Mono- or di-substituted indole derivatives as dengue viral replication inhibitors
10919854 · 2021-02-16
Assignee
Inventors
- Bart Rudolf Romanie Kesteleyn (Beerse, BE)
- Jean-François Bonfanti (Issy-les-Moulineaux, FR)
- Tim Hugo Maria JONCKERS (Beerse, BE)
- Pierre Jean-Marie Bernard Raboisson (Beerse, BE)
- Dorothée Alice Marie-Eve Bardiot (Leuven, BE)
- Arnaud Didier M Marchand (Leuven, BE)
Cpc classification
A61K45/06
HUMAN NECESSITIES
C07D209/14
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
C07D209/14
CHEMISTRY; METALLURGY
A61K45/06
HUMAN NECESSITIES
Abstract
The present invention relates to mono- or di-substituted indole compounds, methods to prevent or treat dengue viral infections by using the compounds and also relates to use of the compounds as a medicine, more preferably for use as a medicine to treat or prevent dengue viral infections. The present invention furthermore relates to pharmaceutical compositions or combination preparations of the compounds, to the compositions or preparations for use as a medicine, more preferably for the prevention or treatment of dengue viral infections. The invention also relates to processes for preparation of the compounds.
Claims
1. A compound of formula (I) ##STR00025## wherein R.sub.1, R.sub.2 and R.sub.3 are selected from the group consisting of: R.sub.1 is H, R.sub.2 is F and R.sub.3 is H or CH.sub.3, R.sub.1 is H, CH.sub.3 or F, R.sub.2 is OCH.sub.3 and R.sub.3 is H, R.sub.1 is H, R.sub.2 is OCH.sub.3 and R.sub.3 is CH.sub.3, R.sub.1 is CH.sub.3, R.sub.2 is F and R.sub.3 is H, R.sub.1 is CF.sub.3, R.sub.2 is H and R.sub.3 is H, R.sub.1 is OCF.sub.3, R.sub.2 is OCH.sub.3 and R.sub.3 is H, and R.sub.1 is OCF.sub.3, R.sub.2 is H and R.sub.3 is CH.sub.3, or a stereoisomer, pharmaceutically acceptable salt, solvate or polymorph thereof.
2. A compound of claim 1 selected from the group consisting of: ##STR00026## ##STR00027## or a stereoisomer, pharmaceutically acceptable salt, solvate or polymorph thereof.
3. A pharmaceutical composition comprising the compound of claim 1 and one or more pharmaceutically acceptable excipients, diluents or carriers.
4. A compound or a stereoisomer, pharmaceutically acceptable salt, solvate or polymorph thereof, according to claim 1, wherein said compound is in a crystalline form.
5. A compound or a stereoisomer, pharmaceutically acceptable salt, or solvate thereof, according to claim 1, wherein said compound is in an amorphous form.
6. A compound or a stereoisomer, pharmaceutically acceptable salt, or polymorph thereof, according to claim 1, wherein said compound is in an un-solvated form, or a pharmaceutically acceptable salt thereof.
7. A method of treating a Dengue viral infection in a patient in need thereof comprising administering to the patient a compound of claim 1.
8. The method of claim 7, further comprising administering another antiviral agent to the patient.
9. A compound according to claim 1, wherein said compound is: Enantiomer 1A, wherein .sup.1H NMR (500 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.72 (s, 3H) 4.00 (s, 3H) 6.24 (d, J=7.9 Hz, 1H) 6.59 (s, 2H) 6.91 (s, 1H) 6.97 (dd, J=8.8, 2.2 Hz, 1H) 7.02-7.10 (m, 2H) 7.12 (d, J=2.2 Hz, 1H) 7.27 (dd, J=9.6, 2.2 Hz, 1H) 7.35 (d, J=8.2 Hz, 1H) 8.14 (dd, J=8.8, 5.7 Hz, 1H) 8.44 (s, 1H) 12.10 (br. s., 1H) LC/MS (method LC-C): R.sub.t 3.09 min, MH.sup.+517 [].sub.D.sup.20: +130.3 (c 0.277, DMF) Chiral SFC (method SFC-D): R.sub.t 3.41 min, MH.sup.+517, chiral purity 100%, or a pharmaceutically acceptable salt, solvate or polymorph thereof.
10. A compound according to claim 1, wherein said compound is: Enantiomer 1n, wherein .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.72 (s, 3H) 4.00 (s, 3H) 6.24 (d, J=7.6 Hz, 1H) 6.53-6.65 (m, 2H) 6.91 (s, 1H) 6.97 (dd, J=8.6, 2.0 Hz, 1H) 7.01-7.09 (m, 2H) 7.12 (d, J=2.0 Hz, 1H) 7.27 (dd, J=9.6, 2.0 Hz, 1H) 7.35 (d, J=8.1 Hz, 1H) 8.14 (dd, J=8.6, 5.6 Hz, 1H) 8.43 (s, 1H) 12.09 (br. s., 1H) LC/MS (method LC-C): R.sub.t 3.09 min, MH.sup.+517 [].sub.D.sup.20: 135.3 (c 0.283, DMF) Chiral SFC (method SFC-D): R.sub.t 4.89 min, MH.sup.+517, chiral purity 99.35%, or a pharmaceutically acceptable salt, solvate or polymorph thereof.
11. A compound according to claim 1, wherein said compound is: Enantiomer 2A, wherein .sup.1H NMR (500 MHz, DMSO-d.sub.6) ppm 2.37-2.39 (m, 3H) 3.09 (s, 3H) 3.72 (s, 3H) 4.01 (s, 3H) 6.26 (d, J=7.9 Hz, 1H) 6.54-6.63 (m, 2H) 6.92 (s, 1H) 6.97 (dd, J=8.4, 1.9 Hz, 1H) 7.02 (dd, J=9.9, 9.0 Hz, 1H) 7.07 (d, J=7.9 Hz, 1H) 7.13 (d, J=1.9 Hz, 1H) 7.35 (d, J=8.4 Hz, 1H) 7.96 (dd, J=8.5, 5.4 Hz, 1H) 8.45 (s, 1H) 12.24 (br. s., 1H) LC/MS (method LC-C): R.sub.t 3.20 min, MH.sup.+531 [].sub.D.sup.20: +104.5 (c 0.2545, DMF) Chiral SFC (method SFC-A): R.sub.t 4.22 min, MH.sup.+531, chiral purity 100%, or a pharmaceutically acceptable salt, solvate or polymorph thereof.
12. A compound according to claim 1, wherein said compound is: Enantiomer 2B, wherein .sup.1H NMR (500 MHz, DMSO-d.sub.6) ppm 2.36-2.41 (m, 3H) 3.09 (s, 3H) 3.72 (s, 3H) 4.01 (s, 3H) 6.26 (d, J=7.9 Hz, 1H) 6.57-6.64 (m, 2H) 6.92 (s, 1H) 6.97 (dd, J=8.2, 1.9 Hz, 1H) 6.99-7.04 (m, 1H) 7.07 (d, J=7.9 Hz, 1H) 7.13 (d, J=1.9 Hz, 1H) 7.35 (d, J=8.2 Hz, 1H) 7.96 (dd, J=8.7, 5.2 Hz, 1H) 8.45 (s, 1H) 12.24 (br. s., 1H) LC/MS (method LC-C): R.sub.t 3.20 min, MH.sup.+531 [].sub.D.sup.20: 104.1 (c 0.2536, DMF) Chiral SFC (method SFC-A): R.sub.t 5.12 min, MH.sup.+531, chiral purity 99.53%, or a pharmaceutically acceptable salt, solvate or polymorph thereof.
13. A compound according to claim 1, wherein said compound is: Enantiomer 3A, wherein .sup.1H NMR (360 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.72 (s, 3H) 3.77 (s, 3H) 4.01 (s, 3H) 6.22 (d, J=8.1 Hz, 1H) 6.55-6.61 (m, 2H) 6.84 (dd, J=8.8, 2.2 Hz, 1H) 6.91 (t, J=1.8 Hz, 1H) 6.94-7.00 (m, 2H) 7.07 (d, J=7.0 Hz, 1H) 7.13 (d, J=1.8 Hz, 1H) 7.35 (d, J=8.4 Hz, 1H) 8.02 (d, J=8.8 Hz, 1H) 8.32 (d, J=2.9 Hz, 1H) 11.87 (d, J=2.6 Hz, 1H) LC/MS (method LC-A): R.sub.t 1.08 min, MH.sup.+529 [].sub.D.sup.20: +134.9 (c 0.545, DMF) Chiral SFC (method SFC-E): R.sub.t 4.31 min, MH.sup.+529, chiral purity 100%, or a pharmaceutically acceptable salt, solvate or polymorph thereof.
14. A compound according to claim 1, wherein said compound is: Enantiomer 3B, wherein .sup.1H NMR (360 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.72 (s, 3H) 3.77 (s, 3H) 4.01 (s, 3H) 6.21 (d, J=8.1 Hz, 1H) 6.54-6.62 (m, 2H) 6.83 (dd, J=8.6, 2.4 Hz, 1H) 6.91 (t, J=1.5 Hz, 1H) 6.94-6.99 (m, 2H) 7.07 (d, J=7.0 Hz, 1H) 7.13 (d, J=1.8 Hz, 1H) 7.35 (d, J=8.1 Hz, 1H) 8.02 (d, J=8.8 Hz, 1H) 8.32 (d, J=2.9 Hz, 1H) 11.87 (br d, J=2.2 Hz, 1H) LC/MS (method LC-A): R.sub.t 1.08 min, MH.sup.+529 [].sub.D.sup.20: 167 (c 0.51, DMF) Chiral SFC (method SFC-E): R.sub.t 4.63 min, MH.sup.+529, chiral purity 94.7%, or a pharmaceutically acceptable salt, solvate or polymorph thereof.
15. A compound according to claim 1, wherein said compound is: Enantiomer 4A, wherein .sup.1H NMR (500 MHz, DMSO-d.sub.6) ppm 2.21 (s, 3H) 3.09 (s, 3H) 3.72 (s, 3H) 3.79 (s, 3H) 4.01 (s, 3H) 6.20 (d, J=7.6 Hz, 1H) 6.58 (d, J=1.6 Hz, 2H) 6.87-6.93 (m, 2H) 6.96 (dd, J=8.2, 1.9 Hz, 1H) 7.02 (d, J=7.6 Hz, 1H) 7.12 (d, J=1.9 Hz, 1H) 7.34 (d, J=8.2 Hz, 1H) 7.89 (s, 1H) 8.25 (s, 1H) 11.78 (br. s., 1H) LC/MS (method LC-C): R.sub.t 3.15 min, MH.sup.+543 [].sub.D.sup.20: +141.8 (c 0.3936, DMF) Chiral SFC (method SFC-C): R.sub.t 4.95 min MH.sup.+543, chiral purity 100%, or a pharmaceutically acceptable salt, solvate or polymorph thereof.
16. A compound according to claim 1, wherein said compound is: Enantiomer 4B, wherein .sup.1H NMR (500 MHz, DMSO-d.sub.6) ppm 2.21 (s, 3H) 3.09 (s, 3H) 3.72 (s, 3H) 3.79 (s, 3H) 4.01 (s, 3H) 6.20 (d, J=7.9 Hz, 1H) 6.58 (s, 2H) 6.88-6.93 (m, 2H) 6.96 (dd, J=8.2, 1.9 Hz, 1H) 7.02 (d, J=7.9 Hz, 1H) 7.12 (d, J=1.9 Hz, 1H) 7.34 (d, J=8.2 Hz, 1H) 7.90 (s, 1H) 8.25 (s, 1H) 11.79 (br. s., 1H) LC/MS (method LC-C): R.sub.t 3.15 min, MH.sup.+543 [].sub.D.sup.20: 142.2 (c 0.3909, DMF) Chiral SFC (method SFC-C): R.sub.t 6.84 min, MH.sup.+543, chiral purity 100%, or a pharmaceutically acceptable salt, solvate or polymorph thereof.
17. A compound according to claim 1, wherein said compound is: Enantiomer 5A, wherein .sup.1H NMR (500 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.72 (s, 3H) 3.85 (s, 3H) 4.00 (s, 3H) 6.21 (d, J=7.9 Hz, 1H) 6.58 (d, J=1.3 Hz, 2H) 6.90 (s, 1H) 6.97 (dd, J=8.2, 2.0 Hz, 1H) 7.07 (d, J=7.9 Hz, 1H) 7.11-7.17 (m, 2H) 7.34 (d, J=8.2 Hz, 1H) 7.82 (d, J=11.7 Hz, 1H) 8.35 (s, 1H) 11.98 (br. s., 1H) LC/MS (method LC-C): R.sub.t 3.00 min, MH.sup.+547 [].sub.D.sup.20: +136.4 (c 0.28, DMF) Chiral SFC (method SFC-B): R.sub.t 3.43 min, MH.sup.+547, chiral purity 100%, or a pharmaceutically acceptable salt, solvate or polymorph thereof.
18. A compound according to claim 1, wherein said compound is: Enantiomer 5B, wherein .sup.1H NMR (500 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.72 (s, 3H) 3.85 (s, 3H) 4.00 (s, 3H) 6.21 (d, J=7.9 Hz, 1H) 6.58 (d, J=1.3 Hz, 2H) 6.90 (s, 1H) 6.97 (dd, J=8.2, 2.0 Hz, 1H) 7.07 (d, J=7.9 Hz, 1H) 7.11-7.19 (m, 2H) 7.34 (d, J=8.2 Hz, 1H) 7.82 (d, J=11.7 Hz, 1H) 8.35 (s, 1H) 11.95 (br. s., 1H) LC/MS (method LC-C): R.sub.t 3.00 min, MH.sup.+547 [].sub.D.sup.20: 126.3 (c 0.2755, DMF) Chiral SFC (method SFC-B): R.sub.t 4.80 min, MH.sup.+547, chiral purity 98.06%, or a pharmaceutically acceptable salt, solvate or polymorph thereof.
19. A compound according to claim 1, wherein said compound is: Enantiomer 6A, wherein .sup.1H NMR (360 MHz, DMSO-d.sub.6) ppm 2.29 (s, 3H) 3.10 (s, 3H) 3.72 (s, 3H) 3.80 (s, 3H) 4.02 (s, 3H) 6.24 (d, J=7.7 Hz, 1H) 6.56-6.59 (m, 1H) 6.59-6.62 (m, 1H) 6.92 (t, J=1.6 Hz, 1H) 6.93-6.99 (m, 2H) 7.06 (d, J=7.7 Hz, 1H) 7.13 (d, J=1.8 Hz, 1H) 7.35 (d, J=8.4 Hz, 1H) 7.94 (d, J=8.4 Hz, 1H) 8.35 (s, 1H) 11.91 (br s, 1H) LC/MS (method LC-A): R.sub.t 1.18 min, MH.sup.+543 [].sub.D.sup.20: +122.9 (c 0.48, DMF) Chiral SFC (method SFC-E): R.sub.t 4.15 min MH.sup.+543, chiral purity 100%, or a pharmaceutically acceptable salt, solvate or polymorph thereof.
20. A compound according to claim 1, wherein said compound is: Enantiomer 6B, wherein .sup.1H NMR (360 MHz, DMSO-d.sub.6) ppm 2.29 (s, 3H) 3.10 (s, 3H) 3.72 (s, 3H) 3.80 (s, 3H) 4.02 (s, 3H) 6.24 (d, J=7.7 Hz, 1H) 6.57-6.59 (m, 1H) 6.59-6.62 (m, 1H) 6.92 (t, J=1.8 Hz, 1H) 6.93-7.00 (m, 2H) 7.06 (d, J=7.7 Hz, 1H) 7.13 (d, J=1.8 Hz, 1H) 7.35 (d, J=8.1 Hz, 1H) 7.94 (d, J=8.8 Hz, 1H) 8.35 (d, J=2.2 Hz, 1H) 11.91 (br s, 1H) LC/MS (method LC-A): R.sub.t 1.22 min, MH.sup.+543 [].sub.D.sup.20: 120.6 (c 0.2755, DMF) Chiral SFC (method SFC-E): R.sub.t 4.50 min, MH.sup.+543, chiral purity 99.35%, or a pharmaceutically acceptable salt, solvate or polymorph thereof.
21. A compound according to claim 1, wherein said compound is: Enantiomer 7A, wherein .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm 2.30 (d, J=1.5 Hz, 3H) 3.09 (s, 3H) 3.72 (s, 3H) 4.00 (s, 3H) 6.22 (d, J=7.9 Hz, 1H) 6.56-6.60 (m, 2H) 6.91 (t, J=1.7 Hz, 1H) 6.97 (dd, J=8.3, 2.1 Hz, 1H) 7.01 (d, J=7.7 Hz, 1H) 7.12 (d, J=2.0 Hz, 1H) 7.22 (d, J=10.1 Hz, 1H) 7.34 (d, J=8.1 Hz, 1H) 8.02 (d, J=7.7 Hz, 1H) 8.37 (s, 1H) 11.96 (s, 1H) LC/MS (method LC-A): R.sub.t 1.15 min, MH.sup.+ 531 [].sub.D.sup.20: 163.2 (c 0.435, DMF) Chiral SFC (method SFC-E): R.sub.t 4.26 min, MH.sup.+ 531, chiral purity 100%, or a pharmaceutically acceptable salt, solvate or polymorph thereof.
