Nucleic acid linked to a trivalent glycoconjugate

10913945 ยท 2021-02-09

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a compound comprising a modified saccharide moiety conjugated to a nucleic acid. The compound is useful in medicine for RNA interference therapy or for research and diagnostic purposes. In particular, the compound is useful in treating liver disease.

Claims

1. A compound selected from the following formulas: ##STR00037## ##STR00038## ##STR00039## ##STR00040## wherein Z is a nucleic acid.

2. The compound according to claim 1, wherein the nucleic acid is selected from RNAi, siRNA, antisense nucleic acid, ribozyme, aptamer and spiegelmer.

3. A composition comprising a compound as defined in claim 1 and a suitable carrier or excipient.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1 provides an illustration of a modified double stranded siRNA conjugated to a three saccharide ligand moiety modified with thiophosphate groups.

(2) FIG. 2 is a bar chart illustrating in vivo efficacy in mice with in vivo efficacy of TTR knockdown in mice. Mice (4 animals per group) were treated with a single subcuteanous dose of 1 mg/kg and sacrifised after 2 days post injection. TTR mRNA level was quantified by TAQman PCR. The level of knockdown is shown above the bars. mRNA level were normalised against PTEN. The introduction of phosphorothioates in the GalNAc linker system as in TTR CF02V21 and TTR CF02V23 showed substantially greater potency compared to standard phosphodiester linkage (as in TTR CF02V20 and TTR CF02V22).

(3) FIG. 3 is a bar chart illustrating the duration of TTR knockdown in mice. Mice (4 animals per group) were treated with a single subcuteanous dose of 2 mg/kg and sacrifised at the given time points (7, 14, 21 and 28 days post injection). TTR mRNA level was quantified by TAQman PCR. The level of knockdown is shown above the bars. mRNA level were normalised against PTEN.

(4) The duration of knockdown with siRNA conjugates of the present invention is much more pronounced and more long lasting when compared with compound TTRCF02 which incorporates the standard Biessen/van Berkel type of GalNAc linker (as in structure ST13).

(5) FIG. 4 is a bar chart illustrating a dose titration of TTR knockdown in mice. Mice (4 animals per group) were treated with the respective dose (3, 1, 0.3, 0.1 mg/kg). TTR mRNA level was quantified by TAQman PCR. mRNA level were normalised against PTEN.

(6) FIG. 5 is a bar chart illustrating the in vitro determination of TTR knockdown of TTR siRNA GalNAc conjugates STS016 L8 and L9. TTR CF02V23 represents the positive control. GN_Luc represents the negative control. mRNA level were normalised against PTEN.

(7) FIG. 6 is a bar chart illustrating the in vitro determination of TTR knockdown of TTR siRNA GalNAc conjugates STS016 L4-L7. TTR CF02V23 represents the positive control. GN_Luc represents the negative control. mRNA level were normalised against PTEN.

(8) FIG. 7 is a bar chart illustrating in vivo efficacy of TTR knockdown in mice. Mice (4 animals per group) were treated with a single subcuteanous dose of 1 mg/kg. Blood was taken after each timepoint (day 8, 15, 22 post injection) and analysed for TTR level using commercially available murineTTR specific Elisa Kit.

(9) FIG. 8 is a bar chart illustrating in vivo efficacy of PTEN Knockdown in mice. Mice (4 animals per group) were treated with the respective dose (1, 3, 10 mg/kg). PTEN mRNA level was quantified by TAQman PCR. A clear dose dependent knockdown of PTEN was demonstrated.

EXAMPLES

(10) General Information

(11) All reactions were carried out under a nitrogen atmosphere, unless stated otherwise. NMR spectra were recorded on a Bruker 400 MHz Ultrashield and all chemical shifts () were determined relative to TMS.

Example 1

Synthesis of GalNAc Phosphoramidites

(12) ##STR00022##

(13) The synthesis of the respective phosphoramidites follow essentially the procedure described in Prakash et al. Bioorg. Med. Chem. Lett. 25 (2015) 4127-4130.

(14) Galactosamine penta acetate was activated with trimethylsilyl trifluoromethylsulfonate and reacted with 4-Benzyloxy 1-butanol. After hydrogenolytical removal of the Benzyl protecting group the resulting alcohol was transferred into the phosphoramidite following the method described by Dubber, 2003.

(15) ##STR00023##

(16) ##STR00024##

(17) ST21 was synthesized following the same procedure as above using Benzyl protected triethylene glycol as starting material.

(18) ##STR00025##

(2R,3R,4R,5R,6R)-5-acetamido-2-(acetoxymethyl)-6-(2-(2-(2-(benzyloxy)ethoxy)ethoxy)ethoxy)tetrahydro-2H-pyran-3,4-diyl diacetate (19)

(19) To a solution of 15 (64.2 g, 166 mmol) in 1,2-dichloroethane (700 mL) was added trimethylsilyl trifluoromethanesulfonate (22.10 g, 99 mmol, 18.04 mL, 0.6 equiv) and the brown suspension was stirred for 15 minutes. Grinded 4A molecular sieves (85 g) were added and stirring was continued for 15 minutes. Triethyleneglycolmonobenzyl ether (51.8 g, 215 mmol, 47.5 mL, 1.3 equiv) was added, via drop wise addition, over a period of 15 minutes and stirring was continued at room temperature. The reaction mixture was filtered over a plug of kieselguhr followed by rinsing with warm dichloromethane. The filtrate was quenched by pouring in ice-cold aqueous saturated NaHCO.sub.3 solution (800 mL) and stirred vigerously. The layers were separated and the aqueous layer was extracted twice more with dichloromethane (2300 mL). The combined organic layers were washed with water (600 mL) and brine (600 mL), dried over Na.sub.2SO.sub.4, filtered and concentrated in vacuo to obtain a yellow oil. Purification was performed by flash column chromatography (5-100% EtOAc in heptane) to obtain a mixture of 19 and triethyleneglycolmonobenzyl ether (64 g). This material was dissolved in dichloromethane (430 mL) followed by the addition of triethylamine (38.4 g, 380 mmol, 52.8 ml, 4 equiv) and DMAP (2.321 g, 19.00 mmol, 0.2 equiv). Then, via batch wise addition, was added TBDMSCl (21.47 g, 142 mmol, 1.5 equiv) and stirring was continued at room temperature for 2 hours. The reaction mixture was filtered and followed by pouring in an ice cold saturated solution of NaHCO3 (1 L). The layers were separated and the aqueous layer was extracted twice more with dichloromethane (2300 mL).

(20) The combined organic layers were washed once with brine (1 L) and dried over Na.sub.2SO.sub.4. After concentrating in vacuo, followed by flash column chromatography (70-100% EtOAc in heptane), 19 was obtained as a colourless oil (36 g, yield 30%) .sup.1H NMR (400 MHz, Chloroform-d) 7.38-7.28 (m, 5H), 6.58 (d, J=9.5 Hz, 1H), 5.26 (d, J=3.3 Hz, 1H), 4.96 (dd, J=11.2, 3.4 Hz, 1H), 4.79 (d, J=8.6 Hz, 1H), 4.53 (d, J=1.3 Hz, 2H), 4.28 (dt, J=11.2, 9.0 Hz, 1H), 4.16-4.06 (m, 2H), 3.88 (dd, J=6.0, 2.7 Hz, 2H), 3.75 (td, J=5.7, 2.7 Hz, 4H), 3.71-3.58 (m, 7H), 2.15 (s, 3H), 2.04 (s, 3H), 1.97 (s, 3H), 1.95 (s, 3H).

(2R,3R,4R,5R,6R)-5-acetamido-2-(acetoxymethyl)-6-(2-(2-(2-hydroxyethoxy)ethoxy)ethoxy)tetrahydro-2H-pyran-3,4-diyl diacetate (ST20)

(21) To a solution of 19 (47.68 g, 84 mmol) in tetrahydrofuran (330 ml) and 2-propanol (330 ml) was added 10% palladium on activated carbon (12.92 g, 12.14 mmol, 1.45 equiv). The reaction mixture was charged with hydrogen (balloon) and stirring was continued at room temperature overnight. The reaction mixture was filtered over kieselguhr and rinsed with warm dichloromethane. After concentrating in vacuo, ST20 was obtained (37 g, yield 94%) .sup.1H NMR (400 MHz, DMSO-d.sub.6) 7.81 (d, J=9.2 Hz, 1H), 5.22 (d, J=3.3 Hz, 1H), 4.97 (dd, J=11.2, 3.4 Hz, 1H), 4.61 (t, J=5.4 Hz, 1H), 4.56 (d, J=8.4 Hz, 1H), 4.03 (s, 3H), 3.88 (dt, J=11.1, 8.9 Hz, 1H), 3.82-3.73 (m, 1H), 3.63-3.45 (m, 9H), 3.41 (t, J=5.1 Hz, 2H), 2.11 (s, 3H), 2.00 (s, 3H), 1.89 (s, 3H), 1.78 (s, 3H).

