Floating gate based sensor apparatus and related floating gate based sensor applications
10962501 ยท 2021-03-30
Assignee
Inventors
Cpc classification
G01N27/4145
PHYSICS
H01L29/42364
ELECTRICITY
H01L29/42328
ELECTRICITY
International classification
G01N27/414
PHYSICS
H01L29/423
ELECTRICITY
Abstract
A floating gate based sensor apparatus includes at least two separate electrical bias components with respect to a floating gate based sensor surface within the floating gate based sensor apparatus. By including the at least two electrical bias components, the floating gate based sensor apparatus provides enhanced capabilities for biomaterial and non-biomaterial detection and manipulation while using the floating gate based sensor apparatus.
Claims
1. A sensor apparatus comprising: a floating gate based sensor surface located within a sample chamber over a substrate, and a reference electrode positioned in the sample chamber spaced apart from the floating gate based sensor surface, wherein the floating gate based sensor surface comprises a floating gate, and is adapted for electrical bias by at least two electrical bias components within the sensor apparatus, wherein at least one of the at least two electrical bias components comprises a finFET transistor, and wherein the floating gate is electrically coupled with at least one control gate.
2. The sensor apparatus of claim 1, wherein the floating gate based sensor surface comprises a sensing gate electrically coupled with the floating gate, the sensing gate being disposed over a first portion of the floating gate.
3. The sensor apparatus of claim 2, wherein the sensing gate is further electrically coupled with the at least one control gate via the floating gate.
4. The sensor apparatus of claim 3, wherein the at least one control gate and the sensing gate are capacitively coupled to the floating gate.
5. The sensor apparatus of claim 3, wherein the at least one control gate is disposed over a second portion of the floating gate.
6. The sensor apparatus of claim 2, wherein a vertical structure comprising a source and a drain of the finFET transistor is laterally and vertically offset from the sensing gate.
7. The sensor apparatus of claim 6, wherein the floating gate comprises a first segment and a second segment, wherein the first segment comprises, at a proximal end, the first portion disposed under the sensing gate, and further comprises a second portion downwardly extending from the first portion and extending laterally relative to the first portion and, at a first distal end, a third portion substantially parallel to the first portion, and wherein the second segment is electrically connected to the first segment and circumscribes a fourth portion of the vertical structure comprising the source and the drain to terminate, at a second distal end, adjacent the control gate.
8. The sensor apparatus of claim 7, wherein the first segment and the second segment are separated by an insulating layer and wherein the first segment is electrically connected to the second segment via one or more conductive vias.
9. The sensor apparatus of claim 1, wherein the sensor surface comprises one or more of a dielectric material, a conductor material, a metal conductor material or a polysilicon conductor material.
10. The sensor apparatus of claim 1, wherein the substrate comprises a bulk semiconductor substrate or a semiconductor-on-insulator substrate.
11. The sensor apparatus of claim 1, wherein the control gate electrically biases the sensor surface with respect to the substrate.
12. The sensor apparatus of claim 1, wherein the reference electrode electrically biases a sample within the sample chamber with respect to the floating gate based sensor surface.
13. The sensor apparatus of claim 1, wherein a coupling capacitance between the reference electrode and a fluid in the sample chamber is larger than a sensing gate capacitance between a sensing gate and the fluid.
14. The sensor apparatus of claim 1, wherein with respect to the substrate, the reference electrode is biased with a direct current potential that is positive or negative, or biased with the direct current bias with a superimposed alternating current bias.
15. The sensor apparatus of claim 1, wherein the reference electrode is electrically coupled to the substrate.
16. The sensor apparatus of claim 1, wherein the reference electrode is electrically floating with respect to substrate layer.
17. The sensor apparatus of claim 1, wherein the floating gate is constructed to maintain a charge to attract or to repel a biomolecule on a surface of a sensing gate.
18. The sensor apparatus of claim 1, wherein a top surface of a sensing gate is coupled to an oxide layer and another top surface of the oxide layer corresponds to the floating gate based sensor surface.
19. The sensor apparatus of claim 1, wherein a channel between a source and a drain of the finFET transistor is surrounded on at least two sides by the floating gate.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The objects, features and advantages of the embodiments are understood within the context of the Detailed Description of the Non-Limiting Embodiments, as set forth below. The Detailed Description of the Non-Limiting Embodiments is understood within the context of the accompanying drawings, that form a material part of this disclosure, wherein:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10) The size of the ion is 5 . As the valency increases, the counter ion decay is more abrupt but results in a saturation of charge density at the interface. (c) Potential distribution for varying valency. (d) Role of varying the hydrated ion size. As the ionic radius increases the maximum achievable charge density at the interface reduces due to the steric effect.
(11)
(12)
(13)
(14)
and becomes more negative with decreasing n.sub.O. This is reflected in the current levels during the transient recordings. At pH.sub.B=7 the current levels flip when E.sub.SG_OX is switched from positive to negative since .sub.O is positive at the positive E.sub.OX and negative at negative E.sub.OX. At pH.sub.B=3, .sub.O is net positive and increases with decreasing n.sub.O. In all three cases, the drain current is higher between 230-285 seconds than the initial state between 0 and 60 seconds. This is attributed to net positive charge due to field-induced protonation which remains after the negative gating pulse is relaxed. This is similar to the observed hysteresis in
(15)
(16)
(17)
(18) Varying cationic valency indicates more pronounced shifts in V.sub.th_CG around the knee point (i.e. where tunneling begins) especially with trivalent salts in comparison to mono and divalent salts. A decrease in the overall V.sub.sh_CG with trivalent salts upon tunneling is consistent with the notion that C.sub.DL is also decreasing. Error bars represent an average over 3 experimental runs.
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
DETAILED DESCRIPTION OF THE NON-LIMITING EMBODIMENTS
(35) A. A Floating Gate Based Sensor Apparatus in Accordance with the Embodiments
(36) 1. Introduction
(37) Transistor-based biological/chemical transducers have gained considerable attention over the last decade. For example, an ion sensitive field effect transistor (ISFET) has its gate oxide directly exposed to an electrolyte with its electrochemical potential set by a solution reference electrode. The gate oxide interface possesses a net surface charge due to hydroxyl groups upon exposure to the electrolyte. The charge density and the electrostatic potential then decay from the interface into the solution bulk over the characteristic distance of the Debye length. A change in the oxide electrolyte interface potential due to ionic adsorption or reference-electrode biasing then induces a shift in the channel current via a change in the electric field in the gate oxide. The change in the reference electrode potential with respect to the transistor source bias to achieve a constant channel current (i.e. a constant field in the gate oxide) is thus a direct measure of the oxide-electrolyte interface potential shift. The transistor is typically only sensitive to ionic and molecular charges within a few Debye lengths from the interface. While numerous examples of FET-based ionic and molecular sensors have been demonstrated, the ability to dissect the complex interplay between pH, salinity and surface chemistry is still unclear. In addition, the ability to impart electrical control over the sensing interface concomitantly is still elusive.
(38) Dynamic control of surface charge can potentially realize reversible interfaces, addressable sensor pixels in large-scale arrays, controlled charge modulation, and even local pH titration with simultaneous detection. However, since ISFET generally has an exposed dielectric interface which consists of amphoteric surface groups, a change in electric field within the oxide would not only modulate ions in solution but also affect the chemical composition of the interface.
(39) Similarly, when an electrode covered by an insulator is biased in an electrolytic medium, the field in the insulator would thereby modulate the ionic double layer. The applied potential to such an electrode or static stored charge on a buried floating electrode can in turn influence the insulator's surface charge according to its amphoteric nature, which then affects the proton binding affinity, the adsorption equilibrium and the net charge in the double layer. The interplay between the applied field and the chemical equilibrium at the interface is termed as electrochemical gating. The first examples of electrochemical gating in microfluidic systems demonstrated that local fields could modulate the electro-osmotic flow in micro-channels, but ilia not elaborate on the chemical properties of the interface.
(40) 2. Theoretical Considerations
(41) In order to develop an intuitive understanding of the embodied floating gate based sensor apparatus and methodology (i.e., in comparison with ISFET sensor apparatus and methodology), one may first consider a conventional electrolyte-oxide-semiconductor (EOS) structure as illustrated in
(42) The CvMOS transistor illustrated in
(43) 3. Additional Embodiments of Floating Gate Based Sensor Apparatus
(44) Alternate configurations and embodiments of a floating gate based sensor apparatus in accordance with the embodiments are illustrated in
(45) In particular,
(46) In addition,
(47) Further,
(48) Still further
(49) Finally
(50) Thus as illustrated within the schematic cross-sectional diagrams of
(51) As is also illustrated within the foregoing cross-sectional schematic diagrams, the embodiments also contemplate control gate electrical bias and body bias with respect to a floating gate as a sensor surface. The embodiments also contemplate control gate and reference electrode bias of a floating gate more generally, although the embodiments also consider other arrangements for at least two bias component bias of a floating gate within a floating gate based sensor apparatus in accordance with the embodiments.
(52) Within any of the foregoing embodiments as illustrated within any of the foregoing schematic cross-sectional diagrams
(53) As is understood by a person skilled in the art, while the foregoing embodiments are illustrated within the context of nominally a bulk semiconductor substrate as a base substrate within a floating gate based sensor apparatus in accordance with the embodiments, the embodiments are not intended to be so limited. Rather the embodiments are also intended to include semiconductor substrates such as but not limited to bulk semiconductor substrates and semiconductor-on-insulator (SOI) semiconductor substrates. In particular, a floating gate based sensor apparatus in accordance with the embodiments fabricated using a SOI substrate in accordance with the schematic cross-sectional diagrams of
(54) Similarly, as is also understood by a person skilled in the art, while the foregoing embodiments are illustrated within the context of conventional planar metal oxide semiconductor field effect transistor structures for CG actuation, the embodiments are as well also not intended to be so limited. Rather the embodiments may utilize semiconductor transistor structures including but not limited to conventional planar semiconductor transistor structures and more advanced finFET three dimensional semiconductor transistor structures for CG actuation. In particular, finFET three dimensional transistor structures as are illustrated in
(55) In summary, the embodiments provide for at least two separate bias component (i.e., bias sources) biasing of a floating gate based sensor surface within a floating gate based sensor apparatus. With such a configuration, for example, AC and DC signals can be applied simultaneously and independently to the floating gate based sensor surface within the floating gate based sensor structure. This feature allows for an impedance using split AC/DC signal delivery. As well, and as will be illustrated within the context of applications of the apparatus as discussed in further detail below, the floating gate based sensor apparatus in accordance with the embodiments may be used for the detection and manipulation of a broad range of biomaterials.
(56) Moreover, floating gate based sensor structures and floating gate based sensor apparatus in accordance with the embodiments may be fabricated using semiconductor device fabrication technology that is otherwise generally conventional. Finally, additional details of related floating gate based sensor structures and floating gate based sensor apparatus in accordance with the embodiments is also taught within U.S. Pat. Nos. 7,053,439 and 7,960,776, the contents of which are incorporated herein fully by reference.
(57) 4. Experimental Considerations
(58) a. Materials
(59) EOS capacitors in accordance with
(60) Electrolytes containing NaCl, MgCl.sub.2 and Co(NH.sub.3).sub.6Cl.sub.3 salts (Sigma Aldrich) were made up to the desired dilution using Millipore de-ionized H.sub.2O. The pH of the solutions was regulated using conjugate acid-base mixtures. TE buffer (10 mM TRIS pH 8, 10 mM NaCl and 1 mM EDTA) was added to test for buffering effects. Electrodes made of Ag/AgCl were used as reference electrodes. Experiments were performed in a light-tight environment.
(61) b. Electrical Instrumentation
(62) Capacitance-voltage (CV) measurements were performed using a Keithley 4200 semiconductor parameter analyzer. CV profiles were recorded at various small-signal frequencies. The reference electrode was supplied with an AC signal superimposed on a slow DC sweep, while the wafer chuck was used as ground. The transistor transfer characteristics (the drain current I.sub.D vs. the CG bias (V.sub.CG)) were recorded using a Keithley 236 source measure unit (SMU) for the drain (V.sub.D=1V) and a Keithley 2400 was used to sweep V.sub.CG. Programming was carried out by applying a large positive voltage to V.sub.CG with a +1V bias on V.sub.D unless otherwise specified, while erasing was by a large-magnitude negative voltage. The transient measurements at constant V.sub.CG were recorded by the trans-impedance amplifier (TIA, Stanford Research Systems SR570, CA, USA) with a sensitivity of
(63)
and low-pass filtering at 3 KHz. The data was collected on a computer through a data acquisition test board (NI BNC 2110 and NI USB 6259). The bias on the TIA was set to 1V. Prior to measurements, the transconductance (g.sub.m) seen from both the CG and SG was recorded in order to calibrate the capacitance ratio.