22. A compound according to claim 1, wherein said compound is: Enantiomer 7B, wherein .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm 2.30 (d, J=1.5 Hz, 3H) 3.09 (s, 3H) 3.72 (s, 3H) 4.00 (s, 3H) 6.22 (d, J=7.7 Hz, 1H) 6.57-6.61 (m, 2H) 6.92 (t, J=1.8 Hz, 1H) 6.97 (dd, J=8.1, 2.0 Hz, 1H) 7.01 (d, J=7.7 Hz, 1H) 7.12 (d, J=2.0 Hz, 1H) 7.22 (d, J=10.0 Hz, 1H) 7.35 (d, J=8.4 Hz, 1H) 8.02 (d, J=7.9 Hz, 1H) 8.37 (d, J=2.4 Hz, 1H) 11.97 (s, 1H) LC/MS (method LC-A): R.sub.t 1.15 min, MH.sup.+ 531 [].sub.D.sup.20: +166.6 (c 0.5, DMF) Chiral SFC (method SFC-E): R.sub.t 3.78 min, MH.sup.+ 531, chiral purity 100%, or a pharmaceutically acceptable salt, solvate or polymorph thereof.
23. A compound according to claim 1, wherein said compound is: Enantiomer 8A, wherein .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.73 (s, 3H) 3.99 (s, 3H) 6.29 (d, J=7.6 Hz, 1H) 6.60 (br s, 2H) 6.92 (s, 1H) 6.98 (dd, J=8.3, 1.8 Hz, 1H) 7.07 (d, J=8.1 Hz, 1H) 7.13 (d, J=1.5 Hz, 1H) 7.36 (d, J=8.1 Hz, 1H) 7.54 (d, J=8.1 Hz, 1H) 7.69 (d, J=8.6 Hz, 1H) 8.49 (s, 1H) 8.60 (s, 1H) 12.41 (br s, 1H) LC/MS (method LC-C): R.sub.t 3.25 min, MH.sup.+ 567 [].sub.D.sup.20: 119.2 (c 0.2727, DMF) Chiral SFC (method SFC-F): R.sub.t 2.64 min, MH.sup.+ 567, chiral purity 100%, or a pharmaceutically acceptable salt, solvate or polymorph thereof.
24. A compound according to claim 1, wherein said compound is: Enantiomer 8B, wherein .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.73 (s, 3H) 3.99 (s, 3H) 6.29 (d, J=8.1 Hz, 1H) 6.60 (s, 2H) 6.92 (s, 1H) 6.98 (dd, J=8.6, 2.0 Hz, 1H) 7.07 (d, J=8.1 Hz, 1H) 7.13 (d, J=2.0 Hz, 1H) 7.36 (d, J=8.6 Hz, 1H) 7.54 (dd, J=8.6, 1.5 Hz, 1H) 7.69 (d, J=8.6 Hz, 1H) 8.49 (s, 1H) 8.60 (s, 1H) 12.40 (br s, 1H) LC/MS (method LC-C): R.sub.t 3.25 min, MH.sup.+ 567 [].sub.D.sup.20: +125.1 (c 0.2455, DMF) Chiral SFC (method SFC-F): R.sub.t 3.44 min, MH.sup.+ 567, chiral purity 100%, or a pharmaceutically acceptable salt, solvate or polymorph thereof.
25. A compound according to claim 1, wherein said compound is: Enantiomer 10A, wherein .sup.1H NMR (360 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.72 (s, 3H) 3.87 (s, 3H) 3.99 (s, 3H) 6.22 (d, J=7.7 Hz, 1H) 6.55-6.59 (m, 2H) 6.88-6.91 (m, 1H) 6.98 (dd, J=8.1, 1.8 Hz, 1H) 7.08 (d, J=7.7 Hz, 1H) 7.13 (d, J=2.2 Hz, 1H) 7.21 (s, 1H) 7.34 (d, J=8.1 Hz, 1H) 8.02 (d, J=1.5 Hz, 1H) 8.41 (s, 1H) 12.05 (br s, 1H) LC/MS (method LC-A): R.sub.t 1.20 min, MH.sup.+ 613 [].sub.D.sup.20: +81.4 (c 0.29, DMF) Chiral SFC (method SFC-E): R.sub.t 3.34 min, MH.sup.+ 613, chiral purity 100%, or a pharmaceutically acceptable salt, solvate or polymorph thereof.
26. A compound according to claim 1, wherein said compound is: Enantiomer 10B, wherein .sup.1H NMR (360 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.72 (s, 3H) 3.87 (s, 3H) 3.99 (s, 3H) 6.22 (d, J=7.7 Hz, 1H) 6.55-6.60 (m, 2H) 6.90 (t, J=1.6 Hz, 1H) 6.98 (dd, J=8.2, 2.0 Hz, 1H) 7.08 (d, J=7.8 Hz, 1H) 7.13 (d, J=2.2 Hz, 1H) 7.21 (s, 1H) 7.34 (d, J=8.4 Hz, 1H) 8.01 (d, J=1.1 Hz, 1H) 8.41 (s, 1H) 12.08 (br s, 1H) LC/MS (method LC-A): R.sub.t 1.20 min, MH.sup.+ 613 [].sub.D.sup.20: 99.6 (c 0.261, DMF) Chiral SFC (method SFC-E): R.sub.t 3.69 min, MH.sup.+ 613, chiral purity 100%, or a pharmaceutically acceptable salt, solvate or polymorph thereof.
27. A compound according to claim 1, wherein said compound is: Enantiomer 11A, wherein .sup.1H NMR (600 MHz, DMSO-d.sub.6) ppm 2.50 (s, 3H) 3.09 (s, 3H) 3.72 (s, 3H) 4.00 (s, 3H) 6.28 (d, J=7.8 Hz, 1H) 6.56-6.63 (m, 2H) 6.92 (br s, 1H) 6.97 (dd, J=8.4, 1.9 Hz, 1H) 7.05 (br s, 1H) 7.07 (d, J=7.9 Hz, 1H) 7.13 (d, J=1.9 Hz, 1H) 7.35 (d, J=8.4 Hz, 1H) 7.90 (br s, 1H) 8.53 (s, 1H) 12.41 (br s, 1H) LC/MS (method LC-A): R.sub.t 1.26 min, MH.sup.+ 597 [].sub.D.sup.20: +81.3 (c 0.3455, DMF) Chiral SFC (method SFC-E): R.sub.t 2.96 min, MH.sup.+ 597, chiral purity 100%, or a pharmaceutically acceptable salt, solvate or polymorph thereof.
28. A compound according to claim 1, wherein said compound is: Enantiomer 11, wherein .sup.1H NMR (600 MHz, DMSO-d.sub.6) ppm 2.51 (s, 3H) 3.09 (s, 3H) 3.72 (s, 3H) 4.00 (s, 3H) 6.28 (d, J=7.9 Hz, 1H) 6.58-6.60 (m, 2H) 6.92 (t, J=1.8 Hz, 1H) 6.97 (dd, J=8.4, 1.9 Hz, 1H) 7.05 (br s, 1H) 7.06 (d, J=7.9 Hz, 1H) 7.13 (d, J=2.1 Hz, 1H) 7.35 (d, J=8.2 Hz, 1H) 7.89 (br s, 1H) 8.53 (s, 1H) 12.37 (br s, 1H) LC/MS (method LC-A): R.sub.t 1.26 min, MH.sup.+ 597 [].sub.D.sup.20: 87.4 (c 0.342, DMF) Chiral SFC (method SFC-E): R.sub.t 3.44 min, MH.sup.+ 597, chiral purity 100%, or a pharmaceutically acceptable salt, solvate or polymorph thereof.
Description
EXAMPLES
(1) LC/MS Methods
(2) The High Performance Liquid Chromatography (HPLC) measurement was performed using a LC pump, a diode-array (DAD) or a UV detector and a column as specified in the respective methods. If necessary, additional detectors were included (see table of methods below).
(3) Flow from the column was brought to the Mass Spectrometer (MS) which was configured with an atmospheric pressure ion source. It is within the knowledge of the skilled person to set the tune parameters (e.g. scanning range, dwell time . . . ) in order to obtain ions allowing the identification of the compound's nominal monoisotopic molecular weight (MW). Data acquisition was performed with appropriate software.
(4) Compounds are described by their experimental retention times (R.sub.t) and ions. If not specified differently in the table of data, the reported molecular ion corresponds to the [M+H].sup.+ (protonated molecule) and/or [MH].sup. (deprotonated molecule). In case the compound was not directly ionizable the type of adduct is specified (i.e. [M+NH.sub.4].sup.+, [M+HCOO].sup., etc. . . . ). For molecules with multiple isotopic patterns (Br, Cl), the reported value is the one obtained for the lowest isotope mass. All results were obtained with experimental uncertainties that are commonly associated with the method used.
(5) Hereinafter, SQD means Single Quadrupole Detector, MSD Mass Selective Detector, RT room temperature, BEH bridged ethylsiloxane/silica hybrid, DAD Diode Array Detector, HSS High Strength silica.
(6) LCMS Method codes (Flow expressed in mL/min; column temperature (T) in C.; Run time in minutes)
(7) TABLE-US-00001 Method code Instrument Column Mobile phase Gradient
(8) SFC-MS Methods
(9) The SFC measurement was performed using an Analytical Supercritical fluid chromatography (SFC) system composed by a binary pump for delivering carbon dioxide (CO2) and modifier, an autosampler, a column oven, a diode array detector equipped with a high-pressure flow cell standing up to 400 bars. If configured with a Mass Spectrometer (MS) the flow from the column was brought to the (MS). It is within the knowledge of the skilled person to set the tune parameters (e.g. scanning range, dwell time . . . ) in order to obtain ions allowing the identification of the compound's nominal monoisotopic molecular weight (MW). Data acquisition was performed with appropriate software.
(10) Analytical SFC-MS Methods (Flow expressed in mL/min; column temperature (T) in C.; Run time in minutes, Backpressure (BPR) in bars.
(11) TABLE-US-00002 Method code column mobile phase gradient
(12) Melting Points
(13) Values are either peak values or melt ranges, and are obtained with experimental uncertainties that are commonly associated with this analytical method.
(14) DSC823e (Indicated as DSC)
(15) For a number of compounds, melting points were determined with a DSC823e (Mettler-Toledo). Melting points were measured with a temperature gradient of 10 C./minute. Maximum temperature was 300 C.
(16) Optical Rotations:
(17) Optical rotations were measured on a Perkin-Elmer 341 polarimeter with a sodium lamp and reported as follows: [] (, c g/100 ml, solvent, T C.).
(18) [].sub..sup.T=(100)/(lc): where l is the path length in dm and c is the concentration in g/100 ml for a sample at a temperature T ( C.) and a wavelength (in nm). If the wavelength of light used is 589 nm (the sodium D line), then the symbol D might be used instead. The sign of the rotation (+ or ) should always be given. When using this equation the concentration and solvent are always provided in parentheses after the rotation. The rotation is reported using degrees and no units of concentration are given (it is assumed to be g/100 ml).
Example 1: Synthesis of 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-1H-indol-3-yl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)ethanone (Compound 1) and Chiral Separation into Enantiomers 1A and 1B
(19) ##STR00009##
(20) Synthesis of Intermediate 1a:
(21) 2-(4-Chloro-2-methoxyphenyl)acetic acid [CAS 170737-95-8] (5.8 g, 28.9 mmol) was added in small portions to thionyl chloride (50 mL) and the resulting solution was stirred overnight at 60 C. The solvent was concentrated under reduced pressure and co-evaporated with toluene to give 2-(4-chloro-2-methoxyphenyl)-acetyl chloride 1a (6.5 g) as an oily residue that was used without further purification in the next step.
(22) Synthesis of Intermediate 1b:
(23) Diethylaluminum chloride 1M in hexane (37.1 mL, 37.1 mmol) was added dropwise at 0 C. to a solution of 6-fluoro-1H-indole [CAS 399-51-9] (3.34 g, 24.76 mmol) in CH.sub.2Cl.sub.2 (100 mL). After 30 min at 0 C., a solution of 2-(4-chloro-2-methoxyphenyl)acetyl chloride 1a (6.3 g, 28.76 mmol) in CH.sub.2Cl.sub.2 (100 mL) was added slowly at 0 C. The reaction was stirred at 0 C. for 3 h. Ice-water was added and the precipitate was filtered off, washed with water and a small amount of CH.sub.2Cl.sub.2. The solids were dried under vacuum at 70 C. overnight to give 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-1H-indol-3-yl)ethanone 1b (4.9 g).
(24) Synthesis of Intermediate 1c:
(25) At 0 C., a solution of phenyltrimethylammonium tribromide [CAS 4207-56-1] (5.8 g, 15.4 mmol) in THF (65 mL) was added dropwise to a mixture of 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-1H-indol-3-yl)ethanone 1b (4.9 g, 15.4 mmol) in THF (60 mL). The mixture was stirred at 0 C. for 1 h and at room temperature for 2.5 h. The precipitate was filtered off and washed with EtOAc. The combined filtrates were concentrated under reduced pressure. The residue was taken up with EtOAc and washed with water. A precipitate appeared in the organic layer and was filtered off and dried to provide a first batch of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-1H-indol-3-yl)ethanone 1c (4.6 g). The organic layer was separated, dried over MgSO.sub.4, filtered and the solvent was evaporated under reduced pressure. The residue was crystallized from EtOAc, the precipitate was filtered off, washed with Et.sub.2O and dried under vacuum to provide a second fraction of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-1H-indol-3-yl)ethanone 1c (1.6 g).
(26) Synthesis of Compound 1 and Chiral Separation of Enantiomers 1A and 1B:
(27) A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-1H-indol-3-yl)-ethanone 1c (3 g, 7.56 mmol), 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (2.28 g, 11.35 mmol) and diisopropylethylamine (1.95 mL, 11.35 mmol) in CH.sub.3CN (60 mL) and THF (30 mL) was stirred at 70 C. for 24 h. The reaction was diluted with EtOAc. The organic layer was washed with 1N HCl (twice) and water, dried over MgSO.sub.4, filtered and the solvent was concentrated under reduced pressure. The residue was purified by flash chromatography on silica gel (15-40 m, 80 g, Mobile phase: CH.sub.2Cl.sub.2/MeOH 99.5/0.5). A second purification was carried out by flash chromatography on silica gel (15-40 m, 80 g, Mobile phase: CH.sub.2Cl.sub.2/MeOH 99.7/0.3). The pure fractions were combined and concentrated under reduced pressure to give 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-1H-indol-3-yl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)ethanone (Compound 1, 2 g) as a racemic mixture.
(28) The enantiomers of Compound 1 were separated via Chiral SFC (Stationary phase: Chiralpak AD-H 5 m 20250 mm, Mobile phase: 50% CO.sub.2, 50% MeOH) yielding 740 mg of the first eluted enantiomer and 720 mg of the second eluted enantiomer. The first eluted enantiomer was crystallized from CH.sub.3CN/Et.sub.2O. The precipitate was filtered off and dried to give Enantiomer 1A (645 mg). The second eluted enantiomer was crystallized from CH.sub.3CN/Et.sub.2O. The precipitate was filtered off and dried to give Enantiomer 1B (632 mg).
(29) Compound 1:
(30) .sup.1H NMR (500 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.72 (s, 3H) 4.00 (s, 3H) 6.24 (d, J=7.9 Hz, 1H) 6.58 (s, 2H) 6.91 (s, 1H) 6.97 (dd, J=8.7, 1.9 Hz, 1H) 7.02-7.09 (m, 2H) 7.12 (d, J=1.9 Hz, 1H) 7.27 (dd, J=9.5, 1.9 Hz, 1H) 7.35 (d, J=8.5 Hz, 1H) 8.14 (dd, J=8.7, 5.5 Hz, 1H) 8.44 (s, 1H) 12.10 (br. s., 1H)
(31) LC/MS (method LC-C): R.sub.t 3.08 min, MH.sup.+ 517
(32) Melting point: 174 C.
(33) Enantiomer 1A:
(34) .sup.1H NMR (500 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.72 (s, 3H) 4.00 (s, 3H) 6.24 (d, J=7.9 Hz, 1H) 6.59 (s, 2H) 6.91 (s, 1H) 6.97 (dd, J=8.8, 2.2 Hz, 1H) 7.02-7.10 (m, 2H) 7.12 (d, J=2.2 Hz, 1H) 7.27 (dd, J=9.6, 2.2 Hz, 1H) 7.35 (d, J=8.2 Hz, 1H) 8.14 (dd, J=8.8, 5.7 Hz, 1H) 8.44 (s, 1H) 12.10 (br. s., 1H)
(35) LC/MS (method LC-C): R.sub.t 3.09 min, MH.sup.+ 517
(36) [].sub.D.sup.20: +130.3 (c 0.277, DMF)
(37) Chiral SFC (method SFC-D): R.sub.t 3.41 min, MH.sup.+ 517, chiral purity 100%.
(38) Melting point: 220 C.
