MOLECULAR DESIGN OF RECOMBINANT PROTEIN DRUG

20210085754 ยท 2021-03-25

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided is a mutant of an endostatin. The mutant has improved ATPase activity and improved activity of inhibiting angiogenesis and inhibiting tumors. Further provided is use of the mutant in treatment of angiogenesis related diseases such as tumors.

Claims

1. A method for increasing the anti-angiogenesis activity of endostatin or variants thereof, including increasing the ATPase activity of endostatin or variants thereof.

2. The method of claim 1, including genetic engineering on the A motif and/or the B motif and/or the C motif of endostatin or variants thereof, to obtain an endostatin mutant with increased ATPase activity.

3. The method of claim 2, wherein said genetic engineering includes one or more of the following approaches: (1) keeping the amino acid residues corresponding to the conserved amino acid residues G89, G92, and K95 in the A motif GXXGXXK in SEQ ID NO:1 unchanged; (2) increasing the spatial conformation flexibility of the peptide corresponding to the A motif by adjusting the variable residues X within the A motif GXXGXXK; (3) adding a Ser or Thr after residue K95 in the classic sequence of A motif GXXGXXK; (4) adjusting the B motif according to the change in the A motif; (5) partially or entirely mutating the amino acid residues in the C motif; (6) adjusting the C motif according to the change in the B motif; (7) adjusting the C motif according to the change in the A motif; (8) changing the A, B, and C motifs at the same time.

4. The method of claim 2, wherein the B motif is kept unchanged.

5. The method of claim 1, wherein said endostatin mutant has a sequence selected from the group consisting of SEQ ID NO: 3-34 and SEQ ID NO: 37-39.

6. The method of claim 1, wherein said endostatin mutant has a sequence selected from the following group: SEQ ID NO: 3, SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30.

7. A mutant of endostatin or variants thereof, wherein said mutant has increased anti-angiogenesis activity, and wherein said mutant comprises a mutation in the ATP-binding motif thereof, and has increased ATPase activity compared to the corresponding wild-type endostatin or variants thereof.

8. The mutant of claim 7, wherein said mutant contains a mutation in the sequence corresponding to the Gly-Ser-Glu-Gly-Pro-Leu-Lys motif consisting of amino acid residues at positions 89-95 of SEQ ID NO: 1, and wherein said mutation is selected from substitution, deletion, and/or addition of one or several amino acid residues, or a combination thereof, and wherein said mutation leads to increased ATPase activity of the mutant.

9. The mutant of claim 7, wherein the sequence of said mutant corresponding to the Gly-Ser-Glu-Gly-Pro-Leu-Lys motif consisting of amino acid residues at positions 89-95 of SEQ ID NO: 1 is partially or completely deleted.

10. The mutant of claim 7, wherein one or more amino acid residues of said mutant which correspond to amino acid residues at positions 89, 92 and 95 in SEQ ID NO:1 are partially or completely substituted or deleted.

11. The mutant of claim 7, wherein (a) the amino acid residue corresponding to Gly at position 89 in SEQ ID NO:1 is deleted or substituted by an uncharged or aromatic amino acid; or (b) the amino acid residue corresponding to Gly at position 92 in SEQ ID NO:1 is deleted or substituted by an uncharged amino acid; or (c) the amino acid residue corresponding to Lys at position 95 in SEQ ID NO:1 is deleted or substituted by a positively charged or an uncharged amino acid; or any combination of (a)-(c).

12. The mutant of claim 11, wherein (a) the amino acid residue corresponding to Gly at position 89 in SEQ ID NO:1 is deleted or substituted by Ala or Pro; or (b) the amino acid residue corresponding to Gly at position 92 in SEQ ID NO:1 is deleted or substituted by Ala; or (c) the amino acid residue corresponding to Lys at position 95 in SEQ ID NO:1 is deleted or substituted by Arg or Gln; or any combination of (a)-(c).

13. The mutant of claim 7, wherein said mutant has a sequence selected from the group consisting of SEQ ID NO: 3-34 and SEQ ID NO: 37-39.

14. The mutant of claim 7, wherein said mutant has a sequence selected from the following group: SEQ ID NO: 3, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30.

15. A pharmaceutical composition which comprises a mutant of claim 7 and a pharmaceutically acceptable carrier.

16. The pharmaceutical composition of claim 15, wherein said mutant is covalently linked to a PEG molecule.

17. The pharmaceutical composition of claim 16, wherein said PEG molecule is covalently linked to the -amino group at the N-terminal of said mutant.

18. The pharmaceutical composition of claim 16, wherein said monomethoxypolyethylene glycol is monomethoxypolyethylene glycol propionaldehyde (mPEG-ALD).

19. A method of treating an angiogenesis-related disease, including administering to a patient an effective amount of a mutant of claim 7.

20. The method of claim 19, wherein said angiogenesis-related disease is tumor, obesity, fatty liver, or insulin resistance.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0040] FIG. 1: expression of ES mutant S03 in engineered bacteria.

[0041] FIG. 2: purification of ES mutant S03 and its mPEG modified products:

[0042] (A) purification of proteins from inclusion bodies;

[0043] (B) purification of refolded proteins;

[0044] (C) purification of modified proteins;

[0045] FIG. 3: native human ES sequence, wherein the first amino acid residue M at the N-terminal can be deleted randomly when recombinantly expressed in Escherichia coli.

[0046] FIG. 4: the S03 sequence recombinantly expressed by Escherichia coli, wherein the first amino acid residue M at the N-terminal can be deleted randomly.

[0047] FIG. 5: the S04 sequence recombinantly expressed by Escherichia coli, wherein the first amino acid residue M at the N-terminal can be deleted randomly.

