximum diameter.
(75) In order to better evaluate the tumor growth kinetics, an in vivo imaging approach based on luciferase was used.
(76) For this purpose, tumor cell lines were transduced with the luciferase enzyme.
(77) Briefly, luciferase-encoding lentiviral particles (LUX-LV) were produced in 293T cells by transient cotransfection of the vector (pHRtripCMV-luc2-IRES-tNGFR-SIN), the envelope plasmid (HCMV-G) and the packaging plasmid (p8.74), following a protocol already published.
(78) The virus was harvested 48 and 72 hours after transfection and concentrated by ultracentrifugation.
(79) 510.sup.5 GRANTA-519 and C-666 cells were harvested and resuspended in 1 mL of complete RPMI medium with concentrated (3- to 5-fold) LV-LUX.
(80) Cells were incubated overnight at 37 C. in the presence of the virus, then the supernatant containing virions was discarded and fresh medium was added.
(81) Seventy-two hours after infection, 210.sup.5 cells were harvested, resuspended in 50 L PBS and plated in an opaque 96-well plate (Nunc).
(82) Then, 50 L of D-Luciferin (0.3 mg/mL, Caliper) were added to the cells for 5 minutes, and the plate was analyzed using IVIS Lumina II.
(83) GRANTA-519 and C-666 luciferase-transduced cells were injected s.c. in SCID mice (510.sup.6/200 L RPMI/mouse) on day 0.
(84) On day 7, the injected mice were randomly divided into two groups, one of which was treated with 0.3 mg/mouse of anti-BARF1 mAb weekly.
(85) Animals were anesthetized i.p. (1-3% isoflurane, Merial Italia SpA) and injected with 150 mg/kg of D-Luciferin in PBS. Eight minutes after injection of luciferin, mice were analyzed for photon emission using IVIS Lumina II.
(86) The same analysis was performed weekly and the average brightness of photons (expressed as p/sec/cm.sup.2/sr) was evaluated.
(87) In a different experiment, SCID mice were injected i.v. with 310.sup.6 GRANTA-519 and C-666 luciferase-transduced cells.
(88) Then, part of the mice was treated with 0.3 mg/mouse of anti-BARF1 mAb from day 7 and weekly thereafter.
(89) All mice were analyzed weekly using IVIS Lumina II.
(90) At the end of each acquisition, a photographic image was obtained.
(91) The pseudocolor bioluminescence images are shown superimposed on grayscale mice images, with the strongest luciferase signal detected shown in red and the weaker signal shown in blue.
(92) Statistical Analyses
(93) For both tumor growth and bioluminescence analyses, statistical analyses were performed using the MedCalc software, version 9.4.2.0, applying each time the most appropriate tests.
(94) Survival diagrams and survival data analysis (using the Kaplan-Meier test) were carried out with the same statistical software.
(95) Results
(96) Antibody Production
(97) Conventional BALB/c mice were immunized according to a routine program with KLH-conjugated peptides (05/08, 06/08 and 08/08 of SEQ ID NO:14;
(98) All peptides gave high absorbance values even at very high dilution after immunization, thus demonstrating the immunogenicity of KLH-conjugated peptides.
(99) On the other hand, since BARF1 is expressed on the surface of infected cells, we labeled the GRANTA-519 cell line, a human EBV+ mantle B-cell lymphoma cell line expressing BARF1 mRNA, with sera of mice and the analysis was conducted by flow cytometry.
(100) After a first series of 3 vaccinations, GRANTA-519 cells were negative, which required additional vaccinations of mice before an appropriate signal was detected.
(101) It is interesting to note that the immunoglobulin titers, as evaluated by ELISA test, remained almost at the same levels, indicating that the antibodies are already present in high titer in mice after a normal immunization program, but only after repeated vaccinations, some antibody became able to recognize epitopes naturally shaped and physiologically presented on the cell surface.
(102) After the generation of hybridomas and the selection performed by ELISA and flow cytometry, only one clone (3D4, derived from a mouse immunized with peptide 08/08 of SEQ ID NO:14) was selected for subsequent analysis.
(103) Isotype characterization revealed that the 3D4 antibody belongs to IgG2a immunoglobulins.
(104) As a first BARF1 recognition test, the antibody was tested by dot blot assay: peptides used for immunization and peptides derived from peptide 08/08 of SEQ ID NO:14 and overlapping of 4-amino acids, were anchored to a PVDF membrane to identify and confirm the epitope recognized by the anti-BARF1 3D4 antibody.
(105) Dot blot analysis revealed that the 3D4 mAb does not recognize non-linked peptides (05/08 and 06/08), while peptide 08/08 is labeled positively.
(106) Moreover, additional peptides were created from peptides 08/08 of SEQ ID NO:10 and 08/08 of SEQ ID NO:14, ranging from AA 1 to 8 (08/08-1) of 08/08, 6-13 (08/08-2) of 08/08 and 5-11 (08/08-2) of 08/08:
(107) TABLE-US-00006 08/08-1 RVTLTSYW SEQIDNO:11 08/08-2 TSYWRRVS SEQIDNO:12 08/08-2 TSYWRRV SEQIDNO:15
(108) Only peptide 08/08-1 was recognized by the anti-BARF1 3D4 antibody, thus indicating that the recognized epitope resides in the sequence thereof (
(109) BLAST analysis revealed that the sequence of the epitope is specific for the BARF1 protein and for the human colony stimulating factor 1 (hCSF-1), which has already been described as sharing high homology with the BARF1 protein.