(39) Enantiomer 1B:
(40) .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.72 (s, 3H) 4.00 (s, 3H) 6.24 (d, J=7.6 Hz, 1H) 6.53-6.65 (m, 2H) 6.91 (s, 1H) 6.97 (dd, J=8.6, 2.0 Hz, 1H) 7.01-7.09 (m, 2H) 7.12 (d, J=2.0 Hz, 1H) 7.27 (dd, J=9.6, 2.0 Hz, 1H) 7.35 (d, J=8.1 Hz, 1H) 8.14 (dd, J=8.6, 5.6 Hz, 1H) 8.43 (s, 1H) 12.09 (br. s., 1H)
(41) LC/MS (method LC-C): R.sub.t 3.09 min, MH.sup.+ 517
(42) [].sub.D.sup.20: 135.3 (c 0.283, DMF)
(43) Chiral SFC (method SFC-D): R.sub.t 4.89 min, MH.sup.+ 517, chiral purity 99.35%.
(44) Melting point: 218 C.
Example 1.1: Chiral Stability of Enantiomer 1A at pH 7.4
(45) The chiral stability of Enantiomer 1A (ROMe) was evaluated by determination of the enantiomeric excess (ee %) after incubation for 24 h and 48 h in a buffered solution at pH 7.4 at 40 C. and 60 C. To assess the influence of the methoxy-substituent of Enantiomer 1A (ROMe) on the stability against racemization, the chiral stability of Enantiomer 1A (RH) was tested under the same conditions. To this end, 5 M buffered (pH=7.4) solutions of 1A and 1A were prepared by mixing 25 L of a 100 M solution of 1A or 1A in DMSO with 475 L aqueous buffer pH 7.4. Samples were taken 24 h and 48 h after incubation at 40 C. and 60 C. The analytical samples were analyzed by Chiral SFC (MS detection) and the chiral purity was expressed as the enantiomeric excess (ee %=% enantiomer A% enantiomer B). Both Enantiomers 1A and 1A had a chiral purity of 100% prior to their incubation.
(46) TABLE-US-00003
Example 2: Synthesis of 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-7-methyl-1H-indol-3-yl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)ethanone (Compound 2) and Chiral Separation into Enantiomers 2A and 2B
(47) ##STR00011##
(48) Synthesis of Intermediate 2a:
(49) Diethylaluminum chloride 1M in hexane (20 mL, 20.0 mmol) was added dropwise at 0 C. to a solution of 6-fluoro-7-methyl-1H-indole [CAS 57817-10-4] (1.50 g, 10.1 mmol) in CH.sub.2Cl.sub.2 (45 mL). After 30 min at 0 C., a solution of 2-(4-chloro-2-methoxyphenyl)acetyl chloride (3.30 g, 15.1 mmol, synthesis: see Example 1) in dichloromethane (30 mL) was added slowly. The reaction mixture was stirred at 0 C. for 3 h. 1M Rochelle salt solution (50 mL) was added and the reaction mixture was stirred at room temperature for 1 h. The solids were filtered off and partitioned between EtOAc and 1N HCl. The phases were separated. The aqueous phase was extracted with EtOAc. The organic phases were combined, washed with brine, dried over MgSO.sub.4, filtered and concentrated under reduced pressure. The residue was triturated with EtOAc and heptane. The precipitate was filtered off to give 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-7-methyl-1H-indol-3-yl)ethanone 2a (2.00 g).
(50) Synthesis of Intermediate 2b:
(51) A solution of phenyltrimethylammonium tribromide [CAS 4207-56-1] (2.49 g, 6.6 mmol) in THF (45 mL) was added dropwise at 0 C. to a solution of 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-7-methyl-1H-indol-3-yl)ethanone 2a (2.00 g, 6.0 mmol) in THF (65 mL). The mixture was stirred at room temperature overnight. The precipitate was filtered off and washed with EtOAc. The combined filtrates were concentrated under reduced pressure. The residue was taken up with a minimum of acetonitrile. The precipitate was filtered off, washed with acetonitrile and dried under vacuum to give a first batch of 2-bromo-2-(4-chloro-2-methoxy-phenyl)-1-(6-fluoro-7-methyl-1H-indol-3-yl)ethanone 2b (1.51 g). The filtrate was concentrated under reduced pressure. The residue was taken up with a minimum of acetonitrile. The precipitate was filtered off, washed with acetonitrile and dried under vacuum to give a second fraction of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-7-methyl-1H-indol-3-yl)ethanone 2b (0.70 g).
(52) Synthesis of Compound 2 and Chiral Separation of Enantiomers 2A and 2B:
(53) A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-7-methyl-1H-indol-3-yl)ethanone 2b (1.8 g, 4.36 mmol) and 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (2.6 g, 13.0 mmol) in THF (9 mL) and CH.sub.3CN (9 mL) was heated at 100 C. under microwave irradiation for 50 min. The reaction mixture was diluted with EtOAc and washed with 1N HCl. The phases were separated. The organic phase was washed with an aqueous saturated NaHCO.sub.3 solution and brine, dried over MgSO.sub.4, filtered and concentrated under reduced pressure. The residue was taken up with a minimum of acetonitrile. The precipitate was filtered off, washed with acetonitrile and dried under vacuum to give 2-(4-chloro-2-methoxy-phenyl)-1-(6-fluoro-7-methyl-1H-indol-3-yl)-2-((3-methoxy-5-(methylsulfonyl)-phenyl)amino)ethanone (Compound 2, 1.7 g) as a racemic mixture. The chiral separation of the enantiomers of Compound 2 (1.59 g) was performed via Preparative SFC (Stationary phase: (S,S)-Whelk-O1 5 m 25021.1 mm, Mobile phase: 50% CO.sub.2, 50% MeOH). The product fractions were combined and evaporated under reduced pressure. The first eluted enantiomer (746 mg) was further purified by column chromatography on silica gel (15-40 m, 24 g, Mobile phase: CH.sub.2Cl.sub.2/MeOH 99.5/0.5). The pure fractions were combined and evaporated under reduced pressure (560 mg). The residue was solidified by trituration with a mixture of Et.sub.2O and a few drops of CH.sub.3CN. The solids were filtered off and dried under vacuum to give Enantiomer 2A (473 mg). The second eluted enantiomer (732 mg) was further purified by column chromatography over silica gel (15-40 m, 24 g, Mobile phase: CH.sub.2Cl.sub.2/MeOH 99.5/0.5). The pure fractions were combined and evaporated under reduced pressure (550 mg). The residue was solidified by trituration with a mixture of Et.sub.2O and a few drops of CH.sub.3CN. The solids were filtered off and dried under vacuum to give of Enantiomer 2B (457 mg).
(54) Compound 2:
(55) .sup.1H NMR (300 MHz, DMSO-d.sub.6) ppm 2.38 (d, J=1.5 Hz, 3H) 3.10 (s, 3H) 3.73 (s, 3H) 4.01 (s, 3H) 6.27 (d, J=7.9 Hz, 1H) 6.55-6.63 (m, 2H) 6.93 (m, 1H) 6.94-7.09 (m, 3H) 7.13 (d, J=1.9 Hz, 1H) 7.35 (d, J=8.3 Hz, 1H) 7.97 (dd, J=8.7, 5.3 Hz, 1H) 8.45 (s, 1H) 12.23 (br. s, 1H)
(56) LC/MS (method LC-D): R.sub.t 1.68 min, MH.sup.+ 531
(57) Enantiomer 2A:
(58) .sup.1H NMR (500 MHz, DMSO-d.sub.6) ppm 2.37-2.39 (m, 3H) 3.09 (s, 3H) 3.72 (s, 3H) 4.01 (s, 3H) 6.26 (d, J=7.9 Hz, 1H) 6.54-6.63 (m, 2H) 6.92 (s, 1H) 6.97 (dd, J=8.4, 1.9 Hz, 1H) 7.02 (dd, J=9.9, 9.0 Hz, 1H) 7.07 (d, J=7.9 Hz, 1H) 7.13 (d, J=1.9 Hz, 1H) 7.35 (d, J=8.4 Hz, 1H) 7.96 (dd, J=8.5, 5.4 Hz, 1H) 8.45 (s, 1H) 12.24 (br. s., 1H)
(59) LC/MS (method LC-C): R.sub.t 3.20 min, MH.sup.+ 531
(60) [].sub.D.sup.20: +104.5 (c 0.2545, DMF)
(61) Chiral SFC (method SFC-A): R.sub.t 4.22 min, MH.sup.+ 531, chiral purity 100%.
(62) Enantiomer 2B:
(63) .sup.1H NMR (500 MHz, DMSO-d.sub.6) ppm 2.36-2.41 (m, 3H) 3.09 (s, 3H) 3.72 (s, 3H) 4.01 (s, 3H) 6.26 (d, J=7.9 Hz, 1H) 6.57-6.64 (m, 2H) 6.92 (s, 1H) 6.97 (dd, J=8.2, 1.9 Hz, 1H) 6.99-7.04 (m, 1H) 7.07 (d, J=7.9 Hz, 1H) 7.13 (d, J=1.9 Hz, 1H) 7.35 (d, J=8.2 Hz, 1H) 7.96 (dd, J=8.7, 5.2 Hz, 1H) 8.45 (s, 1H) 12.24 (br. s., 1H)
(64) LC/MS (method LC-C): R.sub.t 3.20 min, MH.sup.+ 531
(65) [].sub.D.sup.20: 104.1 (c 0.2536, DMF)
(66) Chiral SFC (method SFC-A): R.sub.t 5.12 min, MH.sup.+ 531, chiral purity 99.53%.
Example 3: Synthesis 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-1H-indol-3-yl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)ethanone (Compound 3) and Chiral Separation into Enantiomers 3A and 3B
(67) ##STR00012## ##STR00013##
(68) Synthesis of Intermediate 3a:
(69) A solution of NaHSO.sub.3 (5.7 g, 54.5 mmol) in water (45 mL) was added to a stirring solution of tert-butyl 3-formyl-6-methoxy-1H-indole-1-carboxylate [CAS 847448-73-1] (10 g, 36.3 mmol) in dioxane (45 mL). After 15 min, morpholine (4.8 mL, 54.5 mmol) was added and 35 min later, sodium cyanide (NaCN) (1.96 g, 40 mmol) was added. The resulting suspension was stirred at room temperature for 3 days, until completion of the reaction. The product was filtered off and washed with a 1/1 mixture of dioxane/water (335 mL), and subsequently with water (345 mL) and dried under vacuum at 60 C. The solids were stirred up in Et.sub.2O (125 mL), filtered off, washed with Et.sub.2O (3) and dried under vacuum at 50 C. to provide tert-butyl 3-(cyano(morpholino)methyl)-6-methoxy-1H-indole-1-carboxylate 3a (12.3 g).
(70) Synthesis of Intermediate 3b:
(71) A mixture of tert-butyl 3-(cyano(morpholino)methyl)-6-methoxy-1H-indole-1-carboxylate 3a (6.0 g, 16.2 mmol) in dry DMF (80 mL) was stirred under N.sub.2-atmosphere while cooling on an ice-bath. A solution of KHMDS 0.5 M in toluene (35.5 mL, 17.8 mmol) was added dropwise over 10 min. After stirring for an additional 10 min, 4-chloro-1-(chloromethyl)-2-methoxybenzene [CAS 101079-84-9] (3.09 g, 16.2 mmol) was added and the resulting mixture was stirred at room temperature for 20 h. The reaction mixture was poured out into cold water (400 mL) and the product was extracted with Et.sub.2O (2). The combined organic layers were washed with brine, dried over MgSO.sub.4, filtered, evaporated under reduced pressure and co-evaporated with xylene. The residue was purified by flash chromatography (Stationary phase: Grace Reveleris silica 120 g, Mobile phase: heptane/EtOAc gradient 100/0 to 20/80). The desired fractions were combined, evaporated under reduced pressure and co-evaporated with dioxane to give tert-butyl 3-(2-(4-chloro-2-methoxyphenyl)-1-cyano-1-morpholinoethyl)-6-methoxy-1H-indole-1-carboxylate 3b (7.75 g).
(72) Synthesis of Intermediate 3c:
(73) To a stirred suspension of tert-butyl 3-(2-(4-chloro-2-methoxyphenyl)-1-cyano-1-morpholinoethyl)-6-methoxy-1H-indole-1-carboxylate 3b (7.75 g, 14.7 mmol) in dioxane (40 mL) and water (20 mL) was added a solution of HCl 6 M in isopropanol (36.8 mL, 220 mmol). The resulting mixture was stirred at 60 C. for 4 h and subsequently at 80 C. for 1 h. After cooling to room temperature, the mixture was left standing for 20 h to allow crystallization of the reaction product. The product was filtered off, washed with a 1/1/1 mixture of iPrOH/H.sub.2O/dioxane (215 mL) and dried under vacuum at 50 C. to give 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-1H-indol-3-yl)ethanone 3c (3.67 g).
(74) Synthesis of Compound 3 and Chiral Separation of Enantiomers 3A and 3B:
(75) A stirred mixture of 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-1H-indol-3-yl)-ethanone 3c (2 g, 6.07 mmol) in THF (80 mL) was cooled on an ice-bath under N.sub.2-atm. Phenyltrimethylammonium tribromide [CAS 4207-56-1] (2.39 g, 6.37 mmol) was added and the reaction mixture was stirred at 0 C. for 1 h and subsequently at room temperature for 1.5 h. 3-Methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (3.66 g, 18.2 mmol) was added and the solvent was evaporated under reduced pressure. The residue was dissolved in CH.sub.3CN (100 mL). Diisopropylethylamine (2.09 mL, 12.1 mmol) was added and the reaction mixture was heated at 55 C. for 27 h. The reaction mixture was allowed to cool to room temperature and poured out into stirring water (400 mL). The product was extracted with 2-MeTHF (2). The combined organic layers were washed with brine, dried over MgSO.sub.4, filtered and evaporated under reduced pressure. The residue (8 g) was purified by flash chromatography (stationary phase: Grace Reveleris silica 120 g, Mobile phase: heptane/EtOAc gradient from 100/0 to 0/100). The desired fractions were combined and evaporated under reduced pressure. The residue (5.4 g) was further purified by Preparative HPLC (Stationary phase: RP XBridge Prep C18 OBD10 m, 50150 mm, Mobile phase: 0.25% NH.sub.4HCO.sub.3 solution in water, CH.sub.3CN). The product fractions were combined and evaporated under reduced pressure and subsequently co-evaporated with MeOH. The residue was crystallized from a mixture of EtOAc (15 mL), CH.sub.3CN (2 mL) and MeOH (2 mL). The solids were filtered off, washed with EtOAc (3) and dried under vacuum at 50 C. to provide 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-1H-indol-3-yl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)ethanone (Compound 3, 681 mg) as a racemic mixture.
(76) The chiral separation of the enantiomers of Compound 3 (0.63 g) was performed via Normal Phase Chiral separation (Stationary phase: AS 20 M, Mobile phase: 100% methanol). The product fractions were combined and evaporated under reduced pressure. The first eluted enantiomer was purified by flash chromatography (Stationary phase: Grace Reveleris silica 12 g, Mobile phase: heptane/EtOAc/EtOH gradient from 100/0/0 to 40/45/15). The desired fractions were combined and evaporated, and co-evaporated with EtOAc. The remaining oil was solidified by stirring up in H.sub.2O (4 mL) and slow addition of MeOH (1.6 mL). After stirring for 20 minutes, the product was filtered off, washed (3) with a mixture of MeOH/H.sub.2O and dried under vacuum at 50 C. to provide Enantiomer 3A (168 mg) as an amorphous solid. The second eluted enantiomer was purified by flash chromatography (Stationary phase: Grace Reveleris silica 12 g, Mobile phase: heptane/EtOAc/EtOH gradient from 100/0/0 to 40/45/15). The desired fractions were combined, evaporated under reduced pressure and co-evaporated with EtOAc. The remaining foam was solidified by stirring up in H.sub.2O (4 mL) and slow addition of MeOH (2 mL). After stirring for 15 minutes, the product was filtered off, washed (3) with a mixture of MeOH/H.sub.2O and dried at 50 C. under vacuum to provide Enantiomer 3B (146 mg) as an amorphous solid.
(77) Compound 3:
(78) .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.72 (s, 3H) 3.77 (s, 3H) 4.01 (s, 3H) 6.21 (d, J=7.9 Hz, 1H) 6.54-6.64 (m, 2H) 6.83 (dd, J=8.7, 2.3 Hz, 1H) 6.91 (t, J=1.4 Hz, 1H) 6.94-6.99 (m, 2H) 7.04 (d, J=7.7 Hz, 1H) 7.12 (d, J=2.0 Hz, 1H) 7.35 (d, J=8.1 Hz, 1H) 8.02 (d, J=8.8 Hz, 1H) 8.30 (s, 1H) 11.84 (s, 1H) LC/MS (method LC-A): R.sub.t 1.20 min, MH.sup.+ 529
(79) Enantiomer 3A:
(80) .sup.1H NMR (360 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.72 (s, 3H) 3.77 (s, 3H) 4.01 (s, 3H) 6.22 (d, J=8.1 Hz, 1H) 6.55-6.61 (m, 2H) 6.84 (dd, J=8.8, 2.2 Hz, 1H) 6.91 (t, J=1.8 Hz, 1H) 6.94-7.00 (m, 2H) 7.07 (d, J=7.0 Hz, 1H) 7.13 (d, J=1.8 Hz, 1H) 7.35 (d, J=8.4 Hz, 1H) 8.02 (d, J=8.8 Hz, 1H) 8.32 (d, J=2.9 Hz, 1H) 11.87 (d, J=2.6 Hz, 1H)
(81) LC/MS (method LC-A): R.sub.t 1.08 min, MH.sup.+ 529
(82) [].sub.D.sup.20: +134.9 (c 0.545, DMF)
(83) Chiral SFC (method SFC-E): R.sub.t 4.31 min, MH.sup.+ 529, chiral purity 100%.