[0048] FIG. 6: the S05 sequence recombinantly expressed by Escherichia coli, wherein the first amino acid residue M at the N-terminal can be deleted randomly.

[0049] FIG. 7: the S06 sequence recombinantly expressed by Escherichia coli, wherein the first amino acid residue M at the N-terminal can be deleted randomly.

[0050] FIG. 8: the S07 sequence recombinantly expressed by Escherichia coli, wherein the first amino acid residue M at the N-terminal can be deleted randomly.

[0051] FIG. 9: the S08 sequence recombinantly expressed by Escherichia coli, wherein the first amino acid residue M at the N-terminal can be deleted randomly.

[0052] FIG. 10: the S11 sequence recombinantly expressed by Escherichia coli, wherein the first amino acid residue M at the N-terminal can be deleted randomly.

[0053] FIG. 11: the S13 sequence recombinantly expressed by Escherichia coli, wherein the first amino acid residue M at the N-terminal can be deleted randomly.

[0054] FIG. 12: the S14 sequence recombinantly expressed by Escherichia coli, wherein the first amino acid residue M at the N-terminal can be deleted randomly.

[0055] FIG. 13: the S15 sequence recombinantly expressed by Escherichia coli, wherein the first amino acid residue M at the N-terminal can be deleted randomly.

[0056] FIG. 14: the S16 sequence recombinantly expressed by Escherichia coli, wherein the first amino acid residue M at the N-terminal can be deleted randomly.

[0057] FIG. 15: the S17 sequence recombinantly expressed by Escherichia coli, wherein the first amino acid residue M at the N-terminal can be deleted randomly.

[0058] FIG. 16: the S18 sequence recombinantly expressed by Escherichia coli, wherein the first amino acid residue M at the N-terminal can be deleted randomly.

[0059] FIG. 17: the S19 sequence recombinantly expressed by Escherichia coli, wherein the first amino acid residue M at the N-terminal can be deleted randomly.

[0060] FIG. 18: the S20 sequence recombinantly expressed by Escherichia coli, wherein the first amino acid residue M at the N-terminal can be deleted randomly.

[0061] FIG. 19: the NSN1 sequence recombinantly expressed by Escherichia coli, wherein the first amino acid residue M at the N-terminal can be deleted randomly.

[0062] FIG. 20: the NSN2 sequence recombinantly expressed by Escherichia coli, wherein the first amino acid residue M at the N-terminal can be deleted randomly.

[0063] FIG. 21: the NSN3 sequence recombinantly expressed by Escherichia coli, wherein the first amino acid residue M at the N-terminal can be deleted randomly.

[0064] FIG. 22: the NSN4 sequence recombinantly expressed by Escherichia coli, wherein the first amino acid residue M at the N-terminal can be deleted randomly.

[0065] FIG. 23: the E176A sequence recombinantly expressed by Escherichia coli, wherein the first amino acid residue M at the N-terminal can be deleted randomly.

[0066] FIG. 24: the C174E sequence recombinantly expressed by Escherichia coli, wherein the first amino acid residue M at the N-terminal can be deleted randomly.

[0067] FIG. 25: the E-M sequence recombinantly expressed by Escherichia coli, wherein the first amino acid residue M at the N-terminal can be deleted randomly.

[0068] FIG. 26: comparison of unmodified ES mutants S03, NSN4 and E-M on the activity of inhibiting migration of endothelial cells.

[0069] FIG. 27: comparison of ES mutants E176A and C174E on the activity of inhibiting migration of endothelial cells.

[0070] FIG. 28: comparison of modified ES mutants MS03, MS04, MS05, MS06, MS07, MS08, MS11, and MS13 on the activity of inhibiting migration of endothelial cells.

[0071] FIG. 29: comparison of modified ES mutants MS03, MS14, MS15, MS16, MS17, MS18, MS19, and MS20 on the activity of inhibiting migration of endothelial cells.

[0072] FIG. 30: comparison of modified ES mutants MS03, MNSN1, MNSN2, MNSN3 and MNSN4 on the activity of inhibiting migration of endothelial cells.

[0073] FIG. 31: forward PCR primer sequence for amplification of ES. (SEQ ID NO: 35)

[0074] FIG. 32: reverse PCR primer sequence for amplification of ES. (SEQ ID NO: 36)

[0075] FIG. 33: the sequences of ES mutants 36 (SEQ ID NO: 25), 249 (SEQ ID NO: 26), 381 (SEQ ID NO: 27), 57 (SEQ ID NO: 28), 114 (SEQ ID NO: 29), 124 (SEQ ID NO: 30) and 125 (SEQ ID NO: 31).

[0076] FIG. 34: the sequences of ES mutants 160 (SEQ ID NO: 32), 163 (SEQ ID NO: 33) and 119 (SEQ ID NO: 34).

[0077] FIG. 35: comparison of unmodified ES mutants 36, 249, 381 and modified ES mutants M36, M249, M381 on the activity of inhibiting migration of endothelial cells.

[0078] FIG. 36: comparison of modified ES mutants NSN4, M249, M119, M160, M163, M125, M57, M124 and M114 on the activity of inhibiting migration of endothelial cells.

[0079] FIG. 37: the sequences of unmodified ES mutants Endu-E-M (SEQ ID NO: 37), Endu-114 (SEQ ID NO: 38) and Endu-57 (SEQ ID NO: 39).

[0080] FIG. 38: comparison of unmodified ES mutants Endu-E-M, Endu-114 and Endu-57 on the activity of inhibiting migration of endothelial cells.