(2R,3R,4R,5R,6R)-5-acetamido-2-(acetoxymethyl)-6-(2-(2-(2-(((2- cyanoethoxy)(diisopropylamino)phosphino)oxy)ethoxy)ethoxy)ethoxy)tetrahydro-2H-pyran-3,4-diyl diacetate (ST21)

(22) To a solution of 4,5-dicyanoimidazole (961 mg, 8.13 mmol, 0.65 equiv) in anhydrous acetonitrile (8 mL) and dry dichloromethane (40 ml) were added grinded 4A molecular sieves (4.4 g). Then, 2-cyanoethyl tetraisopropylphosphoro-diamidite (4903 mg, 16.27 mmol, 5.16 ml, 1.3 equiv) was added via a syringe and stirred at room temperature for 10 minutes. Then, a solution of ST20 (6000 mg, 12.51 mmol) in dry dichloromethane (20 ml) was added to the reaction mixture over a period of 10 minutes. The reaction mixture was filtered over a cotton plug followed by concentrating in vacuo. Purification by flash column chromatography was performed twice (10-100% EtOAc in heptane) to obtain ST21 as a pale yellow oil (6.9 g, yield 74%). .sup.1H NMR (400 MHz, DMSO-d.sub.6) 7.81 (d, J=9.3 Hz, 1H), 5.21 (d, J=3.4 Hz, 1H), 4.97 (dd, J=11.2, 3.4 Hz, 1H), 4.55 (d, J=8.5 Hz, 1H), 4.03 (d, J=3.0 Hz, 3H), 3.88 (dt, J=11.2, 8.9 Hz, 1H), 3.82-3.45 (m, 16H), 2.77 (t, J=6.1 Hz, 2H), 2.11 (s, 3H), 2.00 (s, 3H), 1.89 (s, 3H), 1.77 (s, 3H), 1.13 (dd, J=6.8, 3.1 Hz, 12H).

(23) ##STR00026##

(3aR,5R,6R,7R,7aR)-5-(acetoxymethyl)-2-methyl-5,6,7,7a-tetrahydro-3aH-pyrano[3,2-d]oxazole-6,7-diyl diacetate (15)

(24) To a suspension of Galactosamine pentaacetate (125 g, 321 mmol) in dichloromethane (870 mL) at room temperature was added, via drop wise addition, trimethylsilyltrifluoromethanesulfonate (107 g, 482 mmol, 87 mL, 1.5 equiv) over a period of 30 minutes. The reaction mixture was heated to 40 C. for a period of 2 hours, after which it was cooled back to room temperature and quenched by pouring in an ice-cold aqueous saturated NaHCO.sub.3 solution (1000 mL). The layers were separated and the aqueous layer was extracted twice more with dichloromethane (2300 mL). The combined organic layers were washed with water (500 mL) and brine (800 mL), followed by drying over Na.sub.2SO.sub.4. After concentrating in vacuo 15 was obtained as a pale yellow oil (109 g, crude yield 103%). .sup.1H NMR (400 MHz, Chloroform-d) 6.00 (d, J=6.8 Hz, 1H), 5.47 (t, J=3.0 Hz, 1H), 4.91 (dd, J=7.4, 3.3 Hz, 1H), 4.29-4.06 (m, 3H), 4.03-3.97 (m, 1H), 2.13 (s, 3H), 2.07 (d, J=1.0 Hz, 6H), 2.06 (d, J=1.3 Hz, 3H).

(2R,3R,4R,5R,6R)-5-acetamido-2-(acetoxymethyl)-6-(4-(benzyloxy)butoxy)tetrahydro-2H-pyran-3,4-diyl diacetate (16)

(25) To a solution of 15 (109 g, 331 mmol) in dichloromethane (1200 mL) were added powdered molsieves 4A (75 g) followed by stirring for 15 minutes at room temperature. To the mixture was added 4-benzyloxy-l-butanol (89 g, 497 mmol, 87 mL, 1.5 equiv) and stirring was continued for another 15 minutes. Then, via dropwise addition, was added trimethylsilyltrifluoromethanesulfonate (44.1 g, 199 mmol, 36.0 mL, 0.6 equiv) over a period of 15 minutes. Stirring of the reaction mixture was continued for 2 hours. Filtration of the mixture was performed over a plug of kieselguhr followed by rinsing once with dichloromethane (200 mL). The filtrate was then quenched by pouring in an ice-cold saturated aqueous NaHCO.sub.3 solution (1000 mL). The layers were separated followed by extracting the aqueous layer twice more with dichloromethane (2500 mL). The combined organic layers were washed with water (600 mL) and brine (600 mL) followed by drying over Na.sub.2SO.sub.4. After concentrating in vacuo, purification was performed by flash column chromatography on silica neutralized with 1% Et.sub.3N (20-80% EtOAc in heptane) to obtain 16 as a colourless oil which slowly crystalized (109 g, yield 65%). .sup.1H NMR (400 MHz, DMSO-d.sub.6) 7.83 (d, J=9.3 Hz, 1H), 7.39-7.23 (m, 5H), 5.21 (d, J=3.5 Hz, 1H), 4.96 (dd, J=11.2, 3.5 Hz, 1H), 4.48 (d, J=8.5 Hz, 1H), 4.44 (s, 2H), 4.07-3.97 (m, 3H), 3.87 (dt, J=11.2, 8.8 Hz, 1H), 3.72 (p, J=5.3 Hz, 1H), 3.49-3.37 (m, 3H), 2.10 (s, 3H), 1.99 (s, 3H), 1.89 (s, 3H), 1.76 (s, 3H), 1.54 (qd, J=8.0, 5.2, 4.6 Hz, 4H).

(2R,3R,4R,5R,6R)-5-acetamido-2-(acetoxymethyl)-6-(4-hydroxybutoxy)tetrahydro-2H-pyran-3,4-diyl diacetate (17)

(26) To a solution of 16 (109.6 g, 215 mmol) in tetrahydrofuran (1000 mL) and 2-propanol (1000 mL) was added 10% palladium on carbon (17.17 g, 16.13 mmol, 10%, 0.075 equiv) and the flask was charged with hydrogen (atmospheric pressure). Stirring of the reaction mixture was continued overnight at room temperature. The mixture was filtered over a plug of kieselguhr and concentrated in vacuo. After stripping the material twice with toluene (2300 mL) and dichloromethane (2300 mL), 17 was obtained as a white sticky solid (87 g, yield 97%). .sup.1H NMR (400 MHz, Methanol-d.sub.4) 5.33 (dd, J=3.5, 1.0 Hz, 1H), 5.05 (dd, J=11.3, 3.3 Hz, 1H), 4.55 (d, J=8.5 Hz, 1H), 4.20-3.97 (m, 4H), 3.87 (dt, J=10.1, 5.8 Hz, 1H), 3.60-3.48 (m, 3H), 3.30 (p, J=1.8 Hz, 1H), 2.14 (s, 3H), 2.02 (s, 3H), 1.94 (s, 3H), 1.92 (s, 3H), 1.61 (dtd, J=16.8, 11.0, 10.1, 3.6 Hz, 4H).

(2R,3R,4R,5R,6R)-5-acetamido-2-(acetoxymethyl)-6-(4-(((2-cyanoethoxy)(diisopropylamino)phosphino)oxy)butoxy)tetrahydro-2H-pyran-3,4-diyl diacetate (ST23)

(27) To a solution of 4,5-dicyanoimidazole (1.940 g, 16.43 mmol, 0.65 equiv) in dry acetonitrile (20 mL) and dry dichloromethane (20 mL), under an argon atmosphere, were added grinded Molsieves 4A (9 g). Then, 2-cyanoethyl tetraisopropylphosphoro-diamidite (10.00 g, 33.2 mmol, 10.53 mL, 1.31 equiv) was added via a syringe and stirred at room temperature for 10 minutes. Via drop wise addition was then added a solution of 17 (10.6 g, 25.3 mmol) in dry dichloromethane (50 mL) over a period of 10 minutes. After stirring for an additional 30 minutes, the reaction mixture was filtered over a cotton plug and concentrated in vacuo. Purification of the material was performed by multiple flash column chromatograph steps (0-100% EtOAc in heptane with 5% Et.sub.3N) to obtain ST23 as a pale yellow oil (11.75 g, yield 72%). .sup.1H NMR (400 MHz, DMSO-d.sub.6) 7.82 (d, J=9.2 Hz, 1H), 5.21 (d, J=3.4 Hz, 1H), 4.96 (dd, J=11.2, 3.5 Hz, 1H), 4.48 (d, J=8.5 Hz, 1H), 4.02 (s, 3H), 3.93-3.82 (m, 1H), 3.78-3.65 (m, 3H), 3.64-3.49 (m, 4H), 3.48-3.40 (m, 1H), 2.76 (t, J=5.9 Hz, 2H), 2.11 (s, 3H), 2.00 (s, 3H), 1.89 (s, 3H), 1.77 (s, 3H), 1.62-1.46 (m, 4H), 1.13 (dd, J=6.8, 3.6 Hz, 12H). .sup.31P NMR (162 MHz, Chloroform-d) 147 (d, J=8.6 Hz)

(28) ##STR00027##

6-(benzyloxy)hexan-1-ol (18)

(29) To a cooled and vigerously stirred suspension of sodium hydride (90 g, 2242 mmol, 3.5 equiv) in tetrahydrofuran (500 mL) was added, via dropwise addition, a solution of 1,6-hexanediol (265 g, 2242 mmol, 3.5 equiv) in tetrahydrofuran (1000 mL) over a period of one hour. After stirring for an additional 30 minutes, a solution of benzyl bromide (76 mL, 641 mmol, 1 equiv) in tetrahydrofuran (500 mL) was added over a period of 30 minutes. Upon complete addition, the reaction mixture was allowed to reach room temperature and stirring was continued overnight. The reaction mixture was cooled to a temperature of 5 C. followed by the slow addition of water (200 mL). The mixture was then concentrated in vacuo, redissolved in dichloromethane (600 mL) and washed with water (3000 mL). The aqueous layer was extracted three more times with dichloromethane (3500 mL). The combined organic layers were washed with water (3400 mL) and brine (1500 mL) followed by drying over Na.sub.2SO.sub.4 and concentrating in vacuo. Purification was performed by gravity column chromatography (0-50% EtOAc in heptane) to obtain 18 (25 g, yield 20%). .sup.1H NMR (400 MHz, Chloroform-d) 7.40-7.27 (m, 5H), 4.50 (s, 2H), 3.64 (t, J=6.7 Hz, 2H), 3.47 (t, J=6.6 Hz, 2H), 1.68-1.51 (m, 4H), 1.47-1.31 (m, 4H), 1.27 (s, 1H).