(84) Enantiomer 3B:
(85) .sup.1H NMR (360 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.72 (s, 3H) 3.77 (s, 3H) 4.01 (s, 3H) 6.21 (d, J=8.1 Hz, 1H) 6.54-6.62 (m, 2H) 6.83 (dd, J=8.6, 2.4 Hz, 1H) 6.91 (t, J=1.5 Hz, 1H) 6.94-6.99 (m, 2H) 7.07 (d, J=7.0 Hz, 1H) 7.13 (d, J=1.8 Hz, 1H) 7.35 (d, J=8.1 Hz, 1H) 8.02 (d, J=8.8 Hz, 1H) 8.32 (d, J=2.9 Hz, 1H) 11.87 (br d, J=2.2 Hz, 1H)
(86) LC/MS (method LC-A): R.sub.t 1.08 min, MH.sup.+ 529
(87) [].sub.D.sup.20: 116.7 (c 0.51, DMF)
(88) Chiral SFC (method SFC-E): R.sub.t 4.63 min, MH.sup.+ 529, chiral purity 94.7%.
Example 4: Synthesis of 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy-5-(methyl-sulfonyl)phenyl)amino)-1-(6-methoxy-5-methyl-1H-indol-3-yl)ethanone (Compound 4) and Chiral Separation into Enantiomers 4A and 4B
(89) ##STR00014##
(90) Synthesis of Intermediate 4a:
(91) Diethylaluminum chloride 1M in hexane (13.5 mL, 13.5 mmol) was added dropwise at 0 C. to a solution of 6-methoxy-5-methyl-1H-indole [CAS 1071973-95-9] (1.45 g, 9 mmol) in CH.sub.2Cl.sub.2 (45 mL). After 30 min at 0 C., a solution of 2-(4-chloro-2-methoxyphenyl)acetyl chloride 1a (2.4 g, 10.9 mmol) in CH.sub.2Cl.sub.2 (45 mL) was added slowly at 0 C. The reaction was stirred at 0 C. for 3 h. Ice-water was added and the precipitate was filtered off and washed with water. The solid was dried under vacuum to give 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-5-methyl-1H-indol-3-yl)ethanone 4a (2.1 g).
(92) Synthesis of Intermediate 4b:
(93) At 0 C., a solution of phenyltrimethylammonium tribromide [CAS 4207-56-1] (2.4 g, 6.4 mmol) in THF (65 mL) was added dropwise to a mixture of 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-5-methyl-1H-indol-3-yl)ethanone 4a (2.1 g, 6.1 mmol) in THF (60 mL). The mixture was stirred at 0 C. for 1 h and at room temperature for 2.5 h. The precipitate was filtered off and washed with EtOAc. The filtrate was concentrated under reduced pressure. The residue was taken up with the minimum of diisopropylether. The precipitate was filtered off and dried under vacuum to give 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-5-methyl-1H-indol-3-yl)ethanone 4b (2.36 g).
(94) Synthesis of Compound 4 and Chiral Separation of Enantiomers 4A and 4B:
(95) A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-5-methyl-1H-indol-3-yl)ethanone 4b (4.0 g, 9.46 mmol), 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (2.86 g, 14.2 mmol) and diisopropylethylamine (2.44 mL, 14.2 mmol) in CH.sub.3CN/THF (1/1) (100 mL) was stirred at 45 C. for 72 h. The solvents were removed under reduced pressure. The residue was dissolved in EtOAc. The organic layer was washed twice with 1N HCl, washed with water, dried over MgSO.sub.4, filtered and concentrated under reduced pressure. The compound was crystallized from CH.sub.3CN/diisopropylether to give 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)-1-(6-methoxy-5-methyl-1H-indol-3-yl)ethanone (Compound 4, 1.1 g) as a racemic mixture. The chiral separation of the enantiomers of Compound 4 was performed via Preparative Chiral SFC (Stationary phase: (5,5)-Whelk-O1 5 m 25021.1 mm, Mobile phase: 45% CO.sub.2, 55% MeOH) yielding 500 mg of the first eluted enantiomer and 531 mg of the second eluted enantiomer. The first eluted enantiomer was crystallized from CH.sub.3CN/Et.sub.2O to afford Enantiomer 4A (401 mg). The second eluted was crystallized from CH.sub.3CN/Et.sub.2O to afford Enantiomer 4B (396 mg).
(96) Compound 4:
(97) .sup.1H NMR (500 MHz, DMSO-d.sub.6) ppm 2.21 (s, 3H) 3.09 (s, 3H) 3.72 (s, 3H) 3.79 (s, 3H) 4.01 (s, 3H) 6.20 (d, J=7.9 Hz, 1H) 6.58 (s, 2H) 6.88-6.93 (m, 2H) 6.96 (dd, J=8.5, 1.9 Hz, 1H) 7.02 (d, J=7.9 Hz, 1H) 7.12 (d, J=1.9 Hz, 1H) 7.34 (d, J=8.5 Hz, 1H) 7.89 (s, 1H) 8.24 (s, 1H) 11.78 (br. s., 1H)
(98) LC/MS (method LC-C): R.sub.t 3.16 min, MH.sup.+ 543
(99) Melting point: 208 C.
(100) Enantiomer 4A:
(101) .sup.1H NMR (500 MHz, DMSO-d.sub.6) ppm 2.21 (s, 3H) 3.09 (s, 3H) 3.72 (s, 3H) 3.79 (s, 3H) 4.01 (s, 3H) 6.20 (d, J=7.6 Hz, 1H) 6.58 (d, J=1.6 Hz, 2H) 6.87-6.93 (m, 2H) 6.96 (dd, J=8.2, 1.9 Hz, 1H) 7.02 (d, J=7.6 Hz, 1H) 7.12 (d, J=1.9 Hz, 1H) 7.34 (d, J=8.2 Hz, 1H) 7.89 (s, 1H) 8.25 (s, 1H) 11.78 (br. s., 1H)
(102) LC/MS (method LC-C): R.sub.t 3.15 min, MH.sup.+ 543
(103) [].sub.D.sup.20: +141.8 (c 0.3936, DMF)
(104) Chiral SFC (method SFC-C): R.sub.t 4.95 min, MH.sup.+ 543, chiral purity 100%.
(105) Melting point: 173 C.
(106) Enantiomer 4B:
(107) .sup.1H NMR (500 MHz, DMSO-d.sub.6) ppm 2.21 (s, 3H) 3.09 (s, 3H) 3.72 (s, 3H) 3.79 (s, 3H) 4.01 (s, 3H) 6.20 (d, J=7.9 Hz, 1H) 6.58 (s, 2H) 6.88-6.93 (m, 2H) 6.96 (dd, J=8.2, 1.9 Hz, 1H) 7.02 (d, J=7.9 Hz, 1H) 7.12 (d, J=1.9 Hz, 1H) 7.34 (d, J=8.2 Hz, 1H) 7.90 (s, 1H) 8.25 (s, 1H) 11.79 (br. s., 1H)
(108) LC/MS (method LC-C): R.sub.t 3.15 min, MH.sup.+ 543
(109) [].sub.D.sup.20: 142.2 (c 0.3909, DMF)
(110) Chiral SFC (method SFC-C): R.sub.t 6.84 min, MH.sup.+ 543, chiral purity 100%.
(111) Melting point: 174 C.
Example 5: Synthesis of 2-(4-chloro-2-methoxyphenyl)-1-(5-fluoro-6-methoxy-1H-indol-3-yl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)ethanone (Compound 5) and Chiral Separation into Enantiomers 5A and 5B
(112) ##STR00015##
(113) Synthesis of Intermediate 5a:
(114) Diethylaluminum chloride 1M in hexane (15.7 mL, 15.7 mmol) was added dropwise at 0 C. to a solution of 5-fluoro-6-methoxy-1H-indole [CAS 1211595-72-0] (2 g, 12.1 mmol) in CH.sub.2Cl.sub.2 (50 mL). After 30 min at 0 C., a solution of 2-(4-chloro-2-methoxyphenyl)acetyl chloride 1a (3.2 g, 14.6 mmol) in CH.sub.2Cl.sub.2 (50 mL) was added slowly at 0 C. The reaction was stirred at 0 C. for 3 h. Ice-water was added and the precipitate was filtered off, washed with water and the minimum of CH.sub.2Cl.sub.2. The solid was dried under vacuum to give 2-(4-chloro-2-methoxyphenyl)-1-(5-fluoro-6-methoxy-1H-indol-3-yl)ethanone 5a (2.82 g).
(115) Synthesis of Intermediate 5b:
(116) At 0 C., a solution of phenyltrimethylammonium tribromide [CAS 4207-56-1] (3.5 g, 8.1 mmol) in THF (20 mL) was added dropwise to a solution of 2-(4-chloro-2-methoxyphenyl)-1-(5-fluoro-6-methoxy-1H-indol-3-yl)ethanone 5a (2.82 g, 8.1 mmol) in THF (46 mL). The mixture was stirred at 0 C. for 1 h and at room temperature for 4 h. The precipitate was filtered off and washed with EtOAc. The filtrate was concentrated under reduced pressure. The residue was dissolved in EtOAc and washed with water. The organic phase was dried over MgSO.sub.4, filtered and the solvent was evaporated under reduced pressure. The residue was taken up with the minimum of EtOAc. The precipitate was filtered off and dried under vacuum to give 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(5-fluoro-6-methoxy-1H-indol-3-yl)ethanone 5b (2.5 g).
(117) Synthesis of Compound 5 and Chiral Separation of Enantiomers 5A and 5B:
(118) A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(5-fluoro-6-methoxy-1H-indol-3-yl)ethanone 5b (2.5 g, 5.86 mmol), 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (1.415 g, 7.03 mmol) and diisopropylethylamine (1.515 mL, 8.79 mmol) in CH.sub.3CN (55 mL) and THF (100 mL) was stirred at 50 C. for 10 days. The solvents were removed under reduced pressure. The residue was purified by flash chromatography on silica gel (15-40 m, 80 g, Mobile phase: CH.sub.2Cl.sub.2/CH.sub.3OH 99.25/0.75). The pure fractions were combined and evaporated. The compound was dissolved in EtOAc and stirred with HCl 1N for 15 min. A precipitate appeared, and was filtered off and dried under vacuum to give 2-(4-chloro-2-methoxyphenyl)-1-(5-fluoro-6-methoxy-1H-indol-3-yl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)-amino)ethanone (Compound 5, 1.3 g) as a racemic mixture.
(119) The chiral separation of the enantiomers of Compound 5 was performed via Preparative Chiral SFC (Stationary phase: Chiralpak IC 5 m 25020 mm, Mobile phase: 55% CO.sub.2, 45% MeOH). The product fractions were combined and evaporated. The first eluted enantiomer was solidified by trituration with heptane/diisopropylether. The solids were filtered off and dried under vacuum to provide Enantiomer 5A (502 mg) as an amorphous white powder. The second eluted enantiomer was solidified by trituration with heptane/diisopropylether. The solids were filtered off and dried under vacuum to provide Enantiomer 5B (490 mg) as an amorphous white powder.
(120) Compound 5:
(121) .sup.1H NMR (500 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.72 (s, 3H) 3.85 (s, 3H) 4.00 (s, 3H) 6.21 (d, J=7.9 Hz, 1H) 6.58 (d, J=1.3 Hz, 2H) 6.90 (s, 1H) 6.97 (dd, J=8.2, 1.9 Hz, 1H) 7.06 (d, J=7.9 Hz, 1H) 7.10-7.18 (m, 2H) 7.34 (d, J=8.2 Hz, 1H) 7.82 (d, J=12.0 Hz, 1H) 8.35 (s, 1H) 11.98 (br. s., 1H)
(122) LC/MS (method LC-C): R.sub.t 3.01 min, MH.sup.+ 547
(123) Melting point: 182 C.
(124) Enantiomer 5A:
(125) .sup.1H NMR (500 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.72 (s, 3H) 3.85 (s, 3H) 4.00 (s, 3H) 6.21 (d, J=7.9 Hz, 1H) 6.58 (d, J=1.3 Hz, 2H) 6.90 (s, 1H) 6.97 (dd, J=8.2, 2.0 Hz, 1H) 7.07 (d, J=7.9 Hz, 1H) 7.11-7.17 (m, 2H) 7.34 (d, J=8.2 Hz, 1H) 7.82 (d, J=11.7 Hz, 1H) 8.35 (s, 1H) 11.98 (br. s., 1H)
(126) LC/MS (method LC-C): R.sub.t 3.00 min, MH.sup.+ 547
(127) [].sub.D.sup.20: +136.4 (c 0.28, DMF)
(128) Chiral SFC (method SFC-B): R.sub.t 3.43 min, MH.sup.+ 547, chiral purity 100%.
(129) Enantiomer 5B:
(130) .sup.1H NMR (500 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.72 (s, 3H) 3.85 (s, 3H) 4.00 (s, 3H) 6.21 (d, J=7.9 Hz, 1H) 6.58 (d, J=1.3 Hz, 2H) 6.90 (s, 1H) 6.97 (dd, J=8.2, 2.0 Hz, 1H) 7.07 (d, J=7.9 Hz, 1H) 7.11-7.19 (m, 2H) 7.34 (d, J=8.2 Hz, 1H) 7.82 (d, J=11.7 Hz, 1H) 8.35 (s, 1H) 11.95 (br. s., 1H)
(131) LC/MS (method LC-C): R.sub.t 3.00 min, MH.sup.+ 547
(132) [].sub.D.sup.20: 126.3 (c 0.2755, DMF)
(133) Chiral SFC (method SFC-B): R.sub.t 4.80 min, MH.sup.+ 547, chiral purity 98.06%.
Example 6: Synthesis of 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy-5-(methyl-sulfonyl)phenyl)amino)-1-(6-methoxy-7-methyl-1H-indol-3-yl)ethanone (Compound 6) and Chiral Separation into Enantiomers 6A and 6B
(134) ##STR00016##
(135) Synthesis of Intermediate 6a:
(136) Diethylaluminum chloride 1M in hexane (32.8 mL, 32.8 mmol) was added dropwise to a cooled (30 C.) solution of 6-methoxy-7-methyl-1H-indole [CAS 19500-05-1] (3.53 g, 21.9 mmol) in CH.sub.2Cl.sub.2 (150 mL). After stirring for 15 min at 30 C., a solution of 2-(4-chloro-2-methoxyphenyl)acetyl chloride 1a (6.71 g, 30.6 mmol) in CH.sub.2Cl.sub.2 (150 mL) was added slowly at 30 C. The reaction was stirred at 30 C. for 1 h and was allowed to warm to room temperature while stirring for 2 h. The reaction mixture was poured out in ice-water/Rochelle salt. The mixture was filtered over a short pad of Dicalite and the filter cake was rinsed several times with THF. The layers were separated. The aqueous layer was extracted with THF. The combined organic layers were washed with brine, water, dried over MgSO.sub.4, filtered, and evaporated under reduced pressure. The solid residue was suspended in CH.sub.2Cl.sub.2 (50 mL) and the solids were filtered off and washed with a small amount of CH.sub.2Cl.sub.2 and dried under vacuum at 50 C. to give 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-7-methyl-1H-indol-3-yl)ethanone 6a (6.85 g) as an off-white solid.
(137) Synthesis of Intermediate 6b:
(138) At 0 C., a solution of phenyltrimethylammonium tribromide [CAS 4207-56-1] (8.2 g, 21.8 mmol) in THF (150 mL) was added dropwise to a solution of 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-7-methyl-1H-indol-3-yl)ethanone 6a (6.8 g, 19.8 mmol) in THF (250 mL). The mixture was stirred at room temperature for 2 h.
(139) The precipitate was filtered off and washed with THF. The filtrate was concentrated under reduced pressure. The residue was crystallized from CH.sub.2Cl.sub.2. The precipitate was filtered off, wash with CH.sub.2Cl.sub.2 (2) and dried under vacuum at 50 C. to give 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-7-methyl-1H-indol-3-yl)ethanone 6b (5.38 g).
(140) Synthesis of Compound 6 and Chiral Separation of Enantiomers 6A and 6B:
(141) A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-7-methyl-1H-indol-3-yl)ethanone 6b (1.96 g, 4.65 mmol), 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (1.40 g, 6.97 mmol) and diisopropylethylamine (1.20 mL, 6.97 mmol) in CH.sub.3CN (50 mL) was heated overnight under reflux. The solvents were removed under reduced pressure. The residue was dissolved in CH.sub.2Cl.sub.2 and washed with 0.5N HCl and water, dried over MgSO.sub.4, filtered and evaporated under reduced pressure. The residue was purified by flash chromatography on silica gel (Stationary phase: Biotage SNAP Ultra 100 g, Mobile phase: EtOAc:EtOH (3:1)/heptane gradient 0/100 to 50/50). The pure fractions were combined and evaporated under reduced pressure to give 2-(4-chloro-2-methoxy-phenyl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)-1-(6-methoxy-7-methyl-1H-indol-3-yl)ethanone (Compound 6, 1.0 g) as a racemic mixture. The chiral separation of the enantiomers of Compound 6 (1.0 g) was performed via Preparative Chiral SFC (Stationary phase: Chiralcel Diacel OD 20250 mm, Mobile phase: CO.sub.2, EtOH containing 0.2% iPrNH.sub.2). The product fractions were combined and evaporated. The first eluted enantiomer was solidified by trituration with a MeOH/water (1/1) mixture. The solids were filtered off and dried under vacuum at 50 C. to provide Enantiomer 6A (368 mg) as an amorphous white powder. The second eluted enantiomer was solidified by trituration with a MeOH/water (1/1) mixture. The solids were filtered off and dried under vacuum at 50 C. to provide Enantiomer 6B (303 mg) as an amorphous white powder.