DETAILED DESCRIPTION OF THE INVENTION

[0081] Unless otherwise indicated, the scientific and technical terms used in this specification should have the meanings that are commonly understood by a skilled person in the art. In general, the names and techniques associated with cellular and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry used in the present specification are well known and commonly used in the art.

[0082] Unless otherwise indicated, the methods and techniques used in this specification are generally carried out according to the conventional methods or references cited in this specification.

ES, ES Mutants and PEG Modified Products

[0083] ES (Endostatin) refers to native endostatin, such as human endostatin having the sequence of SEQ ID NO: 1, and when the human ES is recombinantly expressed in E. coli, an amino acid residue M will be randomly added to N-terminal of some products (FIG. 3). In the present application, an ES mutant refers to a mutant protein obtained by mutating one or some amino acid residues of an ES variant, such as amino acid deletion, insertion or substitution in an ATP-binding motif. ES mutants can be naturally occurring, for example, when ES is recombinantly expressed in yeast, an ES mutant with an N-terminal deletion of 4 amino acids can be produced due to random deletion at the N-terminal, and furthermore, the C-terminal K can also be randomly deleted. ES mutants can also be artificially constructed, for example, in order to promote protein expression and improve stability, Endu is a mutant produced by adding nine additional amino acid residues MGGSHHHHH to the N-terminal of native ES by genetic engineering means, wherein the first amino acid M can be randomly deleted when recombinantly expressed in E. coli, which makes Endu have the sequence of SEQ ID NO: 2.

[0084] The unmodified and modified ES and ES mutant proteins in the present invention were all provided by Beijing Protgen Ltd.

[0085] Polyethylene glycol (PEG)-modified ES is named M2ES, and PEG-modified ES mutants are named by adding M prior to the mutant designation: for example, PEG-modified ES mutant S03 is named MS03 and PEG-modified ES mutant NSN1 is named MNSN1. For example, in some detailed embodiments of the present invention, the molecule named MS03 or MNSN1 may be the product of a mutant called S03 or NSN1 modified by monomethoxypolyethylene glycol propionaldehyde (mPEG-ALD) with a molecular weight of 20 kD, and the coupling sites are the activated mPEG-ALD aldehyde group and the N-terminal -amino group of S03 or NSN1.

[0086] ATP-binding motif refers to a typical amino acid sequence that binds to ATP in a protein molecule with ATPase activity. The ATP-binding motif usually has a P-loop structure, and the P-loop structure has the following typical sequences: GXXGXXK, (G/A)XXXXGK(T/S), GXXXXGKS and GXXGXGKS. For human ES, the ATP-binding motif mainly refers to the sequence in a form of GXXGXXK, wherein the amino acid residues which are not substituted by X are more conserved. In general, these ATP-binding motifs can also bind to GTP, UTP, CTP, and the like.

[0087] The ATP-binding motifs referred to in the present invention include the A motif (Walker A motif), the B motif (Walker B motif) and the C motif (Walker C motif). The A motif refers to the site with a sequence in the form of GXXGXXK, wherein X is a variable amino acid residue. The A motif is the main site for ES and ATP-binding and catalytic hydrolysis. The B motif refers to the site with sequence in the form of hhhhE, wherein h is a hydrophobic amino acid residue. The B motif is involved in the binding of ATP to ES and affects the ATPase activity of ES by influencing the binding of ES to ATP. The C motif refers to the site with a sequence of Glu-Ala-Pro-Ser (i.e. EAPS) in the ES molecule and is likely to affect the ATPase activity of ES by indirectly influencing the binding of ES with ATP, which needs to be verified by the information of the crystal structure of ES-ATP complex. In addition, since the spatial conformation of a protein is formed by the folding of the peptide chain, the adjacent amino acid residues in the primary sequence are often not close to each other in the spatial conformation; conversely, the amino acid residues far apart in the primary sequence are close to each other in the spatial conformation. The stability of the local conformation of protein molecules is largely dependent on the stability of the overall molecular conformation, and the change of local amino acid sequence may lead to the change of overall molecular conformation. Thus, it will be appreciated by those skilled in the art that there are other sites involved in the regulation of ES and ATP interaction apart from the three motifs of A, B, and C, which can also affect the ATPase activity of ES and inhibit angiogenesis. These sites may play a role alone or in combination with the A, B, C motifs or any combination thereof to influence the ATPase activity of ES and inhibit angiogenesis. Thus, in some embodiments of the present invention, in addition to mutations in the A, B, C motifs or combinations thereof, mutations have been introduced to sites other than the three motifs to achieve better results.

[0088] We have found that the ATPase activities of the tested ES, ES variants, ES mutants and their mPEG modified products are positively related to the activity of inhibiting endothelial cell migration, that is, the ES mutants with high activity of inhibiting endothelial cell migration also have high ATPase activity. Based on this finding, in order to obtain ES with high activity of inhibiting endothelial cell migration, we can increase the ATPase activity of ES by amino acid deletion, insertion or substitution in the ATP-binding motifs of ES.

[0089] Accordingly, the present invention also provides a method of increasing the activity of ES or its variants of inhibiting angiogenesis and tumor growth, including increasing the ATPase activity of ES or its variants. Specifically, by genetic engineering means, mutations can be introduced to ES or variants thereof in the A motif GXXGXXK which participates in ATP-binding, or in the A motif and the B motif simultaneously, or in the C motif, or in any combination of the A, B and C motifs to obtain mutants of ES or variants thereof with increased ATPase activity. These mutants have improved biological activities, such as increased activity of inhibiting angiogenesis (such as inhibiting migration of endothelial cells) and increased activity of inhibiting tumor growth. Among them, mutations in the B motif usually lead to decreased activity of inhibiting angiogenesis and tumor growth, so particular attention should be paid to the mutations in the B motif.