(2R,3R,4R,5R,6R)-5-acetamido-2-(acetoxymethyl)-6-((6-(benzyloxy)hexyl)oxy)tetrahydro-2H-pyran-3,4-diyl diacetate (ST30Bn)

(30) To a solution of 15 (28 g, 85 mmol) in dichloromethane (320 mL) were added powdered molsieves 4A (10 g) followed by stirring for 5 minutes. Then, 18 (26.6 g, 128 mmol, 1.5 equiv) was added and stirring was continued for another 15 minutes. Trimethylsilyl trifluoromethanesulfonate (9.26 mL, 51.0 mmol, 0.6 equiv) was added, via drop wise addition, over a period of 15 minutes. Stirring was continued at room temperature for 2 hours. The reaction mixture was filtered over a cotton plug followed by quenching with an ice-cold saturated aqueous NaHCO3 solution (300 mL). The layers were separated and extraction was performed twice more with dichloromethane (2150 mL). The combined organic layers were washed with water (150 mL) and brine (150 mL) followed by drying over Na.sub.2SO.sub.4 and concentrating in vacuo. Purification was performed by flash column chromatography (20-100% EtOAc in heptane) to obtain ST30Bn as a colourless oil (25 g, yield 55%). .sup.1H NMR (400 MHz, Chloroform-d) 7.38-7.27 (m, 5H), 5.43 (t, J=6.9 Hz, 1H), 5.38-5.27 (m, 2H), 4.71 (d, J=8.3 Hz, 1H), 4.50 (s, 2H), 4.21-4.07 (m, 2H), 3.96-3.81 (m, 3H), 3.47 (t, J=6.3 Hz, 3H), 2.14 (s, 3H), 2.05 (s, 3H), 2.00 (s, 3H), 1.94 (s, 3H), 1.68-1.51 (m, 4H), 1.44-1.30 (m, 4H).

(2R,3R,4R,5R,6R)-5-acetamido-2-(acetoxymethyl)-6-((6-hydroxyhexyl)oxy)tetrahydro-2H-pyran-3,4-diyl diacetate (ST30)

(31) To a solution of ST30Bn (29 g, 54 mmol) in tetrahydrofuran (250 mL) and 2-Propanol (250 mL) was added 10% palladium on carbon (0.582 g, 0.547 mmol, 0.075 equiv). The flask was charged with hydrogen (atmospheric pressure) and stirring of the mixture was continued overnight at room temperature. The reaction mixture was filtered over a plug of kieselguhr and the filtrate was concentrated in vacuo. After stripping twice with toluene (2200 mL) and dichloromethane (2200 mL) ST30 was obtained as a colourless oil (24 g, yield 99%). .sup.1H NMR (400 MHz, Methanol-d.sub.4) 5.37-5.26 (m, 1H), 5.10-4.97 (m, 1H), 4.67-4.48 (m, 2H), 4.20-3.93 (m, 4H), 3.92-3.77 (m, 1H), 3.52 (hept, J=9.4, 8.1 Hz, 3H), 3.36-3.23 (m, 1H), 2.17-2.09 (m, 3H), 2.05-1.98 (m, 3H), 1.97-1.87 (m, 6H), 1.63-1.45 (m, 4H), 1.43-1.29 (m, 4H).

(2R,3R,4R,5R,6R)-5-acetamido-2-(acetoxymethyl)-6-((6-(((2-cyanoethoxy)(diisopropylamino)phosphino)oxy)hexyl)oxy)tetrahydro-2H-pyran-3,4-diyl diacetate (ST31)

(32) To a solution of ST30 (21.2 g, 47.4 mmol) in dry dichloromethane (550 mL), under an argon atmosphere, was added DIPEA (83 mL, 474 mmol, 10 equiv) and Molsieves 4A (30 g). The reaction mixture was cooled to a temperature of 0 C. followed by the drop wise addition of 2-cyanoethyl N,N-diisopropylchlorophosphoramidite (13.46 g, 56.9 mmol, 1.2 equiv) over a period of 10 minutes. Stirring of the mixture was continued while allowing it to warm up over a period of 30 minutes. The reaction mixture was filtered over a cotton plug and directly coated on, with Et.sub.3N treated, silica (60 g). Purification was performed by flash column chromatography (10-60% EtOAc in heptane, 5% Et.sub.3N) to obtain ST31 as a yellow tar (24.8 g, yield 78%). .sup.1H NMR (400 MHz, DMSO-d.sub.6) 7.82 (d, J=9.2 Hz, 1H), 5.21 (d, J=3.4 Hz, 1H), 4.96 (dd, J=11.3, 3.4 Hz, 1H), 4.48 (d, J=8.5 Hz, 1H), 4.02 (s, 3H), 3.91-3.81 (m, 1H), 3.79-3.63 (m, 3H), 3.63-3.49 (m, 4H), 3.45-3.37 (m, 1H), 2.76 (t, J=5.8 Hz, 2H), 2.10 (s, 3H), 2.00 (s, 3H), 1.89 (s, 3H), 1.77 (s, 3H), 1.58-1.40 (m, 4H), 1.37-1.22 (m, 4H), 1.13 (dd, J=6.8, 3.9 Hz, 12H).

Example 2

Synthesis of Trebler Synthons

(33) ##STR00028## ##STR00029##

2-((4-(benzyloxy)butoxy)methyl)-2-(hydroxymethyl)propane-1,3-diol (1)

(34) To a suspension of pentaerythritol (160 g, 1175 mmol, 10 equiv) in dimethyl sulfoxide (320 mL) was added potassium hydroxide (65.9 g, 1175 mmol, 10 equiv) followed by stirring for 15 minutes at room temperature. Then, over a period of 1.5 hours, was added a solution of 4-benzyloxy-1-bromobutane (22.32 mL, 118 mmol, 1 equiv) in dimethyl sulfoxide (107 mL). Upon complete addition, stirring of the reaction mixture was continued overnight at room temperature. The reaction mixture was acidified to pH=2 by the addition of 3M aqueous HCl, the now obtained white suspension was filtered over a glass filter. The filtrate was further diluted with water (900 mL), transferred to a separatory funnel and the product was extracted with dichloromethane (3200 mL). The combined organic layers were washed with water (4200 mL), dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The pale yellow oil was purified by flash column chromatography (50-100% EtOAc in heptane) to obtain 1 as a colourless oil (20.46 gram, yield 58%). .sup.1H NMR (400 MHz, Chloroform-d) 7.41-7.27 (m, 5H), 4.50 (s, 2H), 3.70 (s, 6H), 3.52-3.43 (m, 6H), 2.54 (s, 3H), 1.71-1.64 (m, 4H).

diethyl 3,3-((2-((4-(benzyloxy)butoxy)methyl)-2-(((3-ethoxy-3-oxoprop-1-en-1-yl)oxy)methyl)propane-1,3-diyl)bis(oxy))diacrylate (2)

(35) To a solution of 1 (20.46 g, 68.6 mmol) in dichloromethane (300 mL) was added N-methylmorpholine (33.9 mL, 309 mmol, 4.5 equiv). The reaction mixture was cooled upon an icebath and to the reaction mixture was added ethyl propiolate (27.8 mL, 274 mmol, 4 equiv) via a single stream. Stirring of the reaction mixture was continued for 15 minutes, followed by allowing the reaction mixture to warm up to room temperature. After 2 hours reaction time, the reaction mixture was concentrated in vacuo to obtain a dark brown oil. Purification of the crude material was performed by flash column chromatography (0-37% EtOAc in heptane) to obtain 2 as a yellow oil (31.56 g, yield 78%). .sup.1H NMR (400 MHz, Chloroform-d) 7.54 (d, J=12.6 Hz, 3H), 7.39-7.28 (m, 5H), 5.23 (d, J=12.6 Hz, 3H), 4.50 (s, 2H), 4.16 (q, J=7.1 Hz, 6H), 3.87 (s, 6H), 3.53-3.33 (m, 6H), 1.69-1.55 (m, 4H), 1.26 (t, J=7.1 Hz, 12H).

diethyl 3,3-((2-((4-(benzyloxy)butoxy)methyl)-2-((3-ethoxy-3-oxopropoxy)methyl)propane-1,3-diyl)bis(oxy))dipropanoate (3)

(36) To a solution of 2 (31.56 g, 53.2 mmol) in ethanol (1463 mL) was added 10% palladium on carbon (2.83 g, 2.66 mmol, 0.05 equiv) and pyridine (2.153 mL, 26.6 mmol, 0.5 equiv). The reaction mixture was charged with hydrogen (atmospheric pressure) and stirring of the mixture was continued overnight at room temperature. The reaction mixture was filtered over a plug of kieselguhr, followed by concentrating the filtrate in vacuo. This afforded 3 as a yellow oil (29.75 g, yield 93%). .sup.1H NMR (400 MHz, Chloroform-d) 7.38-7.27 (m, 5H), 4.51 (s, 2H), 4.13 (q, J=7.1 Hz, 6H), 3.64 (t, J=6.5 Hz, 6H), 3.48 (t, J=6.2 Hz, 2H), 3.39-3.33 (m, 8H), 3.30 (s, 2H), 2.52 (t, J=6.5 Hz, 6H), 1.70-1.56 (m, 4H), 1.26 (t, J=7.1 Hz, 9H).