(64) 5. Device Operation and Sensing Principles
(65) a. General
(66) The floating gate based sensor apparatus works on the principle of the conventional neuron MOS transistor where two input gates are coupled to a common FG. The potential on the FG (V.sub.FG) can be calculated by the capacitive divider model shown in
(67)
sets the scaling factor. Thus an asymmetric CvMOS structure can lead to a magnification of the threshold voltage shift (Eq. 1) as observed from the control gate when the sensing gate experiences a load from the electrolyte.
(68)
(69) The governing equations are listed
(70) b. Programming and Erase Operations
(71) In conventional Flash memory devices when the CG bias is swept to a large magnitude, sufficient electric field can develop across the gate stack enabling electron/hole tunneling from the silicon channel onto the FG (Q.sub.FG). Programming is the condition when the FG has a net stored charge state, while erase is the condition under which that charge is removed, see
(72)
which is a pre-requisite for Fowler-Nordheim (FN) tunneling. Such fields are quite common in Flash memory devices and can be employed many times without permanent breakdown. The floating gate based sensor apparatus has an EOT (effective oxide thickness) of approximately 50 nm and the maximum CG bias for programming does not exceed 40V.
(73) The CG is shielded from the solution by a large passivation oxide (>2 m) and hence the CG bias has no direct influence on the electrolyte except through the FG and SG coupling. The SG surface is highly-doped polysilicon which is being considered for biosensing applications. At high V.sub.CG, the electric field in the CG control oxide (E.sub.CG_OX) increases. Normally V.sub.FG would rise together with V.sub.CG. However the FG is coupled to V.sub.REF through the large SG which ensures that V.sub.FG does not increase much with an increase in V.sub.CG. This dire affects E.sub.CG_OX as it rises considerably higher than the field in the tunnel oxide (E.sub.TOX).
(74) For example, given a capacitive ratio of 20, a 40V CG bias induces only a 2V rise in V.sub.FG. Evidently this would cause a larger change in E.sub.CG_OX than in E.sub.TOX. Electrons thus tunnel out of the FG onto the CG faster than they tunnel onto the FG from the channel. This causes a net positive stored charge on the FG and lowers the threshold voltage V.sub.th. However, if V.sub.CG is large and negative, the opposite occurs resulting in net electron storage. The energy band diagrams depicting this operation are shown in
(75) If the reference electrode is left floating, the capacitive coupling in the SG branch is much weaker and V.sub.FG is then allowed to track V.sub.CG. The E-field in this case aids electron injection from the channel into the FG awing programming and hole storage during erase
(76) Thus by flipping the reference electrode between floating and biasing conditions during the programming process, the polarity of stored charge on the floating node can be significantly changed. This nonvolatile charge then capacitively interacts with the fluid via the field effect. A simulation of the tunneling effect with and without the reference electrode is shown in
(77) The SG-fluid interface is considered to be in steady state during the program pulse and V.sub.th measurement ramp. Dynamic processes of ion or water dipole rearrangement are assumed to occur at time scales much faster than tunneling. The double layer capacitance (C.sub.DL) is modeled based on a Poisson-Boltzmann formulation including ion Steric effects.
(78) 6. Role of Surface Groups and Electrochemical Gating
(79) The ISFET or EOS response is generally dictated by the protonation behavior of the interfacial inorganic oxide in direct contact with the electrolyte. Surface hydroxyl groups are amphoteric in nature, protonated or deprotonated depending on the solution bulk pH (pH.sub.B), resulting in a net surface charge .sub.O. It is this shift in charge that determines the net pH.sub.B sensitivity of the underlying transistor. It has been theoretically demonstrated that in addition to pH.sub.B, the field in the underlying oxide profoundly affected .sub.O, which further influenced the surface pH sensitivity (pH.sub.S). One may adopt a hydroxyl surface group model where the basic acid-base equilibrium at the interface is given by Eq. (2).
(80) ##STR00001##
(81) Here K.sub.a and K.sub.b are the dissociation constants and H.sub.B.sup.+ is the bulk proton concentration. At a particular pH.sub.B, the interface is charge neutral. This is termed as pH.sub.PZC, i.e., the pH at the point of zero surface charge. However, when pH.sub.B is not equal to pH.sub.PZC, the surface pH (pH.sub.S) shifts in response to the change in pH.sub.B. The number of surface groups that ionize in response to varying pH.sub.S is termed as the buffer capacity (.sub.S) and its associated capacitance is termed as C.sub.Buffer. By definition, .sub.S is the ratio of the change in net surface charge to that in pH.sub.S.
(82)
(83) Here .sub.O is equal to the net number of titrated groups per area:
.sub.O=e.Math..sup.O+e.Math..sup.OH.sup.
(84) where N.sub.S=.sup.O=.sup.O+.sup.OH.sup.
(85)
and .sup.O, and under the assumption of a single pK model (i.e., pK.sub.a=log.sub.10(K.sub.a)), i.e., when only one type of surface group of O.sup. is considered, Eq. (4) can be rewritten as,
(86)
(87) If we consider both surface ionization reactions i.e., a 2 pK site-binding model, Eq. (4) then becomes
(88)
(89) We can then solve for .sup.OH by using the relationship between K.sub.a, K.sub.b and .sup.O.
(90) Here the surface proton activity H.sub.S.sup.+ is related to the bulk proton activity H.sub.B.sup.+ by the Boltzmann relation
(91)
(92) The simulation considers a metal electrode below an insulator exposed to the electrolyte (metal-oxide-electrolyte) as illustrated in
(93)
(94) Equation (8) is then solved self consistently for the entire electrostatic system.
(95) 7. Electrical Double Layer Charge (.sub.DL)
(96) The SG-electrolyte interface is commonly described by the Gouy-Chapman-Stern (GCS) model which considers ions as point charges. When a solid interface is exposed to electrolyte, ionization or ion adsorption creates a net surface charge density .sub.O. This results in a strong attraction of counterions towards the interface to neutralize the immobile surface charge denoted by .sub.DL. Co-ions on the contrary are repelled away from the wall. The capacitance at the wall is generally described by a Stern capacitance C.sub.Stern from the inner immobile or specifically adsorbed layer and the outer diffuse layer capacitance C.sub.DL. A value of
(97)
is assumed for the Stern layer capacitance (i.e. considering an approximate thickness of 5 and a dielectric constant of 10). The charge distribution is traditionally described by the Poisson-Boltzmann (PB) equation:
(98)
(99) For a z:z electrolyte, where the mobile diffusive charge is confined to a thin capacitor with a width governed by the Debye length.
(100)
(101) Here z is the valency, n.sub.O the bulk ion concentration, e the elementary charge, kT is the thermal energy and is the dielectric constant of the solvent. Equation (9) stems from a mean-field formulation where ions are treated as point charges, i.e., ion-ion and ion-wall interactions are ignored. In the conventional PB formalism, charge density generally blows up due to the exponential dependence on surface potentials which is unrealistic under moderate to high .sub.O values. By accounting for close packing of ions at the interface, a limit is imposed on the maximum achievable charge density. In this work we model the NaCl system alone using the PB approximation since the effect of size was found to be negligible within the range of .sub.O obtained. However when dealing with multivalent ions the ion distribution from the interface is described using a 1:z approximation including Steric effects (see
(102)
(see
(103) Steric related phenomena are generally weak under low monovalent (NaCl) electrolyte concentrations and moderate .sub.O conditions. Using the modeling framework presented in the previous section ion size effects were only marginally observed at E-fields above
(104)
(not shown) with NaCl salts. One may note that in a recent theoretical study surface charge densities approaching
(105)
(which is typical of pristine dielectric interfaces) significant ion layering may be observed even at low saline concentrations. It is thus paramount to understand the interfacial charge conditions as ion size effects can preclude a proper assessment of the observed signals with sensitive field effect devices. To accurately model ionic layering especially with multivalent salts, one may invoke the modified Poisson-Boltzmann (MPB) theory see Eq. (11)] which includes the hard-sphere Steric effect between ions owing to their finite size but ignores correlations. A Stern layer capacitance is not assumed in the MPB formulation.
(106)
(107) where v=2a.sup.3n.sub.O is the volume packing factor of ions and a is the size of the ion. The packing factor sets a limit on the maximum achievable charge density at the interface. The charge within the double layer is then given by
(108)
(109) The electric field originating from the potential across the solid/electrolyte interface
(110)
attracts counterions to the surface forming an initial screening layer. If the surface potential rises further
(111)
the electric field strength becomes high enough to cause layering of counterions against the solid interface (see
(112)
due to the Steric constraint. Under such field conditions, the region of ion accumulation extends away from the surface into the solution where ions do not exhibit specific interactions with the solid interface. This causes a further increase in the thickness of the double layer, leading to a decrease in the inferential capacitance of the diffusive layer. As mentioned previously this effect becomes significant with large multivalent ions.
(113) 8. Multivalent Ions and Charge Inversion
(114) The Debye-Huckel (DH) approximation within the GCS double-layer framework states that the ionic screening effectively lowers the molecular charge in the electrolyte as observed from a finite distance. This is the net charge looking into the Gaussian sphere around the molecule including its screening counter-ion cloud. In comparison with monovalent ions, multivalent ions are known to form a strongly correlated interface with charged moieties which overcharge the interface. This can lead to excess counter ion condensation and eventually polarity reversal, which cannot be explained by the conventional mean-field theory. This counter-intuitive phenomenon is termed as charge inversion (CI). It is postulated that this effect arose primarily due to strong lateral ion-ion interactions which got stronger as the valency increased, and a much larger negative electrochemical potential is developed within the 2D ionic layer. Ion-Ion correlations give rise to counter ion layering against the interface, which can lead to overcharging under suitable field conditions. This is often much easier to achieve with multivalent ions since the interaction energy between an ion and its background charge is directly proportional to z.sup.3/2. Co-ions are then attracted to the interface to neutralize this excess counter ion charge, which is the main reason for surface potential reversal. This effect can also lead to oscillations in the surface potential. In this work one does not model the effect of charge inversion but present experimental evidence in support of such a mechanism.
(115) B. Apparatus Results and Discussion
(116) 1. Nernstian Vs. Non-Nernstian Surface
(117) Before one describes the electrochemical gating response, one first highlights the difference between a Non-Nernstian and Nernstian surface. A Nernstian response implies that .sub.O vs. pH.sub.B response is linear and has a slope of 59 mV/pH.sub.B. One may find that the surface dissociation constants and net surface site density play dominant roles in determining this slope, and can shift the response from Nernstian to non-Nernstian. The pH.sub.B response of an ISFET is traditionally given by
(118)
(119) where is defined as;
(120)
(121) The H.sub.S.sup.+ at the interface at PZC is given by
H.sub.S.sup.+={square root over (K.sub.a.Math.K.sub.b)}(16)
(122) It is immediately clear that a pH insensitive interface (non-Nernstian) necessarily implies a small .sub.S. Equation (14) suggests an intricate interplay between pK and pH.sub.B. A low value of pK and high N.sub.S is desired to achieve near Nernstian response. However the individual contributions of K.sub.a and K.sub.b are not immediately clear from Eq. (15). One may note that others have both simplified Eq. (6) while deriving the pH sensitivity and showed that the surface potential close to the PZC can be described by the relation;
(123)
(124) Here pH.sub.PZC is defined by
(125)
is a dimensionless sensitivity parameter. In order to confirm this approximation and show pH sensitivity is strongly dependent on N.sub.S and
(126)
without making simplifications, one may first solve Eq. (13). One observes that if K.sub.b increases (pK.sub.b is lowered), the surface has more neutral groups and hence pH.sub.PZC extends into the acidic branch of the pH.sub.B response. Lowering K.sub.a (pK.sub.a is increased) ensures the same effect, extending the PZC more towards the base branch. It is important to note that when pH.sub.B is lower than pK.sub.a, the surface will be mostly charge neutral and hence show a flat pH.sub.B response. This is graphically represented in
(127) A smaller .sub.pK creates more charged groups around the PZC, which improves the pH.sub.B response. Lowering N.sub.S reduces and the slope of the pH.sub.B response, because a reduction in the number of ionizable groups decreases the net available sites for proton binding
(128) 2. Electrochemical Gating
(129) As previously mentioned, E.sub.OX will induce .sub.O and .sub.DL which together set .sub.O. For an interface exhibiting a single ionizable group (the single-pK model), .sub.O first responds to E.sub.OX until all charges (N.sub.S) have responded. During this process .sub.O does not change and the surface is said to be buffering. However, in many cases with amphoteric interfaces such as Al.sub.2O.sub.3 and SiO.sub.2, the nature of the buffering strongly depends on pK hand N.sub.S. The choice of pK.sub.a=10 and pK.sub.b=5 for the present polysilicon interface under consideration represents a non-Nernstian surface with a pH.sub.PZC around pH.sub.B=7.5. This corresponds to low pH sensitivity in the given pK range and hence extremely low buffering. In
(130) Under negative E.sub.OX conditions one may notice that varying pK.sub.b, as shown in
(131)
The above simulations show that in addition to pH and bulk salinity E.sub.OX can be tuned to affect the properties of the interface to a desired region of operation.