[0090] Thus, in an example of the present invention, the following mutations were introduced to the A motif or the B motif of ES:

[0091] S03SEQ ID NO: 3 (FIG. 4)

[0092] S04SEQ ID NO: 4 (FIG. 5)

[0093] S05SEQ ID NO: 5 (FIG. 6)

[0094] S06SEQ ID NO: 6 (FIG. 7)

[0095] S07SEQ ID NO: 7 (FIG. 8)

[0096] S08SEQ ID NO: 8 (FIG. 9)

[0097] S11SEQ ID NO: 9 (FIG. 10)

[0098] S13SEQ ID NO: 10 (FIG. 11)

[0099] S14SEQ ID NO: 11 (FIG. 12)

[0100] S15SEQ ID NO: 12 (FIG. 13)

[0101] S16SEQ ID NO: 13 (FIG. 14)

[0102] S17SEQ ID NO: 14 (FIG. 15)

[0103] S18SEQ ID NO: 15 (FIG. 16)

[0104] S19SEQ ID NO: 16 (FIG. 17)

[0105] S20SEQ ID NO: 17 (FIG. 18)

[0106] NSN1SEQ ID NO: 18 (FIG. 19)

[0107] NSN2SEQ ID NO: 19 (FIG. 20)

[0108] NSN3SEQ ID NO: 20 (FIG. 21)

[0109] NSN4SEQ ID NO: 21 (FIG. 22)

[0110] E176ASEQ ID NO: 22 (FIG. 23)

[0111] C174ESEQ ID NO: 23 (FIG. 24)

[0112] E-M-SEQ ID NO: 24 (FIG. 25)

[0113] 36SEQ ID NO: 25 (FIG. 33)

[0114] 249SEQ ID NO: 26 (FIG. 33)

[0115] 381SEQ ID NO: 27 (FIG. 33)

[0116] 57SEQ ID NO: 28 (FIG. 33)

[0117] 114SEQ ID NO: 29 (FIG. 33)

[0118] 124SEQ ID NO: 30 (FIG. 33)

[0119] 125SEQ ID NO: 31 (FIG. 33)

[0120] 160SEQ ID NO: 32 (FIG. 34)

[0121] 163SEQ ID NO: 33 (FIG. 34)

[0122] 119SEQ ID NO: 34 (FIG. 34)

[0123] Endu-E-M-SEQ ID NO: 37 (FIG. 37)

[0124] Endu-57SEQ ID NO: 38 (FIG. 37)

[0125] Endu-114SEQ ID NO: 39 (FIG. 37)

[0126] When ATPase activity was measured by biochemical methods, it was found that ATPase activity of mutants with increased activity of inhibiting endothelial cell migration was significantly higher than that of ES (Table 1).

[0127] It was found that the changes in ATPase activity and the activity of inhibiting endothelial cell migration of Endu caused by mutations in ATP-binding motifs were similar to those changes in the ES related activities caused by the same mutations. Therefore, we believe that the method of altering the ATPase activity and the activity of inhibiting endothelial cell migration by mutating ATP-binding motifs in ES is also applicable to ES mutants.

[0128] Thus, the present invention also provides ES mutants having an increased activity of inhibiting angiogenesis, wherein the mutants comprise a mutation in their A motif and/or B motif and/or C motif, and the ATPase activity of the mutants is increased compared to the corresponding wild-type ES or variants thereof.

[0129] Preferably, the ATPase activity of the ES mutants is increased by at least 100% compared to the wild-type ES, i.e., the ATPase activity of the mutants is 200% of that of the wild-type ES, 300% or more of that of the wild-type ES.

[0130] In some embodiments, the mutants comprise mutations in their ATP-binding motifs compared to the corresponding wild-type ES or ES variants. For example, the mutants have mutations in the sequence corresponding to the Gly-Ser-Glu-Gly-Pro-Leu-Lys motif consisting of amino acid residues at positions 89-95 of SEQ ID NO: 1, wherein the mutations are selected from substitution, deletion or addition of one or several amino acid residues, or a combination thereof, which makes the mutants have increased ATPase activity.

[0131] Preferably, applying the following engineering schemes to ES or variants thereof would increase its ATPase activity: (1) keeping those corresponding to the conserved amino acid residues G89, G92, and K95 in the A motif GXXGXXK of SEQ ID NO: 1 unchanged; (2) increasing the spatial conformation flexibility of the peptide corresponding to the A motif by adjusting the variable residue X within the A motif GXXGXXK; (3) optionally adding a Ser or Thr after residue K95 in the sequence of classic A motif GXXGXXK; (4) adjusting the B motif according to the change in the A motif (5) partially or entirely mutating the amino acid residues in the C motif (6) adjusting the C motif according to the change in the B motif (7) adjusting the C motif according to the change in the A motif (8) changing the A, B, and C motifs at the same time.

[0132] In detailed embodiments, the ES mutant of the present invention comprises a sequence selected from the following group consisting of: SEQ ID NO: 3-21, and 24. Preferably, the endostatin mutant of the present invention comprises a sequence selected from the following group consisting of: SEQ ID NO: 3, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 24.

[0133] Preferably, the ES mutant of the present invention is human ES mutant.

[0134] The present invention also provides a method of treating tumor, comprising administering to the patient an effective amount of an endostatin mutant of the present invention as described above or a pharmaceutical composition of the present invention as described above. The angiogenesis-related diseases include tumor, obesity, fatty liver and insulin resistance. Preferably, the angiogenesis-related disease is tumor.

[0135] Exemplary embodiments of the present disclosure include:

[0136] 1. A method for increasing the anti-angiogenesis activity of endostatin or variants thereof, including increasing the ATPase activity of endostatin or variants thereof.

