SAMPLE HOLDER, METHOD FOR MANUFACTURING THE SAMPLE HOLDER, AND APPARATUS FOR RECEIVING THE METALLIC SAMPLE HOLDER

20210046475 ยท 2021-02-18

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates in a first aspect to a metallic sample holder (1), in particular for capturing sample volumes for digital polymerase chain detection. The sample holder (1) comprises an array of indentations (10), wherein each indentation (11) is adapted to capture a maximal sample volume v.sub.max, with v.sub.max=2 nl, in particular with v.sub.max=1 nl, in particular with v.sub.max=0.8 nl. Each indentation (11) of the array (10) has an area cross-section section a, with a 8*10.sup.3 mm.sup.2, in particular with a 5*10.sup.3 mm.sup.2. A second aspect of the invention relates to a method for manufacturing the sample holder (1). A third aspect of the invention relates to an apparatus (200), in particular for polymerase chain reaction detection, adapted for receiving the metallic sample holder (1). A fourth aspect of the invention relates to the use of the sample holder (1) by means of the apparatus (200).

    Claims

    1. A metallic sample holder (1), in particular for capturing sample volumes for digital polymerase chain detection reactions, comprising an array of indentations (10), wherein each indentation (11) is adapted to capture a maximal sample volume v.sub.max, with v.sub.max=2 nl, in particular with v.sub.max=1 nl, in particular with v.sub.max=0.8 nl, wherein each indentation (11) of the array (10) has an area cross-section a, with a8*10.sup.3 mm.sup.2, in particular with a 5*10.sup.3 mm.sup.2, wherein the indentations (11) have a bottom area.

    2. The metallic sample holder (1) of claim 1, comprising an array (10) with at least 10,000 indentations (11), in particular at least 40,0000 indentations (11).

    3. The metallic sample holder (1) according to claim 1, consisting of aluminum, silver, gold, copper, or alloys thereof.

    4. The metallic sample holder (1) according claim 1, wherein each indentation (11) is of cylindrical shape, of conical shape, or of elliptical cone shape and/or has at least partially a flat bottom area (111).

    5. The metallic sample holder (1) according claim 1, wherein the surface of the indentations (11) is free of any coating.

    6. The metallic sample holder (1) according to claim 1, further comprising a transparent, non-metallic covering sheet for covering the array of indentations (10).

    7. The metallic sample holder (1) according to claim 1, wherein the bottom area is configured to reflect an optical signal.

    8. A method for manufacturing of a metallic sample holder according to claim 1, wherein the array of indentations is fabricated by means of laser engraving.

    9. The method according to claim 8 wherein the laser engraving is performed by pulsing the laser repeatedly with pauses of at least 1 second, in particular with pauses of at least 2 seconds, very particular with pauses of at least 3 seconds.

    10. The method according to claim 8 for comprising at least one step of chemical wet etching.

    11. An apparatus (200), in particular for polymerase chain reaction detection, comprising the metallic sample holder (1) according to claim 1, comprising a thermal setting element (3) thermally coupleable to the sample holder (1) for controlling the temperature of the sample holder (1), a controller (6) for controlling a thermal cycle of the thermal setting element (3) an optical detector (4) arranged in line of sight of the array of indentations (10) of the sample holder (1), wherein the optical detector (4) is configured to detect at least one optical signal from one sample volume of one indentation (11) of the sample holder (1).

    12. The apparatus (200) according to claim 11 comprising an excitation light source (5).

    13. The apparatus (200) according to claim 11, wherein the controller (6) is configured to control the optical detector (4) for recording the at least one optical signal for each thermal cycle of the thermal setting element (3).

    14. The apparatus (200) according to claim 11, wherein the controller (6) is configured to control the optical detector (4) for recording a plurality of optical signals from a plurality of sample volumes of a plurality of indentations (11) for each thermal cycle of the thermal setting element (3).

    15. The apparatus (200) according to claim 11, wherein the optical detector (4) is configured to assign each optical signal to the corresponding sample volume.

    16. The apparatus (200) according to claim 11, wherein the thermal interface conductance between the thermal setting element (3) and the sample holder (1) is at least 1000 W/(m.sup.2K), in particular at least 4000 W/(m.sup.2K), in particular at least 8000 W/(m.sup.2K).