3,3-((2-((4-(benzyloxy)butoxy)methyl)-2-((3-hydroxypropoxy)methyl)propane-1,3-diyl)bis(oxy))bis(propan-1-ol) (ST40)

(37) A solution of 2.4 M lithium aluminium hydride in tetrahydrofuran (76 mL, 183 mmol, 6.2 equiv) in dry tetrahydrofuran (331 mL) was cooled to a temperature of 0 C. Then, via drop wise addition, was added a solution of 3 (17.7 g, 29.6 mmol) in dry tetrahydrofuran (200 mL) at such a rate that the temperature was kept below 10 C. Upon complete addition stirring was continued overnight while allowing the reaction mixture to slowly reach room temperature. The reaction was further diluted with tetrahydrofuran (100 mL) and cooled to a temperature of 0 C. Quenching of the reaction mixture was performed by the slow addition of water (2.0 mL), 4M aqueous NaOH (2.0 mL) and water (6.0 mL). The white precipitate was removed by filtration over a dry Na.sub.2SO.sub.4 plug followed by rinsing twice with tetrahydrofuran. The filtrate was concentrated in vacuo and purification of this was performed by flash column chromatography (0-10% MeOH in dichloromethane) to obtain ST40 as a colourless oil (9.55 g, yield 68%). .sup.1H NMR (400 MHz, Chloroform-d) 7.39-7.27 (m, 5H), 4.51 (s, 2H), 3.74 (q, J=5.2 Hz, 6H), 3.58 (t, J=5.5 Hz, 6H), 3.49 (t, J=6.1 Hz, 2H), 3.40 (s, 8H), 3.33 (s, 2H), 3.27 (s, 3H), 1.79 (p, J=5.3 Hz, 6H), 1.71-1.58 (m, 4H).

8,8-bis((3-(bis(4-methoxyphenyl)(phenyl)methoxy)propoxy)methyl)-1,1-bis(4-methoxyphenyl)-1,16-diphenyl-2,6,10,15-tetraoxahexadecane (ST40DMTrBn)

(38) Residual water was removed from ST40 (9.55 g, 20.21 mmol) by stripping twice with pyridine, followed by redissolving in pyridine (464 mL) under an argon atmosphere. To the reaction mixture were added moleculair sieves 3A (20 g) and stirring was continued for 15 minutes. Solid DMTrCl (30.8 g, 91 mmol, 4.5 equiv) was added and stirring of the now dark orange mixture was continued overnight. The reaction was filtered over a cotton plug and the filtrate was coated on, with Et.sub.3N neutralized, silica. Purification was performed by flash column chromatography (0-40% EtOAc in heptane, 5% Et.sub.3N) to obtain ST40DMTrBn as a yellow foaming oil (25.3 g, yield 84%). .sup.1H NMR (400 MHz, Chloroform-d) 7.43-7.37 (m, 6H), 7.33-7.21 (m, 23H), 7.19-7.13 (m, 3H), 6.82-6.75 (m, 12H), 4.46 (s, 2H), 3.74 (s, 18H), 3.43 (t, J=6.3 Hz, 2H), 3.39 (t, J=6.5 Hz, 6H), 3.26-3.17 (m, 10H), 3.06 (t, J=6.4 Hz, 6H), 1.78 (p, J=6.4 Hz, 6H), 1.64-1.49 (m, 4H).

4-(3-(3-(bis(4-methoxyphenyl)(phenyl)methoxy)propoxy)-2,2-bis((3-(bis(4-methoxyphenyl)(phenyl)methoxy)propoxy)methyl)propoxy)butan-1-ol (ST40DMTrOH)

(39) To a solution of ST40DMTrBn (25.3 g, 18.34 mmol) in tetrahydrofuran (275 mL) was added 5% palladium on carbon, Johnson Matthey type 338 (5.85 g, 2.75 mmol, 0.15 equiv). The flask was charged with hydrogen (atmospheric pressure) and after 45 minutes reaction time it was flushed with nitrogen. The reaction mixture was filtered over a plug of kieselguhr and concentrated in vacuo. Purification was performed by flash column chromatography (0-40% EtOAc in heptane, 5% Et.sub.3N) to obtain ST40DMTrOH as a white foaming solid (11.95 g, yield 50%). .sup.1H NMR (400 MHz, Chloroform-d) 7.44-7.37 (m, 6H), 7.34-7.21 (m, 18H), 7.20-7.13 (m, 3H), 6.83-6.75 (m, 12H), 3.75 (s, 18H), 3.60-3.53 (m, 2H), 3.39 (t, J=6.4 Hz, 6H), 3.27 (t, 2H), 3.22 (s, 8H), 3.07 (t, J=6.4 Hz, 6H), 2.26 (t, J=5.9 Hz, 1H), 1.79 (p, J=6.5 Hz, 6H), 1.60-1.51 (m, 4H).

4-(3-(3-(bis(4-methoxyphenyl)(phenyl)methoxy)propoxy)-2,2-bis((3-(bis(4-methoxyphenyl)(phenyl)methoxy)propoxy)methyl)propoxy)butyl (2-cyanoethyl) diisopropylphosphoramidite (ST41)

(40) To a solution of ST40DMtrOH (11.95 g, 9.27 mmol) in dry dichloromethane (162 mL) was added DIPEA (16.18 mL, 93 mmol, 10 equiv) and moleculair sieves 4A (25 g) followed by cooling to a temperature of 0 C. Then, to the reaction was added 2-cyanoethyl N,N-diisopropylchlorophosphoramidite (2.61 g, 11.03 mmol, 1.2 equiv) via drop wise addition over a period of 15 minutes. Stirring of the reaction mixture was continued for another 15 minutes while allowing it to reach room temperature. The reaction mixture was filtered over a cotton plug and the filtrate was coated on, with Et.sub.3N treated, silica (50 g). Purification was performed by flash column chromatography (0-35% EtOAc in heptane, 5% Et.sub.3N) to obtain ST41 as a colourless tar (10.65 g, yield 77%). .sup.1H NMR (400 MHz, Chloroform-d) 7.44-7.37 (m, 6H), 7.33-7.21 (m, 18H), 7.20-7.13 (m, 3H), 6.83-6.75 (m, 12H), 3.86-3.70 (m, 20H), 3.67-3.50 (m, 4H), 3.39 (t, J=6.4 Hz, 6H), 3.29-3.16 (m, 10H), 3.06 (t, J=6.4 Hz, 6H), 2.57 (t, 2H), 1.78 (p, J=6.4 Hz, 6H), 1.65-1.49 (m, 4H), 1.16 (dd, J=9.1, 6.8 Hz, 12H).

(41) ##STR00030## ##STR00031##

2-(((6-(benzyloxy)hexyl)oxy)methyl)-2-(hydroxymethyl)propane-1,3-diol (4)

(42) To a suspension of pentaerythritol (55.2 g, 406 mmol, 10 equiv) in dimethyl sulfoxide (110 mL) was added potassium hydroxide (22.76 g, 406 mmol, 10 equiv) followed by stirring for 15 minutes at room temperature. Then, over a period of 1.5 hours, was added a solution of benzyl 6-bromohexyl ether (11 g, 40.6 mmol, 1 equiv) in dimethyl sulfoxide (36.6 mL). Upon complete addition, stirring of the reaction mixture was continued overnight at room temperature. The reaction mixture was acidified to pH1 by the addition of 3M aqueous HCl and the now obtained white emulsion was further diluted with water (700 mL), transferred to a separatory funnel and the product was extracted with dichloromethane (470 mL). The combined organic layers were washed with water (370 mL), dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The pale yellow oil was purified by flash column chromatography (50-100% EtOAc in heptane) to obtain 4 as a colourless oil (9.16 gram, yield 67%). .sup.1H NMR (400 MHz, Chloroform-d) 7.38-7.27 (m, 5H), 4.50 (s, 2H), 3.70 (s, 6H), 3.49-3.39 (m, 6H), 2.83 (s, 3H), 1.66-1.52 (m, 4H), 1.45-1.28 (m, 4H).

diethyl 3,3-((2-(((6-(benzyloxy)hexyl)oxy)methyl)-2-(((3-ethoxy-3-oxoprop-1-en-1-yl)oxy)methyl)propane-1,3-diyl)bis(oxy))diacrylate (5)

(43) To a solution of 2 (9.1 g, 27.9 mmol) in dichloromethane (150 mL) was added N-methylmorpholine (13.79 mL, 125 mmol, 4.5 equiv). The reaction mixture was cooled upon an icebath and to the reaction mixture was added ethyl propiolate (11.30 mL, 112 mmol, 4 equiv) via a single stream. Stirring of the reaction mixture was continued for 15 minutes, followed by allowing the reaction mixture to warm up to room temperature. After 2 hours reaction time, the reaction mixture was concentrated in vacuo to obtain a dark brown oil. Purification of the crude material was performed by flash column chromatography (0-30% EtOAc in heptane) to obtain 5 as a pale yellow oil (15.85 g, yield 79%). .sup.1H NMR (400 MHz, Chloroform-d) 7.54 (d, J=12.6 Hz, 3H), 7.37-7.27 (m, 5H), 5.23 (d, J=12.6 Hz, 3H), 4.50 (s, 2H), 4.16 (q, J=7.1 Hz, 6H), 3.88 (s, 6H), 3.46 (t, J=6.5 Hz, 2H), 3.41 (s, 2H), 3.36 (t, J=6.5 Hz, 2H), 1.65-1.49 (m, 4H), 1.43-1.21 (m, 13H).

diethyl 3,3-((2-(((6-(benzyloxy)hexyl)oxy)methyl)-2-((3-ethoxy-3-oxopropoxy)methyl)propane-1,3-diyl)bis(oxy))dipropanoate (6)

(44) To a solution of 5 (15.85 g, 25.5 mmol) in ethanol (750 mL) was added 10% palladium on carbon (1.359 g, 1.277 mmol, 0.05 equiv) and pyridine (1.033 mL, 12.77 mmol, 0.5 equiv). The reaction mixture was charged with hydrogen (atmospheric pressure) and stirring of this was continued overnight at room temperature. The reaction mixture was filtered over a plug of kieselguhr followed by concentrating the filtrate in vacuo which afforded 6 as a pale yellow oil (15.27 g, yield 91%). .sup.1H NMR (400 MHz, Chloroform-d) 7.37-7.27 (m, 5H), 4.50 (s, 2H), 4.14 (q, J=7.1 Hz, 6H), 3.64 (t, J=6.5 Hz, 6H), 3.47 (t, J=6.7 Hz, 2H), 3.40-3.26 (m, 10H), 2.52 (t, J=6.5 Hz, 6H), 1.69-1.46 (m, 4H), 1.44-1.30 (m, 4H), 1.26 (t, J=7.1 Hz, 9H).