(142) Enantiomer 6A:
(143) .sup.1H NMR (360 MHz, DMSO-d.sub.6) ppm 2.29 (s, 3H) 3.10 (s, 3H) 3.72 (s, 3H) 3.80 (s, 3H) 4.02 (s, 3H) 6.24 (d, J=7.7 Hz, 1H) 6.56-6.59 (m, 1H) 6.59-6.62 (m, 1H) 6.92 (t, J=1.6 Hz, 1H) 6.93-6.99 (m, 2H) 7.06 (d, J=7.7 Hz, 1H) 7.13 (d, J=1.8 Hz, 1H) 7.35 (d, J=8.4 Hz, 1H) 7.94 (d, J=8.4 Hz, 1H) 8.35 (s, 1H) 11.91 (br s, 1H)
(144) LC/MS (method LC-A): R.sub.t 1.18 min, MH.sup.+ 543
(145) [].sub.D.sup.20: +122.9 (c 0.48, DMF)
(146) Chiral SFC (method SFC-E): R.sub.t 4.15 min MH.sup.+ 543, chiral purity 100%.
(147) Enantiomer 6B:
(148) .sup.1H NMR (360 MHz, DMSO-d.sub.6) ppm 2.29 (s, 3H) 3.10 (s, 3H) 3.72 (s, 3H) 3.80 (s, 3H) 4.02 (s, 3H) 6.24 (d, J=7.7 Hz, 1H) 6.57-6.59 (m, 1H) 6.59-6.62 (m, 1H) 6.92 (t, J=1.8 Hz, 1H) 6.93-7.00 (m, 2H) 7.06 (d, J=7.7 Hz, 1H) 7.13 (d, J=1.8 Hz, 1H) 7.35 (d, J=8.1 Hz, 1H) 7.94 (d, J=8.8 Hz, 1H) 8.35 (d, J=2.2 Hz, 1H) 11.91 (br s, 1H)
(149) LC/MS (method LC-A): R.sub.t 1.22 min, MH.sup.+ 543
(150) [].sub.D.sup.20: 120.6 (c 0.2755, DMF)
(151) Chiral SFC (method SFC-E): R.sub.t 4.50 min, MH.sup.+ 543, chiral purity 99.35%.
Example 7: Synthesis of 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-5-methyl-1H-indol-3-yl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)ethanone (Compound 7) and Chiral Separation into Enantiomers 7A and 7B
(152) ##STR00017##
(153) Synthesis of Intermediate 7a:
(154) A solution of 6-fluoro-5-methyl-1H-indole [CAS 162100-95-0] (1.7 g, 11.4 mmol) in CH.sub.2Cl.sub.2 (100 mL) was cooled to 0 C. under N.sub.2-atmosphere. A solution of diethylaluminum chloride 1M in hexane (17.1 mL, 17.1 mmol) was added dropwise and the resulting mixture was kept at 0 C. for 15 min. A solution of 2-(4-chloro-2-methoxyphenyl)acetyl chloride 1a (3.50 g, 16 mmol) in CH.sub.2Cl.sub.2 (50 mL) was added dropwise. Stirring was continued at 0 C. for 1 h and at room temperature for 2 h. The reaction mixture was poured out in a stirring ice/Rochelle salt solution. After the ice had melted, the mixture was filtered over Dicalite and the filter cake was washed several times with THF. The filtrates were combined. The layers were separated and the organic layer was washed with brine, dried over MgSO.sub.4, filtered and evaporated under reduced pressure. The solid residue was suspended in CH.sub.2Cl.sub.2 (30 mL), the precipitate was filtered off and dried under vacuum at 50 C. to provide 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-5-methyl-1H-indol-3-yl)ethanone 7a (2.76 g).
(155) Synthesis of Intermediate 7b:
(156) A stirred solution of 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-5-methyl-1H-indol-3-yl)ethanone 7a (2.76 g, 8.32 mmol) in THF (350 mL) was cooled to 0 C. A solution of phenyltrimethylammonium tribromide [CAS 4207-56-1] (3.44 g, 9.15 mmol) in THF (50 mL) was added dropwise. The reaction mixture was stirred at 0 C. for 2 h and at room temperature for 2 h. The solids were removed by filtration and washed with THF. The combined filtrates were evaporated under reduced pressure. The residue was mixed with EtOAc (50 mL). The solids were isolated by filtration, washed with a small amount of EtOAc and dried under vacuum at 50 C. to provide 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-5-methyl-1H-indol-3-yl)ethanone 7b (3.21 g) as a white solid, which was used without further purification in the next step.
(157) Synthesis of Compound 7 and Chiral Separation of Enantiomers 7A and 7B:
(158) A mixture 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-5-methyl-1H-indol-3-yl)ethanone 7b (1.6 g, 3.90 mmol), 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (1.18 g, 5.84 mmol) and diisopropylethylamine (671 L, 3.90 mmol) in CH.sub.3CN (100 mL) was stirred overnight at 85 C. The reaction mixture was concentrated under reduced pressure. The residue was dissolved in CH.sub.2Cl.sub.2 (100 mL), washed with 1 N HCl (100 mL) and water (100 mL), dried over MgSO.sub.4, filtered and evaporated under reduced pressure. The residue was purified by column chromatograph (Stationary phase: Grace Reveleris silica 120 g, Mobile phase: EtOAc:EtOH (3:1)/heptane gradient 0/100 to 50/50). The desired fractions were combined and evaporated under reduced pressure. The residue was precipitated from CH.sub.2Cl.sub.2/heptane. The solids were isolated by filtration and washed with CH.sub.2Cl.sub.2/heptane (1/1). The crude product was further purified by Preparative HPLC (Stationary phase: Uptisphere C18 ODB10 m, 200 g, 5 cm, Mobile phase: 0.25% NH.sub.4HCO.sub.3 solution in water, CH.sub.3CN). The product fractions were combined and evaporated under reduced pressure. The solid residue was mixed with EtOAc (20 mL) and the solids were isolated by filtration and washed with a small amount of EtOAc to provide 2-(4-chloro-2-methoxy-phenyl)-1-(6-fluoro-5-methyl-1H-indol-3-yl)-2-((3-methoxy-5-(methylsulfonyl)-phenyl)amino)ethanone (Compound 7, 341 mg) as a racemic mixture. The filtrate was evaporated under reduced pressure and the residue was taken up with MeOH. After stirring for 30 min, the solids were isolated by filtration to provide a second crop of Compound 7 (92 mg).
(159) The chiral separation of the enantiomers of Compound 7 (402 mg) was performed via Normal Phase Chiral separation (Stationary phase: (S,S)-Whelk-O1, Mobile phase: 100% methanol). The product fractions were combined and evaporated to provide Enantiomer 7A as the first eluted product and Enantiomer 7B as the second eluted product. Enantiomer 7A was further purified by flash chromatography on silica gel (Stationary phase: Grace Reveleris silica 12 g, Mobile phase: heptane/EtOAc/EtOH 100/0/0 to 40/45/15). The desired fractions were combined and evaporated under reduced pressure. The residue was triturated with H.sub.2O (1.75 mL) and MeOH (0.75 mL). The solids were filtered off, washed (2) with H.sub.2O/MeOH 7/3, and dried under vacuum at 50 C. to provide Enantiomer 7A (48 mg). Enantiomer 7B was further purified by flash chromatography on silica gel (Stationary phase: Grace Reveleris silica 12 g, Mobile phase: heptane/EtOAc/EtOH 100/0/0 to 40/45/15). The desired fractions were combined and evaporated under reduced pressure. The residue was triturated with H.sub.2O (1.75 mL) and MeOH (0.75 mL). The solids were filtered off, washed (2) with H.sub.2O/MeOH 7/3, and dried under vacuum at 50 C. to provide Enantiomer 7B (43 mg).
(160) Compound 7:
(161) .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm 2.30 (d, J=0.9 Hz, 3H) 3.09 (s, 3H) 3.72 (s, 3H) 4.00 (s, 3H) 6.22 (d, J=7.7 Hz, 1H) 6.54-6.63 (m, 2H) 6.92 (t, J=1.5 Hz, 1H) 6.97 (dd, J=8.3, 1.9 Hz, 1H) 7.01 (d, J=7.7 Hz, 1H) 7.12 (d, J=1.8 Hz, 1H) 7.22 (d, J=10.2 Hz, 1H) 7.35 (d, J=8.4 Hz, 1H) 8.02 (d, J=7.7 Hz, 1H) 8.37 (s, 1H) 11.97 (br s, 1H)
(162) LC/MS (method LC-A): R.sub.t 1.19 min, MH.sup.+ 531
(163) Enantiomer 7A:
(164) .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm 2.30 (d, J=1.5 Hz, 3H) 3.09 (s, 3H) 3.72 (s, 3H) 4.00 (s, 3H) 6.22 (d, J=7.9 Hz, 1H) 6.56-6.60 (m, 2H) 6.91 (t, J=1.7 Hz, 1H) 6.97 (dd, J=8.3, 2.1 Hz, 1H) 7.01 (d, J=7.7 Hz, 1H) 7.12 (d, J=2.0 Hz, 1H) 7.22 (d, J=10.1 Hz, 1H) 7.34 (d, J=8.1 Hz, 1H) 8.02 (d, J=7.7 Hz, 1H) 8.37 (s, 1H) 11.96 (s, 1H)
(165) LC/MS (method LC-A): R.sub.t 1.15 min, MH.sup.+ 531
(166) []D20: 163.2 (c 0.435, DMF)
(167) Chiral SFC (method SFC-E): R.sub.t 4.26 min, MH.sup.+ 531, chiral purity 100%.
(168) Enantiomer 7B:
(169) .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm 2.30 (d, J=1.5 Hz, 3H) 3.09 (s, 3H) 3.72 (s, 3H) 4.00 (s, 3H) 6.22 (d, J=7.7 Hz, 1H) 6.57-6.61 (m, 2H) 6.92 (t, J=1.8 Hz, 1H) 6.97 (dd, J=8.1, 2.0 Hz, 1H) 7.01 (d, J=7.7 Hz, 1H) 7.12 (d, J=2.0 Hz, 1H) 7.22 (d, J=10.0 Hz, 1H) 7.35 (d, J=8.4 Hz, 1H) 8.02 (d, J=7.9 Hz, 1H) 8.37 (d, J=2.4 Hz, 1H) 11.97 (s, 1H)
(170) LC/MS (method LC-A): R.sub.t 1.15 min, MH.sup.+ 531
(171) [].sub.D.sup.20: +166.6 (c 0.5, DMF)
(172) Chiral SFC (method SFC-E): R.sub.t 3.78 min, MH.sup.+ 531, chiral purity 100%.
Example 8: Synthesis of 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy-5-(methyl-sulfonyl)phenyl)amino)-1-(5-(trifluoromethyl)-1H-indol-3-yl)ethanone (Compound 8) and Chiral Separation into Enantiomers 8A and 8B
(173) ##STR00018## ##STR00019##
(174) Synthesis of Intermediate 8a:
(175) At 0 C., under a N.sub.2-flow, sodium hydride (2.48 g, 64.8 mmol) was added portionwise to a mixture of 5-(trifluoromethyl)-1H-indole [CAS 100846-24-0] (10 g, 54.0 mmol) in DMF (150 mL) and the reaction mixture was stirred at 0 C. for 30 min. A solution of tosyl chloride (11.3 g, 59.4 mmol) in DMF (50 mL) was added dropwise and the resulting mixture was stirred at room temperature for 3 h. At 0 C., the mixture was quenched by the addition of water. The precipitate was filtered off and dried overnight under vacuum at 70 C. to give 1-tosyl-5-(trifluoromethyl)-1H-indole 8a (18.4 g).
(176) Synthesis of Intermediate 8b:
(177) Titanium(IV) chloride (2.4 mL, 21.9 mmol) was added dropwise at room temperature to a solution of 1-tosyl-5-(trifluoromethyl)-1H-indole 8a (3.7 g, 10.95 mmol) and 2-(4-chloro-2-methoxyphenyl)acetyl chloride 1a (4.8 g, 21.9 mmol, synthesis: see Example 1) in 1,2-dichloroethane (120 mL). The reaction was stirred at room temperature for 2 h. Ice-water was added. The reaction mixture was extracted with EtOAc. The organic layer was dried over MgSO.sub.4, filtered, and the solvent was concentrated under reduced pressure. The residue was purified by column chromatography on silica gel (15-40 m, 80 g, Mobile phase: CH.sub.2Cl.sub.2/MeOH 99.5/0.5). The fractions containing Compound 8b were combined and the solvent was evaporated under reduced pressure. The compound was taken up with CH.sub.3CN/diisopropylether. The precipitate was filtered off and dried to give 2-(4-chloro-2-methoxyphenyl)-1-(1-tosyl-5-(trifluoromethyl)-1H-indol-3-yl)ethanone 8b (2.8 g).
(178) Synthesis of Intermediate 8c:
(179) Lithium hydroxide (0.64 g, 15.3 mmol) was added to a solution of 2-(4-chloro-2-methoxyphenyl)-1-(1-tosyl-5-(trifluoromethyl)-1H-indol-3-yl)ethanone 8b (3.2 g, 6.13 mmol) in THF (18 mL) and water (6 mL). The mixture was stirred at 30 C. for 1 h. Water and EtOAc were added. The organic layer was separated, dried over MgSO.sub.4, filtered, and the solvent was evaporated under reduced pressure. The solid was taken up with diisopropylether. The precipitate was filtered off and dried to give 2-(4-chloro-2-methoxyphenyl)-1-(5-(trifluoromethyl)-1H-indol-3-yl)ethanone 8c (2.1 g).
(180) Synthesis of Intermediate 8d:
(181) At 0 C., a solution of phenyltrimethylammonium tribromide [CAS 4207-56-1] (2.1 g, 5.7 mmol) in THF (60 mL) was added dropwise to a mixture of 2-(4-chloro-2-methoxyphenyl)-1-(5-(trifluoromethyl)-1H-indol-3-yl)ethanone 8c (2.15 g, 5.7 mmol) in THF (60 mL). The mixture was stirred at 0 C. for 1 h and at room temperature for 4 h. The precipitate was filtered off and washed with EtOAc. The combined filtrates were concentrated under reduced pressure. The residue was dissolved in EtOAc. The organic layer was washed with water, dried over MgSO.sub.4, filtered and the solvent was evaporated under reduced pressure. The residue was taken up with diisopropylether. The precipitate was filtered off and dried to give 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(5-(trifluoromethyl)-1H-indol-3-yl)-ethanone 8d (2.5 g).
(182) Synthesis of Compound 8 and Chiral Separation into Enantiomers 8A and 8B:
(183) A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(5-(trifluoromethyl)-1H-indol-3-yl)ethanone 8d (1 g, 2.24 mmol), 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (496 mg, 2.46 mmol) and diisopropylethylamine (0.38 mL, 2.24 mmol) in CH.sub.3CN (50 mL) and THF (25 mL) was stirred at 70 C. for 24 h. The solution was concentrated under reduced pressure. The residue was dissolved in EtOAc and the solution was washed with 1N HCl. The organic layer was separated, dried over MgSO.sub.4, filtered and the solvent was evaporated under reduced pressure. The compound was crystallized from diisopropylether/CH.sub.3CN to give 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)-1-(5-(trifluoro-methyl)-1H-indol-3-yl)ethanone (Compound 8, 310 mg) as a racemic mixture. The Enantiomers of Compound 8 were separated via preparative Chiral SFC (Stationary phase: Chiralpak AD-H 5 m 25020 mm, Mobile phase: 70% CO.sub.2, 30% iPrOH+0.3% iPrNH.sub.2) to give, after crystallization in petroleum ether/diisopropylether, 122 mg of the first eluted Enantiomer 8A and 128 mg of the second eluted Enantiomer 8B.
(184) Compound 8:
(185) .sup.1H NMR (500 MHz, DMSO-d.sub.6) ppm 3.10 (s, 3H) 3.72 (s, 3H) 3.99 (s, 3H) 6.29 (d, J=7.9 Hz, 1H) 6.56-6.62 (m, 2H) 6.92 (s, 1H) 6.98 (dd, J=8.4, 2.0 Hz, 1H) 7.09 (d, J=7.9 Hz, 1H) 7.13 (d, J=1.9 Hz, 1H) 7.36 (d, J=8.5 Hz, 1H) 7.54 (dd, J=8.5, 1.6 Hz, 1H) 7.69 (d, J=8.5 Hz, 1H) 8.48 (s, 1H) 8.61 (s, 1H) 12.45 (br s, 1H)
(186) LC/MS (method LC-C): R.sub.t 3.19 min, MH.sup.+ 567
(187) Melting point: 168 C.