    17. The apparatus (200) according to claim 11, comprising at least one temperature sensor for sensing the temperature of the sample holder (1), wherein the temperature sensor is connected to the controller (6) and the thermal setting element (3) for providing a feedback loop for controlling the temperature of the sample holder (1).

    18. The apparatus 200) according to claim 11, wherein the controller is configured to steer the thermal setting element (3) to heat the sample holder (1) with a net effective heating ramp equal or higher than 5.0 C./s, in particular equal or higher than 8.0 C./s, in particular equal or higher than 10.0 C./s, and/or wherein the controller is configured to steer the thermal setting element (3) to cool down the sample holder with a net effective cooling ramp equal or lower than 5.0 C./s, in particular equal or lower than 8.0 C./s, in particular equal or lower than 10.0 C./s.

    19. The apparatus (200) according to claim 11, comprising a body (2), in particular a metallic body, wherein the metallic sample holder (1) is thermally coupleable to the body (2).

    20. The apparatus 200) of claim 11 with a body (2) consisting of at least 80 wt % metal, in particular of at least 90 wt % metal, wherein in particular the metal is aluminum.

    21. The apparatus (200) of claim 11 being portable, in particular being less than 1 kg of weight.

    22. Use of the sample holder (1) according to claim 1 for the polymerase chain reaction detection of sample volumes, in particular by means of the apparatus (200) according to any one of claims 11 to 21.

    23. An indentation of the sample holder according to claim 1, manufactured by a method comprising the steps of laser engraving, wherein the laser engraving is performed by pulsing the laser repeatedly with pauses of at least 1 second, in particular with pauses of at least 2 seconds, very particular with pauses of at least 3 seconds.

    24. A metallic sample holder comprising at least one indentation according to claim 23.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS AND EXPERIMENTS

    [0119] The invention will be better understood and objects other than those set forth above will become apparent from the following detailed description thereof. Such description makes reference to the annexed drawings, wherein:

    [0120] FIG. 1 shows a schematic of a metallic sample holder according to an embodiment of the invention,

    [0121] FIG. 2a shows an enlarged section of the sample holder,

    [0122] FIG. 2b shows a cross section of an indentation according to an embodiment of the invention,

    [0123] FIG. 3 shows a schematic of a cross section of an apparatus according to an embodiment of the invention,

    [0124] FIG. 4 shows a schematic perspective view of an apparatus according to an embodiment of the invention,

    [0125] FIG. 5 shows a schematic view of a cross section of an apparatus according to an embodiment of the invention, and

    [0126] FIGS. 6a and 6b show measurement results of experiments according to a preferred embodiment of the invention.

    [0127] FIGS. 7a and 7b show measurement results of experiments according to a preferred embodiment of the invention.

    MODES FOR CARRYING OUT THE INVENTION

    [0128] FIG. 1 shows a schematic view of a preferred embodiment of the metallic sample holder 1 according to the invention. The sample holder 1 comprises an array of indentations 10. The array 10 can cover selected areas of the sample holder 1 as shown in the figure or can extend over the full area of the sample holder 1. In particular, the indentations 11 of the array 10 can be arranged in a specific pattern. In the embodiment shown in the figure, the indentations 11 are arranged evenly spaced in a regular quadratic pattern.

    [0129] A preferred embodiment of the invention comprises an array 10 with at least 10,000 indentations 11. The array of indentations 10 displayed in the figure showing only few indentations 11 is a symbolic illustration of the preferred array 10.

    [0130] The metallic sample holder 1 is preferably made of aluminum.

    [0131] A preferred size of the sample may be 4 cm times 4 cm. The small size and the correlating small mass of the sample holder allows fast heating and cooling of the holder and therefore faster thermal cycling. In particular, the arrangement of the array 10 on the sample holder 1 leaves space at the edge of the sample holder 1 to handle the holder 1 by means of hands or tweezers without interfering with the array of indentations 10. Preferably, no indentations 11 are arranged within a distance of 0.5 cm from the edge of the sample holder 1.

    [0132] As shown in the enlarged section in FIG. 2a, the indentations 11 themselves are essentially of cylindrical shape. The essentially cylindrical shape can also tend to be slightly conical, for fabrication reasons, as shown in the figure.