[0137] 2. The method of embodiment 1, including genetic engineering on the A motif and/or the B motif and/or the C motif of endostatin or variants thereof, to obtain an endostatin mutant with increased ATPase activity.

[0138] 3. The method of embodiment 2, wherein said genetic engineering includes one or more of the following approaches: (1) keeping the amino acid residues corresponding to the conserved amino acid residues G89, G92, and K95 in the A motif GXXGXXK in SEQ ID NO:1 unchanged; (2) increasing the spatial conformation flexibility of the peptide corresponding to the A motif by adjusting the variable residues X within the A motif GXXGXXK; (3) adding a Ser or Thr after residue K95 in the classic sequence of A motif GXXGXXK; (4) adjusting the B motif according to the change in the A motif, (5) partially or entirely mutating the amino acid residues in the C motif; (6) adjusting the C motif according to the change in the B motif, (7) adjusting the C motif according to the change in the A motif, (8) changing the A, B, and C motifs at the same time.

[0139] 4. The method of embodiment 2 or 3, wherein the B motif is kept unchanged.

[0140] 5. The method of any one of embodiments 1-4, wherein said endostatin mutant is human endostatin mutant.

[0141] 6. The method of any one of embodiments 1-3, wherein said endostatin mutant has a sequence selected from the group consisting of SEQ ID NO: 3-34 and SEQ ID NO: 37-39.

[0142] 7. The method of any one of embodiments 1-3, wherein said endostatin mutant has a sequence selected from the following group: SEQ ID NO: 3, SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30.

[0143] 8. A mutant of endostatin or variants thereof, wherein said mutant has increased anti-angiogenesis activity, and wherein said mutant comprises a mutation in the ATP-binding motif thereof, and has increased ATPase activity compared to the corresponding wild-type endostatin or variants thereof.

[0144] 9. The mutant of embodiment 8, wherein the ATPase activity of said mutant is increased by at least about 100% compared to the corresponding wild-type endostatin or variants thereof.

[0145] 10. The mutant of embodiment 8, wherein the ATPase activity of said mutant is increased by at least about 200% compared to the corresponding wild-type endostatin or variants thereof.

[0146] 11. The mutant of embodiment 8, wherein the ATPase activity of said mutant is increased by at least about 300% compared to the corresponding wild-type endostatin or variants thereof.

[0147] 12. The mutant of embodiment 8, wherein said mutant contains a mutation in the sequence corresponding to the Gly-Ser-Glu-Gly-Pro-Leu-Lys motif consisting of amino acid residues at positions 89-95 of SEQ ID NO: 1, and wherein said mutation is selected from substitution, deletion, and/or addition of one or several amino acid residues, or a combination thereof, and wherein said mutation leads to increased ATPase activity of the mutant.

[0148] 13. The mutant of embodiment 12, wherein the sequence of said mutant corresponding to the Gly-Ser-Glu-Gly-Pro-Leu-Lys motif consisting of amino acid residues at positions 89-95 of SEQ ID NO: 1 is partially or completely deleted.

[0149] 14. The mutant of embodiment 12, wherein one or more amino acid residues of said mutant which correspond to amino acid residues at positions 89, 92 and 95 in SEQ ID NO:1 are partially or completely substituted or deleted.

[0150] 15. The mutant of embodiment 12, wherein

[0151] (a) the amino acid residue corresponding to Gly at position 89 in SEQ ID NO:1 is deleted or substituted by an uncharged or aromatic amino acid; or

[0152] (b) the amino acid residue corresponding to Gly at position 92 in SEQ ID NO:1 is deleted or substituted by an uncharged amino acid; or

[0153] (c) the amino acid residue corresponding to Lys at position 95 in SEQ ID NO: 1 is deleted or substituted by a positively charged or an uncharged amino acid; or

[0154] any combination of (a)-(c).

[0155] 16. The mutant of embodiment 15, wherein

[0156] (a) the amino acid residue corresponding to Gly at position 89 in SEQ ID NO: 1 is deleted or substituted by Ala or Pro; or

[0157] (b) the amino acid residue corresponding to Gly at position 92 in SEQ ID NO:1 is deleted or substituted by Ala; or

[0158] (c) the amino acid residue corresponding to Lys at position 95 in SEQ ID NO:1 is deleted or substituted by Arg or Gln; or

[0159] any combination of (a)-(c).

[0160] 17. The mutant of embodiment 8, wherein said mutant has a sequence selected from the group consisting of SEQ ID NO: 3-34 and SEQ ID NO: 37-39.

[0161] 18. The mutant of embodiment 8, wherein said mutant has a sequence selected from the following group: SEQ ID NO: 3, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30.

[0162] 19. The mutant of any one of embodiments 8-18, which is a mutant of human endostatin or variants thereof.

[0163] 20. A pharmaceutical composition which comprises a mutant of any one of embodiments 8-18 and a pharmaceutically acceptable carrier.

[0164] 21. The pharmaceutical composition of embodiment 20, wherein said mutant is covalently linked to a PEG molecule.

[0165] 22. The pharmaceutical composition of embodiment 21, wherein said PEG molecule is of a molecular weight of 5-40 kD.

[0166] 23. The pharmaceutical composition of embodiment 21, wherein said PEG molecule is covalently linked to the -amino group at the N-terminal of said mutant.

[0167] 24. The pharmaceutical composition of embodiment 21, wherein said PEG molecule is monomethoxypolyethylene glycol.

[0168] 25. The pharmaceutical composition of embodiment 21, wherein said monomethoxypolyethylene glycol is monomethoxypolyethylene glycol propionaldehyde (mPEG-ALD).