3,3-((2-(((6-(benzyloxy)hexyl)oxy)methyl)-2-((3-hydroxypropoxy)methyl)propane-1,3-diyl)bis(oxy))bis(propan-1-ol) (ST42)

(45) A solution of 6 (19.27 g, 30.7 mmol) in dry tetrahydrofuran (360 mL) was cooled to a temperature of 0 C. Then, via drop wise addition, was added 2.4 M lithium aluminium hydride in tetrahydrofuran (128 mL, 307 mmol, 10 equiv) over a period of 1 hour. Upon complete addition, stirring was continued overnight while allowing the reaction mixture to slowly reach room temperature. Upon cooling, the reaction was quenched by the slow addition of water (11.7 mL), 4M aqueous NaOH (11.7 mL) and water (35 mL). The white precipitate was removed by filtration over a dry Na.sub.2SO.sub.4 plug followed by rinsing twice with tetrahydrofuran. The filtrate was concentrated in vacuo and purification was performed by flash column chromatography (0-6% MeOH in dichloromethane) to obtain ST42 as a colourless oil (11.64 g, yield 72%). .sup.1H NMR (400 MHz, Chloroform-d) 7.38-7.27 (m, 5H), 4.50 (s, 2H), 3.74 (t, J=5.4 Hz, 6H), 3.58 (t, J=5.5 Hz, 6H), 3.47 (t, J=6.6 Hz, 2H), 3.40 (s, 6H), 3.36 (t, J=6.5 Hz, 2H), 3.32 (s, 2H), 3.29 (s, 3H), 1.79 (p, J=5.4 Hz, 6H), 1.70-1.49 (m, 4H), 1.44-1.28 (m, 4H).

8,8-bis((3-(bis(4-methoxyphenyl)(phenyl)methoxy)propoxy)methyl)-1,1-bis(4-methoxyphenyl)-1,18-diphenyl-2,6,10,17-tetraoxaoctadecane (ST43DMTrBn)

(46) Residual water was removed from ST42 (4.00 g, 7.99 mmol) by stripping twice with pyridine, followed by redissolving in pyridine (165 mL) under an argon atmosphere. To the reaction mixture were added moleculair sieves 4A (8 g) and stirring was continued for 15 minutes. Solid DMTrCl (13.54 g, 39.9 mmol, 5 equiv) was added and stirring of the now dark orange mixture was continued at room temperature. After 2 hours additional DMTrCl (4.06 g, 11.98 mmol, 1.5 equiv) was added and stirring was continued overnight. The reaction was filtered over a cotton plug and the filtrate was coated on, with Et.sub.3N neutralized, silica (40 g). Purification was performed by flash column chromatography (0-35% EtOAc in heptane, 5% Et.sub.3N) to obtain ST43DMTrBn as a yellow foaming oil (10.44 g, yield 86%). .sup.1H NMR (400 MHz, Chloroform-d) 7.43-7.37 (m, 6H), 7.34-7.21 (m, 23H), 7.19-7.12 (m, 3H), 6.82-6.76 (m, 12H), 4.47 (s, 2H), 3.74 (s, 18H), 3.41 (dt, J=14.6, 6.5 Hz, 8H), 3.26-3.16 (m, 10H), 3.06 (t, J=6.4 Hz, 6H), 1.78 (p, J=6.5 Hz, 6H), 1.56 (p, 2H), 1.45 (p, J=6.6 Hz, 2H), 1.38-1.21 (m, 4H).

6-(3-(3-(bis(4-methoxyphenyl)(phenyl)methoxy)propoxy)-2,2-bis((3-(bis(4-methoxyphenyl)(phenyl)methoxy)propoxy)methyl)propoxy)hexan-1-ol (ST43DMTrOH)

(47) To a solution of ST43DMTrBn (10.2 g, 7.25 mmol) in tetrahydrofuran (200 mL) was added 5% palladium on carbon, Johnson Matthey type 338 (2.313 g, 1.08 mmol, 0.15 equiv). The flask was charged with hydrogen (atmospheric pressure) and after 50 minutes reaction time it was flushed with nitrogen. The reaction mixture was filtered over a plug of Kieselguhr and concentrated in vacuo. Purification was performed by flash column chromatography (0-40% EtOAc in heptane, 5% Et.sub.3N) to obtain ST43DMTrOH as a white foam (3.83 g, yield 38%). .sup.1H NMR (400 MHz, Chloroform-d) 7.44-7.36 (m, 6H), 7.34-7.21 (m, 18H), 7.20-7.13 (m, 3H), 6.84-6.73 (m, 12H), 3.75 (s, 18H), 3.62-3.53 (m, 2H), 3.40 (t, J=6.4 Hz, 6H), 3.27-3.16 (m, 10H), 3.07 (t, J=6.4 Hz, 6H), 1.79 (p, J=6.4 Hz, 6H), 1.56-1.41 (m, 4H), 1.37-1.23 (m, 5H).

6-(3-(3-(bis(4-methoxyphenyl)(phenyl)methoxy)propoxy)-2,2-bis((3-(bis(4-methoxyphenyl)(phenyl)methoxy)propoxy)methyl)propoxy)hexyl (2-cyanoethyl) diisopropylphosphoramidite (ST43)

(48) To a solution of ST43DMtrOH (3.83 g, 2.76 mmol) in dry dichloromethane (50 mL) was added DIPEA (4.82 mL, 27.6 mmol, 10 equiv) and moleculair sieves 4A (7 g) followed by cooling to a temperature of 0 C. Then, to the reaction was added 2-cyanoethyl N,N-diisopropylchlorophosphoramidite (0.948 g, 4.00 mmol, 1.45 equiv) via drop wise addition over a period of 15 minutes. Stirring of the reaction mixture was continued for another 15 minutes while allowing it to reach room temperature. The reaction mixture was filtered over a cotton plug and the filtrate was coated on, with Et.sub.3N treated, silica (10 g). Purification was performed by flash column chromatography (0-30% EtOAc in heptane, 5% Et.sub.3N) to obtain ST43 as a colourless tar (3.48 g, yield 83%). .sup.1H NMR (400 MHz, Chloroform-d) 7.44-7.37 (m, 6H), 7.33-7.20 (m, 18H), 7.19-7.13 (m, 3H), 6.83-6.75 (m, 12H), 3.87-3.69 (m, 20H), 3.66-3.51 (m, 4H), 3.39 (t, J=6.4 Hz, 6H), 3.28-3.15 (m, 10H), 3.07 (t, J=6.4 Hz, 6H), 2.60 (t, J=6.5 Hz, 2H), 1.79 (p, J=6.4 Hz, 6H), 1.58 (p, J=3.9 Hz, 2H), 1.46 (p, J=6.7 Hz, 2H), 1.39-1.23 (m, 4H), 1.17 (t, J=7.3 Hz, 12H).

(49) ##STR00032## ##STR00033##

((8-bromooctyl)oxy)(tert-butyl)dimethylsilane (7)

(50) To a solution of 8-bromooctan-1-ol (8 g, 38.3 mmol) in dry N,N-dimethylformamide (10 mL) was added imidazole (6.51 g, 96 mmol, 2.5 equiv). Once a clear solution was obtained, TBDMS-Cl (7.50 g, 49.7 mmol, 1.2 equiv) was added portion wise to observe an exothermic reaction which reached a maximum temperature of 40 C. Stirring of the reaction mixture was continued overnight at room temperature. The obtained yellow suspension was diluted with Et.sub.2O (40 mL) and washed with brine (40 mL). The aqueous layer was extracted twice more with Et.sub.2O (240 mL) and the combined organic layers were dried over Na.sub.2SO.sub.4. After concentrating in vacuo, purification was performed by flash column chromatography (0-40% EtOAc in heptane) to obtain 7 as a colourless oil (11.73 g, yield 95%). .sup.1H NMR (400 MHz, Chloroform-d) 3.60 (t, J=6.6, 1.7 Hz, 2H), 3.41 (t, J=6.9 Hz, 2H), 1.85 (p, J=7.0 Hz, 2H), 1.60-1.37 (m, 4H), 1.37-1.24 (m, 6H), 0.89 (s, 9H), 0.05 (s, 6H).