    [0133] In particular, the indentations 11 have an at least partially flat bottom area 111. The essentially flat bottom area 111 serves for reflecting an optical signal. In particular because the sample holder 1 is made of metal, the reflected optical signal is very strong and can be detected by an optical detector 4.

    [0134] The sample volumes are directly filled into the indentations. No coating of the metallic sample holder 1 is required.

    [0135] FIG. 2b shows a schematic cross section of one of the preferred indentations 11. In particular, the indentation 11 has a flat bottom surface 111 that promotes reflection of the optical signal within the indentation 11.

    [0136] FIG. 3 shows a cross-section of a preferred embodiment of the apparatus 200. The apparatus 200 comprises a body 2. In the preferred embodiment shown in the figure, all components of the apparatus 200 are arranged within this body 2.

    [0137] The apparatus 200 is adapted for receiving the metallic sample holder 1. In the figure, the apparatus 200 is illustrated comprising the sample holder 1. The apparatus 200 comprises a thermal setting element 3 that is thermally coupled to the sample holder 1 for controlling the sample holder 1 temperature. In the figure, the sample holder 1 is arranged on the thermal setting element 3.

    [0138] In addition, the apparatus 200 further comprises a controller 6 for controlling the thermal cycle of the thermal setting element 3. The controller 6 might be arranged in a base body of the apparatus 200 as shown in FIG. 3. The controller 6 might comprise a screen 61 for displaying the cycling data. In particular, the controller 6 sends signals to the thermal setting element 3 for steering the heating or cooling of the thermal setting element 3. Since the thermal setting element 3 is thermally coupled to the sample holder 1, the sample holder 1 reaches the same temperature as the thermal setting element 3.

    [0139] Therefore, the temperature of the sample holder 1 can be controlled by the controller 3. In addition, the temperature cycles of the sample holder 1 can also be controlled by the controller 3.

    [0140] For example, three consecutive heating and cooling cycles are performed. Initially, the sample holder 1 is heated for 9 seconds, then it is kept at a temperature above 80 C. for 14 seconds and then it is cooled for 6.5 seconds. Preferably, the system is switched off for 10 seconds after every heating and cooling cycle.

    [0141] The apparatus comprises further an optical detector 4 arranged in a way that the array of indentations 10 of the sample holder 1, if there is any sample holder 1 mounted to the apparatus 200, would be in line of sight of the optical detector 4. In line of sight of the optical detector 4 refers to the arrangement of the optical detector 4 in an optical line with the array of indentations 10, as shown in FIG. 3, where the optical detector 4 is arranged in an upper part of the body 2 of the apparatus 200. The thermal setting element 3 that preferably comprises a stage for the sample holder 1 is arranged in a centre part of the body 2 of the apparatus 200.

    [0142] The distance between the level of the sample holder 1 that is mounted to the stage of the thermal setting element 3 and the level of the optical detector 4 is about 4.5 cm.

    [0143] Not visible on the figures, a lens could be arranged between the sample holder 1 and the optical detector 4.

    [0144] The optical detector 4 is configured to detect at least one optical signal from one sample volume of one indentation 11 of the sample holder 1.

    [0145] The optical signal that can be detected by the optical detector 4 is preferably an optical signal that is generated by the liquid sample volume if the sample volume is excited by light that is reflected on the surface area, in particular on the flat bottom area 111, of one of the indentations 11.

    [0146] Preferably, the optical detector 4 receives an optical signal from each sample volume of the indentations 11 of the array 10 simultaneously.

    [0147] The optical detector 4 comprises preferably a CCD or CMOS sensor as an optical sensor element. In particular, the optical detector 4 can comprise a lens for focussing the optical signal to the optical sensor element.

    [0148] The apparatus 200 can comprise a light source 5 for exciting the sample volume. The light source 5 might be an individual lamp. Preferably, the light source 5 is designed as a set of lamps arranged close to and/or around the optical detector 4. The light source 5 might be one or more LEDs or a mercury lamp.

    [0149] FIG. 4 shows a perspective view of an embodiment of an apparatus 200 according to the invention. The sample holder 1 is mounted to the apparatus 200.

    [0150] Preferably, the sample holder 1 is mounted to the thermal setting element 3 or in particular to a stage of the thermal setting element 3 of the apparatus 200. In a further embodiment, the sample holder 1 could also be mounted to a stage of the apparatus 200, wherein the thermal setting element 3 is in thermal connection to the sample holder 1 for heating or cooling the sample holder 1 and the sample volumes respectively.