[0169] 26. A method of treating an angiogenesis-related disease, including administering to a patient an effective amount of a mutant of any one of embodiments 8-18 or a pharmaceutical composition of any one of embodiments 20-25.

[0170] 27. The method of embodiment 27, wherein said angiogenesis-related disease is tumor, obesity, fatty liver, or insulin resistance.

[0171] 28. Use of the mutant of any one of embodiments 8-18 in the preparation of a medicament for treating an angiogenesis-related disease.

[0172] 29. The use of embodiment 28, wherein said angiogenesis-related disease is tumor, obesity, fatty liver, or insulin resistance.

[0173] The present invention is further illustrated by the following non-limiting examples. It is to be understood that the invention is not limited to these examples.

EXAMPLES

Example 1: Construction of ES Recombinant Strains

[0174] In this example, Endostatin was cloned from the cDNA of human lung cancer cell A549, and ligated into pET30a plasmid. The 5 primer used for gene amplification was GGAATTCCATATGCACAGCCACCGCGACTTC (FIG. 31, SEQ ID NO: 35) and the 3 primer was CCGCTCGAGT TACTTGGAGGCAGTCATGAAGCTG (FIG. 32, SEQ ID NO: 36). Endonucleases were NdeI and XhoI, respectively.

[0175] The recombinant plasmids described above were transformed into E. coli according to conventional molecular cloning techniques and expressed.

Example 2: Construction of ES Mutant Strains with ATP-Binding Motif Mutations

[0176] In this example, the ATP-binding motif of wild-type human ES was subjected to mutational engineering. The upstream and downstream primers and the transformation method were the same as those in Example 1. The mutants' numbers and the changes occurred are as follows:

[0177] S03SEQ ID NO: 3 (FIG. 4) four amino acid residues HSHR at the N-terminal were deleted, while the A motif was mutated to be GESGAGK, and T was inserted;

[0178] S04SEQ ID NO: 4 (FIG. 5) four amino acid residues HSHR at the N-terminal were deleted, S was inserted after the A motif. At the same time, the E and subsequent amino acid residues NSFMTASK in the B motif were deleted;

[0179] S05SEQ ID NO: 5 (FIG. 6) four amino acid residues HSHR at the N-terminal were deleted, T was inserted after the A motif. At the same time, the E and subsequent amino acid residues NSFMTASK in the B motif were deleted;

[0180] S06SEQ ID NO: 6 (FIG. 7) four amino acid residues HSHR at the N-terminal were deleted, while the A motif was mutated to be GESGAGK and then T was inserted. At the same time, the E and subsequent amino acid residues NSFMTASK in the B motif were deleted;

[0181] S07SEQ ID NO: 7 (FIG. 8) the A motif was mutated to be GESGAGK and T was inserted. At the same time, deleted the C-terminal amino acid residues SFMTASK;

[0182] S08SEQ ID NO: 8 (FIG. 9) the A motif was mutated to be GESGAGK and T was inserted. At the same time, the C-terminal amino acid residues TASK were deleted;

[0183] S11SEQ ID NO: 9 (FIG. 10) the C-terminal amino acid residues SFMTASK were deleted;

[0184] S13SEQ ID NO: 10 (FIG. 11) the N-terminal residues HS were deleted, the A motif was mutated to be GESGAGK and T was inserted. At the same time, the C-terminal SFMTASK were deleted;

[0185] S14SEQ ID NO: 11 (FIG. 12) the N-terminal residues HS were deleted, the A motif was mutated to be GESGAGK and T was inserted. At the same time, the C-terminal TASK were deleted;

[0186] S15SEQ ID NO: 12 (FIG. 13) the N-terminal residues HS were deleted, the A motif was mutated to be GESGAGK and T was inserted. At the same time, the C-terminal K was deleted;

[0187] S16SEQ ID NO: 13 (FIG. 14) the N-terminal residue H was deleted, the A motif was mutated to be GESGAGK and T was inserted. At the same time, the C-terminal K was deleted;

[0188] S17SEQ ID NO: 14 (FIG. 15) the N-terminal residue H was deleted, the A motif was mutated to be GESGAGK and T was inserted. At the same time, the C-terminal SFMTASK were deleted;

[0189] S18SEQ ID NO: 15 (FIG. 16) the N-terminal residue H was deleted, the A motif was mutated to be GESGAGK and T was inserted. At the same time, the C-terminal TASK were deleted;

[0190] S19SEQ ID NO: 16 (FIG. 17) the N-terminal residue H was deleted, the A motif was mutated to be GESGAGK and T was inserted;

[0191] S20SEQ ID NO: 17 (FIG. 18) the N-terminal residues HS were deleted, the A motif was mutated to be GESGAGK and T was inserted;

[0192] NSN1SEQ ID NO: 18 (FIG. 19) deleted Ser-88, the A motif was mutated to be GESGAGK and T was inserted;

[0193] NSN2SEQ ID NO: 19 (FIG. 20) the A motif was mutated to be GESGAGK, P96T&G97P;

[0194] NSN3SEQ ID NO: 20 (FIG. 21) the A motif was mutated to be GESGAGK, P96T;

[0195] NSN4SEQ ID NO: 21 (FIG. 22) the A motif was mutated to be GESGAGK, P96T, Gly-98 was inserted;

[0196] E176ASEQ ID NO: 22 (FIG. 23) E176A;

[0197] C174ESEQ ID NO: 23 (FIG. 24) C174E;

[0198] E-MSEQ ID NO: 24 (FIG. 25) the A motif was mutated to be GESGAGK, and T was inserted.