2-(((8-((tert-butyldimethylsilyl)oxy)octyl)oxy)methyl)-2-(hydroxymethyl)propane-1,3-diol (8)

(51) To a suspension of pentaerythritol (16.84 g, 124 mmol, 10 equiv) in dimethyl sulfoxide (45 mL) was added potassium hydroxide (6.94 g, 124 mmol, 10 equiv) and this was stirred for 15 minutes at room temperature. Then, over a period of 2 hours, was added 7 (4 g, 12.37 mmol, 1 equiv). Upon complete addition, stirring of the reaction mixture was continued overnight at room temperature. The reaction mixture was extracted three times with Et.sub.2O (3150 mL) and all organic layers were washed separately with brine (50 mL). The combined aqueous layers were then extracted once more with Et.sub.2O (50 mL). The combined organic layers were dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The pale yellow oil was purified by flash column chromatography (0-100% EtOAc in heptane) to obtain 8 as a colourless oil (0.53 g, yield 11%). .sup.1H NMR (400 MHz, Chloroform-d) 3.72 (d, J=3.7 Hz, 6H), 3.60 (t, J=6.6 Hz, 2H), 3.47 (s, 2H), 3.42 (t, J=6.5 Hz, 2H), 2.73 (s, 3H), 1.63-1.44 (m, 4H), 1.30 (s, 8H), 0.89 (s, 9H), 0.05 (s, 6H).

ethyl 15,15-bis(((3-ethoxy-3-oxoprop-1-en-1-yl)oxy)methyl)-2,2,3,3-tetramethyl-4,13,17-trioxa-3-silaicos-18-en-20-oate (9)

(52) To a solution of 8 (2.94 g, 7.76 mmol) in dichloromethane (30 mL) was added N-methylmorpholine (3.84 mL, 34.9 mmol, 4.5 equiv) and ethyl propiolate (3.7 mL, 36.5 mmol, 4.7 equiv). An exothermic reaction was observed and it was cooled back to a temperature of 20 C. with the use of an ice bath. Stirring of the reaction mixture was continued overnight at room temperature. The reaction mixture was concentrated in vacuo to obtain a dark brown oil. Purification of this was performed by flash column chromatography (0-40% EtOAc in heptane) to obtain 9 as a pale yellow oil (3.84 g, yield 73%). .sup.1H NMR (400 MHz, Chloroform-d) 7.54 (d, J=12.6 Hz, 3H), 5.23 (d, J=12.6 Hz, 3H), 4.16 (q, J=7.1 Hz, 6H), 3.89 (s, 6H), 3.59 (t, J=6.6 Hz, 2H), 3.42 (s, 2H), 3.36 (t, J=6.5 Hz, 2H), 1.56-1.45 (m, 4H), 1.35-1.22 (m, 17H), 0.89 (s, 9H), 0.05 (s, 6H).

ethyl 15,15-bis((3-ethoxy-3-oxopropoxy)methyl)-2,2,3,3-tetramethyl-4,13,17-trioxa-3-silaicosan-20-oate (10)

(53) To a solution of 9 (3.84 g, 5.71 mmol) in ethanol (167 mL) was added 10% palladium on carbon (0.304 g, 0.285 mmol, 0.05 equiv) and pyridine (0.213 mL, 2.85 mmol, 0.5 equiv). The reaction mixture was charged with hydrogen (atmospheric pressure) and stirring of the mixture was continued overnight at room temperature. The reaction mixture was filtered over a plug of kieselguhr followed by concentrating the filtrate in vacuo, which afforded 10 as a yellow oil (3.86 g, yield 100%). .sup.1H NMR (400 MHz, Chloroform-d) 4.14 (q, J=7.1 Hz, 6H), 3.64 (t, J=6.5 Hz, 6H), 3.59 (t, J=6.7 Hz, 2H), 3.40-3.28 (m, 10H), 2.53 (t, J=6.5 Hz, 6H), 1.55-1.46 (m, 4H), 1.35-1.23 (m, 17H), 0.89 (s, 9H), 0.05 (s, 6H).

15,15-bis((3-hydroxypropoxy)methyl)-2,2,3,3-tetramethyl-4,13,17-trioxa-3-silaicosan-20-ol (ST44)

(54) A solution of 10 (3.86 g, 5.69 mmol) in dry tetrahydrofuran (67 mL) was cooled to a temperature of 5 C. Then, via drop wise addition, was added 2.4 M lithium aluminium hydride in tetrahydrofuran (24 mL, 57 mmol, 10 equiv) over a period of 1 hour. Upon complete addition stirring was continued overnight while allowing the reaction mixture to slowly reach room temperature. The next day, the reaction mixture was cooled to a temperature of 0 C. and was quenched by the batch wise addition of sodium sulfate decahydrate (18.32 g, 56.9 mmol, 10 equiv). The white precipitate was removed by filtration over a dry Na.sub.2SO.sub.4 plug followed by rinsing twice with tetrahydrofuran. The filtrate was concentrated in vacuo and purification was performed by flash column chromatography (0-7% MeOH in dichloromethane) to obtain ST44 as a pale yellow oil (1.96 g, yield 60%). .sup.1H NMR (400 MHz, Chloroform-d) 3.75 (t, J=5.3 Hz, 6H), 3.64-3.55 (m, 8H), 3.48-3.27 (m, 13H), 1.80 (h, J=5.4, 4.8 Hz, 6H), 1.58-1.46 (m, 4H), 1.36-1.25 (m, 8H), 0.89 (s, 9H), 0.05 (s, 6H).

8,8-bis((3-(bis(4-methoxyphenyl)(phenyl)methoxy)propoxy)methyl)-1,1-bis(4-methoxyphenyl)-20,20,21,21-tetramethyl-1-phenyl-2,6,10,19-tetraoxa-20-siladocosane (ST45DMTrTBDMS)

(55) Residual water was removed from ST44 (1.94 g, 3.51 mmol) by stripping twice with pyridine, followed by redissolving in pyridine (70 mL) under an argon atmosphere. To the reaction mixture were added moleculair sieves 4A (4 g) and stirring was continued for 15 minutes. Solid DMTrCl (4.16 g, 12.28 mmol, 3.5 equiv) was added in batches over a period of two hours. After another 1.5 hours additional DMTrCl (2.38 g, 7.02 mmol, 2 equiv) was added and stirring of the now dark orange mixture was continued overnight at room temperature. The reaction was quenched by the addition of MeOH (4.4 mL, 109 mmol, 31 equiv) and it was stirred for 15 minutes. Then, the reaction mixture was filtered over a cotton plug and the filtrate was coated on, with Et.sub.3N neutralized, silica (20 g). Purification was performed by flash column chromatography (0-100% EtOAc in heptane, 5% Et.sub.3N) to obtain ST45DMTrTBDMS as a yellow foaming oil (0.44 g, yield 8%). Starting material and intermediates were recovered in a 60% yield. .sup.1H NMR (400 MHz, Chloroform-d) 7.43-7.38 (m, 6H), 7.27 (q, J=8.1, 7.3 Hz, 18H), 7.19-7.13 (m, 3H), 6.81-6.76 (m, 12H), 3.76 (s, 18H), 3.58 (td, J=6.5, 3.0 Hz, 2H), 3.44 (dt, J=33.9, 6.4 Hz, 6H), 3.35-3.16 (m, 10H), 3.07 (t, J=6.4 Hz, 6H), 1.79 (h, J=6.3 Hz, 6H), 1.52-1.39 (m, 4H), 1.34-1.20 (m, 8H), 0.89 (s, 9H), 0.04 (s, 6H).

8-(3-(3-(bis(4-methoxyphenyl)(phenyl)methoxy)propoxy)-2,2-bis((3-(bis(4-methoxyphenyl)(phenyl)methoxy)propoxy)methyl)propoxy)octan-1-ol (ST45DMTrOH)

(56) To a solution of ST45DMTrTBDMS (2.20 g, 1.507 mmol) in dry tetrahydrofuran (12 mL) was added 1M TBAF in tetrahydrofuran (1.688 mL, 1.688 mmol, 1.12 equiv) and this was stirred at room temperature overnight. The reaction mixture was concentrated in vacuo and purification was performed by flash column chromatography (0-100% EtOAc in heptane, 5% Et.sub.3N) to obtain ST45DMTrOH as a colourless oil (1.74 g, yield 83%). .sup.1H NMR (400 MHz, Chloroform-d) 7.44-7.37 (m, 6H), 7.34-7.21 (m, 18H), 7.20-7.12 (m, 3H), 6.82-6.75 (m, 12H), 3.75 (s, 18H), 3.59 (q, J=6.5 Hz, 2H), 3.40 (t, J=6.5 Hz, 6H), 3.26-3.15 (m, 10H), 3.07 (t, J=6.4 Hz, 6H), 1.79 (p, J=6.4 Hz, 6H), 1.56-1.39 (m, 4H), 1.37-1.20 (m, 9H).