(188) Enantiomer 8A:
(189) .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.73 (s, 3H) 3.99 (s, 3H) 6.29 (d, J=7.6 Hz, 1H) 6.60 (br s, 2H) 6.92 (s, 1H) 6.98 (dd, J=8.3, 1.8 Hz, 1H) 7.07 (d, J=8.1 Hz, 1H) 7.13 (d, J=1.5 Hz, 1H) 7.36 (d, J=8.1 Hz, 1H) 7.54 (d, J=8.1 Hz, 1H) 7.69 (d, J=8.6 Hz, 1H) 8.49 (s, 1H) 8.60 (s, 1H) 12.41 (br s, 1H)
(190) LC/MS (method LC-C): R.sub.t 3.25 min, MH.sup.+ 567
(191) [].sub.D.sup.20: 119.2 (c 0.2727, DMF)
(192) Chiral SFC (method SFC-F): R.sub.t 2.64 min, MH.sup.+ 567, chiral purity 100%.
(193) Enantiomer 8B:
(194) .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.73 (s, 3H) 3.99 (s, 3H) 6.29 (d, J=8.1 Hz, 1H) 6.60 (s, 2H) 6.92 (s, 1H) 6.98 (dd, J=8.6, 2.0 Hz, 1H) 7.07 (d, J=8.1 Hz, 1H) 7.13 (d, J=2.0 Hz, 1H) 7.36 (d, J=8.6 Hz, 1H) 7.54 (dd, J=8.6, 1.5 Hz, 1H) 7.69 (d, J=8.6 Hz, 1H) 8.49 (s, 1H) 8.60 (s, 1H) 12.40 (br s, 1H)
(195) LC/MS (method LC-C): R.sub.t 3.25 min, MH.sup.+ 567
(196) [].sub.D.sup.20: +125.1 (c 0.2455, DMF)
(197) Chiral SFC (method SFC-F): R.sub.t 3.44 min, MH.sup.+ 567, chiral purity 100%.
Example 9: Synthesis of 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy-5-(methyl-sulfonyl)phenyl)amino)-1-(5-(trifluoromethoxy)-1H-indol-3-yl)ethanone (Compound 9) and Chiral Separation into Enantiomers 9A and 9B
(198) ##STR00020##
(199) Synthesis of Intermediate 9a:
(200) A solution of 5-(trifluoromethoxy)-1H-indole [CAS 262593-63-5] (3 g, 14.9 mmol) in CH.sub.2Cl.sub.2 (150 mL) was cooled to 0 C. under N.sub.2-atmosphere. A solution of diethylaluminum chloride 1M in hexane (22.4 mL, 22.4 mmol) was added dropwise and the resulting mixture was kept at 0 C. for 15 min. A solution of 2-(4-chloro-2-methoxyphenyl)acetyl chloride 1a (4.57 g, 20.9 mmol) in CH.sub.2Cl.sub.2 (100 mL) was added dropwise. Stirring was continued at 0 C. for 1 h and the reaction mixture was subsequently stirred at room temperature for 4 h. The reaction mixture was poured out in a stirring ice/Rochelle salt solution. After the ice had melted, the mixture was filtered over Dicalite and the filter cake was washed several times with THF. The filtrates were combined. The layers were separated and the organic layer washed with brine, dried over MgSO.sub.4, filtered and evaporated under reduced pressure. The residue was triturated with CH.sub.2Cl.sub.2 (50 mL). The resulting precipitate was filtered off and dried under vacuum at 50 C. to provide 2-(4-chloro-2-methoxy-phenyl)-1-(5-(trifluoromethoxy)-1H-indol-3-yl)ethanone 9a (4.39 g).
(201) Synthesis of Intermediate 9b:
(202) A stirred solution of 2-(4-chloro-2-methoxyphenyl)-1-(5-(trifluoromethoxy)-1H-indol-3-yl)ethanone 9a (4.39 g, 11.4 mmol) in THF (200 mL) was cooled to 0 C. A solution of phenyltrimethylammonium tribromide [CAS 4207-56-1] (4.73 g, 12.6 mmol) in THF (100 mL) was added dropwise. The resulting suspension was stirred at room temperature for 2 h. The solids were removed by filtration and washed with THF. The combined filtrates were evaporated under reduced pressure. The residue was mixed with EtOAc (30 mL). The solids were isolated by filtration, washed with a small amount of EtOAc and dried under vacuum at 50 C. to provide 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(5-(trifluoromethoxy)-1H-indol-3-yl)ethanone 9b (5.0 g) as a white solid, which was used without further purification in the next step.
(203) Synthesis of Compound 9 and Chiral Separation of Enantiomers 9A and 9B:
(204) A mixture 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(5-(trifluoromethoxy)-1H-indol-3-yl)ethanone 9b (2.5 g, 5.40 mmol), 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (1.49 g, 7.38 mmol) and diisopropylethylamine (931 L, 5.40 mmol) in CH.sub.3CN (100 mL) was stirred overnight at 90 C. The reaction mixture was concentrated under reduced pressure. The residue was dissolved in CH.sub.2Cl.sub.2 (100 mL), washed with 1N HCl (100 mL) and water (100 mL), dried over MgSO.sub.4, filtered and evaporated under reduced pressure. The residue was purified by column chromatograph (Stationary phase: Grace Reveleris silica 120 g, Mobile phase: EtOAc:EtOH (3:1)/heptane gradient 0/100 to 50/50). The desired fractions were combined and evaporated under reduced pressure. The residue was precipitated from EtOAc (10 mL) while stirring. The solids were isolated by filtration and washed with a small amount of EtOAc to provide 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)-1-(5-(trifluoro-methoxy)-1H-indol-3-yl)ethanone (Compound 9, 477 mg) as a racemic mixture. The filtrate was evaporated under reduced pressure and the residue was taken up with EtOAc (5 mL). After overnight stirring, the solids were isolated by filtration and washed with EtOAc to provide a second crop of Compound 9 (216 mg). The chiral separation of the enantiomers of Compound 9 (663 mg) was performed via Normal Phase Chiral separation (Stationary phase: AS 20 m, Mobile phase: 100% methanol). The product fractions were combined and evaporated to provide Enantiomer 9A as the first eluted product and Enantiomer 9B as the second eluted product. Enantiomer 9A was stirred up in H.sub.2O (2 mL) and MeOH (3 mL) at 40 C. The solids were filtered off, washed (3) with H.sub.2O/MeOH 1/1, and dried under vacuum at 45 C. to provide Enantiomer 9A (151 mg). Enantiomer 9B was further purified by flash chromatography on silica gel (Stationary phase: Grace Reveleris silica 12 g, Mobile phase: heptane/EtOAc/EtOH 100/0/0 to 40/45/15). The desired fractions were combined, evaporated under reduced pressure and co-evaporated with EtOAc. The residue was stirred up in MeOH (5 mL) and precipitated by the slow addition of H.sub.2O (4 mL). The solids were filtered off, washed (3) with H.sub.2O/MeOH 1/1, and dried under vacuum at 50 C. to provide Enantiomer 9B (132 mg).
(205) Compound 9:
(206) .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.73 (s, 3H) 3.99 (s, 3H) 6.26 (d, J=7.9 Hz, 1H) 6.57-6.62 (m, 2H) 6.91 (t, J=1.9 Hz, 1H) 6.98 (dd, J=8.4, 2.0 Hz, 1H) 7.07 (d, J=7.9 Hz, 1H) 7.13 (d, J=2.0 Hz, 1H) 7.22 (dd, J=8.6, 2.2 Hz, 1H) 7.36 (d, J=8.4 Hz, 1H) 7.59 (d, J=8.8 Hz, 1H) 8.06 (d, J=0.9 Hz, 1H) 8.55 (s, 1H) 12.28 (br s, 1H)
(207) LC/MS (method LC-A): R.sub.t 1.31 min, MH.sup.+ 583
(208) Enantiomer 9A:
(209) .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.73 (s, 3H) 3.99 (s, 3H) 6.26 (d, J=7.9 Hz, 1H) 6.55-6.62 (m, 2H) 6.91 (t, J=1.5 Hz, 1H) 6.98 (dd, J=8.4, 2.0 Hz, 1H) 7.07 (d, J=7.9 Hz, 1H) 7.13 (d, J=2.0 Hz, 1H) 7.21 (dd, J=8.8, 1.8 Hz, 1H) 7.36 (d, J=8.4 Hz, 1H) 7.59 (d, J=8.8 Hz, 1H) 8.07 (d, J=0.9 Hz, 1H) 8.55 (s, 1H) 12.29 (br s, 1H)
(210) LC/MS (method LC-A): R.sub.t 1.20 min, MH.sup.+ 583
(211) [].sub.D.sup.20: +130.3 (c 0.555, DMF)
(212) Chiral SFC (method SFC-E): R.sub.t 3.10 min, MH.sup.+ 583, chiral purity 100%.
(213) Enantiomer 9B:
(214) .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.73 (s, 3H) 3.99 (s, 3H) 6.26 (d, J=7.9 Hz, 1H) 6.56-6.62 (m, 2H) 6.92 (t, J=2.0 Hz, 1H) 6.98 (dd, J=8.1, 2.0 Hz, 1H) 7.07 (d, J=7.9 Hz, 1H) 7.13 (d, J=2.0 Hz, 1H) 7.22 (dd, J=8.8, 1.8 Hz, 1H) 7.36 (d, J=8.4 Hz, 1H) 7.59 (d, J=8.8 Hz, 1H) 8.07 (d, J=0.9 Hz, 1H) 8.55 (s, 1H) 12.30 (br s, 1H)
(215) LC/MS (method LC-A): R.sub.t 1.20 min, MH.sup.+ 583
(216) [].sub.D.sup.20: 133.2 (c 0.5, DMF)
(217) Chiral SFC (method SFC-E): R.sub.t 3.50 min, MH.sup.+ 583, chiral purity 100%.
Example 10: Synthesis of 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)-1-(6-methoxy-5-(trifluoromethoxy)-1H-indol-3-yl)-ethanone (Compound 10) and Chiral Separation into Enantiomers 10A and 10B
(218) ##STR00021## ##STR00022##
(219) Synthesis of Intermediate 10a:
(220) To a cooled (15 C.) solution of 3-methoxy-4-(trifluoromethoxy)benzaldehyde [CAS 853771-90-1] (50 g, 230 mmol) and ethyl azidoacetate (89 g, 690 mmol) in EtOH (400 mL) was added dropwise, over a period of 2 h, a solution of NaOEt (0.69 mol, prepared from 15.9 g of Na and 700 mL of EtOH). The reaction mixture was stirred at room temperature overnight. After cooling on an ice-bath, the reaction was quenched with a saturated NH.sub.4Cl solution (1.2 L), and stirred for 10 min. The precipitate was filtered off, washed with water, and dried to give (Z)-ethyl 2-azido-3-(3-methoxy-4-(trifluoromethoxy)phenyl)acrylate 10a (32 g) as a yellowish solid.
(221) Synthesis of Intermediate 10b:
(222) A solution of (Z)-ethyl 2-azido-3-(3-methoxy-4-(trifluoromethoxy)phenyl)acrylate 10a (3 g, 10 mmol) in xylene (40 mL) was heated under reflux overnight. After cooling to room temperature, the solvent was evaporated to dryness. The residue was triturated with hexane (50 mL) and the precipitate was filtered off to afford methyl 6-methoxy-5-(trifluoromethoxy)-1H-indole-2-carboxylate 10b (yield: 1.4-1.6 g) as a yellow solid.
(223) Synthesis of Intermediate 10c:
(224) To a mixture of methyl 6-methoxy-5-(trifluoromethoxy)-1H-indole-2-carboxylate 10b (25 g, 87 mmol) in MeOH/H.sub.2O (2/1, 300 mL) was added NaOH (7 g, 175 mmol) and the mixture was heated under reflux until a clear solution was obtained. After cooling to room temperature, most of the methanol was removed under reduced pressure and the remaining aqueous solution was acidified with conc. HCl to pH 3-4. The product was extracted with EtOAc (2250 mL). The combined organic layers were washed with brine, dried, and evaporated under reduced pressure to give 6-methoxy-5-(trifluoromethoxy)-1H-indole-2-carboxylic acid 10c (22.7 g) as a grey solid.
(225) Synthesis of Intermediate 10d:
(226) A suspension of 6-methoxy-5-(trifluoromethoxy)-1H-indole-2-carboxylic acid 10c (7.5 g, 27 mmol) and Cu (1.22 g, 0.7 equiv.) in quinoline (150 mL) was heated to 220-230 C. under inert atmosphere for 12 h. After cooling to room temperature, the mixture was diluted with methyl tert-butyl ether (MTBE, 400 mL) and washed with a saturated aqueous NaHSO.sub.4 solution (2500 mL). The organic layer was dried over MgSO.sub.4, filtered through short pad of silica gel, and evaporated under reduced pressure. The residue was purified by column chromatography to afford 6-methoxy-5-(trifluoromethoxy)-1H-indole 10d (3.75 g) as a yellow solid.
(227) Synthesis of Intermediate 10e:
(228) A solution of 6-methoxy-5-(trifluoromethoxy)-1H-indole 10d (1.61 g, 6.96 mmol) in CH.sub.2Cl.sub.2 (150 mL) was cooled to 0 C. under N.sub.2-atmosphere. A solution of diethylaluminum chloride 1M in hexane (10.4 mL, 10.4 mmol) was added dropwise and the resulting mixture was kept at 0 C. for 30 min. A solution of 2-(4-chloro-2-methoxyphenyl)acetyl chloride 1a (2.28 g, 10.4 mmol) in CH.sub.2Cl.sub.2 (75 mL) was added dropwise. Stirring was continued at 0 C. for 1 h and at room temperature for 1 h. The reaction mixture was cooled to 0 C. and a solution of potassium sodium tartrate tetrahydrate (Rochelle salt, 3.93 g, 13.9 mmol) in water (6 mL) was added dropwise. The reaction mixture was stirred for 30 min at 0 C. THF (200 mL) was added and the reaction mixture was stirred at room temperature for 20 min. Na.sub.2SO.sub.4 (25 g) was added, the mixture was stirred overnight, filtered over Dicalite and the filter cake was washed several times with THF (4150 mL). The filtrates were combined and evaporated under reduced pressure. The solid residue was stirred up in a mixture of diisopropyl ether (25 mL) and EtOAc (2 mL). The solids were filtered off, washed with DIPE (3) and dried under vacuum at 50 C. to provide 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-5-(trifluoromethoxy)-1H-indol-3-yl)ethanone 10e (3.6 g).
(229) Synthesis of Intermediate 10f:
(230) A stirred solution of 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-5-(trifluoro-methoxy)-1H-indol-3-yl)ethanone 10e (3.6 g, 6.53 mmol) in THF (130 mL) was cooled to 0 C., under N.sub.2-atmosphere. Phenyltrimethylammonium tribromide [CAS 4207-56-1] (2.58 g, 6.85 mmol) was added and the reaction mixture was stirred at 0 C. for 45 min and at room temperature for 1.5 h. The solids were removed by filtration and washed with THF (2). The combined filtrates were evaporated under reduced pressure to provide 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-5-(trifluoromethoxy)-1H-indol-3-yl)ethanone 10f (4.16 g), which was used without further purification in the next step.
(231) Synthesis of Compound 10 and Chiral Separation of Enantiomers 10A and 10B:
(232) A mixture 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-5-(trifluoro-methoxy)-1H-indol-3-yl)ethanone 10f (4.16 g, 6.50 mmol), 3-methoxy-5-(methyl-sulfonyl)aniline [CAS 62606-02-4] (2.62 g, 13.0 mmol) and diisopropylethylamine (2.24 mL, 13.0 mmol) in CH.sub.3CN was stirred at room temperature for 2 days under N.sub.2-atmosphere. Water (250 mL) was added and the product was extracted with Et.sub.2O (2). The combined organic layers were dried over MgSO.sub.4, filtered and evaporated under reduced pressure. The residue was purified by column chromatography (Stationary phase: Grace Reveleris silica 100 g, Mobile phase: heptane/EtOAc/EtOH gradient 100/0/0 to 40/45/15). The desired fractions were combined and evaporated under reduced pressure. The residue was further purified via preparative HPLC (Stationary phase: RP XBridge Prep C18 OBD10 m, 50150 mm, Mobile phase: 0.25% NH.sub.4HCO.sub.3 solution in water, CH.sub.3CN). The desired fractions were combined and evaporated under reduced pressure. The residue, containing racemic 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)-1-(6-methoxy-5-(trifluoromethoxy)-1H-indol-3-yl)ethanone (Compound 10, 380 mg), was submitted to chiral separation by preparative SFC (Stationary phase: Chiralpak Diacel AS 20250 mm, Mobile phase: CO.sub.2, EtOH+0.4% iPrNH.sub.2). The product fractions were combined, evaporated under reduced pressure and co-evaporated with MeOH to provide Enantiomer 10A as the first eluted product and Enantiomer 10B as the second eluted product. Both enantiomers were precipitated from a solvent mixture of MeOH and water, filtered off and dried at 50 C. under vacuum to provide Enantiomer 10A (135 mg) and Enantiomer 10B (144 mg).