Example 3: Expression and Preparation of Recombinant ES and its Mutants

[0199] In this example, the expression and preparation methods of ES and its mutants are briefly described as follows taking S03 as an example: ES or its mutant engineering strains were spreading cultivated overnight in LB medium shaking flask, inoculated into a 5 L fermentor (Sartorius), and IPTG was added timely for induction. After induction, cultivation was continued for about 4 hours, then the bacteria were collected, and analyzed by electrophoresis (FIG. 1).

[0200] The bacteria cells were resuspended in PBS buffer and were thoroughly crushed with a high-pressure homogenizer, repeatedly for three times, and each time after crushing were centrifuged to collect the sediment, which was then resuspended in PBS buffer. The sediment of crushed bacteria was dissolved in Tris-HCl buffer containing 8 M urea (pH 8.5) and then eluted with DEAE chromatography media (GE Healthcare) with Tris-HCl buffer at pH 8.5. The penetrated fraction was collected and a purified protein before renaturation was obtained. After refolding the protein, gradient elution was performed using a CM chromatography media (GE Healthcare) with Tris-HCl buffer at pH 8.5 with a salt concentration ranged from 0 to 500 mM NaCl to obtain a refolded protein with a purity greater than 95% (FIG. 2A, B). The refolded protein was dialyzed against NaAcHAc (pH 6.0). Monomethoxypolyethylene glycol propanal (mPEG-ALD, 20 kDa, Beijing JianKai Technology Co., Ltd) with an average molecular weight of 20 kD was used to perform N-terminal single modification of the refolded protein according to the operation method of described in the product specification. The modified product was purified using a SP column (GE Healthcare), gradient elusion was performed using NaCl with a concentration of 0-500 mM to give the target fractions (FIG. 2C).

[0201] The preparation of other ES mutants and their modified products were the same as described above.

Example 4: Assay for ATPase Activity of ES, ES Mutants and their mPEG Modified Products

[0202] A method for testing ATPase activity disclosed in prior art (PCT/CN2012/081210) was used in this example. The ATPase activity of ES, ES mutants and their mPEG modified products was tested. The results were shown in Table 1. Protein Myosin (extracted from pig heart, Sigma) with relatively high ATPase activity was used as a positive control in this assay.

Example 5: Activity of ES and ES Mutants to Inhibit Endothelial Cell Migration

[0203] The Transwell endothelial cell assay disclosed in prior art (PCT/CN2012/081210) was used in this example. The endothelial cells HMEC were divided into the following groups and were treated differently. The first group: negative control group, no ES (the same amount of buffer solution was added) treatment; the second group: ES (20 g/mL) treatment; the third group: ES mutant YH-16 (20 g/mL) treatment; the fourth group: ES mutant S03 (20 g/mL) treatment; the fifth group: ES mutant NSN4 (20 g/mL) treatment; the sixth group: ES mutant E-M (20 g/mL) treatment. The results showed that the activity of S03, NSN4 and E-M to inhibit the endothelial cell migration was significantly increased compared to ES. The number of migrated cells of the S03, NSN4 and E-M treatment groups were approximately 30%, 16% and 40% of the ES treatment group, respectively (FIG. 26).

[0204] The activity of ES mutants E176A and C174E to inhibit endothelial cell migration were tested using the same assay. The activity of E176A and C174E to inhibit endothelial cell migration were both lower than ES (FIG. 27).

Example 6: Activity of mPEG-Modified ES, ES Mutants to Inhibit Endothelial Cell Migration

[0205] The activity of mPEG-modified ES, ES mutants to inhibit endothelial cell migration was tested by the method described in Example 5. Since the increase of the activity of inhibiting endothelial cell migration was significant for many mutant proteins, and in order to reflect the difference in activity between the mutant proteins more clearly, in this example a reduced dose (i.e. 5 g/mL) was used to treat the cells, and obvious inhibition effect was still able to be observed, as follows:

[0206] The activity of mPEG-modified ES mutants MS03, MS04, MS05, MS06, MS07, MS08, MS11, MS13 to inhibit endothelial cell migration (FIG. 28). Among them, the activity of MS03, MS04, MS07, MS11, MS13 to inhibit endothelial cell migration was significantly better than that of M2ES: the number of migrated cells of the MS03 treatment group was about of that of the M2ES treatment group, the number of migrated cells of the MS04, MS07, MS11 and MS13 treatment group was about of that of the M2ES treatment group; while the activity of MS05, MS06 and MS08 to inhibit endothelial cell migration was lower than that of M2ES.

[0207] The activity of mPEG-modified ES mutants MS03, MS14, MS15, MS16, MS17, MS18, MS19, MS20 to inhibit endothelial cell migration (FIG. 29). Among them, the activity of MS03, MS14, MS17 to inhibit endothelial cell migration was significantly better than that of M2ES; the activity of MS15, MS19 to inhibit endothelial cell migration had no significant difference with that of M2ES; the activity of MS16, MS18, MS20 to inhibit endothelial cell migration was lower than that of M2ES.

[0208] The activity of mPEG-modified ES mutants MS03, MNSN1, MNSN2, MNSN3, MNSN4 to inhibit endothelial cell migration (FIG. 30). The activity of MS03, MNSN1, MNSN2, MNSN3 and MNSN4 to inhibit endothelial cell migration was significantly better than that of M2ES, and wherein the number of migrated cells of the MNSN4 treated group was about 1/20 of that of M2ES.

[0209] Mutations with increased ATPase activity showed comparable or significantly increased activity of inhibiting endothelial cell migration to that of ES, which is consistent with the positive correlation between the activity of ATPase and the activity of inhibiting endothelial cells migration.