(110) In Vitro Assays
(111) Staining by Immunofluorescence
(112) The anti-BARF1 3D4 antibody was used to label tumor cell lines belonging to different histological types and with or without the presence of EBV infection.
(113) Although with different staining capacity, the 3D4 clone showed the ability to stain BARF1-positive cells, while EBV-negative and BARF1-negative cells remained negative (
(114) The differences of staining intensity observed among positive cells can be most probably attributed to the differential expression of BARF1: in fact, little information about the expression of BARF1 on the cell surface is available, so we can expect a differential protein expression on different cell lines or on the same cell line but at different culture stages (in fresh medium or in an acidified medium).
(115) Moreover, cleavage of the extracellular domain of BARF1 has been described, although the percentage of cleavage is still to be clarified.
(116) In order to define the specificity of the antibody for its target more precisely, we generated a BARF1-expressing cellular model: labeling of the BARF1-transduced cell line MKN-45 with anti-BARF1 3D4 mAb revealed a high positivity, compared to the BARF1-negative parental cell line (
(117) CDC and ADCC
(118) Complement-mediated lysis (CDC) was evaluated in a standard chromium release assay. Also in this test, we used both EBV-positive and EBV-negative cell lines as target cells.
(119)
(120) EBV-positive cell lines (GRANTA-519, C-666 and BL-41 B95.8) were lysed when exposed to the complement, while the lysis of the BL-41 cell line (EBV-negative cell line) was almost comparable to the background signal.
(121) As described for the flow cytometric analysis, we observed different lysis percentages for the different target cell lines which, again, may be attributable to the differential BARF1 expression on the cell surface (
(122) Antibody-Dependent Cell-mediated Cytotoxicity (ADCC) assays were run using the Calcein AM protocol.
(123) EBV-positive cells (GRANTA-519, C-666) and EBV-negative cells (BL-41) were also used for this test, while PBMC from the Buffy Coat of healthy donors were used as effector cells (
(124)
(125) The highest BARF1-positive cell lysis was obtained with 20 g/mL of clone 3D4 at an effector:target ratio of 300:1.
(126) The NK population (CD56 and CD16 positive) was evaluated in PBMCs: the percentage of NK cells was quantified between 12% and 15% of the total population.
(127) In Vivo Assays
(128) Biodistribution
(129) For the biodistribution analysis, the fluorescence signal of Alexa-680-conjugated anti-BARF1 antibody was analyzed in EBV-positive and EBV-negative tumor mass-bearing mice.
(130) Mice were injected with MKN-45 cells on one side thereof and with MKN-45 cells transduced with BARF1 on the other side thereof.
(131) The analysis was performed daily for a week and the fluorescence intensity values for the two tumor masses were reported.
(132) Statistical analysis revealed that the 3D4 antibody accumulates specifically in the BARF1-positive tumor mass (
(133) Therapy
(134) Tumor cell lines were injected in SCID mice to evaluate the therapeutic capacity of the anti-BARF1 3D4 antibody in a mouse model.
(135) C-666 cells were injected subcutaneously in SCID mice and part of them were treated with the anti-BARF1 3D4 mAb.
(136) Statistical analysis of tumor growth kinetics in treated mice compared to the controls revealed that injection of the anti-BARF1 3D4 mAb slowed down and reduced the tumor growth (p=0.0028, p=0.002 and p=0.0026 at days 24, 26, and 28, respectively;
(137) After 30 days, the therapeutic effect of the treatment decreased and the C-666 tumor mass begins to grow rapidly also in the treated group.
(138) On the contrary, in mice injected subcutaneously with the EBV-positive but BARF1-negative RAJI cells, the treatment did not result in any reduction of the tumor mass, as expected from the in vitro results.
(139) C-666 cells were also injected subcutaneously in RAG.sup./ -chain.sup. mice (lacking functional B, T and NK cells), but no difference was observed between the control and the treated group (p=0.77; data not shown), thereby indicating that the main action mode of the selected mAb is probably ADCC.
(140) A bioluminescence model was used for the analysis of the same cell line injected through the caudal vein: in fact, C-666 cells were transduced with the enzyme luciferase and injected intravenously in mice.
(141) The mouse tumor model was analyzed weekly with the IVIS Lumina II equipment, and the number of photons within an area of interest is the parameter used for statistical analysis.
(142) As indicated above for the s.c. tumor growth kinetics, the progression of the C-666 tumor was slowed by the treatment with the 3D4 anti-BARF1 antibody (
(143) Statistical analysis was performed on the average radiance (
(144) Finally, we analyzed the survival of treated and control mice, which outlined a significant improvement in the treated group compared to the control group (data not shown).
(145) The same experiments were performed using the GRANTA-519 cell line.
(146) In the control group, the tumor growth was fast and aggressive, while in mice treated with the 3D4 mAb it is significantly reduced (p<0.05 at day 21;
(147) As already described, the same test when performed in RAG.sup./ -chain.sup./ mice revealed no significant difference in tumor growth, thus underlining the importance of ADCC as anti-BARF1 antibody-mediated cytotoxicity mechanism (p=0.14; data not shown).
(148) Moreover, GRANTA-519 cells were transduced with the luciferase gene, injected i.v. and analyzed by bioluminescence.
(149) Also in this context, statistical analysis of survival showed a better trend of treated mice compared to controls (p=0.002;
(150) The study revealed that also in this condition, treatment with the anti-BARF1 3D4 mAb slowed the tumor spread with respect to the control group (p<0.05 at day 21;