(132) 3. EOS Capacitance-Voltage (CV) Measurements
(133) Polysilicon-Oxide-Silicon capacitors were fabricated as described earlier. V.sub.REF was swept from 10V to +10V. At 10V, the silicon was in accumulation (positive interface charge). As V.sub.REF was swept positive, the charge in silicon was depleted, and finally at +10V it was inverted. The effect of the double layer modulation or pH.sub.B on the surface potential is that the DC operating point is affected, which shifts the flat-band voltage (V.sub.FB) of the capacitor stack as illustrated in
(134) A linear response in V.sub.FB with respect to pH.sub.B variation was noticed (50 mV/pH) when sweeping V.sub.REF from 10V to +10V. A strong hysteresis effect was observed when V.sub.REF was cycled from 10V to +10V and back to 10V as shown in
.sub.O=C.sub.i.Math..sub.O=.sub.DL(16)
(135) where C.sub.i is the total capacitance seen by the interface:
(136)
(137) Here .sub.DL is the charge in the double layer, and C.sub.Stern is the Stern layer capacitance which is generally considered immobile. A change in n.sub.O directly affects .sub.O via .sub.DL [Eq. (16)] which in-turn affects C.sub.DL and .sub.O self-consistently. The Boltzmann relation in Eq. (7) directly implies that a change in .sub.O affects H.sub.S.sup.+. However, the surface buffering capacity .sub.S will try to maintain H.sub.S.sup.+ constant by ensuring a new surface chemical equilibrium satisfied by Eq. (8). If .sub.S is small, C.sub.DL can strongly regulate .sub.O, where the surface is maximally sensitive to ions and least sensitive to pH.
(138) In order to further validate field-dependent ionic activity, one may also vary the z/v (valency/volume) ratio of the cation. Ionic size and valency play a crucial role in the double layer formation. Hence field-induced double layer mollification serves as a suitable control to validate electrochemical response over the electrolyte interface. Size and valency sets a constraint on the width of the double layer which is strongly surface potential dependent. When V.sub.REF was swept from 10V to +10V one may observe a reduction in V.sub.FB when MgCl.sub.2 replaced NaCl in the electrolyte but a slight increase in V.sub.FB when Co(NH.sub.3).sub.6Cl.sub.3 replaced MgCl.sub.2, see
(139) However, the net reversal in .sub.O observed with the trivalent cations cannot be accounted for solely by the Steric effect. .sub.O reversal is possible with trivalent ions even at extremely low n.sub.O primarily due to electrostatic correlations. This seems to suggest that the predominant factors that determine the onset of potential reversal are the ionic
(140)
ratio and strong ion-ion interaction between multivalent ions.
(141) 4. Floating Gate Based Sensor Structure
(142) a. Transient Responses
(143)
(144) For pH.sub.B=11, the surface was already buffering
(145) b. Quasi-Static Response
(146)
(147) c. Programming Response and the Role of the Reference Electrode
(148) One may recall that V.sub.FG is influenced by .sub.O which is pH.sub.B and C.sub.DL dependent. Also from the transient measurements it is clear that at small positive CG pulses the net carry-over charge is negative. Hence as V.sub.CG is initially increased, V.sub.FG perturbs .sub.O inducing a net .sub.O which couples back to influence the transistor current. As V.sub.CG is further increased V.sub.FG does not rise as high due to the influence of V.sub.REF. The E.sub.CG_OX increases favoring FN tunneling to create a net positive Q.sub.FG, reducing V.sub.th measured from the CG as illustrated in
(149) In order to confirm the interplay between .sub.DL and Q.sub.FG, one may perform experiments by changing n.sub.O and hence C.sub.DL. It may be found that C.sub.DL is strongly influenced by the tunneling characteristics as illustrated in
(150) In many experiments involving cell suspensions and biomolecules, the electrolyte composition is never just composed of single monovalent salts. In order to further develop the gating concept and corroborate the CV measurements, one may perform experiments keeping n.sub.O constant at 20 mM and varying the cationic
(151)
ratio, see
(152) 5. Concluding Remarks Regarding Apparatus
(153) The embodiments provide a floating gate based sensor apparatus that presents a dynamic surface charge modulation of a solid-electrolyte interface, and the concept of surface pH tuning. By modulating the polarity of stored charge, one can switch between a pH sensitive condition and a non-Nernstian surface. Transistor and EOS capacitor measurements are compared and a 2-pK model with surface charge regulation is presented. One may conclude that proton adsorption and desorption is the primary reason for hysteresis at such interfaces, which also provides a method of probing the surface charge state. Quasi-static I-V measurements, CV profiles and high resolution transient recordings are presented to corroborate related findings.
(154) B. Applications of Floating Gate Based Sensor Apparatus in Accord with Embodiments for Biomaterial Detection and Manipulation
(155) Various embodiments of the floating gate based sensor apparatus in accordance with the embodiments can be utilized for the detection and/or manipulation of biomolecules. Indeed, the detection and manipulation of biomolecules, especially simultaneously, provides for analysis of the fundamental properties of proteins/DNA, controlled drug delivery and reversible bio-electronic interfaces. While biomolecular detection by transistors has been described, it has so far been very difficult to realize the opposite, i.e., using the transistor for molecular actuation. Serving as an affordable, fast and extremely sensitive tool, the transistor platform is easier to integrate and scale than optical techniques and could also facilitate label-free readout. Present non-faradaic sensors rely on the conventional ISFET (ion sensitive field effect transistor) approach. The surface of the open-gate field effect transistor (FET) is made sensitive to ion and molecule adsorption, which subsequently modulates the transistor current. The threshold voltage in this case is measured with respect to a reference electrode, often by Ag/AgCl in a chlorine-rich buffer. However, recent efforts have been directed towards achieving dual gate control which gives intrinsic amplification of the surface potential shift. Given the small size and high sensitivity of these dual-gate devices, sensing the intrinsic properties and interactions of proteins, DNA and other small bio-molecules becomes plausible.
(156) Traditionally, the gate metal of the FET is removed and sensing is performed on the gate oxide or functional coatings. Alternatively, the gate metal can be left electrically floating and the target adsorption is on the metal surface. A reference electrode such as Ag/AgCl or Pt in the electrolyte biases the transistor at the appropriate operating point. This is commonly known as the ISFET. In comparison, the floating gate based sensor apparatus in accordance with the embodiments makes use of an independently driven control gate, hence alleviating the sole reliance on the reference electrode for biasing, which can nevertheless still be used to set the bulk electrolyte potential and affect the sensor output. The use of V.sub.REF can lower the read voltage to void read disturb, as high V.sub.CG can induce unintended nonvolatile charge injection.
(157) 1. Biomolecule Detection and Manipulation
(158) a. Introduction
(159) Optical detection schemes of DNA hybridization and protein binding traditionally rely on fluorescent labels. Not only can labeling affect the delicate nature of molecular interactions, but integrating optical detection with sub-millisecond monitoring is difficult. CMOS electrochemical sensors on the other hand, enable aggressive miniaturization, label-free operation, high spatial and temporal resolution, and high sensitivity based on both capacitance and charge. Moreover, transistor detection of DNA hybridization through surface charge sensing can potentially realize electronic micro-assays.
(160) Recent efforts towards dynamic control of biomolecular activity have included electrophoretic and electrochemically driven stimuli. Electric-field manipulation is preferred compared to faradaic schemes as redox reactions often interfere and disturb the delicate molecular properties. It is also possible to ensure sufficiently high electric field gradients with low-voltage operation which is dependent on the double layer capacitance. Under such conditions, it was proposed that the sensing electrode can still be treated as purely polarizable, as in the conventional Gouy-Chapman (GC) double-layer theory.
(161) Previous research has provided compelling experimental evidence that the oligonucleotides desorption occurred during an unsteady electrochemical state away from equilibrium, contrary to the notion that desorption was well captured by the GC model where an equilibrium could always be established. Similar studies demonstrated that DNA desorption occurred after sub-milli-second pulses between a surface electrode and the bulk electrolyte, further indicating that desorption happened well before equilibrated double-layer conditions were reached. This was believed to be primarily due to counter ion descreening exposing the DNA backbone which gets electrostatically repelled, reorganizes and then re-adsorbs. More recently, the effect of self-heating in SOI transistors was demonstrated as a method for local desorption with simultaneously sensing capabilities. This is an attractive alternative approach but precise thermal control at such scales is still challenging.
(162) On the other hand controlled nonvolatile charge injection, by either hot electron injection or Fowler-Nordheim (F-N) tunneling causes the FG to hold static charge of either polarity. This charge capacitively couples to the sensing gate which imparts an electrostatic force on ions and adsorbed biomolecules.
(163) Accordingly, described below is the sensing and dynamic manipulation of surface-immobilized DNA using the floating gate based sensor apparatus in which quasi-static I-V and impedance spectroscopy measurements are performed. The measured .sub.O during DNA immobilization and hybridization is E-field dependent. A positive E-field enhances the hybridization and immobilization signal while a negative E-field reduced it. In addition dual-gate control and charge programmed onto the FG affects the sensitivity by inducing different field conditions in the SG oxide. Manipulation of the oligonucleotides is realized via non-volatile charge injection which set a defined repulsive/attractive field between the FG and solution. The ionic cloud and associated de-screening around DNA is believed to be responsible for this effect as it can be perturbed via the field effect. This is further corroborated by modeling the DNA membrane using modified screening and partition energy formulations. The modified permittivity due to the partition energy difference which could arise either due to orientation or ion specific exclusion effects is found to play a key role. Furthermore V.sub.th_CG and .sub.O are observed to recover after DNA desorption aided by the non-covalent nature of the binding. Impedimetric detection using a split-gate approach showed a clear shift in the frequency response upon DNA immobilization (pole) and subsequent hybridization (pole and zero).
(164) According to an embodiment, two different lengths are tested (24 bp and 48 bp) and the results indicate that the impedance recovers upon charge injection indicating surface recovery. The frequency response is also found to exhibit a molecular weight and structure dependence. Upon programming the FG with electrons, the interface impedance is observed to recover, indicating DNA desorption. This technique of combined detection and manipulation using CMOS compatible charge sensors can potentially help realize electrically addressable sensor arrays, refreshable bio-sensor interfaces and dynamic reconfiguration of protein complexes, among many other applications.
(165) b. Experimental Considerations
(166) i. Materials
(167) The sensor chips utilized were as described above. The sensing gates were coated with a receptor, poly-l-lysine (Sigma Aldrich), set aside for two hours and then washed with DI water, dried and stored at 4 C. before use. DNA strands B1 and B2 (see Table 1) were procured from IDT DNA and were 99.9% HPLC purified. These 20 base-pair (bp) oligonucleotides (7 nm length) were kept at a stock concentration of 0.5 mM in a 10 mM saline (TE) buffer (10 mM Tris at pH 8.0, 10 mM NaCl, and 1 mM EDTA). The DNA concentration used during measurements was diluted to 5 M in order to achieve sufficient surface coverage without suffering from Coulombic repulsion which normally occurs at high probe densities. DNA strands (C1, C2) (24 bp) and (D1, D2) (48 bp) were additionally used under identical conditions to ascertain the impedance dependence on molecular length before and after hybridization. The bond pads were isolated from the sensing region via an epoxy coating which also served as the fluid reservoir. Fluid was dispensed and removed from the well via pipettes.
(168) TABLE-US-00001 TABLE1 Name Sequence(5to3) B1-probe CATAGGCCTTGGAACCTATG(SEQIDNO.1) B2-target CATAGGTTCCAAGGCCTATG(SEQIDNO.2) C1-probe GCATCTGGGCTATAAAAGGGCGTCG(SEQIDNO.3) C2-target CGACGCCCTTTTATAGCCCAGATGC(SEQIDNO.4) D1-probe GCATCTGGGCTATAAAAGGGCGTCGGTATCCAAGGTTCCG GATACGAG(SEQIDNO.5) D2-target CTCGTATCCGGAACCTTGGATACCGACGCCCTTTTATAGC CCAGATGC(SEQIDNO.6)
(169) Although the sensing gates were coated with poly-l-lysine as the receptor, many other types and varieties of receptors are possible. Examples of possible receptors include, but are not limited to (3-Aminopropyl)triethoxysilane (APTES), mercaptopropyltrimethoxysilane (MPTES), poly-l-lysine, poly-d-lysine, (3-Glycidyloxypropyl)triethoxysilane (GPTES), poly-ethylene glycol (PEG) receptors, laminin, and/or fibronectin, in addition to many others. Since the receptor used to coat the sensing gates can be determined by the target of choice, the possible receptors are only limited by target/receptor pairs. In addition, if a receptor is used to hunt or determine targets, the receptor can be chosen without knowing the particular target.