    [0151] The body 2 serves as a housing and also as a scaffold for all the components of the apparatus 200.

    [0152] The body 2 has preferably a pyramidal outer shape as shown in the figure. This shape of the body 2 is advantageous, since it has a bigger surface for a given machine volume and therefore its functionality as a heat sink is very efficient.

    [0153] In particular the sample holder 1, if mounted to the apparatus 200 as shown in this figure, is thermally coupled to the body 2, such that the body 2 might serve as a thermal heat sink for enabling fast change of temperature of the sample holder 2.

    [0154] The optical detector 4 and any optional lenses are arranged within a peak section 21 of the preferably pyramidal body 2. In addition, also the light source 5 can be arranged within this peak 21.

    [0155] To mount the sample holder 2 to the apparatus 200, the peak section 21 can be lifted as shown in the figure and the sample holder 1 can be arranged onto the thermal setting element 3 or a stage of the thermal setting element 3.

    [0156] The body 2 of the apparatus 200 can further comprise a screen 61, e.g. to display temperature data of the thermal setting element 3 or of a temperature sensor.

    [0157] Preferably, the apparatus 200 has the dimensions of 8 cm8 cm17 cm and is very lightweight. Preferably, the apparatus 200 weights about 1 kg or about 500 g, very preferably below 1 kg.

    [0158] FIG. 5 shows a cross section of a preferred embodiment of the apparatus 200. The sample holder 1 is mounted to the apparatus 200.

    [0159] The cross-sectional view reveals the interior of the apparatus 200. In particular, the optical detector 4 and the light source 5 are arranged in the peak section 21 of the apparatus body 2.

    [0160] The sample holder 1 is mounted to the thermal setting element 3.

    [0161] The light source 5 in this embodiment is arranged close by the location, in particular a stage, where the sample holder 1 is mounted.

    [0162] The peak section 21 can be lifted for mounting the sample holder 1 onto the stage. In particular, the peak section 21 might be connected to the remaining body 2 by means of a hinge.

    [0163] A controller 6 is arranged within the lower part, respectively the remaining part without the peak section 21, of the apparatus body 2.

    [0164] To further illustrate the invention, examples of measurements with the sample holder and the apparatus according to the invention are provided in the following and shown in FIGS. 6a and 6b and 7a and 7b. These examples are provided with no intend to limit the scope of the invention.

    [0165] Example 1: A metallic sample holder according to claim 1 is manufactured by laser engraving of an array of indentations into a metal plate.

    [0166] The laser engraving machine used in this example is able to generate a directional focused laser beam that is directed towards the indentations of the sample holder. In order to prevent overheating of the apparatus, the laser beam is pulsed at a given frequency. Therefore, the amount of exposure of the sample holder surface can be controlled by changing the duration of each pulse.

    [0167] As soon as the beam reaches the surface of the sample holder, the energy of the beam is at least partly absorbed by the sample holder surface material and is therefore locally heating the sample holder. The local heating leads to evaporation of the material in the heated spot and therefore to the creation of an indentation.

    [0168] By drawing the blueprint of the array of indentations in the software and setting the appropriate frequency and speed of the laser pulses, an array of indentations can be generated on the surface of the sample holder substrate. By repeating the procedure, multiple layers of material can be removed for adjusting the depth of the indentation.

    [0169] In this example the sample holder is an aluminum plate with the dimensions of 40400.3 mm. The aluminum plate is placed under a 20W fiber laser engraving machine. The blueprint of an array of indentations that extends over an area of approximately 1010 mm is designed by means of the software. The controlling parameters of the engraving process are the scanning speed of the laser (set at 4000 mm/s), the power of the laser (set at 100%) and the pulse frequency (20 kHz).

    [0170] The engraving process is repeated 12 times and therefore creating indentations with a depth of approximately 60 m. Each indentation has a diameter of approximately 60 m. The array of indentations manufactured by means of the presented method is shown in FIG. 6a.