8-(3-(3-(bis(4-methoxyphenyl)(phenyl)methoxy)propoxy)-2,2-bis((3-(bis(4-methoxyphenyl)(phenyl)methoxy)propoxy)methyl)propoxy)octyl (2-cyanoethyl) diisopropylphosphoramidite (ST45)

(57) To a solution of ST45DMtrOH (1.9 g, 1.412 mmol) in dry dichloromethane (25 mL) was added DIPEA (2.466 mL, 14.12 mmol, 10 equiv) and moleculair sieves 4A (3.8 g) followed by cooling to a temperature of 0 C. Then, to the reaction was added 2-cyanoethyl N,N-diisopropylchlorophosphoramidite (0.401 g, 1.694 mmol, 1.2 equiv) via drop wise addition over a period of 5 minutes. Stirring of the reaction mixture was continued for another 15 minutes while allowing it to reach room temperature. The reaction mixture was filtered over a cotton plug and the filtrate was coated on, with Et.sub.3N treated, silica (7.5 g). Purification was performed by flash column chromatography (0-100% EtOAc in heptane, 5% Et.sub.3N) to obtain ST45 as a clear oil (1.37 g, yield 59%). .sup.1H NMR (400 MHz, Chloroform-d) 7.44-7.37 (m, 6H), 7.33-7.20 (m, 18H), 7.19-7.13 (m, 3H), 6.82-6.74 (m, 12H), 3.88-3.70 (m, 20H), 3.68-3.52 (m, 4H), 3.39 (t, J=6.4 Hz, 6H), 3.30-3.15 (m, 10H), 3.07 (t, J=6.4 Hz, 6H), 2.61 (t, J=6.6 Hz, 2H), 1.79 (h, J=6.5, 5.9 Hz, 6H), 1.63-1.54 (m, 2H), 1.50-1.40 (m, 2H), 1.37-1.21 (m, 8H), 1.17 (t, J=6.4 Hz, 12H).

Example 3

Synthesis of Nucleic Acid Conjugates

(58) All Oligonucleotides were synthesized on an AKTA oligopilot synthesizer. Commercially available solid support and 2O-Methyl RNA phosphoramidites, 2Fluoro, 2Deoxy RNA phosphoramidites and commercially available long trebler phosphoramidite (STKS) (Glen research) were used. Oligonucleotide synthesis, deprotection and purification followed standard procedures that are known in the art. Oligonucleotide and oligonucleotide conjugate synthesis was performed by a commercial oligonucleotide manufacturer (Biospring, Frankfurt, Germany).

(59) ##STR00034##

(60) Conjugation of the GalNAc synthons (ST21, ST23, ST31) or trebler synthons (STKS, ST41, ST43, ST45) was achieved by coupling of the respective phosphoramidite to the 5 end of the oligochain under standard phosphoramidite coupling conditions. Phosphorothioates were introduced using standard commercially available thiolation reagents (EDITH, Link technologies).

(61) The single strands were cleaved off the CPG by using aqueous Methylamine and the resulting crude oligonucleotide was purified by Ionexchange chromatography (Resource Q, 6 mL, GE Healthcare) on a AKTA Pure HPLC System using a Sodium chloride gradient. Product containing fractions were pooled, desalted on a size exclusion column (Zetadex, EMP Biotech) and lyophilised.

(62) For Duplexation, equimolar amounts of the respective single strands were dissolved in water and heated to 80 C. for 5 min. After cooling the resulting Duplex was lyophilised.

(63) TABLE-US-00002 TABLE 2 Mass spectrometry data for oligonucleotides Oligonucleotide MS found MS calculated antisense strand (TTR and STS016) 6943 Da 6943.33 Da TTR CF02 sense strand 8603.17 Da 8604 Da TTR CF02V20 sense strand 8490.38 Da 8490.62 Da TTR CF02V21 sense strand 8554.87 Da 8554.62 Da TTR CF02V22 sense strand 8310.02 Da 8310.47 Da TTR CF02V23 sense strand 8374.13 Da 8374.47 Da STS016 L4 sense strand 8388 Da 8388.47 Da STS016 L5 sense strand 8471 Da 8472.47 Da STS016 L6 sense strand 8415 Da 8416.47 Da STS016 L7 sense strand 8500 Da 8500.47 Da STS016 L8 sense strand 8444 Da 8444.47 Da STS016 L9 sense strand 8528 Da 8528.47 Da GN_Luc antisense 6260 Da 6259.93 Da GN_Luc sense 7799 Da 7800.21 Da GN_PTENV10F antisense 6320.43 Da 6318 Da GN_PTENV10F sense 7727.24 Da 7727.17 Da

Synthesis of Comparative Nucleic Acid Conjugate MoleculeTTR CF02

(64) Oligonucleotide sequence:

(65) TABLE-US-00003 Antisensestrand 5u(ps)u(ps)auagagcaagaacacug(ps)u(ps)u3 Sensestrand 3aminohexylaauaucucguucuugugac(ps)a(ps)a5

(66) Modifications key:

(67) bold=2OMe ribonucleotide

(68) underline=2F/2deoxyribonucleotide

(69) ps=phosphorothioate

(70) The sense strand was modified postsynthetically with an activated ester (NHS) of the GalNAc linker ST13:

(71) ##STR00035##

(72) The synthesis of ST13 and coupling was performed similar to published procedures (Ostergaard, Bioconjug Chem. 2015 Aug. 19; 26(8):1451-5), with the difference that NHS was used instead of PFP active ester.

(73) Structure of the final conjugate (TTR CF02):

(74) ##STR00036##

(75) Sequences:

(76) Modifications key for the following sequences:

(77) bold=2O-Methyl ribonucleotide

(78) underline=2Fluoro/2deoxyribonucleotide

(79) ps=phosphorothioate linkage

(80) TABLE-US-00004 TTRCF02: Antisensestrand 5u(ps)u(ps)auagagcaagaacacug(ps)u(ps)u3 Sensestrand 3ST13aminohexylaauaucucguucuuguga c(ps)a(ps)a5 TTRCF02V20 Antisensestrand 5u(ps)u(ps)auagagcaagaacacug(ps)u(ps)u3 Sensestrand 3a(ps)a(ps)uaucucguucuugugacaaSTKS (ST21).sub.35 TTRCF02V21 Antisensestrand 5u(ps)u(ps)auagagcaagaacacug(ps)u(ps)u3 Sensestrand 3a(ps)a(ps)uaucucguucuugugacaa(ps)STKS (ps)(ST21).sub.35 TTRCF02V22 Antisensestrand 5u(ps)u(ps)auagagcaagaacacug(ps)u(ps)u3 Sensestrand 3a(ps)a(ps)uaucucguucuugugacaaSTKS (ST23).sub.35 TTRCF02V23 Antisensestrand 5u(ps)u(ps)auagagcaagaacacug(ps)u(ps)u3 Sensestrand 3a(ps)a(ps)uaucucguucuugugacaa(ps)STKS (ps)(ST23).sub.35

(81) Modifications key for the following sequences:

(82) f denotes 2Fluoro 2deoxyribonucleotide

(83) m denotes 2O Methyl ribonucleotide

(84) (ps) denotes phosphorothioate linkage

(85) TABLE-US-00005 STS016-L4 Antisensestrand: 5mU(ps)fU(ps)mAfUmAfGmAfGmCfAmAfGmA fAmCfAmCfUmG(ps)fU(ps)mU3 Sensestrand: 5(ST23(ps)).sub.3ST41(ps)fAmAfCmAfGmUfGmU fUmCfUmUfGmCfUmCfUmAfU(ps)mA(ps)fA3 STS016-L5 Antisensestrand: 5mU(ps)fU(ps)mAfUmAfGmAfGmCfAmAfG mAfAmCfAmCfUmG(ps)fU(ps)mU3 Sensestrand: 5(ST31(ps))3ST41(ps)fAmAfCmAfGmUfGmU fUmCfUmUfGmCfUmCfUmAfU(ps)mA(ps)fA3 STS016-L6 Antisensestrand: 5mU(ps)fU(ps)mAfUmAfGmAfGmCfAmAfGmA fAmCfAmCfUmG(ps)fU(ps)mU3 Sensestrand: 5(ST23(ps)).sub.3ST43(ps)fAmAfCmAfGmUfGmU fUmCfUmUfGmCfUmCfUmAfU(ps)mA(ps)fA3 STS016-L7 Antisensestrand: 5mU(ps)fU(ps)mAfUmAfGmAfGmCfAmAfGmA fAmCfAmCfUmG(ps)fU(ps)mU3 Sensestrand: 5(ST31(ps)).sub.3ST43(ps)fAmAfCmAfGmUfGmU fUmCfUmUfGmCfUmCfUmAfU(ps)mA(ps)fA3 STS016-L8 Antisensestrand: 5mU(ps)fU(ps)mAfUmAfGmAfGmCfAmAfGmA fAmCfAmCfUmG(ps)fU(ps)mU3 Sensestrand: 5(ST23(ps)).sub.3ST45(ps)fAmAfCmAfGmUfGmU fUmCfUmUfGmCfUmCfUmAfU(ps)mA(ps)fA STS016-L9 Antisensestrand: 5mU(ps)fU(ps)mAfUmAfGmAfGmCfAmAfGmA fAmCfAmCfUmG(ps)fU(ps)mU3 Sensestrand: 5(ST31(ps)).sub.3ST45(ps)fAmAfCmAfGmUfGmU fUmCfUmUfGmCfUmCfUmAfU(ps)mA(ps)fA3 GN_Luc(nontargetingcontrol) Antisensestrand: 5mU(ps)fC(ps)mGfAmAfGmUfAmUfUmCfCmGfCmGfUmA(ps) fC(ps)mG3 Sensestrand: 5(ST23(ps)).sub.3STKS(ps)fCmGfUmAfCmGfCmGfGmAfAmUfAm CfUmUfC(ps)mG(ps)fA3 GN_PTENV10F Antisense 5mU(ps)fA(ps)fAmGfUmUmCfUmAfGmCfUmGfUmGfGmU(ps)fG (ps)mG3 Sense 5(ST23(ps)).sub.3STKS(ps)fCmCfAmCfCmAfCmAfGmCfUmAfGm AfAmCfU(ps)mU(ps)fA3

Example 4

In Vivo Assay and Duration of TTR Knockdown in Mice

(86) 8 weeks old male C57BL/6JOlaHsd mice were injected with the respective dose with a single subcutaneous injection of 300 uL/kg (4 animals per group).