(170) ii. Electrical Instrumentation
(171) Impedance measurements were performed by monitoring the small-signal transistor gain as a function of frequency. A single-toned sinusoid waveform was applied (Stanford Research Systems DS345, CA, USA) through a solution gate (Ag/AgCl reference electrode) while the DC bias was supplied via the control gate independently (Keithley 2400, USA). The output current of the transistor was fed to a lock-in amplifier (Stanford Research Systems, SR844, CA, USA) through the TIA. Bode responses and current/voltage (I/V) sweeps were measured intermittently to ascertain the operating point stability. The CG was then adaptively biased to maintain a constant operating point during the impedance measurement.
(172) c. Device Operation and Sensing Principles
(173) i. Quasi-static Operations
(174) V.sub.FG is perturbed by analyte adsorption on the SG. Upon DNA immobilization, the readout current is modulated by a change in the V.sub.FG from both the SG capacitance C.sub.SG and .sub.O as outlined (see
(175) Note that DNA itself is a dielectric and hence will give rise to additional capacitive effects at the interface, which is noticeable but not well understood, as the rotation angle will further affect the capacitive readout. The subthreshold slope is directly proportional to the total capacitance C.sub.T (see
(176) ii. DNA Transistor Interface
(177) Over the last few years many models of the DNA-transistor interaction have been proposed to highlight the nature of charge modulation at the ISFET interface. Various groups have illustrated the effects of the adsorbed biomembrane as ion permeable, resulting in a Donnan potential. Additionally, it has been shown that high intrinsic surface charge density negates and even cancels the Donnan effect. Hence a Nernstian pH response is deletrious to biomolecular sensitivity. However, it was recently shown that the maximal sensitivity of protein detection coincided with maximal pH sensitivity, in direct contradiction to known theories. It was argued that this is due to the interaction of the protein with surface sites, and hitherto this issue still had not been resolved.
(178) The Donnan theory formulation was later improved wherein ion permeation into the DNA layer was treated by accounting for the partition energy barrier. It was explained that ion diffusion from a high permittivity medium (bulk) to a low permittivity medium (the DNA membrane) is always associated with an energy penalty, leading to a low ion density within the membrane. DNA orientation on the surface plays an important role as it decides the net partion energy barrier. It is thus reasonable to assume that the field in the underlying oxide plays an important role in determining the overall sensitivity as molecular orientation and the local ionic environment can be field dependent.
(179) Accordingly, described below are experiments in which different ion screening profiles are incorporated within and outside the DNA membrane, and it is shown that this leads to a pronounced effect on the measured .sub.O. Further, the model framework to compare different partition energy barriers for distinct configurations is then presented.
(180) iii. Impedance Spectroscopy
(181) Impedance spectroscopy was realized through small-signal analysis using a split-gate approach as CG sets the DC bias and V.sub.REF delivers the AC excitation independently. This scheme has an important advantage to independently tune the transistor's DC operating point at the pixel level while maintaining a constant global AC perturbation in the buffer. DNA immobilized on the sensing gate is analogous to an additional dielectric layer with a counterion cloud which can be modeled by an equivalent RC circuit. The main reason that justifies the RC model is that when operating at high DNA concentrations in this case 1-5 M, the DNA strands orient in such a way to minimize Steric interactions and reduce the overall free energy. This results in a tightly packed film. The adsorbed DNA is also known to form an ion permeable membrane which causes a fixed charge density within the adsorbed DNA film. This allows for a Donnan potential to be set within the membrane which further affects the surface potential shifts. In the AC impedimetric mode, this introduces a strongly resistive component into the interfacial impedance in addition to the dielectric property of the DNA. The frequency responses are attributed to both resistive and capacitive changes at the interface. The transfer function can be modeled by a Bode (pole-zero) plot. Accordingly, such impedimetric approaches can be viewed as simple two-electrode systems, but integrating with FET's allows for simultaneous charge and capacitance estimation at the nanoscale.
(182) The small-signal output can be represented by the simple relation v.sub.out=i.sub.dR.sub.d where R.sub.D is the feedback resistance and v.sub.out is the small-signal output of the transimpedance amplifier. The small signal current i.sub.D can be approximated by g.sub.mv.sub.gs where g.sub.m is the transconductance of the amplifier and v.sub.gs is the intrinsic small-signal gate-to-source voltage. The transfer function H(j) depicting the relaxation across the DNA monolayer accounts for the effective reduction in v.sub.gs, which further relates to the output voltage by v.sub.out=g.sub.mH(j)v.sub.ocR.sub.D, H(j) can be expanded to;
(183)
(184) where and v.sub.oc are the frequency and small-signal bias applied while C.sub.OX is the gate oxide capacitance. The DNA monolayer is described by a resistance (R.sub.DNA) and capacitance (C.sub.DNA) in parallel. R.sub.eff is the cumulative resistive contributions from both the reference electrode, the electrolyte and the adsorbed DNA film. C.sub.FG-BULK is the parasitic capacitance from the floating gate to bulk.
(185) The frequency response of the interfacial RC network has the pole (P.sub.1) primarily dependent on the gate oxide capacitance, associated parasitics and electrolytic resistance. The first zero (Z.sub.1) is described by the relaxation across the DNA film at the interface, in the absence of DNA, Z.sub.1 does not exist;
P.sub.1R.sub.eff(C.sub.OX+C.sub.FG-BULK+C.sub.DNA)(19)
and;
Z.sub.1R.sub.DNAC.sub.DNA(20)
(186) By performing frequency sweeps, one can monitor the properties of the adsorbed film given that the operating point is held constant. Impedance spectroscopy can also provide a suitable method to benchmark the effects of charge-injection-induced surface manipulation, as reflected in the capacitance and resistance of the interfacial layer.
(187) d. Biomaterial Detection and Manipulation Results and Discussion
(188) i. Quasistatic Readout
(189)
(190) In a separate study, depicted in
(191)
for the choice of capacitance ratios used in this study and also without the need for a continuously applied CG bias (part I). Such fields, as described in detail above, can lead to shifts in .sub.O of 50-70 mV (pH.sub.B=8) during readout.
(192) Once the FG is programmed or erased and DNA is added, the reference electrode and CG are temporarily floated prior to sweeping the CG bias for readout (i.e. a standby state). .sub.O strongly tracks V.sub.FG during this period, primarily due to the strong capacitive coupling between SG and FG and weak coupling to the bulk. It is noted that the source and drain connections are not perturbed during and due to the extremely small capacitance coupling to the FG have a negligible influence on V.sub.FG, V.sub.FG is then predominantly defined by
(193)
which under the given conditions can reach values 0.2-0.3V just prior to the readout sweep. Such dramatic changes in surface potential can strongly influence the nature of DNA immobilization and manipulation, as interaction with a PLL-coated surface is mainly electrostatic in nature. It is interesting to note that the ideal condition would demand a low SG/CG and a large CG/FG coupling ratio to ensure maximal field modulation by injected charge. This however will affect the sensitivity to analyte detection. Hence it poses a design tradeoff.
(194) In
(195) Buffer was first dispensed and the I/V responses were recorded during the programming and erasing cycles. A significant V.sub.th_CG shift of 8V was observed implying +8 pC of stored charge (see
(196) Once a hybridization signal was recorded after 40 min, a pipette was introduced filled with fresh buffer and gently sloshed back and forth 34 times till the entire buffer was replaced in order to remove loosely bound DNA. No V.sub.th_CG shift was observed (see
(197) The effects of programming and erasing FG were compared with and without buffer exchange. The measurements indicated that after electrons were injected and subsequently erased and without replacing the buffer, V.sub.th_CG recovered to the same point. Complete V.sub.th_CG recovery was obtained only with electron injection and buffer exchange. This suggested that injection manipulated and weakened the DNA surface interaction, allowing complete desorption during the buffer replacement. However without buffer exchange, DNA would be re-adsorbed.
(198) During the initial rising CG pulse, V.sub.FG increases and after 10 ms significant amount of electrons begin to tunnel onto the FG. This electron accumulation in turn reduces V.sub.FG (i.e. a negative feedback). When the CG and reference electrode are momentarily open circuited prior to readout, V.sub.FG is highly negative and strongly couples to the SG as previously mentioned. DNA is then strongly manipulated, i.e. DNA manipulation possibly occurred even before a steady state condition (readout) was reached.
(199) ii. The DNA Transistor Interface Model
(200) In order to corroborate the potential shifts and understand the true nature of the observed signals, the DNA interface stack was simulated using the following approach (see
(201)
(202) where .sub.DNA is a constant background charge, i.e. similar to how dopants in a semiconductor are treated. Ions are mobile and are akin to electrons and holes. Equation 21 is then reformulated into the form;
(203)
(204) where .sub.eff is the effective permittivity of the DNA membrane and the subscript represents the boundary between the DNA and bulk electrolyte presented in
(205)
(206) where .sub.eE.sub.1=E.sub.2 across the DNA electrolyte interface as a discontinuity in the E-field would exist due to the differences in permittivity. Here is the dielectric constant of water and E.sub.2 represents the field condition in the electrolyte across the DNA membrane. Combing Eq. (22) and Eq. 23;
(207)
(208) In order to describe the physical mechanisms of signal generation when DNA adsorbs to the surface of the transistor two approaches are examined. In the first approach using Eq. (24) the screening models inside and outside the membrane are treated differently while permittivities are the same i.e. .sub.eff= throughout. The Debye-Huckel (DH) in Eq. (25) and Poisson-Boltzmann (PB) in Eq. (26) formulations are compared both inside and outside the membrane and solve Eq. (24) self consistently in a background DNA volume charge density of
(209)
as shown in
(210)
(211) First considered is the effect of different ion screening profiles in the DNA layer. It is found that when the DH approximation is used within the membrane .sub.O varies a lot more in comparison to the PB model (see
(212) Other groups treated the ionic screening inside the DNA membrane using a partition energy (G.sub.m) formulation with the PB approximation. In
(213)
(214) where a is the ion radius and z is the valency. For a=1.1 , z1, .sub.medium=80 and .sub.eff=20, on find G.sub.m=0.243 eV.
(215) Ion hydration and polarization effects at the SG interface have not been considered here, but such effects can further riddle the measured .sub.O. A large negative G.sub.m implies a lower ion charge density within the DNA membrane as it is energetically favorable and hence less screening. Such effects have been considered to be orientation dependent and are stronger with the strands parallel to the SG interface and/or tightly packed. This leads to a qualitatively similar result to the DH model but is mathematically more robust. From the measurements presented in
(216) Nevertheless, a clear relation between G.sub.m and the E-field is still lacking and is currently work in progress.
(217) iii. On Dual Gate Operation .sub.O Amplification
(218) CG driven .sub.O shifts of 120-300 mV were observed upon ssDNA addition and a further 100 mV shift upon hybridization. Conventional GCS theory cannot account for such large .sub.O shifts due to strong nonlinear screening. From measurements presented earlier is extracted an average charge density of
(219)
(immobilized ssDNA) and a subsequent
(220)
during hybridization. With traditional ISFET's however, DNA adsorption and hybridization normally reveal .sub.O shifts of 40 mV and 5-20 mV, respectively. The plausible reasons for such differences are as follows: (i) .sub.O, although influenced by the Donnan potential, also depends on the surface pH response, since a pure Nernstian response would effectively screen any membrane charge from the FG. The pH response of the CvMOS is extremely non-Nernstian with and without a PLL coating and pH.sub.PZC was found to be closer to pH 9 (not shown). The PLL coating in addition neutralizes most of the surface charge and also makes it slightly positive resulting in a non-monotonic and weak pH response especially around pH.sub.PZC (low N.sub.S in Part I). This can enhance the Donnan effect, and thereby lead to larger surface potential. (ii) The Born charge dielectric function can play a significant role in amplifying the .sub.O shift, (iii) The high surface charge of
(221)
normally used for SiO.sub.2 [3] is orders of magnitude higher than the surface charge density observed in this study
(222)
for polysilicon with and without PLL. Such high sheet charge densities can lead to high negative .sub.O potentials, screen out most of the DNA charge and often interfere with DNA immobilization affecting the Donnan equilibrium and orientation. (iv) Majority of ISFET sensors use a constant readout current when monitoring DNA binding and hybridization. This implies a constant field across the gate oxide between the 2D electron/hole gas in the channel and the reference electrode. In the CvMOS due to the different E.sub.SG_OX conditions when driven from the CG, .sub.O can vary by a few
(223)
This can influence DNA immobilization slue to Coulombic interactions, resulting in counter ion descreening and re-orientation on the surface, interfacial polarization can cause further modulation.