    [0171] Example 2: The detection capabilities of the device have been investigated by analyzing a sample volume comprising: [0172] Mastermix: KAPA SYBR FAST qPCR Master Mix (2), which contains KAPA SYBR FAST DNA Polymerase, reaction buffer, dNTPs, SYBR Green I dye, and MgCl2 at a final concentration of 2.5 mM

    TABLE-US-00001 Aforwardprimer: (SEQIDNO:1) AGACGTGTGCTCTTCCGATC Areverseprimer: (SEQIDNO:2) ACACGACGCTCTTCCGATCT SyntheticDNA: Sequence(5-3): (SEQIDNO:3) ACACGACGCTCTTCCGATCTGACTCTCATCTACTAG ATAGATCTCCACCTCGCAGTCTCGTCTTCAACGGTG CTCACGCGATATAGTTAGCTCGCGACTACCATAGCG CTACATAGAAGTCAGCAAGAGATCGGAAGAGCACAC GTCT Sequence(5-3): (SEQIDNO:4) AGACGTGTGCTCTTCCGATCTCTTGCTGACTTCTAT GTAGCGCTATGGTAGTCGCGAGCTAACTATATCGCG TGAGCACCGTTGAAGACGAGACTGCGAGGTGGAGAT CTATCTAGTAGATGAGAGTCAGATCGGAAGAGCGTC GTGT [0173] A solution of bovine serum albumin [0174] Deionized water

    [0175] A sample volume smaller than 1 L has been applied onto the sample holder according to Example 1. The sample holder has been placed under the optical detector and the excitation light source of the device. The excitation light source is composed of 8 commercial LEDs with a power rating of 3W and a central wavelength of 460 nm. The light sources were directed to the sample holder for exciting the sample volumes captured in the indentations of the sample holder array.

    [0176] Detection was performed with a single-board computer (Raspberry Pi model 3B) equipped with a CCD camera (Raspberry Pi Camera Module v2) that was placed vertically above the center of the sample holder. A 12 mm lens was mounted onto the CCD camera and a long pass filter was placed in front of the lens (cut on frequency approximately at 580 nm). The signal was detected by recording the image produced by the CCD camera and saving it to an image file. Portion of the signal detected by the optical sensor is shown in FIG. 6b.

    [0177] In FIG. 6b, the array of indentations (white circles) can be identified against the background.

    [0178] Furthermore, indentations that respond to the excitation with a strong signal (such as the indentation in row 4, column 2 from the top-left corner) can be distinguished over indentations that are not producing any signal (such as the first indentation in the top left corner).

    [0179] In digital PCR the detection is done by comparing the signal of each indentation with a specific threshold for determining whether the well contains amplified DNA or not.

    Example 3: Manufacturing of the metallic sample holder is shown in this example.

    [0180] Two samples were produced, a comparison example in FIG. 7a and a sample that is produced with the manufacturing method according to the invention in FIG. 7b. Both samples comprise a metallic sample holder, wherein an indentation is fabricated into each sample by means of laser engraving with two different procedures. Both samples are manufactured on a aluminum plate of 40400.3 mm. The plate is placed for each sample under a 20W fibre laser engraving machine. The laser is operated at 100% power and the pulse frequency is set to 20 kHz.

    [0181] The laser engraving machine used in these experiments is able to generate a directional focused laser beam that is shining onto the surface of the substrate. When the beam hits the surface, the energy is at least partly absorbed and thus heat is transferred to the material. Due to this generation of heat, a portion of the substrate is completely evaporated and thus an indentation is created.

    [0182] In the comparison example, the laser has been focused on one spot and the engraving process has been repeated continuously (without pauses) until the desired depth (around 100 um) was achieved. Due to the continuous operation of the laser, the material was not removed effectively and, as shown in FIG. 7a, the resulting well is very narrow and with a very limited bottom area. In the sample in FIG. 7b that has been manufactured with the method according to the present invention, the engraving process has been repeated 20 times at intervals of 3 seconds between every iteration. By doing so, a better evaporation and removal of material from the surface was achieved. As shown in FIG. 7b, the well obtained has a more defined lateral surface and a broader bottom area, mostly flat, compared to the comparison example as shown in FIG. 7a. Therefore, the fabrication of the indentations with the inventive method results in indentations that are favorable for performing measurements.

    [0183] While there are shown and described presently preferred embodiments and examples of the invention, it is to be distinctly understood that the invention is not limited thereto but may be otherwise variously embodied and practised within the scope of the following claims.