(87) At each timepoint mice were sacrificed, the liver were harvested and analysed for TTR mRNA using TAQman analysis.

(88) Target Gene Expression In Vivo:

(89) Total RNA was isolated from fresh liver tissue essentially as described in Fehring et al. 2014:

(90) For target mRNA knockdown analyses, tissues were dissected immediately after sacrifice of the mice and instantly snap-frozen in liquid nitrogen. Approximately 20 mg of tissue was homogenized in a Mixer Mill MM 301 (Retsch GmbH, Haan, Germany) using tungsten carbide beads (Qiagen, Hilden, Germany). TotalRNA was isolated from the lysate with the Invisorb Spin Tissue RNA MiniKit (Invitek, Berlin, Germany). Depending on the tissue, 25-100 ng total RNA was used for quantitative TaqMan RT-PCR with the amplicon sets obtained from BioTez GmBH, Berlin, Germany: The TaqMan RT-PCR reactions were carried out with an ABI PRISM 7700 Sequence Detector (Software: Sequence Detection System v1.6.3 (ABI Life Technologies)) or StepOnePlus Real Time PCR System (ABI) using a standard protocol for RT-PCR (as described in Fehring et al. 2014) with primers and probes at a concentration of 300 and 100 nmol/1 respectively. TaqMan data were calculated by using the comparative Ct method. mRNA level were normalised against PTEN.

(91) Amplicon Sets for Detection of TTR mRNA

(92) TABLE-US-00006 mmTTR:467U22 TGGACACCAAATCGTACTGGAA mmTTR:550L22 CAGAGTCGTTGGCTGTGAAAAC mmTTR:492U27FL ACTTGGCATTTCCCCGTTCCATGAATT

(93) Amplicon Sets for Detection of PTEN mRNA

(94) TABLE-US-00007 PTEN CACCGCCAAATTTAACTGCAGA PTEN AAGGGTTTGATAAGTTCTAGCTGT PTEN TGCACAGTATCCTTTTGAAGACCATAACCCA

(95) The above method was used, with a single subcutaneous dose of 1 mg/kg. Mice were sacrificed 2 days post injection. The tested compounds were TTR CF02, TTR CF02V20, TTR CF02V21, TTR CF02V22 and TTR CF02V23. Introduction of phosphorothioates in the GalNAc linker system (TTR CF02V21 and TTR CF02V23) showed substantially greater potency compared to standard phosphodiester linkage (TTR CF02V20 and TTR CF02V22). Results are shown in FIG. 2.

(96) The above method was used, with a single subcutaneous dose of 2 mg/kg. Mice were sacrificed at given timepoints (7, 14, 21 and 28 days post injection). The tested compounds were PTEN CF02 (control), TTR CF02, TTR CF02V21 and TTR CF02V23. Results are shown in FIG. 3.

Example 5

Dose Titration of TTR CF02V21 and TTR CF02V23

(97) 8 weeks old male C57BL/6JOlaHsd mice were injected with the respective dose (3, 1, 0.3, 0.1 mg/kg) with a single subcutaneous injection of 300 uL/kg (4 animals per group). PBS was used as a control. After two days mice were sacrified, the liver were harvested and analysed for TTR mRNA using TAQman analysis. Analysis of samples was performed as in Example 4.

(98) Both siRNA GalNAc conjugates TTR CF02V21 and TTR CF02V23 were very effective in reducing TTR levels in a dose dependent manner. Results are shown in FIG. 4.

Example 6

In Vitro Determination of TTR Knockdown of Various TTR siRNA GalNAc Conjugates

(99) In vitro determination of TTR knockdown of various TTR siRNA GalNAc conjugates STS016 L4-L9 was determined in a hepatocyte assay.

(100) Primary Hepatocytes (Life technology) were seeded into 6 well plates (600,000 cells per well) according to manufacturer's protocol and incubated with the respective concentration of the GalNac conjugate. Cells were harvested 24 h post incubation and RNA was isolated and analysed using Taqman analysis as in Example 4.

(101) All different siRNA GalNAc conjugates STS016 L4-L9 were very effective in reducing TTR levels. Results are shown in FIGS. 5 and 6. TTR CF02V23 represents the positive control. GN_Luc represents the negative control.

Example 7

In Vivo Assay and Duration of TTR Knockdown in Mice

(102) 8 weeks old male C57BL/6JOlaHsd mice were injected with the dose of 1 mg/kg with a single subcutaneous Injection of 300 uL/kg (4 animals per group).

(103) Blood was taken after each timepoint (day 8, 15, 22 post injection) and analysed for TTR level using commercially available murineTTR specific Elisa Kit.

(104) All different siRNA GalNAc conjugates STS016 L4-L9 were very effective in reducing TTR levels. Results are shown in FIG. 7.

Example 8

In Vivo Assay of PTEN Knockdown in Mice

(105) 8 weeks old male C57BL/6JOlaHsd mice were injected with the respective dose (1, 3, 10 mg/kg) with a single subcutaneous injection of 300 uL/kg (4 animals per group). PBS was used as control.

(106) 2 days after administration, mice were sacrificed, the liver were harvested and analysed for PTEN mRNA using TAQman analysis.

(107) Target Gene Expression In Vivo:

(108) Total RNA was isolated from fresh liver tissue essentially as described in Fehring et al. 2014:

(109) For target mRNA knockdown analyses, tissues were dissected immediately after sacrifice of the mice and instantly snap-frozen in liquid nitrogen. Approximately 20 mg of tissue was homogenized in a Mixer Mill MM 301 (Retsch GmbH, Haan, Germany) using tungsten carbide beads (Qiagen, Hilden, Germany). TotalRNA was isolated from the lysate with the Invisorb Spin Tissue RNA MiniKit (Invitek, Berlin, Germany). Depending on the tissue, 25-100 ng total RNA was used for quantitative TaqMan RT-PCR with the amplicon sets obtained from BioTez GmBH, Berlin, Germany: The TaqMan RT-PCR reactions were carried out with an ABI PRISM 7700 Sequence Detector (Software: Sequence Detection System v1.6.3 (ABI Life Technologies)) or StepOnePlus Real Time PCR System (ABI) using a standard protocol for RT-PCR (as described in Fehring et al. 2014) with primers and probes at a concentration of 300 and 100 nmol/l respectively. TaqMan probes for PTEN were the same as described in Example 4.

(110) Results are shown in FIG. 8. A clear dose dependent knockdown of PTEN was demonstrated.

REFERENCES

(111) 1. Fire, A.; Xu, S.; Montgomery, M. K.; Kostas, S. A.; Driver, S. E.; Mello, C. C., Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 1998, 391 (6669), 806-11. 2. Elbashir, S. M.; Lendeckel, W.; Tuschl, T., RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes & development 2001, 15 (2), 188-200. 3. Dubber, M.; Frechet, J. M., Solid-phase synthesis of multivalent glycoconjugates on a DNA synthesizer. Bioconjugate chemistry 2003, 14 (1), 239-46. 4. Weigel, P. H.; Yik, J. H., Glycans as endocytosis signals: the cases of the asialoglycoprotein and hyaluronan/chondroitin sulfate receptors. Biochim Biophys Acta 2002, 1572 (2-3), 341-63. 5. Ishibashi, S.; Hammer, R. E.; Herz, J., Asialoglycoprotein receptor deficiency in mice lacking the minor receptor subunit. J Biol Chem 1994, 269 (45), 27803-6. 6. Biessen, E. A.; Broxterman, H.; van Boom, J. H.; van Berkel, T. J., The cholesterol derivative of a triantennary galactoside with high affinity for hepatic asialoglycoprotein receptor: a potent cholesterol lowering agent. J Med Chem 1995, 38 (11), 1846-52. 7. Akinc, A.; Querbes, W.; De, S.; Qin, J.; Frank-Kamenetsky, M.; Jayaprakash, K. N.; Jayaraman, M.; Rajeev, K. G.; Cantley, W. L.; Dorkin, J. R.; Butler, J. S.; Qin, L.; Racie, T.; Sprague, A.; Fava, E.; Zeigerer, A.; Hope, M. J.; Zerial, M.; Sah, D. W.; Fitzgerald, K.; Tracy, M. A.; Manoharan, M.; Koteliansky, V.; Fougerolles, A. d.; Maier, M. A., Targeted Delivery of RNAi Therapeutics With Endogenous and Exogenous Ligand-Based Mechanisms. Molecular therapy: the journal of the American Society of Gene Therapy 2010, 18 (7), 1357-1364. 8. Fehring, V.; Schaeper, U.; Ahrens, K.; Santel, A.; Keil, O.; Eisermann, M.; Giese, K.; Kaufmann, J., Delivery of therapeutic siRNA to the lung endothelium via novel Lipoplex formulation DACC. Mol Ther 2014, 22 (4), 811-20. 9. Prakash, T. P.; Brad Wan, W.; Low, A.; Yu, J.; Chappell, A. E.; Gaus, H.; Kinberger, G. A.; stergaard, M. E.; Migawa, M. T.; Swayze, E. E.; Seth, P. P., Solid-phase synthesis of 5-triantennary N-acetylgalactosamine conjugated antisense oligonucleotides using phosphoramidite chemistry. Bioorganic & medicinal chemistry letters 2015, 25 (19), 4127-4130. 10. Li, L.-C.; Okino, S. T.; Zhao, H.; Pookot, D.; Place, R. F.; Urakami, S.; Enokida, H.; Dahiya, R., Small dsRNAs induce transcriptional activation in human cells. Proceedings of the National Academy of Sciences 2006, 103 (46), 17337-17342.