(224) Using the circuit representation shown in
(225)
(226) when V.sub.REF is grounded and the CG is driven. On the other hand;
(227)
(228) when V.sub.REF is driven and the CC is rounded. In the case when V.sub.REF is floating, the change in .sub.O can be written as;
(229)
(230) One readily notices that the readout mechanism can severely affect the measured .sub.O. For example, CG and V.sub.REF readouts are dominated by the diffusive capacitance. The equations seemingly imply that V.sub.REF readout would always result in a slightly higher .sub.O. However, Q.sub.DNA+Q.sub.ions which makes up Q, can be different under different E.sub.SG_OX, which can arise when V.sub.th is measured from the reference electrode as opposed to CG. Hence, by appropriate sizing of the CG and SG areas, the sensitivity to DNA detection can be maximized by engineering the Q dependence on E-field. Additionally when V.sub.REF is floating, .sub.O can swing (150 mV) a lot more (see
(231) iv. Impedance Spectroscopy
(232) In order to further validate DNA desorption upon charge injection, impedance spectroscopy was performed, which probes the dielectric properties of the interface and is not dependent on surface potential and pH fluctuations. This test would help ascertain whether DNA truly desorbs as monitored by the interfacial impedance change. By using the split-gate approach (see methods), the small-signal output is monitored through a lock-in amplifier. An important point is that the bandwidth is determined by the combined effect of the floating gate based transistor gate stack and the parasitic FG to bulk capacitance, leading to a roll-off at approximately 300 KHz, well within the lock-in amplifier and TIA bandwidth. Recently the overall time constant of the Bode response was reported and also shown to be dependent on the contact-lane capacitance (10 nF) and electrolyte resistance, which results in the first pole at fairly low (KHz) frequencies. In the present study however the bandwidth of the overall response was limited by the external amplifier. The contact-lane capacitance consists of the source-drain contact line parasitics in parallel to the gate oxide capacitance. SPICE simulations with estimated parameters depict this behavior qualitatively. An increase in the interface capacitance would move Z.sub.1 lower and increase the impedance. An increase in interfacial resistance would move P.sub.1 lower with a higher time constant. Impedimetric responses were monitored for 2 different DNA lengths (24 and 48 bP). The Bode response with only buffer was recorded and used as a baseline. Strand D1 immobilization revealed a net increase in the interfacial resistance (parallel shift in P.sub.1). Upon complimentary (D2) strand addition. P.sub.1 was seen to move further in with the clear formation of Z.sub.1, indicating relaxation of the adsorbed DNA film illustrated in
(233) Upon programming (electron injection) the FG, a recovery was observed of P.sub.1 and Z.sub.1 to their respective initial points of pure buffer. This is in agreement with the quasi-static analysis where a recovery of .sub.O was observed. Impedimetric spectroscopy using FET's at a constant operating point is immune to any drift in solution pH and reliably probes the dielectric properties and local molecular structure. The impedance technique could potentially be used to ascertain local interactions between DNA and proteins where charge and capacitance can be concomitantly detected, and serve as a versatile test bench in biophysical applications.
(234) 2. DNA Detection for Diagnostics
(235) a. Introduction
(236) Diagnostics plays a central role in modern slay medicinal practice as it enables informed treatment decisions, and helps monitor disease state and promises effective viral and bacterial screening procedures, among many, many other uses. Data that is collected also helps ensure emergency public health interventions and long-term public health strategies. In developing countries access to hospitals and advanced diagnostic centers are mainly relegated to big cities. Providing suitable treatment procedures, laboratories, timely diagnosis and skilled personnel in interior villages, towns and smaller cities is thus difficult. Furthermore the lack of basic infrastructure such as water, storage, transport, electricity and communication makes diagnostics and treatment a hard task in resource limited settings. Under such conditions the utility and importance of point of care (POC) diagnosis becomes critical. Point-of-care (POC) detection, i.e. testing carried at or near the site of the patient, is thus an extremely attractive option offering increased access to tests for infectious diseases such as HIV, malaria, tuberculosis, and sexually transmitted infections.
(237) Recently there have been a number of reports outlining the use of NATs (Nucleic Acid Tests) for the diagnosis and therapeutic monitoring of infections. Such methods are sensitive and allow identification of specific fragments of infectious agent genome. In comparison to immunological (antibody based) biomarkers, NAT's exhibit several important practical advantages, including: (1) straightforward design of specific recognition elements (primers and probes) with predictable molecular behaviors including binding affinities, and (2) compatibility with enzymatic target amplification methods. Amplification techniques such as the polymerase chain reaction (PCR), as well as isothermal amplification methods such as ligase-chain reaction (LCR), nucleic acid sequence-based amplification (NASBA) and transcription-mediated amplification (TMA) are widely used for genomic screening of viruses such as hepatitis C (HCV) and HIV. Most of these amplification procedures use enzymes, for example polymerases, which are effective for target amplification of nucleic acids but introduce important challenges for POC detection. Specifically, enzymes often require refrigeration for transport, storage, and handling. PCR, probably the most widely used method, demands careful temperature control rendering micro and nanoscale integration challenging. Approaches that avoid enzymes and thermal control however are slowly gaining precedence. Although still in the early stages of development, enzyme free approaches represent one important step towards the development of novel POC diagnostics.
(238) Over the last few years POC readout has been widely researched and actively sought through optical, mechanical and electrical means. One method of electrochemical readout that is particularly attractive for diagnostics is the use of field effect transistors (FET's) that transduce biochemical and ionic changes to current through surface charge based sensing. However, direct molecular charge transduction is known to be affected by Debye screening effects close to the sensing interface. Strong nonlinear screening of surface charge due to mobile counterions in the electrolyte causes a rapid decay in surface potential emanating from the sensing interface into the bulk electrolyte. The transistor is sensitive to molecular charges only within this effective length. As the screening effect becomes stronger under moderate to high saline conditions the Debye length reduces and the net sensitivity to molecular charge lowers. It is important to note that DNA hybridization and recognition is most effective under high saline conditions where inter-strand repulsion is lowest, but this scenario would entail strong Debye screening and hence lower the charge sensitivity. Nonetheless we do point out that such charge based sensing schemes have been realized and shown to be massively scalable and highly sensitive when combined with PCR and isothermal amplification strategies. Sensing in such cases is rendered possible through the intrinsic surface proton sensitivity, amplified molecular density and nanowire surface to volume effects to improve the response rendering it suitable for POC. There however has been no report to the best of our knowledge on coupling enzyme and temperature free DNA amplification strategies with transistor readout. Impedimetric detection can potentially overcome the screening capacitance limited response of potentiometric sensors by probing signals at higher frequencies beyond the Debye layer relaxation limit. Most of these studies however use standalone metal electrodes with off-chip amplification. Over the last few years however there have been reports that essentially combine transistors with frequency mode operation pushing the limits of FET based biosensing beyond the screening limited regime. Under moderate saline conditions, this would allow for simultaneous charge and impedance sensing. At this point, two questions are asked; (1) is it possible to detect low concentrations of pathogenic DNA using a non-enzymatic and non-PCR based approach using transistor frequency mode readout; and (2) what are the essential molecular features that one captures with such frequency mode operations.
(239) In this section, therefore, is introduced the use of branched Y-DNA monomers as molecular labels which upon hybridization with pathogenic targets self-assemble into aggregates. This aggregation effect is readout using frequency mode operation of the floating gate based sensor apparatus in accordance with the embodiments. The frequency response (Bode plot) of the transistor characterized by poles and zeros are sensitive to the net change in interfacial AC resistance and capacitance, a consequence of increased fragment size. Also examined is the effect of aiding Au nanoparticle labels sensitized with capture probes in addition to Y-DNA monomers as an additional amplifying strategy.
(240) According to an embodiment of the floating gate based sensor apparatus approach for diagnostics, branched Y-DNA monomers are tagged with specific short ss-DNA capture sequences at each end of the Y-core, exhibiting only a partial match to the target. Upon ss-target (pathogen) addition, end probes on each branch of the Y-DNA monomer hybridize with the corresponding set of sequences on the target strand. This reaction is extremely efficient due to the kinetics of solution phase hybridization. Two Y-DNA monomers are thus linked to each other through a single target sequence. This causes a linkage between different monomer-target formations which results in aggregates with distinct molecular weight and size. This is in stark contrast to mismatched Y-DNA fragments, which remain disassociated in the solution. Unlike existing assays that use branched DNA, this method is immobilization and enzyme free.
(241) In one series of experiments demonstrating the effectiveness of the approach, a prototypical pathogen target is chosen, namely a nucleic acid sequence from a conserved region of the HIV genome. Y-DNA nanostructures tagged with capture sequences were treated with both complimentary and non-complimentary target sequences in 500 mM saline conditions in order to ensure maximum hybridization efficiency. In order to ascertain this molecular specific reaction electrochemically, the aggregates were dispensed onto floating gate ion-sensitive transistors and biosensing was performed by probing the TF. The pole (p1) was found to be extremely sensitive to the resistive component of the AC impedance of the molecule-transistor interface while the zero (z1) was determined by the DNA aggregate relaxations, reflective of capacitive effects. At low target concentrations (100 fM) the Y-DNA-target interaction resulted in an increase in the interfacial resistance reflected by a clear shift in p1, dominated by the un-reacted monomer surface density. Increasing the target concentration lowered p1 but increased z1. This indicates that as aggregation occurs the resistive component at the interface reduces while capacitive effects begin (ex, counter ion polarization) to dominate. This effect is reasoned on the hypothesis of increased polarization due to amplified molecular weight. Relaxations in the KHz range were observed. Addition of capture sequence tagged Au nano-particles was found to further increase the sensitivity due to increased polarization and aggregate size, improving the limit of target detection to 100 fM.
(242) b. Materials and Methods
(243) i. Transistors and Operating Principles
(244) Floating gate based transistors in accordance with the embodiments were fabricated in a 1.5 m AMI foundry process as described above. According to an embodiment, the transistors were comprised of independently tunable control (CG) and sensing (SG) gates coupled to a common floating gate (FG). The tunnel oxide i.e. the oxide between the channel and the FG is 10 nm thick, while the control oxide which represents the oxide between the CG/SG and FG is 35 nm thick. The CG areas measured 25 m40 m while SG areas varied between 5 m400 m and 200 m400 m. The FG is sandwiched between the control and tunnel oxides and is thus electrically floating. The reference electrode (Ag/AgCl, Warner instruments) pins the electrolyte bulk to a defined electrochemical potential (V.sub.REF) and also supplies a global small signal AC perturbation. The CG is used to ascertain the threshold voltage (V.sub.TH) set the quiescent point and provide additional voltage offsets if required. This reduces the burden on the reference elctrode to solely provide a DC bias which is important when working with large arrays. It is noted that in the present series of experiments the reference electrode was used to control the DC operating point particularly when dealing with large SG/CG ratios, since the application of high CG biases (10-18V to achieve saturation) can induce tunneling or shift the field in the SG oxide thereby modulating ionic charge, surface pH and DNA binding as previously shown which can complicate the interpretation of the measurement.