(233) Enantiomer 10A:
(234) .sup.1H NMR (360 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.72 (s, 3H) 3.87 (s, 3H) 3.99 (s, 3H) 6.22 (d, J=7.7 Hz, 1H) 6.55-6.59 (m, 2H) 6.88-6.91 (m, 1H) 6.98 (dd, J=8.1, 1.8 Hz, 1H) 7.08 (d, J=7.7 Hz, 1H) 7.13 (d, J=2.2 Hz, 1H) 7.21 (s, 1H) 7.34 (d, J=8.1 Hz, 1H) 8.02 (d, J=1.5 Hz, 1H) 8.41 (s, 1H) 12.05 (br s, 1H)
(235) LC/MS (method method LC-A): R.sub.t 1.20 min, MH.sup.+ 613
(236) [].sub.D.sup.20: +81.4 (c 0.29, DMF)
(237) Chiral SFC (method SFC-E): R.sub.t 3.34 min, MH.sup.+ 613, chiral purity 100%.
(238) Enantiomer 10B:
(239) .sup.1H NMR (360 MHz, DMSO-d.sub.6) ppm 3.09 (s, 3H) 3.72 (s, 3H) 3.87 (s, 3H) 3.99 (s, 3H) 6.22 (d, J=7.7 Hz, 1H) 6.55-6.60 (m, 2H) 6.90 (t, J=1.6 Hz, 1H) 6.98 (dd, J=8.2, 2.0 Hz, 1H) 7.08 (d, J=7.8 Hz, 1H) 7.13 (d, J=2.2 Hz, 1H) 7.21 (s, 1H) 7.34 (d, J=8.4 Hz, 1H) 8.01 (d, J=1.1 Hz, 1H) 8.41 (s, 1H) 12.08 (br s, 1H) LC/MS (method method LC-A): R.sub.t 1.20 min, MH.sup.+ 613
(240) [].sub.D.sup.20: 99.6 (c 0.261, DMF)
(241) Chiral SFC (method SFC-E): R.sub.t 3.69 min, MH.sup.+ 613, chiral purity 100%.
Example 11: Synthesis of 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy-5-(methyl-sulfonyl)phenyl)amino)-1-(7-methyl-5-(trifluoromethoxy)-1H-indol-3-yl)ethanone (Compound 11) and Chiral Separation into Enantiomers 11A and 11B
(242) ##STR00023## ##STR00024##
(243) Synthesis of Intermediate 11a:
(244) A mixture of boron(III) chloride 1M in CH.sub.2Cl.sub.2 (25.5 mL, 25.5 mmol) and aluminum(III) chloride (3.40 g, 25.5 mmol) was diluted with CH.sub.2Cl.sub.2 (20 mL) and cooled on an ice-bath under N.sub.2-atmosphere. A solution of 2-methyl-4-(trifluoro-methoxy)aniline [CAS 86256-59-9] (4.88 g, 25.5 mmol) and chloroacetonitrile (3.24 mL, 51.0 mmol) in CH.sub.2Cl.sub.2 (7.5 mL) was added dropwise. After addition, the ice-bath was removed and the mixture was heated under reflux for 8 h. The mixture was cooled again to 0 C. using an ice-bath. 2N HCl (75 mL) was added dropwise, causing heavy precipitation. The resulting suspension was heated under reflux for 90 min, and cooled to room temperature. The solids were removed by filtration. The filter cake was washed with CH.sub.2Cl.sub.2 (4). The filtrates were combined and the phases were separated. The organic layer was isolated, washed with an aqueous NaHCO.sub.3 solution, dried over MgSO.sub.4, filtered and evaporated under reduced pressure. The residue was purified by flash chromatography (Stationary phase: Biotage SNAP Ultra Silica 100 g, Mobile phase: heptane/CH.sub.2Cl.sub.2 gradient 100/0 to 0/100). The desired fractions were combined and concentrated to a residual volume of 30 mL. The precipitate was filtered off, washed with heptane and CH.sub.2Cl.sub.2, and dried under vacuum at 50 C. to provide 1-(2-amino-3-methyl-5-(trifluoromethoxy)phenyl)-2-chloroethanone 11a (1.37 g). The filtrate was concentrated under reduced pressure. The solid residue was stirred up in a mixture of heptane (20 mL) and diisopropyl ether (3 mL), filtered off, washed with heptane (3) and dried under vacuum at 50 C. to provide a second fraction of 11a (0.24 g).
(245) Synthesis of Intermediate 11b:
(246) Sodium borohydride (326 mg, 8.61 mmol) was added to a stirred solution of 1-(2-amino-3-methyl-5-(trifluoromethoxy)phenyl)-2-chloroethanone 11a (1.92 g, 7.17 mmol) in tert-butanol (50 mL) and water (5 mL). The reaction mixture was stirred at room temperature for 30 min and at 90 C. for 2.5 h. Water (50 mL) was added and the product was extracted with diethyl ether (2). The combined organic layers were washed with brine, dried over MgSO.sub.4, filtered and evaporated under reduced pressure. The residue was purified by flash chromatography (Stationary phase: Biotage SNAP Ultra Silica 25 g, Mobile phase: heptane/EtOAc gradient 100/0 to 20/80). The desired fractions were combined, concentrated under reduced pressure, co-evaporated with heptane and dried under vacuum at 50 C. to provide 7-methyl-5-(trifluoromethoxy)-1H-indole 11b (1.2 g).
(247) Synthesis of Intermediate 11c:
(248) A mechanically stirred solution of 7-methyl-5-(trifluoromethoxy)-1H-indole 11b (1.5 g, 6.97 mmol) in CH.sub.2Cl.sub.2 (100 mL) was cooled to 0 C. under N.sub.2-atmosphere. A solution of diethylaluminum chloride 1M in hexane (10.5 mL, 10.5 mmol) was added dropwise and the resulting mixture was kept at 0 C. for 25 min. A solution of 2-(4-chloro-2-methoxyphenyl)acetyl chloride 1a (2.29 g, 10.5 mmol) in CH.sub.2Cl.sub.2 (40 mL) was added dropwise while keeping the reaction temperature below 6 C. Stirring was continued at 0 C. for 1 h and the reaction mixture was subsequently stirred at room temperature for 1 h. The reaction mixture was cooled to 0 C. and a solution of Rochelle salt [CAS 6100-16-9] (3.94 g, 13.9 mmol) in water (4 mL) was added dropwise. After stirring for 1 h, the reaction mixture was filtered over Dicalite and the filter cake was washed with THF (5100 mL). The combined filtrates were evaporated under reduced pressure. The residue solidified upon standing overnight. The solids were stirred up in CH.sub.3CN (5 mL), filtered off, washed with CH.sub.3CN (31.5 mL) and dried under vacuum at 50 C. to provide 2-(4-chloro-2-methoxyphenyl)-1-(7-methyl-5-(trifluoromethoxy)-1H-indol-3-yl)-ethanone 11c (1.9 g).
(249) Synthesis of Intermediate 11d:
(250) A stirred solution 2-(4-chloro-2-methoxyphenyl)-1-(7-methyl-5-(trifluoromethoxy)-1H-indol-3-yl)ethanone 11c (2.13 g, 5.35 mmol) in THF (80 mL) was cooled to 0 C., under N.sub.2-atmosphere. Phenyltrimethylammonium tribromide [CAS 4207-56-1] (2.11 g, 5.62 mmol) was added and the reaction mixture was stirred at 0 C. for 40 min and at room temperature for 2 h. The solids were removed by filtration and washed with THF (2). The combined filtrates were evaporated under reduced pressure to provide 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(7-methyl-5-(trifluoromethoxy)-1H-indol-3-yl)ethanone 11d (3.45 g), which was used without further purification in the next step.
(251) Synthesis of Compound 11 and Chiral Separation of Enantiomers 11A and 11B:
(252) A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(7-methyl-5-(trifluoro-methoxy)-1H-indol-3-yl)ethanone 11d (3.45 g, 6.87 mmol), 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (2.76 g, 13.7 mmol) and diisopropylethylamine (2.37 mL, 13.7 mmol) in CH.sub.3CN (60 mL) was stirred at room temperature for 2 days under N.sub.2-atmosphere. Water (125 mL) was added and the product was extracted with Et.sub.2O (2). The combined organic layers were washed with brine, dried over MgSO.sub.4, filtered and evaporated under reduced pressure. The residue was purified via preparative HPLC (Stationary phase: RP XBridge Prep C18 OBD10 m, 50150 mm, Mobile phase: 0.25% NH.sub.4HCO.sub.3 solution in water, CH.sub.3CN). The fractions containing product were combined and evaporated under reduced pressure to provide racemic 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)-1-(7-methyl-5-(trifluoromethoxy)-1H-indol-3-yl)ethanone (Compound 11, 1.74 g). The chiral separation of the enantiomers of Compound 11 (1.74 g) was performed via Preparative SFC (Stationary phase: Chiralpak Diacel AS 20250 mm, Mobile phase: CO.sub.2, EtOH+0.4% iPrNH.sub.2). The product fractions were combined and evaporated under reduced pressure to provide Enantiomer 11A as the first eluted product and Enantiomer 11B as the second eluted product. Both enantiomers were precipitated from a solvent mixture of MeOH and water, filtered off and dried at 50 C. under vacuum to provide Enantiomer 11A (777 mg) and Enantiomer 11B (712 mg).
(253) Enantiomer 11A:
(254) .sup.1H NMR (600 MHz, DMSO-d.sub.6) ppm 2.50 (s, 3H) 3.09 (s, 3H) 3.72 (s, 3H) 4.00 (s, 3H) 6.28 (d, J=7.8 Hz, 1H) 6.56-6.63 (m, 2H) 6.92 (br s, 1H) 6.97 (dd, J=8.4, 1.9 Hz, 1H) 7.05 (br s, 1H) 7.07 (d, J=7.9 Hz, 1H) 7.13 (d, J=1.9 Hz, 1H) 7.35 (d, J=8.4 Hz, 1H) 7.90 (br s, 1H) 8.53 (s, 1H) 12.41 (br s, 1H)
(255) LC/MS (method method LC-A): R.sub.t 1.26 min, MH.sup.+ 597
(256) [].sub.D.sup.20: +81.3 (c 0.3455, DMF)
(257) Chiral SFC (method SFC-E): R.sub.t 2.96 min, MH.sup.+ 597, chiral purity 100%.
(258) Enantiomer 11B:
(259) .sup.1H NMR (600 MHz, DMSO-d.sub.6) ppm 2.51 (s, 3H) 3.09 (s, 3H) 3.72 (s, 3H) 4.00 (s, 3H) 6.28 (d, J=7.9 Hz, 1H) 6.58-6.60 (m, 2H) 6.92 (t, J=1.8 Hz, 1H) 6.97 (dd, J=8.4, 1.9 Hz, 1H) 7.05 (br s, 1H) 7.06 (d, J=7.9 Hz, 1H) 7.13 (d, J=2.1 Hz, 1H) 7.35 (d, J=8.2 Hz, 1H) 7.89 (br s, 1H) 8.53 (s, 1H) 12.37 (br s, 1H)
(260) LC/MS (method LC-A): R.sub.t 1.26 min, MH.sup.+ 597
(261) [].sub.D.sup.20: 87.4 (c 0.342, DMF)
(262) Chiral SFC (method SFC-E): R.sub.t 3.44 min, MH.sup.+ 597, chiral purity 100%.
(263) Antiviral Activity of the Compounds of the Invention
(264) DENV-2 Antiviral Assay
(265) The antiviral activity of all the compounds of the invention was tested against the DENV-2 16681 strain which was labeled with enhanced green fluorescent protein (eGPF; Table 1). The culture medium consists of minimal essential medium supplemented with 2% of heat-inactivated fetal calf serum, 0.04% gentamycin (50 mg/mL) and 2 mM of L-glutamine. Vero cells, obtained from ECACC, were suspended in culture medium and 25 L was added to 384-well plates (2500 cells/well), which already contain the antiviral compounds. Typically, these plates contain a 5-fold serial dilution of 9 dilution steps of the test compound at 200 times the final concentration in 100% DMSO (200 nL). In addition, each compound concentration is tested in quadruplicate (final concentration range: 25 M-0.000064 M or 2.5 M-0.0000064 M for the most active compounds). Finally, each plate contains wells which are assigned as virus controls (containing cells and virus in the absence of compound), cell controls (containing cells in the absence of virus and compound) and medium controls (containing medium in the absence of cells, virus and compounds). To the wells assigned as medium control, 25 L of culture medium was added instead of Vero cells. Once the cells were added to the plates, the plates were incubated for 30 minutes at room temperature to allow the cells to distribute evenly within the wells. Next, the plates were incubated in a fully humidified incubator (37 C., 5% CO.sub.2) until the next day. Then, DENV-2 strain 16681, labeled with eGFP, was added at a multiplicity of infection (MOI) of 0.5. Therefore, 15 L of virus suspension was added to all the wells containing test compound and to the wells assigned as virus control. In parallel, 15 L of culture medium was added to the medium and cell controls. Next, the plates were incubated for 3 days in a fully humidified incubator (37 C., 5% CO.sub.2). At the day of the read out, the eGFP fluorescence was measured using an automated fluorescence microscope at 488 nm (blue laser). Using an in-house LIMS system, inhibition dose response curves for each compound were calculated and the half maximal effective concentration (EC.sub.50) was determined. Therefore, the percent inhibition (I) for every test concentration is calculated using the following formula: I=100*(S.sub.TS.sub.CC)/(S.sub.VCS.sub.CC), S.sub.T, S.sub.CC and S.sub.VC are the amount of eGFP signal in the test compound, cell control and virus control wells, respectively. The EC.sub.50 represents the concentration of a compound at which the virus replication is inhibited with 50%, as measured by a 50% reduction of the eGFP fluorescent intensity compared to the virus control. The EC.sub.50 is calculated using linear interpolation.
(266) In parallel, the toxicity of the compounds was assessed on the same plates. Once the read-out for the eGFP signal was done, 40 L of ATPlite, a cell viability stain, was added to all wells of the 384-well plates. ATP is present in all metabolically active cells and the concentration declines very rapidly when the cells undergo necrosis or apoptosis. The ATPLite assay system is based on the production of light caused by the reaction of ATP with added luciferase and D-luciferin. The plates were incubated for 10 minutes at room temperature. Next, the plates were measured on a ViewLux. The half maximal cytotoxic concentration (CC.sub.50) was also determined, defined as the concentration required to reduce the luminescent signal by 50% compared to that of the cell control wells. Finally, the selectivity index (SI) was determined for the compounds, which was calculated as followed: SI=CC.sub.50/EC.sub.50.
(267) TABLE-US-00004 TABLE 1 EC.sub.50, CC.sub.50, and SI for the compounds of the invention in the DENV-2 antiviral assay EC.sub.50 CC.sub.50 compound# (M) N (M) N SI N 1 0.00052 5 5.5 4 11500 4 1A 0.00026 8 4.3 8 19700 8 1B 0.012 6 6.5 6 530 6 2 0.00060 4 5.0 4 8410 4 2A 0.00026 4 4.8 4 22000 4 2B 0.026 4 7.4 4 285 4 3 0.00058 4 >11 6 37700 4 3A 0.00025 5 7.2 5 29800 5 3B 0.0038 3 >9.7 5 2480 3 4 0.00039 4 5.9 4 14900 4 4A 0.00027 11 4.2 13 16900 11 4B 0.036 5 12 5 341 5 5 0.00062 4 5.5 4 8780 4 5A 0.00041 5 5.0 5 12900 5 5B 0.068 4 13 4 206 4 6A 0.000068 8 >25 8 >65500 8 6B 0.019 4 11 4 603 4 7 0.00047 4 3.2 3 >7040 3 7A 0.013 3 6.8 3 538 3 7B 0.00020 5 3.2 5 18500 5 8 0.00013 6 2.9 7 30400 6 8A 0.0030 3 7.4 3 2510 3 8B 0.000069 5 3.4 5 >40900 5 9 0.000074 6 3.1 8 >39100 6 9A 0.000067 9 2.9 9 >37500 9 9B 0.0038 5 6.2 6 1480 5 10A 0.00012 3 2.6 3 22600 3 10B 0.0039 3 9.8 3 2530 3 11A 0.000085 3 2.6 3 30100 3 11B 0.0041 3 9.2 3 2220 3 N = the number of independent experiments in which the compounds were tested.
(268) Tetravalent Reverse Transcriptase Quantitative-PCR (RT-qPCR) Assay: Protocol A.
(269) The antiviral activity of the compounds of the invention was tested against DENV-1 strain TC974 #666 (NCPV; Table 6), DENV-2 strain 16681 (Table 7), DENV-3 strain H87 (NCPV; Table 8) and DENV-4 strains H241 (NCPV; Table 9A) and SG/06K2270DK1/2005 (Eden; Table 9B) in a RT-qPCR assay. Therefore, Vero cells were infected with either DENV-1, or -2, or -3, or -4 in the presence or absence of test compounds. At day 3 post-infection, the cells were lysed and cell lysates were used to prepare cDNA of both a viral target (the 3UTR of DENV; Table 2) and a cellular reference gene (-actin, Table 2). Subsequently, a duplex real time PCR was performed on a Lightcycler480 instrument. The generated Cp value is inversely proportional to the amount of RNA expression of these targets. Inhibition of DENV replication by test compound results in a shift of Cp's for the 3UTR gene. On the other hand, if a test compound is toxic to the cells, a similar effect on -actin expression will be observed. The comparative Cp method is used to calculate EC.sub.50, which is based on the relative gene expression of the target gene (3UTR) normalized with the cellular housekeeping gene (-actin).