Example 7: Construction of ES Mutant Strains

[0210] In this example, mutant engineering was made on wild-type human ES, specific methods, upstream and downstream primers and engineering methods were the same as in Example 1. The mutants' numbers and their sequences are shown in FIG. 33 and FIG. 34.

[0211] 36SEQ ID NO: 25 (FIG. 33) 3 amino acid residues HSH at the N-terminal were deleted, A39Q, and Gly-89 was deleted;

[0212] 249SEQ ID NO: 26 (FIG. 33) 3 amino acid residues HSH at the N-terminal were deleted, the A motif was mutated to be GSQGQLQ, the C motif was mutated to be DERG;

[0213] 381SEQ ID NO: 27 (FIG. 33) the A motif was mutated to be GSEAPLR;

[0214] 57SEQ ID NO: 28 (FIG. 33) the A motif was mutated to be GESGAGK, the C motif was mutated to be DSRA;

[0215] 114SEQ ID NO: 29 (FIG. 33) the B motif was mutated to be VLCIA, the C motif was mutated to be DSRA;

[0216] 124SEQ ID NO: 30 (FIG. 33) 4 amino acid residues HSHR at the N-terminal were mutated, the A motif was mutated to be GSEGPLR, the C motif was mutated to be DSRA;

[0217] 125SEQ ID NO: 31 (FIG. 33) 4 amino acid residues at the N-terminal were mutated, the A motif was mutated to be GSEGPLR, the C motif was mutated to be DSRA, and K was added at the C-terminal;

[0218] 160SEQ ID NO: 32 (FIG. 34) amino acid residues other than the A, B, and C motifs were mutated, see the sequence.

[0219] 163SEQ ID NO: 33 (FIG. 34) the A motif was mutated to be GSQGQLQ, the C motif was mutated to be ETTG;

[0220] 119SEQ ID NO: 34 (FIG. 34) the A motif was mutated to be VSQGQLQ.

Example 8: Activity of mPEG-Modified ES and ES Mutants to Inhibit Endothelial Cell Migration

[0221] The activity of mPEG-modified ES and ES mutants to inhibit endothelial cell migration was tested by the method described in Example 6, detailed as follows:

[0222] The activity of mPEG-modified ES mutants 36, 249, 381 and modified ES mutants M36, M249, M381 to inhibit endothelial cell migration (FIG. 35). Among them, the number of migrated cells in the 36 treatment group was about 70% of that in the ES treatment group. There was no significant difference between the activity of the 249 and 381 group and the activity of the ES group in inhibiting endothelial cells migration; the number of migrated cells in the modified mutant M36 treatment group was about 50% of that in the ES treatment group; There was no significant difference between activity of the M249, M381 group and the activity of the ES group in inhibiting endothelial cells migration.

[0223] The activity of mPEG-modified ES mutants NSN4, M249, M119, M160, M163, M125, M57, M124, M114 to inhibit endothelial cell migration (FIG. 36). The activity of NSN4, M249, M160, M163, M125, M57, M124, M114 to inhibit endothelial cell migration was significantly increased compared to that of M2ES. M119 had no significant difference compared to M2ES. Among them, the number of migrated cells in the M57, M124 and M114 treated groups was about 34%, 28% and 24% of that in the M2ES treated group respectively.

Example 9: Construction of ES Mutant Strains

[0224] In this example, mutational engineering was made on Endu, and the specific methods, upstream and downstream primers and transformation methods were the same as those in Example 1. The mutants' numbers and their sequences are shown in FIG. 37.

[0225] Endu-E-MSEQ ID NO: 37 (FIG. 37) MGGSHHHHH was added at the N-terminal, the A motif was mutated to GESGAGK, and T was inserted thereafter; Endu-57SEQ ID NO: 38 (FIG. 37) MGGSHHHHH was added at the N-terminal, the A motif was mutated to GESGAGK, and T was inserted thereafter;

[0226] Endu-114SEQ ID NO: 39 (FIG. 37) MGGSHHHHH was added at the N-terminal, the A motif was mutated to GESGAGK, and T was inserted thereafter;

Example 10: The Activity of Inhibiting Endothelial Cell Migration of mPEG-Modified ES Mutants

[0227] The activity of inhibiting endothelial cell migration of mPEG-modified ES mutants Endu-E-M, Endu-57, Endu-114 was tested by the method described in Example 6 (FIG. 38).

[0228] The activity of inhibiting endothelial cell migration of Endu-E-M, Endu-57 and Endu-114 was significantly better than that of Endu (control), and the inhibition rates were 64%, 50% and 34% respectively.

TABLE-US-00001 TABLE 1 Sample ATPase activity Sample ATPase activity Number name (nM/mg/min) name (nM/mg/min) 1 ES 14920 mPEG-ES 2596 2 Endu 5586 mPEG-Endu 1626 3 S03 26110 MS03 4585 4 S04 24021 MS04 4057 5 S05 22828 MS05 4269 6 S06 19693 MS06 3474 7 S07 23128 MS07 3987 8 S08 19995 MS08 3571 9 S11 24322 MS11 4286 10 S13 24737 MS13 4275 11 S14 23250 MS14 4051 12 S15 20679 MS15 3520 13 S16 21082 MS16 3780 14 S17 22866 MS17 4011 15 S18 21421 MS18 3716 16 S19 22160 MS19 3874 17 S20 21025 MS20 3652 18 NSN1 23754 MNSN1 4131 19 NSN2 23345 MNSN2 4136 20 NSN3 26605 MNSN3 4869 21 NSN4 31809 MNSN4 5807 22 E176A 5626 ME176A 1012 23 C174E 7809 MC174E 1405 24 E-M 19396 ME-M 3463