(245) The transistor transfer characteristics (i.e. the drain current I.sub.D as a function of the CG bias (V.sub.CG) or (V.sub.REF)) was recorded using Keithley 236 source measure unit (SMU) (Keithley Instruments, USA) for the drain (V.sub.D=1V) and a Keithley 2400 (Keithley Instruments, USA) was used to sweep V.sub.CG. In order to ascertain the impedance response V.sub.CG or V.sub.REF was first tuned to a desired DC value such that the drain current level was maintained in saturation at a predefined value usually set between 10 to 50 A. The drain current output was then fed to a transimpedance amplifier (TIA, SR570 Stanford research systems, USA) with a suitable gain setting such that the output of the amplifier is not saturated. No filter settings were used. The bias on the TIA was set to 1V. The output of the TIA was subsequently fed to two different lock in amplifiers (LIA, SR831 and SR844 Stanford research systems, USA) depending on the frequency range being monitored and the bode response was subsequently recorded and stored. The following equation outlines the TIA output;
v.sub.out=i.sub.DR.sub.D(31)
(246) where R.sub.D is the feedback resistance and v.sub.out is the small signal output of the TIA. In the saturation region of the transistor, the small signal current i.sub.D can be recast in the form g.sub.mv.sub.gs where, v.sub.gs is the small signal gate-to-source voltage and g.sub.m is the small signal transconductance. The gate voltage can be represented in terms of the transfer function across the DNA layer given by the relation, v.sub.gs=H(j)v.sub.in, where v.sub.in is the AC small signal amplitude. The transfer function representing the relaxation across the DNA-transistor interface is represented by the following equation;
(247)
(248) where
(249)
is the effective oxide representing the overall limiting capacitive condition. Here R.sub.sol defines the solution resistance. s=j, C.sub.DNA and R.sub.DNA represent the resistance and capacitance of the DNA membrane, C.sub.ion the FG to channel capacitance, C.sub.SG the sensing gate interpoly oxide capacitance, C.sub.CG the control gate interpoly oxide capacitance. It is noted that the effect of C.sub.line i.e. the source/drain parasitic contact lane capacitances is not considered in the analytical derivation to gain an intuitive understanding of the dominant poles and zeros. However, as explained below these additional source and drain line capacitances are accounted for in SPICE simulations to elucidate the overall limiting behavior at higher frequencies and in the limit of poor passivation. The analytical transfer function without accounting for C.sub.line represents a two poles and one zero defined by the following three equations. With line capacitances included, the system comprises of two zeros and three poles (not shown) and will be presented elsewhere.
(250)
(251) The CG or reference electrode is re-biased in order to maintain the quiescent point and hence the current level a constant (i.e. constant V.sub.FG). The V.sub.FG is given by the below equation where C.sub.GS and C.sub.GD represent the gate to source/drain parasitics, V.sub.S and V.sub.D the source and drain potentials, .sub.O the SG surface potential, C.sub.T the total capacitance in the system and Q the stored charge on the FG.
(252)
(253) The AC small signal perturbation however is solely supplied by the reference electrode and superimposed on the DC bias whenever applied.
(254) iii. Reagents
(255) The chip was cleaned with DI water and isopropyl-alcohol (IPA) before each test. A small reservoir made of epoxy was created to isolate the fluid from the bond pads. In between experiments with DNA, each chip was additionally treated with soap and gently swabbed to remove any residual DNA. The chips were subsequently treated with Poly-L-Lysine (SIGMA, USA) in order to ensure attraction of monomer aggregates to the sensing surface. Both target fragments and monomer DNA were maintained in TE buffer (10 mM TRIS pH 8, 500 mM NaCl and 1 mM EDTA) which was also used as the blank solution to ascertain the baseline for every experiment. Y-DNA monomers were prepared as follows, three single-stranded DNA molecules were rationally designed with specific sequences such that each was partially complementary to another. These single-stranded DNA molecules were mixed in an equimolar ratio, resulting in self-annealed, branched, Y-shaped DNA (Y-DNA). Each branch of the Y-DNA (see Table 2) contains a sequence partially specific to the target of interest which in this case represents a conserved region from the HIV genome (50 bp, Table 2). Y-DNA monomers were mixed with target (50 bp, Table 2) to a final concentration of 3.3 nM for each of the 3 Y-DNA and 5 Y-DNA causing rapid aggregation within 15-20 minutes of treatment. Y-DNA monomer concentrations were maintained at 6.6 nM while the target concentrations varied in order to test for the limit of detection (LOD). Hybridization was performed in solution phase and then dispensed on the CMOS chip. Au nano-particles (Au-NP) (10 nM for 3AuNP and 10 nM for the 5AuNP) 15 nm diameter were synthesized in-house using previously published methods.sup.29 and made up to a final concentration of 20 nM. The samples were treated with capture sequences specific to the HIV target and subsequently added to the monomer mixture. Each nanoparticle had approximately 100 capture probes. Gel electrophoresis (Bio-RAD Laboratories, USA) and dynamic light scattering (DLS) (Zetasizer, Malvern UK) studies were performed to ascertain aggregation for both Y-DNA and AuNP Y-DNA mixtures under different target and salt conditions. For the DLS and gel studies the Y-DNA and AuNP's were diluted to final concentrations of 13.3 nM and 39.5 nM respectively. Target concentrations used in gel electrophoresis measurements were 1 M. Experiments with transistors were then performed in a light-tight environment.
(256) TABLE-US-00002 TABLE2 DNASTRAND SEQUENCE Y1HIV5 CTCATTGATGGTCTCTTTTTTTTTGGATCCG CATGACATTCGCCGTAAG (SEQIDNO.7) Y2HIV5 CTCATTGATGGTCTCTTTTTTTTCTTACGGC GAATGACCGAATCAGCCT (SEQIDNO.8) Y3HIV5 CTCATTGATGGTCTCTTTTTTTTAGGCTGAT TCGGTTCATGCGGATCCA (SEQIDNO:9) Y1HIV3 TGGATCCGCATGACATTCGCCGTAAGTTTTT CAATCTATCCCATTCTGC (SEQIDNO.10) Y2HIV3 CTTACGGCGAATGACCGAATCAGCCTTTTTT CAATCTATCCCATTCTGC (SEQIDNO:11) Y3HIV3 AGGCTGATTCGGTTCATGCGGATCCATTTTT CAATCTATCCCATTCTGC (SEQIDNO:12) HIVtarget(50bp) TGTTAAAAGAGACCATCAATGAGGAAGCTGC AGAATGGGATAGATTGCAT (SEQIDNO:13) 5HIVcapture TTCCTCATTGATGGTCTCTTTTAACATTTTT probeforAuNP /3ThioMC3-D/(SEQIDNO.14) 3HIVcapture /5ThioMC6-D/TTTTTATGCAATCTCCC probeforAuNP ATTCTGCAGC(SEQIDNO.15)
(257) c. Results and Discussion for DNA Diagnostic Embodiments
(258) i. Simulating the Frequency Response of the CvMOS
(259) The frequency response of the floating gate based sensor apparatus was simulated using the split signal delivery method in SPICE including physical descriptions for the double layer, DNA layer and surface hydroxyl ionization. Since the electrolyte is highly conductive, R.sub.sol5 K was set. C.sub.CG and C.sub.SG are set to 1 pF and 20 pF respectively. From the frequency response it was observed that the zero (z1) is critically dependent on C.sub.DNA while the pole (p1) is highly sensitive to R.sub.DNA (see
(260) ii. Y-DNA Aggregation and the Effect of AuNP's
(261) Gel-electrophoresis measurements were first performed on Y-DNA monomer under different conditions. A large smear was observed (see
(262) iii. Floating Gate Based Frequency Response to Y-DNA Aggregate Addition
(263) Samples were first exposed to target pathogen and allowed to react in a pellet. The mixture was then subsequently added to PLL functionalized CMOS chips. As shown in
(264)
(265)
(266) iv. Floating Gate Based Sensor Apparatus Frequency Response to AuNP-Y-DNA Aggregate Addition
(267) In order to increase the LOD, the effect of aiding capture probe functionalized AuNP tags to the Y-DNA mixture was tested and ascertained its effect on aggregate formation. As shown in
(268) Accordingly, the transistor-based impedimetric detection of pathogenic DNA, amplified by branched monomer self-assembly, and was successfully carried out under high saline conditions, which is required for nucleic acid hybridization but is not compatible with most/many alternative electrochemical approaches. Branched Y-DNA monomers tagged with 3 and 5 capture probes bind to ss-DNA targets, driven by nucleic acid hybridization, eventually culminating in rapid aggregation among different Y-DNA-target species. The reaction proceeded rapidly due to the kinetics of solution phase hybridization to form aggregates within minutes of target addition at room temperature. The aggregates were then dispensed on the sensing gates of CvMOS transistors. A new split signal delivery methodology was outlined using CvMOS transistors where the AC small signal perturbation and DC bias to set the quiescent point were delivered through independent gates. Aggregate relaxation was reflected by a clear shift in the pole-zero response. A roll-off in signal amplitude with a corresponding peak in phase was observed with increasing frequencies, indicative of relaxations. These relaxations were found to be highly dependent on the amplified molecular mass. AuNP tags coated with capture probes were additionally added to ascertain any effects on the LOD. A clear enhancement in LOD was observed (100 fM) along with distinct relaxation effects. Taken together the results suggest a non-enzymatic and temperature free method of enhancing hybridization signals coupled with rapid frequency mode transistor operation.
(269) 3. Exocytosis Detection Using Floating Gate Based Sensor Apparatus
(270) a. Introduction
(271) According to yet another embodiment is the use of floating gate based sensor apparatus for exocytosis detection, including the non-faradaic electrochemical detection of exocytosis. According to an embodiment is the detection of exocytosis from mast and chromaffin cells using the floating gate based sensor apparatus.
(272) Synaptic interactions and cell to cell communication in the human body are frequently characterized by the release of charged hormones and transmitters which impinge on specific receptor molecules encoded on the target cell. Depending on the excitable nature, cells respond to these chemical inputs by either further releasing granules containing charged molecules or inducing an electrical wave such as an action potential (AP). These granules are often termed as vesicles. The mechanism of vesicle fusion with the cell plasma membrane upon stimulation and subsequent release of the granular contents (i.e. in the form of quanta) into the extracellular environment is termed exocytosis and is characterized by a distinctive temporal response. Exocytosis recordings are also often employed as indicators of drug action on cells. For example, amperometric recordings have shown that the Parkinson's drug L-Dopa increases the quantal size. There is thus a need to develop high throughput, scalable and multi-functional electronic instrumentation in order to characterize the action of various pharmacological inhibitors, toxins and stimulants on vesicle release. Transmitter and granular release can be specifically induced or inhibited depending on the cell type under study. In immune cells such as mast cells, exocytosis can be induced through a receptor effector function where a specific antigen receptor interaction causes a signal cascade within the cell, culminating in the release of mediators and hormones which causes an allergic response. In neurons on the contrary, electrical excitations in the form of action potentials (AP) propagate along the axon and stimulate neurotransmitter release in the region between the axon terminus of the pre-synaptic neuron and the dendritic spine of the post-synaptic neuron called the synapse. The released transmitters impinge on specific receptors on the post-synaptic neuron inducing another electrical excitation and hence forth. With mast cells the released hormones impinge on cells expressing specific receptors (example the histamine receptor on smooth muscle cells) and elicit a downstream response.
(273) According to an embodiment are provided experiments creating a CMOS sensor capable of detecting degranulation from mast cells, where it can function as an electronic cell assay and also mimic the downstream communication in the post-synaptic excitable cell. Thus the transmitter-receptor induced electrical excitation is replaced by an electronic analogue. Such a system not only provides a test bench for fundamental studies on exocytosis but also monitors cell-specific molecular and electrical events with high temporal resolution. This is paramount in understanding cellular kinetics and establishing rapid screening procedures. It also sets a possible launch pad for future artificial synapse systems and ionic-electronic interfacing circuitry.
(274) Current methods of monitoring exocytosis include fluorescent techniques, and carbon-fiber amperometry. The fluorescent technique often requires labels which increases the complexity of the experiment. On the other hand, amperometry is prone to noise due to the low current levels, requires highly sensitive low-noise amplifiers, relies on faradaic chemistry for detection, and is challenging to miniaturize in terms of pixel density, although recent efforts have resulted in significant improvements. Non-faradaic transistor-based measurements on the contrary extend the detection capability to chemically inactive molecules, are extremely sensitive to surface adsorption, record cellular signals with a high degree of temporal sensitivity, present a naturally occurring high impedance node due to the gate oxide, and render sub-cellular spatial resolution with very low input referred noise characteristics. Previous work on transistor-based cellular sensing has primarily focused on recording signals upon stimulation from excitatory cells such cardiac myocytes and nerve cells. Recently others extended this approach to detect antigen-stimulated T-cell activation detection by CMOS-compatible semiconducting nanowire sensors.
(275) The ISFET-cell interface has been widely researched over the past decade. Typically the cell forms a high impedance seal at the ISFET interface and the voltage within the cleft acts as a secondary gate input to the transistor. Changes in ionic activity sets up a transmembrane potential within the cleft which capacitively influences the transistor output, while surface chemical changes such as pH or molecular binding directly influence the net surface charge.
(276) Limitations of this approach include the lack of independent control of the transistor operating point. Controlling the ISFET operating point traditionally relies either on the reference electrode bias or via source barrier modulation, but running a large voltage across the cell from a reference electrode will potentially influence or even destroy the cell by electroporation. This presents a reliability challenge and limits the choice of supporting signal conditioning circuitry. Also with cells directly immobilized on gate oxide, long-term drift associated with ion penetration into the active region is a serious issue which can potentially lead to deleterious effects during measurement. Recent strides in CMOS technology nonetheless allows the use of metal layers and vias to isolate the transistor channel from the sensing region which has shown promising results. One drawback, however, is that, top metal interfaces lack chemical specificity to ionic and molecular adsorption, unless specific functionalized coatings are used.