(270) TABLE-US-00005 TABLE2 Primersandprobesusedforthereal-time, quantitativeRT-PCR. Primer/probe Target Sequence.sup.a,b F3utr258 DENV3'-UTR 5'-CGGTTAGAGGAGACCCCTC-3' R3utr425 DENV3'-UTR 5'-GAGACAGCAGGATCTCTGGTC-3' P3utr343 DENV3'-UTR -5'-AAGGACTAG-ZEN- AGGTTAGAGGAGACCCCCC-3'-
Factin743 -actin 5'-GGCCAGGTCATCACCATT-3' Ractin876 -actin 5'-ATGTCCACGTCACACTTCATG-3' Pactin773 -actin
-5'-TTCCGCTGC-
- CCTGAGGCTCTC-3'-
.sup.aReporter dyes (FAM, HEX) and quenchers (ZEN and IABkFQ) elements are indicated in bold and italics. .sup.bThe nucleotide sequence of the primers and probes were selected from the conserved region in the 3'UTR region of the dengue virus genome, based on the alignment of 300 nucleotide sequences of the four dengue serotypes deposited in Genbank (Gong et al., 2013, Methods Mol Biol, Chapter 16).
(271) The culture medium consisted of minimal essential medium supplemented with 2% of heat-inactivated fetal calf serum, 0.04% gentamycin (50 mg/mL) and 2 mM of L-glutamine. Vero cells, obtained from ECACC, were suspended in culture medium and 75 L/well was added in 96-well plates (10000 cells/well), which already contain the antiviral compounds. Typically, these plates contain a 5-fold serial dilution of 9 dilution steps of the test compound at 200 times the final concentration in 100% DMSO (500 nL; final concentration range: 25 M-0.000064 M or 2.5 M-0.0000064 M for the most active compounds). In addition, each plate contains wells which are assigned as virus controls (containing cells and virus in the absence of compound) and cell controls (containing cells in the absence of virus and compound). Once the cells were added in the plates, the plates were incubated in a fully humidified incubator (37 C., 5% CO.sub.2) until the next day. Dengue viruses serotype-1, 2, 3 and 4 were diluted in order to obtain a Cp of 22-24 in the assay. Therefore, 25 L of virus suspension was added to all the wells containing test compound and to the wells assigned as virus control. In parallel, 25 L of culture medium was added to the cell controls. Next, the plates were incubated for 3 days in a fully humidified incubator (37 C., 5% CO.sub.2). After 3 days, the supernatant was removed from the wells and the cells were washed twice with ice-cold PBS (100 L). The cell pellets within the 96-well plates were stored at 80 C. for at least 1 day. Next, RNA was extracted using the Cells-to-CT lysis kit, according to the manufacturer's guideline (Life Technologies). The cell lysates can be stored at 80 C. or immediately used in the reverse transcription step.
(272) In preparation of the reverse transcription step, mix A (table 3A) was prepared and 7.57 L/well was dispensed in a 96-well plate. After addition of 5 L of the cell lysates, a five minute denaturation step at 75 C. was performed (table 3B). Afterwards, 7.43 L of mix B was added (table 3C) and the reverse transcription step was initiated (table 3D) to generate cDNA.
(273) Finally, a RT-qPCR mix was prepared, mix C (table 4A), and 22.02 L/well was dispensed in 96-well LightCycler qPCR plates to which 3 L of cDNA was added and the qPCR was performed according to the conditions in table 4B on a LightCycler 480.
(274) Using the LightCycler software and an in-house LIMS system, dose response curves for each compound were calculated and the half maximal effective concentration (EC.sub.50) and the half maximal cytotoxic concentration (CC.sub.50) were determined.
(275) TABLE-US-00006 TABLE 3 cDNA synthesis using Mix A, denaturation, Mix B and reverse transcription. A Mix A Plates 8 Samples 828 Reaction Vol. (l) 20 Concentration Volume for (l) Mix Item Unit Stock Final 1 sample x samples Milli-Q H.sub.2O 7.27 6019.56 R3utr425 M 20 0.27 0.15 124.20 Ractin876 M 20 0.27 0.15 124.20 Volume mix/well (l) 7.57 Cell lysates 5.00 B Denaturation step: Step Temp Time Denaturation 75 C. 5 Hold 4 C. hold C Mix B Samples 864 Concentration Volume for (l) Mix Item Unit Stock Final 1 sample x samples Expand HIFI X 10.00 1.00 2.00 1728.0 buffer 2 MgCl.sub.2 mM 25.00 3.50 2.80 2419.2 dNTPs mM 10.00 1.00 2.00 1728.0 Rnase inhibitor U/l 40.00 1.00 0.50 432.0 Expand RT U/l 50.00 0.33 0.13 112.3 Total Volume Mix (l) 7.43 D Protocol cDNA synthesis Step Temp Time Rev transc 42 C. 30 Denaturation 99 C. 5 Hold 4 C. hold
(276) TABLE-US-00007 TABLE 4 qPCR mix and protocol. A Mix C Samples 833 Reaction Vol. (l) 25 Concentration Volume for (l) Mix Item Unit Stock Final 1 sample x samples H.sub.2O 7.74 6447.42 PCR grade Roche Roche 2xMM mix X 2 1 12.50 10412.50 F3utr258 M 20 0.3 0.38 316.54 R3utr425 M 20 0.3 0.38 316.54 P3utr343 M 20 0.1 0.13 108.29 Factin743 M 20 0.3 0.38 316.54 Ractin876 M 20 0.3 0.38 316.54 Pactin773 M 20 0.1 0.13 108.29 Volume Mix/Tube (l) 22.02 cDNA 3.00 B Protocol qPCR3 Ramp Step Temp Time rate preincub/denat 95 C. 10 min 4.4 Denaturation 95 C. 10 sec 4.4 annealing 58 C. 1 min 2.2 40 cycles Elongation 72 C. 1 sec 4.4 Cooling 40 C. 10 sec 1.5
(277) Tetravalent Quantitative Reverse Transcriptase-PCR (RT-qPCR) Assay: Protocol B.
(278) The antiviral activity of the compounds of the invention was tested against DENV-1 strain Djibouti strain (D1/H/IMTSSA/98/606; Table 6), DENV-2 strain NGC (Table 7), DENV-3 strain H87 (Table 8) and DENV-4 strain SG/06K2270DK1/2005 (Table 9B) in a RT-qPCR assay. Vero-B or Vero-M cells (510.sup.4) were seeded in 96-well plates. One day later, culture medium was replaced with 100 L assay medium containing a 2, 3 or 5 serial dilution of the compound (concentration range: 50 g/mL-0.00038 g/mL, 50 g/mL-0.0076 g/mL, and 50 g/mL-0.00013 g/mL, respectively) and 100 L of dengue virus inoculum (DENV). Following a 2 hour incubation period, the cell monolayer was washed 3 times with assay medium to remove residual, non-adsorbed virus and cultures were further incubated for either 4 days (DENV-2 NGC) or 7 days (DENY-1 Djibouti strain D1/H/IMTSSA/98/606, DENV-3 strain H87 prototype, DENV-4 strain H241, and DENV-4 strain EDEN) in the presence of the inhibitor. Supernatant was harvested and viral RNA load was determined by real-time quantitative RT-PCR. The 50% effective concentration (EC.sub.50), which is defined as the compound concentration that is required to inhibit viral RNA replication by 50%, was determined using logarithmic interpolation. RNA was isolated from 100 L (or in some circumstances 150 L) supernatant with the NucleoSpin 96 Virus kit (Filter Service, Duren, Germany) as described by the manufacturer. The sequences of the TaqMan primers (DENV-For, DENV-Rev; Table 5) and TaqMan probes (DENV-Probe Table 5) were selected from non-structural gene 3 (NS3) or NS5, of the respective flaviviruses using Primer Express software (version 2.0; Applied Biosystems, Lennik, Belgium). The TaqMan probe was fluorescently labelled with 6-carboxyfluorescein (FAM) at the 5 end as the reporter dye, and with minor groove binder (MGB) at the 3 end as the quencher (Table 5). One-step, quantitative RT-PCR was performed in a total volume of 25 L, containing 13.9375 L H.sub.2O, 6.25 L master mix (Eurogentec, Seraing, Belgium), 0.375 L forward primer, 0.375 L reverse primer, 1 L probe, 0.0625 L reverse transcriptase (Eurogentec) and 3 L sample. RT-PCR was performed using the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Branchburg, N.J., USA) using the following conditions: 30 min at 48 C. and 10 min at 95 C., followed by 40 cycles of 15 s at 95 C. and 1 min at 60 C. The data was analyzed using the ABI PRISM 7500 SDS software (version 1.3.1; Applied Biosystems). For absolute quantification, standard curves were generated using 10-fold dilutions of template preparations of known concentrations.
(279) TABLE-US-00008 TABLE5 Primersandprobesusedforreal-time, quantitativeRT-PCR. Primer/ Tar- Probe Sequence(5'.fwdarw.3').sup.a Source.sup.b get DENV-For TCGGAGCCGGAGTTTACAAA DENV2 NS3 (SEQIDN.1) NGC DENV-Rev TCTTAACGTCCGCCCATGAT (SEQIDN.2) DENV- ATTCCACACAATGTGGCAT- Probe
(SEQIDN.3) DenS GGATAGACCAGAGATCCTGCTGT DENV-1, NS5 (SEQIDN.4) -3,-4 DenAS1-3 CATTCCATTTTCTGGCGTTC DENV-1, (SEQIDN.5) -3 DenAS4 CAATCCATCTTGCGGCGCTC DENV-4 (SEQIDN.6) DEN_1-3
CAGCATCATTCCAGGCACAG- DENV-1, probe
(SEQIDN.7) -3 DEN_4
-CAACATCAATCCAGGCACAG- DENV-4 probe
(SEQIDN.8) .sup.aReporter dye (FAM) and quencher (MGB/TAMRA) elements are indicated in bold and italics. .sup.bThe nucleotide sequence and position of the primers and probes within the genome were deduced from the nucleotide sequence of DENV 2 NGC (Gen Bank accession no. M29095; Irie et al., 1989), dengue virus serotype 1 Djibouti strain D1/H/IMTSSA/98/606 (Genbank Accession Number AF298808), dengue virus serotype 3 strain H87 prototype (c93130), dengue virus serotype 4 strain H241 (no sequences available), dengue virus serotype 4 strain EDEN (no sequences available)
(280) Cytotoxic Assay
(281) Potential cytotoxic effects of the compounds were evaluated in uninfected quiescent Vero-B or Vero-M cells. Cells were seeded at 510.sup.4 cells/well in a 96-well plate in the presence of two-, three- or five-fold serial dilutions (ranging from 50 g/mL-0.0038 g/mL, 50 g/mL-0.0076 g/mL, and 50 g/mL-0.00013 g/mL, respectively) of compound and incubated for 4 to 7 days. Culture medium was discarded and 100 L 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxy-methoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium/phenazinemethosulfate (MTS/PMS; Promega, Leiden, The Netherlands) in PBS was added to each well. Following a 2-hour incubation period at 37 C., the optical density was determined at 498 nm. Cytotoxic activity was calculated using the following formula: % cell viability=100(OD.sub.Compound/OD.sub.CC), where OD.sub.compound and OD.sub.CC correspond to the optical density at 498 nm of the uninfected cell cultures treated with compound and that of uninfected, untreated cell cultures, respectively. The 50% cytotoxic concentration (i.e., the concentration that reduces the total cell number with 50%; CC.sub.50) was calculated using linear interpolation.
(282) TABLE-US-00009 TABLE 6 EC.sub.50, CC.sub.50, and SI for the compounds against serotype 1 in the RT-qPCR assays Protocol A Protocol B RT-qPCR serotype 1 TC974#666 RT-qPCR serotype 1 Djibouti EC.sub.50 CC.sub.50 EC.sub.50 CC.sub.50 compound# (M) N (M) N SI N (M) N (M) N SI N 1A 0.0025 9 5.0 9 1950 9 <0.015 3 8 6 >533 3 2A 0.0024 6 5.3 6 2190 6 <0.014 2 7.3 3 >523 2 3A 0.0042 6 5.5 5 1360 5 ND ND ND ND ND ND 4A 0.00097 8 5.1 8 4400 8 <0.014 3 4.3 4 >306 3 5A 0.0036 6 5.2 6 1460 6 <0.014 2 9.2 2 >658 2 6A 0.0016 6 >10 6 >8160 6 <0.014 2 >92 3 >6571 2 7B 0.00040 3 2.2 2 6600 2 ND ND ND ND ND ND 8B 0.00045 5 1.9 6 3130 4 ND ND ND ND ND ND 9A 0.00011 4 1.7 5 13300 4 ND ND ND ND ND ND 10A 0.00027 2 1.6 2 5670 2 ND ND ND ND ND ND 11A 0.00013 2 >2.5 2 >22100 2 ND ND ND ND ND ND N = the number of independent experiments in which the compounds were tested. ND: not determined.
(283) TABLE-US-00010 TABLE 7 EC.sub.50, CC.sub.50, and SI for the compounds against serotype 2 in the RT-qPCR assays Protocol A Protocol B RT-qPCR serotype 2 16681 RT-qPCR serotype 2NGC-Tongalike EC.sub.50 CC.sub.50 EC.sub.50 CC.sub.50 compound# (M) N (M) N SI N (M) N (M) N SI N 1A 0.00028 7 3.8 12 15300 8 <0.00027 4 11 4 >40470 4 2A 0.00024 5 4.9 6 21500 5 <0.00024 1 11 1 >45833 1 3A 0.00030 6 5.0 6 9970 6 ND ND ND ND ND ND 4A 0.00020 7 3.9 10 25400 6 0.00032 1 6.6 1 20339 1 5A 0.00034 5 5.8 6 19000 5 <0.00023 1 ND ND ND ND 6A 0.00011 7 >10 6 >142306 6 <0.00024 1 >92 1 >383333 1 76 0.00017 3 2.9 5 23600 3 ND ND ND ND ND ND 86 0.00031 4 2.2 6 23400 4 ND ND ND ND ND ND 9A 0.000057 3 2.2 4 31700 3 ND ND ND ND ND ND 10A 0.000057 3 1.6 3 28200 3 ND ND ND ND ND ND 11A 0.000051 3 >2.5 3 >69000 3 ND ND ND ND ND ND N = the number of independent experiments in which the compounds were tested. ND: not determined.
(284) TABLE-US-00011 TABLE 8 EC.sub.50, CC.sub.50, and SI for the compounds against serotype 3 in the RT-qPCR assays Protocol A Protocol B RT-qPCR serotype 3 H87 RT-qPCR serotype 3 H87 EC.sub.50 CC.sub.50 EC.sub.50 CC.sub.50 compound# (M) N (M) N SI N (M) N (M) N SI N 1A 0.023 7 3.7 5 169 5 <0.015 3 8.0 6 >533 3 2A 0.019 4 4.3 3 224 3 <0.014 1 7.3 3 >521 1 3A 0.048 4 4.1 3 67 3 ND ND ND ND ND ND 4A 0.015 6 3.1 4 195 4 <0.014 1 4.3 4 >307 1 5A 0.053 4 4.4 2 75 2 0.022 1 9.2 2 422 1 6A 0.019 4 6.7 3 318 3 <0.014 1 > 92 3 >6571 1 7B 0.0078 3 1.6 3 240 3 ND ND ND ND ND ND 8B 0.0058 4 2.1 3 609 3 ND ND ND ND ND ND 9A 0.0021 3 1.6 1 474 1 ND ND ND ND ND ND 10A 0.0037 3 1.0 3 280 3 ND ND ND ND ND ND 11A 0.0012 3 >2.5 3 >2630 3 ND ND ND ND ND ND N = the number of independent experiments in which the compounds were tested. ND: not determined.
(285) TABLE-US-00012 TABLE 9 EC.sub.50, CC.sub.50, and SI for the compounds against serotype 4 in the RT-qPCR assays EC.sub.50 CC.sub.50 compound# (M) N (M) N SI N A Protocol A RT-qPCR serotype 4 H241 1A 0.093 10 3.0 9 30 9 2A 0.083 6 3.7 6 42 6 3A 0.11 6 3.8 4 37 4 4A 0.053 11 2.5 11 54 11 5A 0.10 6 4.0 6 39 6 6A 0.095 7 7.7 5 69 5 78 0.044 5 2.2 5 53 5 88 0.015 5 1.7 3 122 3 9A 0.012 5 1.5 5 121 5 10A 0.011 3 1.6 2 127 2 11A 0.011 3 3.1 3 >250 3 B Protocol A RT-qPCR serotype 4 EDEN 1A 0.0024 5 4.6 5 1927 5 2A 0.0013 2 5.0 2 3913 2 3A 0.0030 2 5.4 2 1802 2 4A 0.00055 2 > 2.5 1 > 4520 1 5A 0.0029 2 5.5 2 1878 2 6A 0.00042 2 > 10 2 > 24085 2 N = the numberof independent experiments in which the compounds were tested.