(277) Another class of sensors uses nanowire/nanotube channels, as opposed to the ISFET's buried channel, to improve sensitivity due to stronger electrostatic coupling. The transistor operating point however is still modulated by either the reference electrode or a global back gate which sets a limitation on sensitivity tuning for each individual transistor. This scheme further imposes restrictions on control circuitry integration. While there have been recent efforts towards creating independent local gate control to achieve tunability during operation, a highly sensitive, stable, scalable and addressable transducing scheme is still elusive. In this series of experiments is demonstrated CMOS compatible, extended floating gate transistor which serves as an electronic analogue of the downstream communication, i.e., the receptor induced signal cascade. The device permits independent bias control, decouples the sensing region from the active region to allow for independent scaling, and introduces simultaneous charge and impedance readout to record cellular activity.
(278) Accordingly, in one aspect is investigation of exocytosis utilizing one or more of the CvMOS systems described and/or envisioned herein. To demonstrate the efficacy of the CvMOS transistor as a non-invasive synaptic input, exocytosis upon stimulation from non-excitatory RBL mast cells and excitatory chromaffin cells of the bovine adrenal medulla was monitored.
(279) The rat basophilic leukemia cell (RBL-2H3) is a tumor cell line used frequently as an experimental model for mucosal mast cells. The release of inflammatory mediators from mast cells is the primary event in an allergic response. They serve as a robust model for understanding the underlying biophysical and biochemical mechanism which couples signals originating at the membrane receptor with a biological effector function. Immunoglobulins of the IgE class serve as antigenic receptors which are anchored to cells via the membrane protein complex FcRI. Upon stimulation with DNP BSA (2,4 Dinitrophenyl Bovine Serum Albumin), the receptor crosslink causes a signal cascade within the cell, which eventually culminates in the secretion of preformed mediators stored in the cellular granules. Mast cells form a specialized niche of the immune system, because the triggered cellular activity is immediate. Depending on the particular type of mast cells or basophil's, secretion occurs within seconds to minutes following the IgE cross linking step. Mast cells also provide a meaningful model for cell activation by an immunological stimulus, i.e., by an antibody-antigen reaction.
(280) To complement the non-excitatory cell study, the device detection capability is further demonstrated against the stimulatory responses from excitatory cells such as the chromaffin cell to study neurotransmitter release and related synaptic activity. The chromaffin cell allows the study of stimulus secretion coupling as mediated by both calcium entry and voltage gated channels, i.e., exocytosis induced by depolarization. Transistor recording of vesicle release from chromaffin cells was demonstrated recently using open-gate ISFET's. The recorded signal was attributed solely to the change in the local pH across the double-layer interface which leads to protonation of the surface and hence a change in surface potential. In this work in addition to pH dependent signal generation mechanisms is provides evidence and suggest direct molecular binding to the sensor surface as a signal generating mechanism.
(281) Also presented are non-faradaic electrochemical recordings of exocytosis using floating-gate MOS transistors on a population of mast and chromaffin cells. The floating gate based sensor apparatus allows the quiescent point to be independently controlled and physically isolates the transistor channel from the electrolyte which is critical for stable long-term recordings. The efficacy of this approach is first demonstrated by measuring the degranulation response on a population of RBL-2H3 mast cells mediated by IgE and its high-affinity cell surface receptor FcRI using the antigen DNP-BSA. Quasi-static I-V measurements reflected a gradual shift in surface potential (.sub.O) upon stimulation which was found to be strongly dependent on extracellular calcium ([Ca].sub.o) and buffer strength, suggesting vesicular release with significant proton content. Unsensitized cells showed no response to antigenic stimulation while high-resolution transient recordings revealed current fluctuations with a rapid rise and slowly varying re-equilibration time scales. Fluorescent imaging of dextran-labeled vesicle release performed separately showed evidence of a similar time course after stimulation, indicating that the transistor was recording a coupled stimulus-secretion effect. Extending the study to bovine chromaffin cells, a gradual shift in surface potential is observed accompanied by rapid current fluctuations in response to KCl stimulation, which implies the presence of both action potentials (AP) and molecular release. The extracellular AP response comprised of both biphasic and inverted capacitive waveforms indicative of varying ion channel distributions across the cell membrane and the cell-transistor junction. The approach presents a facile route to realize non-redox based biosensors in commercial CMOS, capable of detecting chemically active or inactive hormones, neurotransmitters and ion channel currents with minimal invasiveness and localized sensitivity control.
(282) b. Materials and Methods
(283) i. Cell Culture and Buffer Conditions
(284) RBL-2113 cells were maintained in a monolayer culture in Minimum Essential Medium, supplemented with 10% fetal bovine serum (Atlanta Biologicals, Norcross, Ga.), 1 ml/liter mito+ serum extender (Collaborative Biomedical Products, Bedford, Mass.), and 10 mg/ml gentamicin. Typically, cells were used in 3-5 days after passage. The cells were treated with IgE (2 g/ml) for 1 hour at 37 C. and then re-suspended in tyrodes before dispensing them over native SG surfaces. Experiments were performed at 37 C. using variable buffer (HEPES) with concentration ranging between 5 mM and 40 mM. The cells were stimulated by DNP BSA (Sigma) (1 g/ml). The temperature was maintained through a carefully calibrated air blower. 1 g/ml monovalent hapten was used to inhibit the degranulation, serving as a negative control. Bovine adrenal glands were obtained from a local slaughterhouse and prepared as described elsewhere. Prior to cell immobilization the chips were coated with 0.02% poly-l-lysine (Sigma) and used only within the first two days of cell preparation. Cells were subsequently dispensed onto transistors in a background of ringer's solution containing 150 mM NaCl, 10 mM Hepes, 5 mMCaCl.sub.2, 5 mM KCl, and 2 mM MgCl.sub.2 (pH 7.25) (318 mOsm). Ringer's solution (318 mOsm) with reduced sodium chloride (10%) and n-methyl-glucamine (NMG) (90%) were used to test for the occurrence of AP's. Cells were stimulated by adding high KCl (200 mM) globally to the bath such that final KCl concentration was about 80100 mM. Experiments on the chromaffin cells were performed at room temperature.
(285) ii. Fluorescent Imaging of Vesicle Release
(286) RBL-2H3 mast cells were loaded with 2 mg/ml FITC-dextran overnight, 200 M serotonin and sensitized with 1 g/ml IgE. On the following day, the cells were washed repeatedly with tyrodes-BSA before antigenic stimulation. A confocal microscope (Zeiss, Germany) with an immersion lens (60, oil lens) was used for imaging. The temperature was maintained at 37 C. throughout the experiment using a combination of an objective heater and heated chamber.
(287) iii. Transistors, Instrumentation and Measurement Setup
(288) The chips were fabricated in a 1.5 m foundry CMOS (AMS) double-poly process with SG exposed and the rest of the chip covered with a 2 m polymer insulation. The first polysilicon layer forms the FG while the second polysilicon layer forms the CG and SG. The SG interface is exposed to bio-media while the CG is buried below insulation. The control oxide thickness (i.e. interpoly oxide) is 35 nm, the tunnel oxide (i.e. between the PG and channel) is 10 nm, and the capacitance ratio between SG and CG
(289)
ranges between 2 and 25 for various designs. SG areas on the chip ranges between 400 m200 m to 400 m5 m while the CG areas are 40 m25 m. The devices have an active channel area of 3 m2 m.
(290) Three distinct measurement procedures were performed, quasi-static I/V sweeps for monitoring gradual changes in surface potential (.sub.O), high-resolution transient recordings of extracellular secretory activity, and impedimetric detection of the SG interface. For I/V measurements, we used a semiconductor parameter analyzer (HP 4145 B) with the drain voltage (V.sub.D) kept constant at 1V across all measurements. The transient measurements at a fixed CG bias was recorded by interfacing the transistor to a trans-impedance amplifier (TIA, Stanford Research Systems SR570, CA, USA) with a sensitivity ranging between
(291)
depending on the relative current magnitude, drift over time and the resolution of the data acquisition system (NI BNC 2110 and NI USB 6259). During transient analysis the signals were high-pass filtered at 1 Hz unless specified and low-pass filtered at 3 KHz before sampling to reduce the aliasing effects. Further analysis and filtering was done through custom software. Before every measurement, the transconductance g.sub.m observed from both the CG and SG was recorded in order to calibrate the sensitivity and accurately estimate .sub.O. For the devices used, g.sub.m observed from the SG was found to range between 0.01-0.3 mA/V, limited by parasitics and interface characteristics after repeated cleaning and lysine addition. Impedance measurements monitored the small-signal transistor gain as a function of frequency. The AC sinusoid was supplied by a function generator (Stanford Research Systems DS345, CA, USA) through the Ag/AgCl reference electrode (Warner instruments, USA), while the DC bias (quiescent point) was set by the CG independently (Keithley 2400, USA). The transistor output was fed to a lock-in amplifier (LIA, Stanford Research Systems SR844, CA USA) through the TIA, hence monitoring the root-mean-square voltage V.sub.RMS as a function of frequency. The sensitivity of the TIA was adjusted so as to avoid saturating the LIA input and was operated under the high bandwidth mode.
(292) c. Floating Gate Based Sensor Apparatus Detection Principles
(293) In a floating gate based sensor apparatus, the FG voltage (V.sub.FG) is set by the weighted sum of the potentials across all its coupled capacitors (Eq. 37) (see
(294)
(295) A small change in .sub.O causes the threshold voltage measured from the CG(V.sub.TH_CG) to be scaled by the amplification factor
(296)
This parameter can be independently tuned with respect to the channel active area which sets the transconductance and frequency response. The nMOS transistor threshold voltage V.sub.TH is usually at 0.8V as measured from V.sub.FG, which is normally fixed in foundry. Independent CG control could help alleviate the need to set such large biases on the reference electrode but still maintain the transistor above V.sub.TH for high g.sub.m. Furthermore, it can be used to overcome sensor mismatch by pixel level re-biasing or tunneling static charge on and off the FG, reducing the need for complex global calibration circuitry.
(297) Prior to every experiment, the reference electrode is used to calibrate the transconductance observed from the SG interface to extract the capacitive ratio. During the quasi-static and transient measurements the immobilized cells act as independent current sources i.e., they either secrete charge or give rise to ionic currents upon stimulation. Protons and molecules released during this secretory process can bind to the surface hydroxyl groups and shift .sub.O. Ionic currents however in conjunction with the cell-transistor cleft resistance give rise to a transient voltage in the vicinity of the SG surface (V.sub.J). A change in V.sub.J modulates .sub.O which modulates V.sub.FG and hence the output current. It is important to note that with non-faradaic detection the secreted charges are not consumed (i.e. they do not undergo a redox reaction) but can rather transiently bind to the SG surface or remain within the cell-transistor cleft until they slowly diffuse out. Impedance spectroscopy monitors a shift in the cell's passive properties via the transfer function (see supporting information). Maintaining constant DC readout current through CG feedback enables pure capacitive detection, as V.sub.FG is held constant.
(298) d. Results and Discussion for an Exocytosis Analysis Embodiment
(299) i. Quasi-Static Measurements
(300) Antigen-mediated cross-linking of FcRI triggers degranulation in mast cells, which eventually results in vesicle release. Cyclic CG voltage sweeps were performed to ascertain the shift in .sub.O upon antigen addition, as shown in
(301) The absence of [Ca].sub.o was found to suppress any shift in .sub.O even when cells were sensitized, which strongly suggested that calcium entry was an important precondition to elicit a stimulation response. It is well known that intracellular calcium oscillations are a pre-requisite for exocytosis to occur. Furthermore unsensitized cells showed no response upon stimulation, while B4A6C1 mutant cells which are known to weakly degranulate did not yield any appreciable change in .sub.O either. These observations asserted that the observed FET signals were indeed a consequence of cellular secretion. An important condition imposed during the above study was the temperature of the experimental set up was regulated to be close to 37 C. When we stimulated IgE sensitizes cells at room temperature under low buffer conditions, the overall .sub.O increased slightly with time rather than decrease (see
(302) Confocal microscopy studies of FITC-dextran-loaded mast cells stimulated under identical conditions was performed confirm the kinetic time scales of the transistor recordings. FITC-dextran, once taken up by the cell, is stored in its secretory vesicles. Due to the low pH within these vesicles, the FITC fluorescence is quenched. The fluorescence intensity increases when exocytosis occurs as the pH of the secreted vesicular content re-equilibrates with the surrounding.
(303) ii. Transient Responses at High Temporal Resolution
(304) In the previous section, the use of quasi-static surface potential measurements described to monitor exocytosis and found that .sub.O gradually shifts on the time scales of minutes after stimulation. While such recordings prove useful to ascertain antigen/receptor interactions, one cannot monitor events occurring on the order of milli-seconds. Quantal release events with such temporal scales are common during exocytosis, which can potentially be captured with transient recordings under constant CG bias. The release of neurotransmitters and hormones is accompanied by a low pH cloud and results in rapidly varying electrochemical potentials in the cell-transistor cleft. The proximity of the cell to the sensing surface strengthens the capacitive coupling and increases the cleft resistance, inducing a strong modulation in the drain current during secretion. Due to the ion-sensitive nature of the SG interface, surface protonation contributes significantly to the readout fluctuation as corroborated in previous studies. This notion however does not rule out the hypothesis that other chemically active and inactive molecules can non-specifically bind to the sensing interface and shift .sub.O further. This can be further calibrated, for example. During exocytosis, molecules are released within the cell transistor cleft and diffuse towards the SG surface causing a shift in .sub.O. This is analogous to a voltammetric signal; however the charge is not consumed in this process. Transient recordings of RBL mast cell stimulation show the expected behavior of a sharp rise and decay within minutes of stimulation (stimulation indicated by grey bar) with DNP BSA, as shown in
(305)
(306) Absence of [Ca].sub.o in tyrodes suppressed these current fluctuations (not shown) while the introduction of monovalent hapten, which is known to disaggregate FcRI clustering, effectively reduced the fluctuation to the baseline. This strongly indicates that the recordings are correlated with IgE cross linking induced signaling.
(307) iii. Signal Amplitudes and Surface Charging
(308) Taking account of both the quasi-static and the transient responses, an attempt to resolve the physical basis of the detected signals is made. For example .sub.O shifts of 5 mV correspond to a net overall interface charge of Q=1 pC10 pC for moderately sized SG (as capacitive ratio ranging 212 and interface specific capacitance of 10 F/cm.sup.2. So this raises the question as to what causes such a large change in surface charge. Firstly, the calculation presented is a conservative estimate for surface charging and does not include surface protonation effects which can also contribute to the signal amplitude and gradual re-equilibration. Also since the secreted histamine is not readily amenable to voltammetric detection due to its redox inactive nature, further suggests molecular binding to the SG surface as a possible signal generation mechanism in addition to pH and mediator release. RBL cells are known to have few vesicles with each vesicle approximately 0.4 m. If each granule contained 0.05 pC which is a reasonable estimate given that secretory cells release 0.1 pC of quanta and a total of 100 vesicles were released from immobilized cells atop the transistor surface, the recordings suggests mV signal amplitudes and that the degranulation response is derived from a collection of vesicles rather than single vesicle events. On an average there are 10-15 cells covering every SG.
(309) iv. Impedance Spectroscopy at the RBL Cell-Transistor Interface
(310) As secretory granules fuse with the plasma membrane during exocytosis, the overall cell area increases in proportion to the extruded vesicular surface area. It is well known that the most biological membranes have a specific capacitance of
(311)
and hence an increase in membrane area directly reflects an increase in overall capacitance. RBL mast cell degranulation is often accompanied by rapid membrane ruffling and morphological changes within minutes of antigenic stimulation, resulting in a slight increase in total membrane capacitance reaching 0.5 pF. This is in stark contrast to traditional rat mast cells which reveal a near 30 pF change due to the lower number of granules in the RBL line. This effect along with granule fusion is normally captured by patch clamp capacitance recordings. Time-resolved impedance measurements thus allow for simultaneous measurements of membrane capacitance and conductance, thus providing a powerful tool to detect such secretion coupling events.
(312) In order to further corroborate cell stimulation and exocytosis detection, experiments were performed in an effort to confirm the overall capacitance shift through impedimetric analysis. Impedance detection along with surface potential was performed using a split excitation technique, see
(313) In
(314) v. The Chromaffin Cell-Transistor Coupling
(315) To further demonstrate exocytosis detection by CvMOS with high-resolution transients, chromaffin cell of the bovine adrenal medulla was chosen as a known exocytotic model albeit through a different mode of stimulation. The chromaffin cell helps serve as a model system of voltage-gated ion-channel activity and exocytosis induced by membrane depolarization. Chromaffin cells are known to secrete catecholamines as a consequence of exocytosis and the granular content is known to be highly acidic which should contribute to a net shift in surface potential upon release. One important difference between the chromaffin and mast cell studies is that the electrical currents in the form of AP can flow in the cell transistor junction as a result of activated ion channel activity in neuro-endocrine cells. In previous transistor-based studies of chromaffin cells, this aspect of signaling (i.e. AP's) was ignored, because it complicates the model to discern independent electrochemical contributions in the cell-transistor cleft.
(316) Chromaffin cells were prepared as described above, re-suspended in ringer's solution and then dispensed on the poly-l-lysine coated SG. After about 4560 minutes after immobilization, a pipette of concentrated KCl was introduced and the solution was flushed to reach the final concentration of KCl around 80 mM. Upon KCl stimulation which causes membrane depolarization, sharp fluctuations in readout current with millisecond time resolution were observed, as shown in
(317) A gradual increase in .sub.O as a function of time upon KCl depolarization was noticed although AP's cease to exist. The rise in .sub.O denotes a net positive surface charging effect similar to the mast cell degranulation study, indicating that secretion and possibly exocytosis is being detected. Also observed were fluctuations in .sub.O with ti re courses typical of delayed diffusion. In the absence of [Ca].sub.o. .sub.O shifts were absent altogether (not shown) while AP waveforms characterized by their milli-second time scales and rapid activity continued to persist, as shown in
(318)
(319) where g.sub.FM represents the conductance in the cell membrane in contact with the transistor SG, g.sub.FM represents the conductance in the free membrane not in contact with the transistor and g.sub.J represents the conductance in the cell-transistor cleft due to displaced ions (the effective seal resistance). Also, i represents the different types of channels (i.e. Na.sup.+, K.sup.+ and leakage channels). The cell thus acts like a current source creating an extracellular potential due to the net resistance in the cleft.
(320) In the model there was a decision to maintain the specific free membrane conductance for Na.sup.+ (G.sub.Na1) and K.sup.+ (G.sub.K1) as 600 pS/m.sup.2 and 200 pS/m.sup.2, respectively, while varying the overall attached membrane conductance (G.sub.Na2 and G.sub.K2) and scaling them by factors ranging from 0 to 2 in steps of 0.2 (i.e. g.sub.Na=G.sub.Na2.Math.k and g.sub.K=G.sub.K2.Math.k) with respect to the attached membrane values (see
(321)
was assumed in the simulation to account for the number of cells on the SG surface. A considerable amount of experimental effort has been previously performed on neurons to elucidate the underlying physical basis of such signals based on ion channel re-distribution, enhancement and depletion.
(322) 4. Proton Sensing and Actuation
(323) According to yet another embodiment is the use of a floating gats based sensor apparatus for detecting and/or actuating protons. Proton detection can be extremely important, for example, from both a physiological (intracellular secreted charge, vesicles, traditional pH meters, blood pH, local extracellular pH) anal industrial (acidity tests in packaged fools) perspective. In the last few years, for example, there has been a surge in interest to develop ion-sensitive sensors for sequencing. ISFET's are used to detect single DNA bases using the intrinsic proton sensitivity of the interface.
(324) According to an embodiment, a floating gate based sensor apparatus biosensor with the appropriate surface will have the ability to boost the proton diffusion into the top few layers of the sensing interface due to stored non-volatile charge (electrons), thus enabling a higher signal-to-noise for pH sensing. Additionally it allows one to tune the surface from being pH-sensitive to pH-insensitive, which is useful when switching between proton detection and intrinsic biomolecular charge detection.
(325) Further, this ability to manipulate the surface charge induces a change in local ion concentration at the surface. As a result, these methods and systems would be very useful in microfluidic drug delivery in which different concentrations of ions can be mixed using field effect control, while simultaneously sensing the effect of the drug. Thus, for example, according to this embodiment, the floating gate based apparatus in accordance with the embodiments could be utilized for both drug screening and drug delivery.
(326) 5. Biomolecular Sensing an Actuation
(327) According to yet another embodiment is the use of a floating gate based sensor apparatus for detecting, desorbing, and/or re-adsorbing one or more biomolecules. As described above, the floating gate based sensor apparatus was utilized for the sensing and dynamic manipulation of surface-immobilized DNA. In a similar manner, the floating gate based sensor apparatus could be utilized for any of a variety of different biomolecules. For example, according to an embodiment, instead of the poly-l-lysine utilized to immobilize the DNA, another compound or agent could be used to coat a portion of the floating gate based sensor apparatus for immobilization of one or more target biomolecules. A variety of other techniques could also be utilized to immobilize or actuate the one or more target biomolecules.
(328) This would be desirable, for example, where the sensor must be re-usable or the surfaces need to be regenerated, as the floating gate based sensor apparatus could be re-used for the same or different biomolecules. This would also be desirable where background false positives should be or need to be reduced. Another benefit of utilizing the floating gate based sensor apparatus for detecting, desorbing, and/or re-adsorbing one or more biomolecules is that the system could be designed to be specific for a subset of molecules within a mixture of two or more different molecules. Further, the floating gate basest sensor apparatus system would improve the signal-to-noise ratio for protein, DNA, and for RNA studies. Indeed, the floating gate basest sensor apparatus system could thus be utilized for or with DNA and protein microarrays, and as a component of point-of-care diagnostic devices in part because of the small size of the system, as well as the re-usability of the sensor, among many other factors.
(329) 6. Impedance Spectroscopy
(330) According to yet another embodiment is the use of a floating gate based sensor apparatus in accordance with the embodiments for impedance spectroscopy, particularly utilizing the combined AC and DC methods and systems described herein. According to these methods and systems, for example, the floating gate based sensor apparatus system may be utilized for simultaneous charge and structure detection, which would especially useful with proteins and DNA-protein interactions. Another advantage would be cell surface area monitoring concomitantly with the analysis of released protons, ions, and/or molecules, which could be utilized to study disease state such as metastasis or brain disorders, among many others.
(331) According to another embodiment, using a floating gate basest sensor apparatus for impedance spectroscopy would allow for the analysis of cell membrane capacitance and simultaneous action potential and vesicle release. The methods and systems could also be utilized for small molecule drug packing and DNA sorting, among other uses. These methods and systems could be extremely important in drug screening, for example.
(332) 7. Cellular Interfaces
(333) According to yet another embodiment, and as described above, is the use of a floating gate based sensor apparatus as a mechanical interface with the cell. For example, according to various methods and systems the floating gate basest sensor apparatus could be utilized with peripheral nerves to both stimulate and detect action potentials, thus acting as a true interface. The floating gate based sensor apparatus could also be utilized according to the methods and systems described and envisioned herein to detect released neurotransmitters, thus giving rise to an electroceutical with an array of uses. In the brain, for example, the floating gate based sensor apparatus system could be used for extracellular stimulation and recording, including in a massively parallel system for numerous neurons at once. The system could also be utilized to measure non-reducible and oxidizable neurotransmitters in the brain such as GABA, among others. According to yet another embodiment, the system could be utilized to detect one or more neurotransmitters such as acetylcholine, dopamine, and/or D-serine, among others, using a non-faradic approach. This would be benign and involve no passage of current in the brain. According to another embodiment, the system could be used for cochlear implants or a wide variety of other implants inor that somehow interface tothe nervous system.
(334) All references, including publications, patent applications, and patents cited herein are hereby incorporated by reference in their entireties to the same extent as if each reference was individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.
(335) The use of the terms a and an and the aria similar referents in the context of describing the invention (especially in the context of the following claims) is to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms comprising, having, including, and containing are to be construed as open-ended terms (i.e., meaning including, but not limited to,) unless otherwise noted. The term connected is to be construed as partly or wholly contained within, attached to, or joined together, even if there is something intervening.
(336) The recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it was individually recited herein.
(337) All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., such as) provided herein, is intended merely to better illuminate embodiments of the invention and does not impose a limitation on the scope of the invention unless otherwise claimed.
(338) No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
(339) It will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the spirit and scope of the invention. There is no intention to limit the invention to the specific form or forms disclosed, but on the contrary, the intention is to cover all modifications, alternative constructions, and equivalents falling within the spirit and scope of the invention, as defined in the appended claims. Thus, it is intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents.